ArticlePDF Available

Abstract and Figures

Proteolytic enzymes are ubiquitous and active in a myriad of biochemical pathways. One type, the rhomboids are intramembrane serine proteases that release their products extracellularly. These proteases are present in all forms of life and their function is not fully understood, although some evidence suggests they participate in cell signaling. Streptomycetes are prolific soil bacteria with diverse physiological and metabolic properties that respond to signals from other cells and from the environment. In the present study, we investigate the evolutionary dynamics of rhomboids in Streptomycetes, as this can shed light into the possible involvement of rhomboids in the complex lifestyles of these bacteria. Analysis of Streptomyces genomes revealed that they harbor up to five divergent putative rhomboid genes (arbitrarily labeled families A-E), two of which are orthologous to rhomboids previously described in Mycobacteria. Characterization of each of these rhomboid families reveals that each group is distinctive, and has its own evolutionary history. Two of the Streptomyces rhomboid families are highly conserved across all analyzed genomes suggesting they are essential. At least one family has been horizontally transferred, while others have been lost in several genomes. Additionally, the transcription of the four rhomboid genes identified in Streptomyces coelicolor, the model organism of this genus, was verified by reverse transcription. Using phylogenetic and genomic analysis, this study demonstrates the existence of five distinct families of rhomboid genes in Streptomycetes. Families A and D are present in all nine species analyzed indicating a potentially important role for these genes. The four rhomboids present in S. coelicolor are transcribed suggesting they could participate in cellular metabolism. Future studies are needed to provide insight into the involvement of rhomboids in Streptomyces physiology. We are currently constructing knock out (KO) mutants for each of the rhomboid genes from S. coelicolor and will compare the phenotypes of the KOs to the wild type strain.
Content may be subject to copyright.
Novick
et al. BMC Res Notes (2015) 8:234
DOI 10.1186/s13104-015-1205-x
RESEARCH ARTICLE
Evolutionary dynamics ofrhomboid
proteases inStreptomycetes
Peter A Novick, Naydu M Carmona and Monica Trujillo
*
Abstract
Background: Proteolytic enzymes are ubiquitous and active in a myriad of biochemical pathways. One type, the
rhomboids are intramembrane serine proteases that release their products extracellularly. These proteases are present
in all forms of life and their function is not fully understood, although some evidence suggests they participate in cell
signaling. Streptomycetes are prolific soil bacteria with diverse physiological and metabolic properties that respond
to signals from other cells and from the environment. In the present study, we investigate the evolutionary dynam-
ics of rhomboids in Streptomycetes, as this can shed light into the possible involvement of rhomboids in the complex
lifestyles of these bacteria.
Results: Analysis of Streptomyces genomes revealed that they harbor up to five divergent putative rhomboid genes
(arbitrarily labeled families A–E), two of which are orthologous to rhomboids previously described in Mycobacteria.
Characterization of each of these rhomboid families reveals that each group is distinctive, and has its own evolution-
ary history. Two of the Streptomyces rhomboid families are highly conserved across all analyzed genomes suggest-
ing they are essential. At least one family has been horizontally transferred, while others have been lost in several
genomes. Additionally, the transcription of the four rhomboid genes identified in Streptomyces coelicolor, the model
organism of this genus, was verified by reverse transcription.
Conclusions: Using phylogenetic and genomic analysis, this study demonstrates the existence of five distinct fami-
lies of rhomboid genes in Streptomycetes. Families A and D are present in all nine species analyzed indicating a poten-
tially important role for these genes. The four rhomboids present in S. coelicolor are transcribed suggesting they could
participate in cellular metabolism. Future studies are needed to provide insight into the involvement of rhomboids in
Streptomyces physiology. We are currently constructing knock out (KO) mutants for each of the rhomboid genes from
S. coelicolor and will compare the phenotypes of the KOs to the wild type strain.
Keywords: Streptomyces, Rhomboid proteins, Proteases, S. coelicolor, Bioinformatics
© 2015 Novick et al. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License
(http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium,
provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license,
and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/
publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Background
Rhomboids are intramembrane serine proteases, mecha-
nistically characterized because they release factors to
the outside of the cell, rather than into the cytosol. e
first rhomboid protease was discovered in Drosophila [1]
and further work revealed the existence of homologs in
all branches of life [2]. e human and mouse genomes
encode rhomboid genes, but the largest number of rhom
-
boid genes are encoded by plants [2]. Despite their ubiq-
uity, rhomboid sequence identity is only about 6% across
all domains of life [2]. is extremely low conservation
could be due to the fact that sequences are predomi
-
nantly transmembrane, thereby experiencing a different
evolutionary pressure than other proteases [2]. rough
multidisciplinary approaches, it has been demonstrated
that rhomboids create a central hydrated microenviron
-
ment immersed below the membrane surface; this micro-
environment supports the hydrolysis carried out by its
serine protease-like catalytic apparatus [3]. Rhomboid
proteases can have three different topologies. e sim
-
plest form has six transmembrane (TM) helices and it is
the most prevalent in prokaryotic rhomboids. e other
two forms have an extra TM helix either at the C-termi
-
nus (6+1 TM) or at the N-terminus (1+6 TM), and are
Open Access
*Correspondence: MTrujillo@qcc.cuny.edu
Biological Sciences and Geology Department, Queensborough
Community College, City University of New York, Bayside, NY, USA
Page 2 of 11
Novick
et al. BMC Res Notes (2015) 8:234
typical of eukaryotic rhomboids. Prokaryotic rhomboids
AarA from the pathogenic Providencia stuartii, YqgP
from Bacillus subtilis and Rv0110, one of the rhomboids
from Mycobacteria are exceptions as they exhibit 6+1
TM topology like eukaryotes [4].
In spite of their shared mechanism of action, rhom
-
boids exhibit a wide diversity of biological roles. It has
been demonstrated that these proteases: control EGF
receptor signaling in Drosophila and Caenorhabditis
elegans [2], are involved in the cleavage of adhesins in
apicomplexan parasites, and regulate aspects of mito
-
chondrial morphology and function in yeast and mul-
ticellular eukaryotes [5]. Furthermore, rhomboids are
involved in processes such as inflammation and cancer
suggesting they could have therapeutic potential [6].
Not much is known to date about the biological role that
rhomboids play in prokaryotes. AarA, from P. stuartii
affects quorum sensing [7], YqgP from B. subtilis plays
a role in cell division and glucose uptake [8]. e crystal
structure of GlpG from Escherichia coli has been solved,
yet its biological function is still undetermined [9].
Rhomboid proteases, Rv0110 and Rv1337 from Myco
-
bacterium, a genus from the Actinomyces phylum, have
been described, yet their substrates have not been identi
-
fied [10, 11]. Little is also known about rhomboids from
Streptomyces, another genus from Actinomyces [11].
Streptomycetes are “multicellular” prokaryotic organ
-
isms with a complex developmental cycle and secondary
metabolite secretion, in which signals from other cells
and from the environment are detected, integrated and
responded to using multiple signal transduction systems.
Streptomycetes produce two thirds of all industrially
manufactured antibiotics, and a large number of eukary
-
otic cell differentiation-inducers [12], apoptosis inhibitors
[13] and inducers [1416], protein C kinase inhibitors
[17], and compounds with antitumor activity [18]. e
production of these secondary metabolites (physiologi
-
cal differentiation) is usually temporally and genetically
coordinated with the developmental program (morpho
-
logical differentiation) when cultured in agar and is likely
to respond to environmental, physiological and stress
signals [1922]. ese processes are controlled by dif
-
ferent families of regulatory proteins, and are elicited by
both extracellular and intracellular signaling molecules
mediated by an array of signal transduction systems [23].
Given the involvement of rhomboids in cell signaling, we
propose that they could participate in some of the signal
-
ing cascades existing in Streptomycetes.
Here, we use bioinformatics to identify and describe
putative rhomboid genes in the genome of nine fully-
sequenced Streptomyces species [2432]. Furthermore,
we demonstrate that these genes are transcribed in Strep
-
tomyces coelicolor, the model organism for this genus.
Methods
Sequence analysis
Nucleotide and amino acid sequences from Strepto-
mycetes and related species were collected in two ways
to guarantee an exhaustive search. An initial collec
-
tion was obtained from a BLASTp search using a pre-
viously identified rhomboid protein from P. stuartii,
aAaR (S70_10405) as the query. Secondly, a gene search
using the Integrated Microbial Genomes Education Site
(IMG/EDU) was conducted retrieving all genes with
the pfam01694 domain [33]. Using a combination of
both NCBI and IMG, we determined which genomes
have complete sequence data, and which are in draft
format. We limited our final analysis to nine com
-
pletely sequenced genomes. All resulting sequences
were aligned in Bioedit using ClustalW and sorted
based upon sequence similarity [34]. An initial neigh
-
bor joining phylogenetic tree was constructed using the
translated nucleotide sequences which aided in the con
-
struction of our groups. Monophyletic families with high
similarity and bootstrap support (>80%) were then arbi
-
trarily named A–E.
Active sites in the rhomboid domain were found using
pfam and e values were collected for support [35]. Any
additional domains identified were collected. Using
TMHMM and Phobius, sequences were analyzed for the
number of transmembrane domains, amount of trans
-
membrane amino acids, the cellular locations of active
sites and the distance between them [36, 37]. A two-
dimensional model of the transmembrane structure was
constructed using TMRPres2D [38].
In order to determine conserved sites within and across
families, sequences were analyzed with weblogo which
indicates with large letters residues that are most likely
important in protein function [39]. Consensus sequences
of each family were also constructed using Bioedit and
the pair wise divergence of the rhomboid domains within
and between each family was calculated to determine
which families were most similar.
Phylogeny reconstruction
One sequence from each family was used as a query for a
BLASTp search of all sequenced genomes excluding the
Actinomycetes [40]. en, a phylogenetic tree containing
sequences from our library and the non-Actinomycetes
sequences were constructed to determine other species
that harbor the same family in their genome.
Mega 5.0 was utilized for our phylogenetic recon
-
structions [41]. Previously aligned sequences were used
to construct both neighbor joining trees and maximum
likelihood trees for comparison. 1,000 bootstrap rep
-
licates were calculated and those lower than 70 were
removed.
Page 3 of 11
Novick
et al. BMC Res Notes (2015) 8:234
Gene neighborhoods
IMG-ACT was used to determine the genome location
of each rhomboid gene. Using the five sequences from S.
scabiei as a query, all orthologs were identified to deter
-
mine if they were found in a similar region of the genome,
in the same orientation, and had the same neighboring
genes. e presence or absence of operons and the func
-
tions of neighboring genes were also determined [33].
Strains andcultures
S. coelicolor M145 was kindly provided by Dr. Mervyn
Bibb. S. coelicolor was grown in Mannitol Soya flour and
in R5 medium [42].
PCR conditions
Chromosomal DNA was extracted from S. coelicolor [42].
Internal primers for the four putative rhomboid genes for
S. coelicolor were designed with Primer 3 [43] (Table1).
Amplification reactions contained 0.3 μM each of the
rhomboid specific forward and reverse primers (Table1),
0.02 U/μl KOD Hot Start Master Mix (Novagen) ~200ng
genomic DNA and nuclease free water in a reaction vol
-
ume of 20μl. e reactions were performed in a C1000
ermocycler (BioRad) using the following conditions:
Initial polymerase activation and denaturation was done
at 95°C for 2min, followed by 30 cycles consisting of:
denaturation at 95°C for 20s, annealing at 60°C for 10s,
extension at 70°C for 10s with a final extension at 70°C of
5min. e correct internal fragment size was amplified
for the four putative rhomboid genes.
Transcription assays
50ml of R5 [44] liquid media in a 250ml flask were inoc-
ulated with spores from a Soy Flour Manitol [44] S. coe-
licolor plate and incubated in 30°C shaker at 240rpm for
2days. e pellet was harvested and RNA was prepared
using EZRNA Total RNA Kit. Reverse transcription was
done using M_MLB Reverse Transcriptase, oligo-random
primers and nucleotide mixture from Promega, with
~60ng/μl mRNA used as template. PCR was performed
using the validated primers (Table1) following the pro
-
tocol described above. e expected fragment sizes were
revealed via gel electrophoresis, the purified PCR prod
-
uct was cloned into pUC19, and DNA sequences were
verified by sequencing at DNA analysis facility (Yale
University).
Results anddiscussion
A. Phylogenetic studies andfamily relationships
e in silico analysis of rhomboid proteases in nine fully
sequenced and assembled genomes of Streptomycetes
revealed that their genomes have up to five diverse and
distinct rhomboid genes (arbitrarily labeled Families
A–E) as shown in Table 2. is is supported by high
bootstrap values (Figure 1) and the high divergence
across the five rhomboid families (Table3). Streptomy
-
ces avermitilis, bingchenggensis, cattleya, coelicolor, gri-
seus, hygroscopicus, pristinaespiralis, scabiei and sviceus
have two to five rhomboid genes. Only S. scabiei and S.
sviceus (Table2) genomes contained all five families. Two
of these families (A and D) are consistently present in
the strains listed above, as well as in 30 additional Strep
-
tomyces genomes recently analyzed (data not shown).
Streptomyces rhomboids have a few differences with
the recently described Mycobacterium (a closely related
Actinomycetes genus) rhomboids: Streptomycetes harbor
up to five rhomboids genes whereas Mycobacteria have a
maximum of two; Streptomyces rhomboids are not found
in large operons as the Mycobacterium counterparts are
[10], and Streptomyces rhomboid genes also appear in dif
-
ferent gene neighborhoods than Mycobacterium rhom-
boids (Figure2). A summary of the phylogenetic analysis
of the five rhomboid genes is presented (Figure1).
e topological analysis of the Streptomyces rhom
-
boid genes shows that families C, D and E have the most
prevalent structure in prokaryotic rhomboids, 6 TM
helices; interestingly families A and B have an additional
TM helix similar to AarA from P. stuartii [7] and YqgP
from B. subtilis [8] (Figure3). It has been suggested that
the bacterial rhomboids with the 6+1 TM helices could
either be a bacterial progenitor to the eukaryotic rhom
-
boid proteases or they may represent an ancient family
of rhomboid proteases present in the last universal com
-
mon ancestor (LUCA) [45]. e fact that family A (6+1
TM topology) and family D (6 TM topology) are present
in all genomes analyzed suggests that each family could
have different and potentially critical biological roles in
Streptomyces.
We have also found that families A and B have zinc
fingers as extra membranous domains, but this motif is
less conserved in families C, D and E. It is suggested that
these soluble accessory domains may be involved in the
oligomerization status of the rhomboid proteins [46].
Table 1 Primer sequences
Gene identier Primer sequence Fragment
size (bp)
SCO3855 family A GCTACCTCGCCCTCTACCTC
GGGTGAAGGTGAAGATCAGG
206
SCO2013 family B GATGAACATGGTCGTGCTGT
GGCCATGAAACGGTTGAC
241
SCO6038 family C GCTCTTCCTGTGGATCTTCG
CCTCGGATACAGCACCAGAT
196
SCO2139 family D CTGCCCTTCCTCTTCTTCCT
ACGCCACCAACTCTAGTCGT
197
Page 4 of 11
Novick
et al. BMC Res Notes (2015) 8:234
ese findings again support the idea that different fami-
lies could have distinct functions in Streptomyces biology.
Family A Rhomboids belonging to family A are orthol
-
ogous to the Rv0110 rhomboid protease 1 in Mycobacte-
ria [11]; they are of similar length and structure. Family
A rhomboids have seven TM helices, with a long run of
extracellular amino acids between helices 1 and 2. At the
N-terminus, there is a long string of cytoplasmic amino
acids that in many cases have a zinc-finger domain. Each
protein contains the same catalytic residues, a serine and
a histidine, 46 amino acids apart in TM 4 and 6 (Figure3).
Phylogenetic analysis indicates vertical transfer of rhom
-
boid A gene (Figure 1) during the diversification of
Actinomycetes (shown in blue), since they are found in
the Frankia lineage, Kitasatospora setae, Acidothermus
cellulolyticus, and in the nine Streptomycetes sequences
analyzed. Rhomboid A genes are 27% divergent (Table4),
are found next to the gene encoding peptidyl-prolyl
cis–trans isomerase, and the surrounding neighbor
-
hood is conserved across species (Figure2). Usually they
are located towards the center of the genome, but their
orientation is not the same across all species (Figure4).
Table 2 Analysis of putative rhomboid proteases from nine sequenced Streptomycetes
Bold characters are used to identify S. coelicolor genes.
a
Amino acids.
b
Active site.
c
Transmembrane helix.
IMG Gene_OID Species Length (aa)
a
Family AS
b
AS distance (aa) aa in TMH
c
# TMH pfam e value
29607986 S. avermitilis 298 A 249, 203 46 130.58 6 2.50E34
297158806 S. bingchenggensis 295 A 245, 199 46 132.73 6 2.10E35
337767090 S. cattleya 282 A 232, 185 47 141.11 7 1.20E34
259419993 S. coelicolor (SCO3855) 297 A 248, 202 46 138.3 7 3.30E37
178466026 S. griseus subsp. griseus 208 A 236, 190 46 136.70 7 4.50E35
374101595 S. hygroscopicus jinggangensis 281 A 232, 186 46 121.77 6 2.60E36
297193265 S. pristinaespiralis 299 A 249, 203 46 136.04 7 2.90E37
260648514 S. scabiei 297 A 248, 201 47 135.09 7 1.70E38
297200957 S. sviceus 294 A 245, 199 46 130.14 7 8.60E36
29609854 S. avermitilis 321 B 270, 223 47 135.72 7 3.80E27
24419018 S. coelicolor (SCO2023) 285 B 229, 182 47 139.55 7 9.70E24
178467794 S. griseus subsp. griseus 303 B 251, 204 47 131.42 6 1.20E–28
260650743 S. scabiei 309 B 258, 211 47 133.61 7 8.40E–26
197711076 S. sviceus 305 B 252, 205 47 138.69 7 1.10E–26
29605874 S. avermitilis 272 C 235, 169 66 128.22 6 1.70E–36
337763630 S. cattleya 266 C 235, 169 66 126.73 6 6.10E–35
21224370 S. coelicolor (SCO6038) 285 C 346, 280 66 132.24 6 2.60E36
374103480 S. hygroscopicus jinggangensis 274 C 235, 169 66 129.53 6 6.40E–37
260646107 S. scabiei 269 C 232, 166 66 128.35 6 2.50E–38
297203088 S. sviceus 295 C 256, 190 66 127.84 6 2.30E–37
29609721 S. avermitilis 247 D 213, 149 64 130.48 6 7.80E–30
297161230 S. bingchenggensis 237 D 203, 139 64 128.67 6 6.10E–33
337765279 S. cattleya 259 D 226, 162 64 130.11 6 9.10E–33
4539208 S. coelicolor (SCO2139) 256 D 221, 157 64 128.18 6 2.50E31
178467673 S. griseus subsp. griseus 249 D 217, 153 64 131.13 6 5.30E34
374100011 S. hygroscopicus jinggangensis 225 D 190, 126 64 127.83 6 4.10E30
197720707 S. pristinaespiralis 255 D 222, 158 64 128.94 6 3.30E–31
260650624 S. scabiei 251 D 209, 145 64 128.36 6 8.30E–30
297199120 S. sviceus 256 D 221, 157 64 130.03 6 8.10E30
178466512 S. griseus subsp. griseus 249 E 181, 129 52 122.50 6 5.20E25
197722368 S. pristinaespiralis 196 E 176, 123 53 125.71 6 6.40E23
290958287 S. scabiei 223 E 198, 145 53 127.68 6 2.30E20
197711057 S. sviceus 197 E 175, 122 53 127.02 6 1.20E21
Page 5 of 11
Novick
et al. BMC Res Notes (2015) 8:234
Figure1 NJ Phylogenetic tree of the five putative rhomboid families using Mega 5.0 (Bootstrap values <70 have been omitted). Colored boxes are
indicative of rhomboid sequences from Streptomycetes, while the clear boxes are sequences of the same rhomboid family, but from other Actinomy-
cetes.
Page 6 of 11
Novick
et al. BMC Res Notes (2015) 8:234
Table 3 Divergence across rhomboid families
This table was built using consensus sequences representative of each family.
Rhomboid type A Strepto B Strepto C Strepto D Strepto E Strepto E Myco AB Myco
A Strepto
B Strepto 0.29474
C Strepto 0.35789 0.35789
D Strepto 0.40001 0.38947 0.16842
E Strepto 0.43158 0.38947 0.40000 0.42105
E Myco (Rv1337) 0.46316 0.53684 0.48421 0.50526 0.29474
AB Myco (Rv0110) 0.23158 0.29500 0.33684 0.36842 0.35789 0.51579
Figure2 Gene neighborhoods for selected Streptomyces strains and M. tuberculosis. From top Family A, D and E. Rhomboid genes are colored in red
and underlined when present.
Page 7 of 11
Novick
et al. BMC Res Notes (2015) 8:234
Genomic rearrangements could have contributed to the
shuffling of its genomic location in some species.
Family B Family B rhomboids are similar to family A in
that they have 7 TMs (Figure3), approximately 46 amino
acids separating the active sites and are also 27% divergent
(Table 4). B rhomboids are only found in Streptomyces
and their sister species Kitasatospora seta and Streptospo
-
rangia roseum (Figure1 shown in red). is is likely due
to a gene duplication event before the diversification of
the Streptomyces genus, but after the separation of other
Actinomycetes, such as members of the genus Frankia and
Mycobacteria. Although rhomboids A and B are parala
-
gous, their 29% divergence (Table3) is indicative of the
antiquity of the duplication event, and may suggest that
they have different roles. e location and orientation of
rhomboid B (Figure4) is highly conserved across Strepto
-
mycetes; it is located at the end of the genome and in close
proximity to the rhomboid D gene. Rhomboid B genes
Figure3 Transmembrane structure of Rhomboids using TMRPres2D [45]. Rhomboids a, b, c and d are from S. coelicolor, and e is from S. sviceus
active sites are highlighted with a red circle.
Page 8 of 11
Novick
et al. BMC Res Notes (2015) 8:234
have been lost in several species including, S. bingcheng-
gensis, S hygroscopicus and S. pristinaespiralis. e phylo-
genetic history among species of Streptomyces is not well
understood, and thus it is unknown if the loss of this gene
was due to a single or multiple events.
Families C and D We hypothesize that the C and D
rhomboid families are paralogous xenologs; these fami
-
lies are most likely due to a horizontal transfer event to
the ancestor of the Streptomyces, Kitasatospora, Frankia
and Acidothermus genera (Figure 1 shown in green
and purple). Rhomboids C and D are, in addition, phy
-
logenetically discontinuous, this is supported by their
absence from the Mycobacterium lineage and other Act
-
inobacteria. Since Streptomycetes are typically promis-
cuous, horizontal transfer of this lineage of rhomboids
is possible; although it is also possible that they have
been deleted from other Actinomycetes lineages several
times. Families C and D are 80 and 77% similar within
their families, respectively (Table4). Further analysis of C
and D rhomboids reveals a non-Actinomycetes ancestor
(Figure5) suggesting a different evolutionary history for
these genes.
Rhomboids belonging to family C are found in six of
the nine analyzed Streptomycetes (Table2) and display a
unique 6 TM motif with 66 amino acids separating the
active sites (Figure3). All C rhomboids are found towards
the beginning of the genome when present, and in the
same orientation (Figure4).
D rhomboids also have 6 TMs, but consistently have
only 64 amino acids separating their active sites (Fig
-
ure 3). D rhomboids are found in all of the species
analyzed, and therefore are likely to be functionally
important. ey are found at the end of the genome, and
in reverse orientation. S. cattleya appears to be unique
since its D rhomboid gene is found at the opposite end
of the genome, in close proximity to the C gene, and in
the forward orientation (Figure4). is could be due to
genomic rearrangement. As rhomboids C and D genes
are the result of a duplication event in the Streptomy
-
ces ancestor, it is expected that all genomes that contain
rhomboid D would also possess rhomboid C. However,
rhomboid C is not present in three of the nine species
analyzed. As discussed for the rhomboid B family, it is
unknown if the loss of this gene was due to a single or
multiple events.
Family E E rhomboids are orthologous to the Rv1337
rhomboid protease 2 in Mycobacteria. is family is
Table 4 Average divergence of nucleotide sequences
within rhomboid families
Rhomboid Distance SE
Family A 0.2721 0.0083
Family B 0.2732 0.0089
Family C 0.2065 0.0086
Family D 0.2348 0.0090
Family E 0.268 0.013
Figure4 Location and orientation of rhomboids from selected species. Each family is color coded as in Figure 1.
Page 9 of 11
Novick
et al. BMC Res Notes (2015) 8:234
found only in four of the nine genomes analyzed, with
27% divergence in their nucleotide sequence (Table4).
ey are located in the middle of the linear genome,
although the orientation is not conserved (Figure4). ey
are also not found in the same operon or gene neighbor
-
hood as Mycobacteria homologs (Figure2). Phylogenetic
analysis indicates vertical transfer (Figure1) during the
diversification of Actinomycetes, as rhomboid E genes
(shown in yellow) are found in Actinomycetes. Like other
rhomboid genes, E rhomboids have been lost in several
species, including S. coelicolor (Figure2 shows the loca
-
tion where rhomboid E should be in the S. coelicolor
genome). eir sequence analysis shows a structure of 6
TM helices with catalytic residues in TMs 4 and 6 sepa
-
rated by about 52 amino acids (Table2).
B. Transcriptional analysis ofputative S. coelicolor
rhomboid genes
e existence of multiple rhomboid genes in Streptomy-
cetes raises the question whether all, none, or some of
Figure5 NJ Tree of rhomboids C and D using Mega 5.0. (Bootstrap values <70 have been removed). Rhomboids C and D are more similar to rhom-
boid genes in Chlorofexi, Cyanobacteria and Planctomycetes than they are to other rhomboids within the Streptomycetes.
Page 10 of 11
Novick
et al. BMC Res Notes (2015) 8:234
them are transcribed. Phylogenetic analysis identified
four candidate rhomboid genes (A, B, C and D) in S. coe
-
licolor. Primers (Table1) were designed to amplify inter-
nal fragments for these genes. Fragments of the predicted
sizes were obtained using these primers and S. coelicolor
genomic DNA as a template (Figure6).
To determine if these genes are transcribed, we iso
-
lated mRNA from a S. coelicolor liquid culture, and used
reverse transcriptase (RT) to make cDNA. Detection of
transcribed rhomboid genes was done by PCR using the
primers described above (Table1). e expected fragment
sizes were obtained (Figure 7). e purified PCR prod
-
ucts were cloned into pUC19, and the correct inserts were
verified by sequencing. erefore, reverse transcription
analysis confirms that the four rhomboid genes (SCO3855,
SCO2139, SCO6038, SCO2013) are transcribed in S.
coelicolor.
Conclusions
In summary, our analysis demonstrates the existence of
five distinct families of rhomboid genes in Streptomy
-
cetes. Families A and D are present in all Streptomyces
genomes analyzed, family D displays the typical prokary
-
otic topology with 6 TMs while family A has 6+1 TMs.
ese findings suggest that both families A and D are
essential and may play different biological roles in Strep
-
tomyces. e evolutionary dynamic of the Streptomyces
rhomboids is very complex, and we will expand our anal
-
ysis to other Streptomyces strains and the Actinobacteria
taxa to obtain a more comprehensive understanding of it.
We also show that the four rhomboid genes present in S.
coelicolor are transcribed. We are currently studying the
expression of these genes, specifically by constructing
knock out (KO) mutants for each of the putative rhom
-
boid genes from S. coelicolor and comparing the KOs to
the wild type strain. is will provide insight into the
involvement of rhomboids in Streptomyces physiology.
Authors’ contributions
PN carried out the bioinformatics analysis, and contributed to drafting the
manuscript. NC carried out the PCR and RT-PCR assays, cloning for sequence
analysis, and contributed to drafting the manuscript. MT conceived the study,
participated in its design and coordination, and helped to draft the manu-
script. All authors read and approved the final manuscript.
Acknowledgements
We are grateful to Dr. Mervyn Bibb for kindly providing us with S. coelicolor
M145. This work is supported by U.S. National Science Foundation Grant MCB-
1412929 and a CUNY Community College Collaborative Incentive Research
Grant.
Compliance with ethical guidelines
Competing interest
The authors declare that they have no competing interests.
Received: 19 February 2015 Accepted: 8 May 2015
References
1. Bier E, Jan LY, Jan YN (1990) Rhomboid, a gene required for dorsoventral
axis establishment and peripheral nervous system development in Dros-
ophila melanogaster. Genes Dev 4(2):190–203
2. Urban S, Dickey SW (2011) The rhomboid protease family: a decade of
progress on function and mechanism. Genome Biol 12(10):231
12 34 5
M
2000
1500
1000
750
500
300
200
150
50
bp
Figure6 Amplification of internal fragments of S. coelicolor rhom-
boid genes. Genomic DNA was used as template and primers are
listed in Table 1. Lanes 1 SCO2013; 2 SCO2139; 3 SCO6038; 4 SCO3855;
5 positive control using act primers; M exACTGene low range DNA
ladder.
M123
M
123 45
a b
Figure7 RT-PCR amplification of internal fragments of S. coelicolor
rhomboid families. a Lanes M exACTGene low range DNA ladder;
1 SCO3855; 2 SCO3855; 3 negative control, S. coelicolor mRNA, not
transcribed. b Lanes M exACTGene low range DNA ladder; 1 negative
control S. coelicolor mRNA, not transcribed; 2 negative control (water);
3 SCO2139; 4 SCO6038; 5 SCO2013.
Page 11 of 11
Novick
et al. BMC Res Notes (2015) 8:234
3. Vinothkumar KR, Strisovsky K, Andreeva A, Christova Y, Verhelst S, Free-
man M (2010) The structural basis for catalysis and substrate specificity of
a rhomboid protease. EMBO J 29(22):3797–3809
4. Sampathkumar P, Mak MW, Fischer-Witholt SJ, Guigard E, Kay CM,
Lemieux MJ (2012) Oligomeric state study of prokaryotic rhomboid
proteases. Biochim Biophys Acta 1818(12):3090–3097
5. Freeman M (2008) Rhomboid proteases and their biological functions.
Annu Rev Genet 42:191–210
6. Bergbold N, Lemberg MK (2013) Emerging role of rhomboid family
proteins in mammalian biology and disease. Biochim Biophys Acta
1828(12):2840–2848
7. Stevenson LG, Strisovsky K, Clemmer KM, Bhatt S, Freeman M, Rather PN
(2007) Rhomboid protease AarA mediates quorum-sensing in Providencia
stuartii by activating TatA of the twin-arginine translocase. Proc Natl Acad
Sci USA 104(3):1003–1008
8. Mesak LR, Mesak FM, Dahl MK (2004) Expression of a novel gene, gluP,
is essential for normal Bacillus subtilis cell division and contributes to
glucose export. BMC Microbiol 4:13
9. Maegawa S, Ito K, Akiyama Y (2005) Proteolytic action of GlpG, a rhom-
boid protease in the Escherichia coli cytoplasmic membrane. Biochemis-
try 44(41):13543–13552
10. Kateete DP, Okee M, Katabazi FA, Okeng A, Asiimwe J, Boom HW et al
(2010) Rhomboid homologs in Mycobacteria: insights from phylogeny
and genomic analysis. BMC Microbiol 10:272
11. Kateete DP, Katabazi FA, Okeng A, Okee M, Musinguzi C, Asiimwe BB
et al (2012) Rhomboids of Mycobacteria: characterization using an aarA
mutant of Providencia stuartii and gene deletion in Mycobacterium smeg-
matis. PLoS One 7(9):e45741
12. Eritt I, Grafe U, Fleck WF (1984) Inducers of both cytodifferentiation and
anthracycline biosynthesis of Streptomyces griseus and their occurrence in
actinomycetes and other microorganisms. Z Allg Mikrobiol 24(1):3–12
13. Yoshimoto Y, Sawa T, Naganawa H, Sugai T, Takeuchi T, Imoto M (2000)
MK800-62F1, a new inhibitor of apoptotic cell death, from Streptomyces
diastatochromogenes MK800-62F1. II. Structure elucidation. J Antibiot
(Tokyo) 53(6):575–578
14. Hayakawa Y, Sasak K, Nagai K, Shin-ya K, Furihata K (2006) Structure of
thioviridamide, a novel apoptosis inducer from Streptomyces olivoviridis. J
Antibiot (Tokyo) 59(1):6–10
15. Hayakawa Y, Sasaki K, Adachi H, Furihata K, Nagai K, Shin-ya K (2006)
Thioviridamide, a novel apoptosis inducer in transformed cells from
Streptomyces olivoviridis. J Antibiot (Tokyo) 59(1):1–5
16. Tomikawa T, Shin-ya K, Furihata K, Kinoshita T, Miyajima A, Seto H et al
(2000) Rasfonin, a new apoptosis inducer in ras-dependent cells from
Talaromyces sp. J Antibiot (Tokyo) 53(8):848–850
17. Trew SJ, Wrigley SK, Pairet L, Sohal J, Shanu-Wilson P, Hayes MA et al
(2000) Novel streptopyrroles from Streptomyces rimosus with bacterial
protein histidine kinase inhibitory and antimicrobial activities. J Antibiot
(Tokyo) 53(1):1–11
18. Pamboukian CR, Facciotti MC (2004) Production of antitumoral retamycin
during fed-batch fermentations of Streptomyces olindensis. Appl Biochem
Biotechnol 112(2):111–122
19. Craney A, Ozimok C, Pimentel-Elardo SM, Capretta A, Nodwell JR (2012)
Chemical perturbation of secondary metabolism demonstrates impor-
tant links to primary metabolism. Chem Biol 19(8):1020–1027
20. Gehring AM, Wang ST, Kearns DB, Storer NY, Losick R (2004) Novel
genes that influence development in Streptomyces coelicolor. J Bacteriol
186(11):3570–3577
21. McArthur M, Bibb MJ (2008) Manipulating and understanding antibiotic
production in Streptomyces coelicolor A3(2) with decoy oligonucleotides.
Proc Natl Acad Sci USA 105(3):1020–1025
22. Xu W, Huang J, Lin R, Shi J, Cohen SN (2010) Regulation of morphologi-
cal differentiation in S. coelicolor by RNase III (AbsB) cleavage of mRNA
encoding the AdpA transcription factor. Mol Microbiol 75(3):781–791
23. Bibb MJ (2005) Regulation of secondary metabolism in Streptomycetes.
Curr Opin Microbiol 8(2):208–215
24. Ikeda H, Ishikawa J, Hanamoto A, Shinose M, Kikuchi H, Shiba T et al
(2003) Complete genome sequence and comparative analysis of
the industrial microorganism Streptomyces avermitilis. Nat Biotechnol
21(5):526–531
25. Wang XJ, Yan YJ, Zhang B, An J, Wang JJ, Tian J et al (2010) Genome
sequence of the milbemycin-producing bacterium Streptomyces
bingchenggensis. J Bacteriol 192(17):4526–4527
26. Barbe V, Bouzon M, Mangenot S, Badet B, Poulain J, Segurens B et al
(2011) Complete genome sequence of Streptomyces cattleya NRRL
8057, a producer of antibiotics and fluorometabolites. J Bacteriol
193(18):5055–5056
27. Bentley SD, Chater KF, Cerdeño-Tárraga AM, Challis GL, Thomson NR,
James KD et al (2002) Complete genome sequence of the model actino-
mycete Streptomyces coelicolor A3(2). Nature 417(6885):141–147
28. Grubbs KJ, Biedermann PH, Suen G, Adams SM, Moeller JA, Klas-
sen JL et al (2011) Genome sequence of Streptomyces griseus strain
XylebKG-1, an ambrosia beetle-associated actinomycete. J Bacteriol
193(11):2890–2891
29. Wu K, Chung L, Revill WP, Katz L, Reeves CD (2000) The FK520 gene cluster
of Streptomyces hygroscopicus var. ascomyceticus (ATCC 14891) contains
genes for biosynthesis of unusual polyketide extender units. Gene
251(1):81–90
30. Fischbach M, Godfrey P, Ward D, Young S, Zeng Q, Koehrsen M et al (2013)
The genome sequence of Streptomyces pristinaespiralis strain ATCC 25486.
Unpublished
31. Bignell DR, Seipke RF, Huguet-Tapia JC, Chambers AH, Parry RJ, Loria R
(2010) Streptomyces scabies 87–22 contains a coronafacic acid-like biosyn-
thetic cluster that contributes to plant–microbe interactions. Mol Plant
Microbe Interact 23(2):161–175
32. Fischbach M, Godfrey P, Ward D, Young S, Zeng Q, Koehrsen M et al
(2013) The genome sequence of Streptomyces sviceus strain ATCC 29083.
Unpublished
33. Markowitz VM, Chen IM, Palaniappan K, Chu K, Szeto E, Grechkin Y et al
(2012) IMG: the Integrated Microbial Genomes database and compara-
tive analysis system. Nucleic Acids Res 40(Database issue):D115–D122
34. Hall TA (1999) BioEdit: a user-friendly biological sequence alignment
editor and analysis program for Windows 95/98/NT. Nucleic Acids Sym-
posium Series 41:95–98
35. Punta M, Coggill PC, Eberhardt RY, Mistry J, Tate J, Boursnell C et al (2012)
The Pfam protein families database. Nucleic Acids Res 40(Database
issue):D290–D301
36. Sonnhammer EL, von Heijne G, Krogh A (1998) A hidden Markov model
for predicting transmembrane helices in protein sequences. Proc Int Conf
Intell Syst Mol Biol 6:175–182
37. Kall L, Krogh A, Sonnhammer EL (2004) A combined transmem-
brane topology and signal peptide prediction method. J Mol Biol
338(5):1027–1036
38. Spyropoulos IC, Liakopoulos TD, Bagos PG, Hamodrakas SJ (2004)
TMRPres2D: high quality visual representation of transmembrane protein
models. Bioinformatics 20(17):3258–3260
39. Crooks GE, Hon G, Chandonia JM, Brenner SE (2004) WebLogo: a
sequence logo generator. Genome Res 14(6):1188–1190
40. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local
alignment search tool. J Mol Biol 215(3):403–410
41. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular Evolu-
tionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol
24(8):1596–1599
42. Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA (2000) Practical
streptomyces genetics. John Innes Foundation
43. Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and
for biologist programmers. Methods Mol Biol 132:365–386
44. Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA (2000) Practical
streptomyces genetics. John Innes Foundation
45. Kinch LN, Grishin NV (2013) Bioinformatics perspective on rhomboid
intramembrane protease evolution and function. Biochim Biophys Acta
1828(12):2937–2943
46. Brooks CL, Lemieux MJ (2013) Untangling structure–function relation-
ships in the rhomboid family of intramembrane proteases. Biochim
Biophys Acta 1828(12):2862–2872
ResearchGate has not been able to resolve any citations for this publication.
Article
Full-text available
Rhomboids are ubiquitous proteins with unknown roles in mycobacteria. However, bioinformatics suggested putative roles in DNA replication pathways and metabolite transport. Here, mycobacterial rhomboid-encoding genes were characterized; first, using the Providencia stuartii null-rhomboid mutant and then deleted from Mycobacterium smegmatis for additional insight in mycobacteria. Using in silico analysis we identified in M. tuberculosis genome the genes encoding two putative rhomboid proteins; Rv0110 (referred to as "rhomboid protease 1") and Rv1337 ("rhomboid protease 2"). Genes encoding orthologs of these proteins are widely represented in all mycobacterial species. When transformed into P. stuartii null-rhomboid mutant (ΔaarA), genes encoding mycobacterial orthologs of "rhomboid protease 2" fully restored AarA activity (AarA is the rhomboid protein of P. stuartii). However, most genes encoding mycobacterial "rhomboid protease 1" orthologs did not. Furthermore, upon gene deletion in M. smegmatis, the ΔMSMEG_4904 single mutant (which lost the gene encoding MSMEG_4904, orthologous to Rv1337, "rhomboid protease 2") formed the least biofilms and was also more susceptible to ciprofloxacin and novobiocin, antimicrobials that inhibit DNA gyrase. However, the ΔMSMEG_5036 single mutant (which lost the gene encoding MSMEG_5036, orthologous to Rv0110, "rhomboid protease 1") was not as susceptible. Surprisingly, the double rhomboid mutant ΔMSMEG_4904-ΔMSMEG_5036 (which lost genes encoding both homologs) was also not as susceptible suggesting compensatory effects following deletion of both rhomboid-encoding genes. Indeed, transforming the double mutant with a plasmid encoding MSMEG_5036 produced phenotypes of the ΔMSMEG_4904 single mutant (i.e. susceptibility to ciprofloxacin and novobiocin). Mycobacterial rhomboid-encoding genes exhibit differences in complementing aarA whereby it's only genes encoding "rhomboid protease 2" orthologs that fully restore AarA activity. Additionally, gene deletion data suggests inhibition of DNA gyrase by MSMEG_4904; however, the ameliorated effect in the double mutant suggests occurrence of compensatory mechanisms following deletion of genes encoding both rhomboids.
Article
Designing PCR and sequencing primers are essential activities for molecular biologists around the world. This chapter assumes acquaintance with the principles and practice of PCR, as outlined in, for example, refs. 1, 2, 3, 4.
Article
Rhomboid proteases are a family of integral membrane proteins that have been implicated in critical regulatory roles in a wide array of cellular processes and signaling events. The determination of crystal structures of the prokaryotic rhomboid GlpG from Escherichia coli and Haemophilus influenzae has ushered in an era of unprecedented understanding into molecular aspects of intramembrane proteolysis by this fascinating class of protein. A combination of structural studies by X-ray crystallography, and biophysical and spectroscopic analyses, combined with traditional enzymatic and functional analysis has revealed fundamental aspects of rhomboid structure, substrate recognition and the catalytic mechanism. This review summarizes these remarkable advances by examining evidence for the proposed catalytic mechanism derived from inhibitor co-crystal structures, conflicting models of rhomboid-substrate interaction, and recent work on the structure and function of rhomboid cytosolic domains. In addition to exploring progress on aspects of rhomboid structure, areas for future research and unaddressed questions are emphasized and highlighted. This article is part of a Special Issue entitled: Intramembrane Proteases.
Article
Endopeptidase classification based on catalytic mechanism and evolutionary history has proven to be invaluable to the study of proteolytic enzymes. Such general mechanistic- and evolutionary- based groupings have launched experimental investigations, because knowledge gained for one family member tends to apply to the other closely related enzymes. The serine endopeptidases represent one of the most abundant and diverse groups, with their apparently successful proteolytic mechanism having arisen independently many times throughout evolution, giving rise to the well-studied soluble chemotrypsins and subtilisins, among many others. A large and diverse family of polytopic transmembrane proteins known as rhomboids has also evolved the serine protease mechanism. While the spatial structure, mechanism, and biochemical function of this family as intramembrane proteases has been established, the cellular roles of these enzymes as well as their natural substrates remain largely undetermined. While the evolutionary history of rhomboid proteases has been debated, sorting out the relationships among current day representatives should provide a solid basis for narrowing the knowledge gap between their biochemical and cellular functions. Indeed, some functional characteristics of rhomboid proteases can be gleaned from their evolutionary relationships. Finally, a specific case where phylogenetic profile analysis has identified proteins that contain a C-terminal processing motif (GlyGly-Cterm) as co-occurring with a set of bacterial rhomboid proteases provides an example of potential target identification through bioinformatics. This article is part of a Special Issue entitled: Intramembrane Proteases.
Article
From proteases that cleave peptide bonds in the plane of the membrane, rhomboids have evolved into a heterogeneous superfamily with a wide range of different mechanistic properties. In mammals 14 family members have been annotated based on a shared conserved membrane-integral rhomboid core domain, including intramembrane serine proteases and diverse proteolytically inactive homologues. While the function of rhomboid proteases is the proteolytic release of membrane-tethered factors, rhomboid pseudoproteases including iRhoms and derlins interact with their clients without cleaving them. It has become evident that specific recognition of membrane protein substrates and clients by the rhomboid fold reflects a spectrum of cellular functions ranging from growth factor activation, trafficking control to membrane protein degradation. This review summarizes recent progress on rhomboid family proteins in the mammalian secretory pathway and raises the question whether they can be seen as new drug targets for inflammatory diseases and cancer.
Article
Rhomboid peptidases (proteases) play key roles in signaling events at the membrane bilayer. Understanding the regulation of rhomboid function is crucial for insight into its mechanism of action. Here we examine the oligomeric state of three different rhomboid proteases. We subjected Haemophilus influenzae, (hiGlpG), Escherichia coli GlpG (ecGlpG) and Bacillus subtilis (YqgP) to sedimentation equilibrium analysis in detergent-solubilized dodecylmaltoside (DDM) solution. For hiGlpG and ecGlpG, rhomboids consisting of the core 6 transmembrane domains without and with soluble domains respectively, and YqgP, predicted to have 7 transmembrane domains with larger soluble domains at the termini, the predominant species was dimeric with low amounts of monomer and tetramers observed. To examine the effect of the membrane domain alone on oligomeric state of rhomboid, hiGlpG, the simplest form from the rhomboid class of intramembrane proteases representing the canonical rhomboid core of six transmembrane domains, was studied further. Using gel filtration and crosslinking we demonstrate that hiGlpG is dimeric and functional in DDM detergent solution. More importantly co-immunoprecipitation studies demonstrate that the dimer is present in the lipid bilayer suggesting a physiological dimer. Overall these results indicate that rhomboids form oligomers which are facilitated by the membrane domain. For hiGlpG we have shown that these oligomers exist in the lipid bilayer. This is the first detailed oligomeric state characterization of the rhomboid family of peptidases.
Article
Bacterially produced secondary metabolites are used as antibiotics, anticancer drugs, and for many other medicinal applications. The mechanisms that limit the production of these molecules in the laboratory are not well understood, and this has impeded the discovery of many important compounds. We have identified small molecules that remodel the yields of secondary metabolites in many actinomycetes and show that one set of these molecules does so by inhibiting fatty acid biosynthesis. This demonstrates a particularly intimate relationship between this primary metabolic pathway and secondary metabolism and suggests an approach to enhance the yields of metabolites for discovery and biochemical characterization.