Lactoferrin and ovotransferrin contribute toward antioxidative effects of Edible Bird’s Nest against hydrogen peroxide-induced oxidative stress in human SH-SY5Y cells

Abstract

There are reports of improved redox outcomes due to consumption of Edible Bird's Nest (EBN). Many of the functional effects of EBN can be linked to its high amounts of antioxidants. Interestingly, dietary components with high antioxidants have shown promise in the prevention of aging and its related diseases like Alzheimer's disease. In this study, the antioxidative potentials of EBN and its constituents, lactoferrin (LF) and ovotransferrin (OVF), were determined and protective effects against hydrogen peroxide (H2O2)- induced toxicity on SH-SY5Y cells using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and acridine orange and propidium iodide (AO/PI) staining with microscopy were examined. Results showed that EBN and its constituents attenuated H2O2-induced cytotoxicity, and decreased radical oxygen species (ROS) through increased scavenging activity. Furthermore, LF, OVF, and EBN produced transcriptional changes in antioxidant related genes that tended towards neuroprotection as compared to H2O2-treated group. Overall, the results suggest that LF and OVF may produce synergistic or all-or-none antioxidative effects in EBN.

Full text

Lactoferrin and ovotransferrin contribute toward antioxidative effects of
Edible Bird’s Nest against hydrogen peroxide-induced oxidative stress in
human SH-SY5Y cells
Zhiping Hou
1,3
, Mustapha Umar Imam
1
, Maznah Ismail
1,2,
*, Nur Hanisah Azmi
1
,
Norsharina Ismail
1
, Aini Ideris
4
and Rozi Mahmud
5
1
Laboratory of Molecular Biomedicine, Institute of Bioscience, Universiti Putra Malaysia, Serdang, Malaysia;
2
Department of Nutrition and Dietetic, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia,
Serdang, Malaysia;
3
Department of Pathology, Chengde Medical University, Chengde, China;
4
Department of
Veterinary Clinical Studies, Faculty of Veterinary Medicine, Universiti Putra Malaysia, Serdang, Malaysia;
5
Imaging
Department, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Serdang, Malaysia
Received January 13, 2015; accepted April 21, 2015
http://dx.doi.org/10.1080/09168451.2015.1050989
There are reports of improved redox outcomes
due to consumption of Edible Bird’s Nest (EBN).
Many of the functional effects of EBN can be linked
to its high amounts of antioxidants. Interestingly,
dietary components with high antioxidants have
shown promise in the prevention of aging and its
related diseases like Alzheimer’s disease. In this
study, the antioxidative potentials of EBN and its
constituents, lactoferrin (LF) and ovotransferrin
(OVF), were determined and protective effects
against hydrogen peroxide (H
2
O
2
)- induced toxicity
on SH-SY5Y cells using 3-(4,5-dimethylthiazol-2-yl)-
2,5-diphenyltetrazolium bromide (MTT) assay and
acridine orange and propidium iodide (AO/PI)
staining with microscopy were examined. Results
showed that EBN and its constituents attenuated
H
2
O
2
-induced cytotoxicity, and decreased radical
oxygen species (ROS) through increased scavenging
activity. Furthermore, LF, OVF, and EBN produced
transcriptional changes in antioxidant related genes
that tended towards neuroprotection as compared to
H
2
O
2
-treated group. Overall, the results suggest that
LF and OVF may produce synergistic or all-or-none
antioxidative effects in EBN.
Key words: Edible Bird’s Nest; lactoferrin; ovotrans-
ferrin; antioxidant; neuroprotection
Introduction
Aging is a slow and gradual biological process,
associated with multiple physiological and pathological
changes including altered redox status. The brain cells
are normally sensitive to the effects of reactive oxygen
species (ROS) because they are a nidus for peroxida-
tive molecules, and because of their peculiar energetic
demands.
1)
In brain senescence, ROS starts to accumu-
late in neurons before clinically evident signs and
symptoms of the disease can be detected.
1)
When ROS
accumulate, oxidative damage is normally prevented by
induction of protective factors like antioxidants, which
may not be effective if the insult is too overwhelming.
In such cases, apoptotic mechanisms set in to remove
neurons deemed irreparable.
2)
Loss of neurons through
these apoptotic deaths results in severe morphological
and functional deficits, which manifest with progressive
memory and cognitive decline.
Recently, due to concerns of side effects, researches
have been focused on natural substances with neuro-
protective potential that can scavenge free radicals and
protect cells from oxidative damage, rather than syn-
thetic chemicals.
3)
Edible Bird’s Nest (EBN, Aerodra-
mus fuciphaga) is produced by swiftlets from their
salivary glue, which is a cementing substance.
Although EBN mainly contains carbohydrates, amino
acids, and mineral salts, its major ingredients are glyco-
proteins.
4)
Due to its nutritious and medical properties,
EBN has been deemed a precious food tonic in Chi-
nese community ever since Tang (608–907AD) dynas-
ties.
5)
Despite the long history of using EBN for
medicinal purposes, there has only been limited number
of scientific reports on the health benefits of EBN.
Recently, EBN has been found to potentiate mitogenic
response of human peripheral blood monocytes
6)
and
stimulate deoxyribonucleic acid synthesis in 3T3
fibroblasts.
7)
Furthermore, enzymatic hydrolysis can
release active peptides, which have beneficial effects on
a variety of biological systems
8)
including the cardio-
vascular, gastrointestinal, immune, and nervous sys-
tems. The ability of glycoprotein to interact with
radical species or to inhibit oxidative reactions could
*Corresponding author. Email: maznahis@upm.edu.my
Abbreviations: AO/PI, Acridine orange and propidium iodide; EBN, Edible Bird’s Nest; LF, Lactoferrin; ORAC, Oxygen Radical Absorbance
Capacity; OVF, ovotransferrin; ROS, radical oxygen species; SOD, superoxide dismutase.
Bioscience, Biotechnology, and Biochemistry, 2015
© 2015 Japan Society for Bioscience, Biotechnology, and Agrochemistry
Downloaded by [Dr Imam Mustapha Umar] at 03:44 12 June 2015

lead to the development of novel food ingredients rele-
vant in health promotion and disease prevention.
Lactoferrin (LF) and ovotransferrin (OVF) are glyco-
proteins and family members of transferrin. Different
studies have also shown that LF and OVF serve neuro-
protective and antioxidant functions
9,10)
and may there-
fore be good sources of functional food ingredients.
EBN is reported to have antioxidative properties,
11,12)
and in view of the properties of LF and OVF, we
hypothesize that they may be contributing towards the
overall antioxidant properties of EBN.
SH-SY5Y cell line can be differentiated by retinoic
acid (RA) with similar characteristics to brain neurons
and thus can be used to study neuronal cell activity
in vitro.
3)
Hydrogen peroxide (H
2
O
2
) is a major reac-
tive free radical that has been studied in a variety of
neurodegenerative diseases, and has been implicated as
an important mediator of unbalanced redox reactions
and apoptosis in various cells including neurons.
13)
Consequently, this study was conducted to determine
the concentration of LF and OVF in EBN, and evaluate
their effectiveness against H
2
O
2
-induced oxidative
stress on SH-SY5Y cells.
Materials and methods
Materials. SH-SY5Y human neuroblastoma cell
line was obtained from American Type Culture Collec-
tion (Manassas, VA, USA). Minimum essential Eagle’s
medium, Ham’s nutrient mixture F-12 (DMEM/F-12),
fetal bovine serum, 3-(4,5-dimethylthiazol-2-yl)-2,5-
diphenyltetrazolium bromide (MTT), dimethyl sulfoxide
(DMSO) and all other chemicals were purchased from
Sigma (St. Louis, MO, USA). The GenomeLab™GeXP
Start Kit was from Beckman Coulter Inc. (Miami, FL,
USA), and the total ribonucleic acid (RNA) Isolation kit
was obtained from RBC Bioscience Corp. (Taipei, Tai-
wan). The OxiSelect™Superoxide Dimutase Activity
Assay (SOD) and OxiSelect™Intracellular ROS Assay
kit (ROS) were from Cell Biolabs, Inc. (USA). Lactofer-
rin (L4894) and ovotransferrin (C7786) were purchased
from Sigma-Aldrich (St. Louis, MO, USA).
Preparation of EBN water-soluble protein. EBNs
from Sabah and Sarawak (states of Malaysia in the
Borneo Island) were dried in an oven at 50 °C for three
days and finely grounded with a food grinder (Waring
Commercial, Torrington, CT, USA). As reported previ-
ously,
14)
the grounded EBN samples (1.0 g) were dis-
solved into 1000 ml of dd H
2
O, followed by
ultrasonication (Power Sonic 505, Hwashin Technology
Co. Seoul, Korea) in an ice bath (pulse on, 2 s; pulse
off, 4 s; ampl, 80%; 30 min) and centrifugation
(10,000 rpm for 10 min); the supernatants were
desalted and condensed in a dialysis bag with a 3500
cut-off molecular weight; then the water-soluble protein
stored at −20 °C until use.
LF and OVF detection. LF and OVF concentration
in EBN water extract were detected using Chicken
Lactoferrin Elisa kit and Chicken Ovotransferrin Elisa
Kit, Biosource (San Diego, CA, USA). All the proto-
cols were based on manufacturer instructions.
Cell culture. The human neuroblastoma SH-SY5Y
cells were grown in complete culture medium contain-
ing DMEM/F-12, 10% fetal bovine serum, 1% MEM
(non-essential amino acids), and 50 μg/ml gentamicin.
Cells were maintained at 37 °C with 5% CO
2
and 95%
air.
2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)
(ABTS) radical cation scavenging activity. ABTS
radical cation was generated through oxidation of
7 mM ABTS with 2.45 mM potassium persulfate and
incubated overnight in the dark at room temperature.
ABTS radical cation solution was then diluted with
ethanol to obtain an absorbance of 0.70 ± 0.02 at
734 nm spectrophotometerically (Pharmaspec UV-1700,
Shimadzu, Kyoto, Japan). EBN, LF and OVF (50 μL
each) were individually mixed with 950 μL of diluted
ABTS solution and incubated for 10 min at room tem-
perature. The absorbance was measured under 734 nm.
All the determinations were carried out in triplicate and
the readings were averaged. Trolox was used as stan-
dard and percentage of ABTS radical cation decoloriza-
tion inhibition was calculated using the formula
reported by Ismail in 2012.
3)
ABTS radical cation scav-
enging activity of EBN, LF, and OVF was expressed in
mg Trolox equivalent per gram extracts as described
before (mg TE/g extract).
Oxygen Radical Absorbance Capacity (ORAC)
Assay. The abilities of extracts to scavenge peroxyl
radical capacity were determined by Oxygen Radical
Absorbance Capacity (ORAC) according to the method
described by Huang et al.
15)
Briefly, 150 μLfluorescein
and 25 μL sample (1000 μg/ml EBN, 5 μg/ml LF, and
10 μg/ml OVF) or standard (Trolox) were added into
each well, and incubated 37 °C for 10–15 min. After
incubation, fluorescence measurements (Ex. 485 nm,
Em. 520 nm) were taken every one min to determine
the background signal. After 3 cycles, 25 μL of freshly
prepared 2,2′-azobis(2-amidinopropane) dihydrochloride
(AAPH) at final concentration 81.6 nM was added
manually with a multichannel pipette. Fluorescence
readings for each cycle were saved in Synergy H1
Hybrid Multi-Mode Microplate Reader (BioTek,
Winooski, VT, USA), as they would all be used
to calculate areas under the curves and Trolox
equivalents.
MTT assay. SH-SY5Y cells were seeded into
96-well culture plates at density of 2 × 10
5
cells/ml and
were allowed to attach. After 2 days, cells were differ-
entiated with RA (10 μM) for 7 days prior to treatment.
To examine the possible toxic effects, the cells were
treated with EBN (10–100,000 μg/ml), LF (0.05–
500 μg/ml), and OVF (0.1–1000 μg/ml) individually
for 24 h. To determine the neuroprotective ability, cells
were pretreated with 1000 μg/ml EBN and the equiva-
lence 5 μg/ml LF and 10 μg/ml OVF diluted in serum-
free medium for 24 h and then incubated with H
2
O
2
for another 2 h. Then, MTT was added to all the wells
and stranded in incubator for 4 h. The amount of MTT
2 H. Zhiping et al.
Downloaded by [Dr Imam Mustapha Umar] at 03:44 12 June 2015

formazan product was dissolved by DMSO and mea-
sured absorbance at 540 nm using a Microplate reader
(All the MTT assays were performed in triplicate).
Acridine orange and propidium iodide (AO/PI)
staining. SH-SY5Y cells (2 × 10
5
) were seeded into
6-well culture plates, treated with 1000 μg/ml EBN and
the equivalence 5 μg/ml LF and 10 μg/ml OVF, then fol-
lowed by 250 μMH
2
O
2
for 2 h. Then, cells were har-
vested, and stained with AO/PI (10 μl of 1 mg/ml AO
and 10 μl of 1 mg/ml PI). They were examined under an
inverted fluorescence microscope (Olympus, Tokyo,
Japan). Multiple independent images were taken.
Superoxide dismutase (SOD) and ROS ELISA
assays. SH-SY5Y cells (2 × 10
5
) were seeded into
12-well culture plates, treated with 1000 μg/ml EBN
and the equivalence 5 μg/ml LF and 10 μg/ml OVF,
then followed by 250 μMH
2
O
2
for 2 h. Protocols for
the ELISA tests were based on manufacturer instruc-
tions. For SOD assay, absorbance of samples were
finally read at 490 nm on the Synergy H1 Hybrid
Multi-Mode Microplate Reader (BioTek, Winooski, VT,
USA), while fluorescence for ROS assay were read at
480/530 nm by Synergy H1 Hybrid Multi-Mode Micro-
plate Reader (BioTek, Winooski, VT, USA).
Ribonucleic acid (RNA) extraction, reverse transcrip-
tion and multiplex polymerase chain reaction (PCR)
analysis. SH-SY5Y-treated cells were extracted by
the Total RNA Isolation kit (RBC Bioscience Corp.,
Taiwan) according to the manufacturer’s instructions.
Primer sequences (Table 1) were designed using Geno-
meLab eXpress Profiler software based on Homo
sapien sequence from the NCBI website. The primers
were supplied by Biosune (Shanghai, China), while the
internal control (KanR) was supplied by Beckman
Coulter. Reverse transcription and PCR were performed
according to the GenomeLab™GeXP kit instruction
(Beckman Coulter) in an XP Thermal Cycler (Bioer
Technology, Germany). The PCR products were finally
analyzed by the GeXP genetic analysis system, and the
results were normalized using GeXpress Profiler soft-
ware based on the manufacturer’s instructions.
Statistical analysis. All the data (n= 3) was con-
ducted by Tukey’s multiple comparisons of one-way
ANOVA using Statistical Package for Social Science
(SPSS) version 20 (SPSS Inc., Chicago, IL). p<0.05
was considered as statistically significant difference.
Results and discussion
LF and OVF detection in EBN water extraction
The results of LF and OVF concentrations deter-
mined using enzyme-linked immunosorbent assay
(ELISA) kits (chicken source), are shown in Table 2.
From comparisons made with the reported contents
from other sources, the compositions in EBN, espe-
cially white house EBN, are considerably higher. The
concentrations of LF and OVF in house white EBN
were approximately 0.5 and 1%, respectively. Thus, we
chose house white EBN as experimental subject.
Based on the biological functions of LF and OVF
reported
16−20)
, we hypothesized that LF and OVF could
be contributing towards the overall functional proper-
ties of EBN, which prompted further evaluation of their
properties.
EBN, LF, and OVF attenuate H
2
O
2
-induced
cytotoxicity on SH-SY5Y cells
The abilities of EBN, LF, and OVF to protect
SH-SY5Y cells from H
2
O
2
were determined by MTT
assay (Fig. 1), an indicator of cell viability. EBN
(10–100,000 μg/ml), and equivalent concentrations
of LF an OVF in EBN (0.05–500 μg/ml, and
0.1–1000 μg/ml, respectively) displayed above 80%
viability on SH-SY5Y cells (Fig. 1(A)), and showed no
significant differences when compared with the control
group (p> 0.05).
H
2
O
2
is an oxidant that can induce intracellular
defense mechanisms to attenuate H
2
O
2
-induced oxida-
tive damage. As reported in our previous paper,
3)
SH-SY5Y cells exposure to 250 μMH
2
O
2
for 2 h
resulted in approximately 50% cell death compared
with untreated control cells (p< 0.01). As shown in
Fig. 1(B), EBN produced a hormetic effect on the via-
bility of the cells in the presence of H
2
O
2
, with
1000 μg/ml EBN producing the best result. Although
antioxidants are known to relieve oxidative stress and
improve cell survival, it is also suggested that higher
concentrations of antioxidants may in fact disrupt the
natural hormetic capacity of cells
21)
resulting in more
damage. It is also likely that at higher concentrations,
the oxidants simply became prooxidant.
22,23)
Therefore,
for our subsequent experiments, 1000 μg/ml EBN, and
equivalent concentrations of LF and OVF (5 and
10 μg/ml, respectively) were used.
ABTS radical cation scavenging activity and ORAC
assay
ORAC assay is a simple, sensitive, and reliable
method to quantitate the radical absorbing capacity of
antioxidants in serum or other biological fluids,
especially natural products.
24)
Additionally, ABTS is
also widely used for measuring the relative radical
scavenging activity of hydrogen donating and chain
breaking antioxidants in many fields.
25)
To determine
antioxidant potentials of EBN, LF, and OVF, ABTS and
ORAC were performed on the samples (Fig. 2). EBN
(1000 μg/ml) exhibited the best scavenging effect on
ABTS (5.23 ± 0.18 mg Trolox equivalent/g extract),
followed by LF (5 μg/ml) and OVF (10 μg/ml) at con-
centrations similar to what is contained in 1000 μg/ml
of EBN (4.67 ± 0.40 and 2.79 ± 0.18 mg Trolox
equivalent/g extract, respectively). Results of the ORAC
assay also showed that EBN had the highest antioxidant
capacity (3.04 ± 0.23 mg Trolox equivalent/g extract)
when compared with LF and OVF (2.14 ± 0.10 and
1.22 ± 0.08 mg Trolox equivalent/g extract, respec-
tively). The results also indicated significant differences
(p< 0.05) between LF and OVF, and also when each is
compared with EBN.
EBN lower oxidative stress 3
Downloaded by [Dr Imam Mustapha Umar] at 03:44 12 June 2015

Table 1. Gene name, accession number, reverse and forward primer sequences used in GeXP multiplex gene expression analyses.
Gene name Accession number
Primer sequence with universal tag
Forward Reverse
KanR
a
AGGTGACACTATAGAATAATCATCAGCATTGCATTCGATTCCTGTTTG GTACGACTCACTATAGGGAATTCCGACTCGTCCAACATC
GAPDH
b
NM_002046 AGGTGACACTATAGAATAAAGGTGAAGGTCGGAGTCAA GTACGACTCACTATAGGGAGATCTCGCTCCTGGAAGATG
SOD1 NM_00454 AGGTGACACTATAGAATATCATCAATTTCGAGCAGAAGG GTACGACTCACTATAGGGA TGCTTTTTCATGGACCACC
SOD2 NM_00636 AGGTGACACTATAGAATACATCAAACGTGACTTTGGTTC GTACGACTCACTATAGGGACTCAGCATAACGATCGTGGTT
PARP1 NM_001618 AGGTGACACTATAGAATATATCGAGTCGAGTACGCCAA GTACGACTCACTATAGGGAGTGTGGGACTTTTCCATCAAA
a
Internal control.
b
Housekeeping gene. RT reaction was at 48 °C for 1 min; 37 °C for 5 min; 42 °C for 60 min; 95 °C for 5 min, then hold at 4 °C, while PCR was as follows: initial denaturation at 95 °C for 10 min, followed by two-step cycles of 94 °C for 30 s and
55 °C for 30 s, ending in a single extension cycle of 68 °C for 1 min.
4 H. Zhiping et al.
Downloaded by [Dr Imam Mustapha Umar] at 03:44 12 June 2015

Results of EBN, LF, and OVF have demonstrated
consistent data in scavenging activities by ORAC and
ABTS radical scavenging assays. EBN demonstrated
the highest antioxidant activity followed by LF and
OVF via ORAC and ABTS radical cation scavenging
methods (Fig. 2). The results so far suggest that LF
and OVF possess antioxidant capacities, and even
though the capacities of any one of the compounds
may not explain the antioxidant capacity of EBN, it is
likely that they contribute towards the overall capacity
in EBN. Additionally, the overall antioxidant capacity
of EBN may be contributed by other compounds in
Table 2. Lactoferrin and Ovotransferrin expression in different species.
Lactoferrin Ovotransferrin
House white EBN (Sabah) 4.68 ± 0.57 μg/mg EBN 10.23 ± 0.72 μg/mg EBN
Cave white EBN (Sabah) 4.27 ± 0.49 μg/mg EBN 10.63 ± 0.90 μg/mg EBN
Cave black EBN (Sabah) 2.80 ± 0.21 μg/mg EBN 1.31 ± 0.07 μg/mg EBN
Cave red EBN (Sabah) 3.43 ± 0.07 μg/mg EBN 3.13 ± 0.58 μg/mg EBN
Cave red EBN (Sarawak) 3.13 ± 0.07 μg/mg EBN 8.40 ± 0.56 μg/mg EBN
Human milk 2 g/l
32)
NA
Cow milk 1 g/l
32)
NA
Human tears 0.9 g/l
32,33)
NA
Rat/rabbit/dog milk <50 mg/l
32)
NA
Hen egg NA 130 mg/g egg albumen
19)
Notes: EBN, Edible Bird’s Nest; NA, not available.
Fig. 1. Effects of edible birds’nest (EBN), lactoferrin (LF), and ovotransferrin (OVF) on H
2
O
2
-induced cytotoxicity in SH-SY5Y cells deter-
mined by MTT assay.
Notes: (A) Human SH-SY5Y neuroblastoma cells were incubated with EBN (10–10,000 μg/mL), LF (0.05–500 μg/mL), and OVF (0.1–1000 μg/mL)
for 24 h; (B) SH-SY5Y pretreated with EBN, LF or OVF for 24 h with or without H
2
O
2
(250 μM) for an additional 2 h. Results are presented as the
mean ± SD in triplicates.
a
p<0.01vs.H
2
O
2
,
b
p< 0.01 vs. control.
EBN lower oxidative stress 5
Downloaded by [Dr Imam Mustapha Umar] at 03:44 12 June 2015

addition to LF and OVF, since LF and OVF do not
entirely reflect the same activity as EBN. Different
studies have already shown that due to synergistic
effects of compounds in crude extracts, crude plant
extracts usually exhibit superior health-oriented proper-
ties than purified compounds.
26)
It is also likely that
synergy between the different bioactive compounds in
EBN may potentiate their activity when they are bound
together in a single matrix.
27)
AO/PI staining
AO and PI are among the most used stains for analy-
ses of cell apoptosis. Using a combination of these
stains, cells appear orange/red to indicate they are
apoptosis, while intact cells appear green. As shown in
Fig. 3, control cells appeared green, suggesting normal
structure and viability, while H
2
O
2
-treated cells
appeared orange, representing early apoptosis. As for
the EBN-treated cells, majority of the cells were stained
green, showing normal appearance of intact cells; simi-
larly, LF and OVF groups showed mostly normal cells,
with little signs of apoptosis.
ROS and SOD assay
SOD belongs to the endogenous antioxidant system
that can scavenge ROS. The disruption in the balance
between ROS and the endogenous antioxidant systems
contributes to oxidative damage of cellular macro-
molecules ultimately leading to cell death.
28)
In this
study, the relative activity of SOD in the SH-SY5Y
cells exposed to 250 μMH
2
O
2
for 2 h decreased to
69.6% compared with the control group. Pretreatment
with EBN, LF, and OVF for 24 h recovered the SOD
activity to 90.7, 87.8, and 80.9%, respectively
(Fig. 4(A)). SOD is the important antioxidant defense
normally catalyze dismutation of the superoxide radical
into H
2
O
2
. However, SOD also displayed antioxidant
effect according to suppress the oxygen metabolites,
like superoxide.
To investigate whether EBN, LF, and OVF have the
effect to scavenge intracellular ROS generation induced
by H
2
O
2
, intracellular ROS kit was used to examine
intracellular H
2
O
2
/hydroxyl radical. DCFH-DA (2′,7′-
dichlorofluorescin diacetate) fluorescence staining indi-
cated that the value of H
2
O
2
-treated cells was increased
about twofold compared with untreated control cells.
However, the increase in intracellular H
2
O
2
was
reduced by EBN, LF, and OVF treatment (Fig. 4(B))
because they can directly attenuate hydroxyl radical
produced by H
2
O
2
. Meanwhile, the antioxidant system
will be stimulated even when exogenous ROS were
developed. As reported in the papers, OVF showed a
dose dependence in DCFH-DA oxidation by HD11
cells in the presence of phorbol 12-myristate 13-acetate
(PMA),
29)
and LF displayed antioxidant ability in both
in ferric nitrilotriacetate-induced renal oxidative damage
in rats.
30)
Therefore, the antioxidant properties of EBN,
LF, and OVF base on scavenging hydroxyl radical and
oxygen byproducts. Obviously, these results corroborate
those of the antioxidant capacities of LF and OVF,
which indicated that they had high antioxidant capaci-
ties that may be contributing to that of EBN.
Effects of EBN, LF, and OVF on mRNA levels of
antioxidant and apoptosis genes
The mRNA levels of three antioxidant and apoptosis
genes (poly (ADP-ribose) polymerase 1 [PARP1],
SOD1, and SOD2, nuclear factor kappa-light-chain-en-
hancer of activated B cells [NF-κB], cellular tumor
antigen p53 [p53], p38 mitogen-activated protein kinase
[p38MAPK], and protein kinase B [Akt]) were studied
using Multiplex GeXP genetic analysis system, with
KanR as the internal control. The target genes and
housekeeping gene are shown in Table 1.
As shown in Fig. 5, treatment with 250 μMH
2
O
2
downregulated the mRNA levels of SOD1, SOD2, and
PARP1 genes. Treatments with 1000 μg/ml EBN water
extract, 5 μg/ml LF, or 10 μg/ml OVF upregulated the
expression of the three genes even in the presence of
250 μMH
2
O
2
. In the case of SOD1 and SOD2, the
EBN, LF, and OVF-treated cells upregulated the gene
significantly higher than H
2
O
2
-treated controls
(p< 0.01), although the expression levels were lower
than in non-treated control cells (p< 0.01). The mRNA
level of PARP1 in EBN treated cells was higher than
H
2
O
2
-treated and normal untreated cells (p< 0.05), but
those of LF- and OVF-treated cells were not different
from H
2
O
2
-treated cells, and were lower than in
untreated controls (p> 005).
Upregulation of antioxidant genes (SOD) is an
endogenous mechanism for boosting antioxidant
defenses in the presence of oxidative insults, and could
be the basis for the increased SOD activity observed in
this study when SH-SY5Y cell were treated with EBN,
LF, or OVF (Fig. 4). Moreover, the mRNA levels for
the EBN, LF, and OVF groups are reflective of the
SOD activities observed in the respective groups, as no
significant differences in SOD mRNA levels or activi-
ties were observed between the groups. There are
numerous papers reported the antioxidant ability of
lactoferrin, most importantly, ovotransferrin was also
processed SOD-like function
31)
which showed the main
Fig. 2. ABTS radical cation scavenging activities and ORAC of
Edible Bird’s Nest, lactoferrin (LF), and ovotransferrin (OVF).
Notes: Concentrations of LF and OVF used for the assays corre-
spond to their concentrations present in EBN, as shown in Table 2.
Values expressed as mean ± standard deviation.
a
p< 0.01 vs. EBN;
b
p< 0.01 vs. LF. ABTS, 2,2-azino-bis[3-ethylbenzothiazoline-6-sul-
fonic acid; ORAC, oxygen radical absorbance capacity.
6 H. Zhiping et al.
Downloaded by [Dr Imam Mustapha Umar] at 03:44 12 June 2015

key enzyme involved in redox balance in cellular and
controlled antioxidant expression both in proteomic and
transcriptional levels. The results, therefore, suggest
that EBN boosts SOD levels and its activity through
increased transcriptional regulation of the gene, and
that LF and OVF in EBN contribute to this effect.
However, combination of these compounds and others
in EBN may not have produced additive effects since
there are no differences between EBN, LF, and OVF
treatments. Furthermore, activation of PARP1 is
reported to improve cell survival after oxidative dam-
age from H
2
O
2
.
15)
Its increased expression by EBN but
not LF or OVF suggest that other constituents in EBN
may be contributing to this effect other than LF or
OVF, or that their synergistic effect with or without
other compounds may be contributing to expression
Fig. 3. AO (acridine orange, green)/PI (propidium iodide, red) double staining on SH-SY5Y human cells under fluorescent microscope.
Notes: (A) untreated control cells; (B) treatment with 250 μMH
2
O
2
for 2 h; (C–E) cells pretreated with 1000 µg/ml EBN water extract, 5 µg/mL
LF or 10 µg/mL OVF, respectively, and subsequently treated with 250 μMH
2
O
2
for 2 h.
Fig. 4. Superoxide dismutase (SOD) activity (A) and reactive oxygen species (ROS) generation (B) in SH-SY5Y cells, following treatment with
1000 μg/ml EBN water extract, 5 µg/mL LF, or 10 µg/mL OVF, and subsequent treatment with or without 250 μMH
2
O
2
, in comparison with
untreated control. Results are presented as the mean ± SD in triplicates.
a
p< 0.01 vs. H
2
O
2
,
b
p< 0.01 vs. control,
c
p< 0.01 vs. EBN.
EBN lower oxidative stress 7
Downloaded by [Dr Imam Mustapha Umar] at 03:44 12 June 2015

level seen in EBN-treated cells. The overall data from
this study, therefore, indicates that EBN constituents
interact in different ways to produce its activity; the
presence of multiple compounds may produce additive
or synergistic effects as suggested by the antioxidant
capacity tests and expression of PARP1, while in some
cases it may produce an all-or-none effect as seen with
the activity and expression of SOD.
Conclusions
In summary, the present study demonstrated that
EBN protects SH-SY5Y cells against H
2
O
2
-induced
cytotoxicity and cell oxidative stress. LF and OVF con-
tributed to the antioxidative effects of EBN in different
ways. They were also able to inhibit early apoptosis in
response to H
2
O
2
treatment. The findings indicate that
EBN constituents contribute towards producing syner-
gistic antioxidative effects of EBN.
Author contributions
Study design: Hou Zhiping, Maznah Ismail. Supervi-
sion of the study: Maznah Ismail, Aini Idris and Rozi
Mahmud. Primer design for gene expression study:
Norsharina Ismail and Mustapha Umar Imam. Conduct
of experimental parts: Hou Zhiping and Nur Hanisah
Azmi. Data analyses and preparation of manuscript:
Mstapha Umar Imam and Hou Zhiping. Review of
manuscript and final approval for submission: Maznah
Ismail.
Acknowledgments
This work was carried out under the financial sup-
port of Ministry of Science, Technology and Innova-
tion, e-sciencefund (vote 5450666), Malaysia. The
authors wish to thank Mr. Mohd Khairil Othman from
Matrix Optics (M) Sdn. Bhd. for the technical assis-
tance in fluorescence microscopy analysis and all staff
of Laboratory of Molecular Biomedicine for the help
during the study.
Disclosure statement
The authors declare that they have no competing interests.
ORCID
Mustapha Umar Imam http://orcid.org/0000-0001-9888-4809
Nur Hanisah Azmi http://orcid.org/0000-0003-4184-7585
References
[1] Gandhi S, Abramov AY. Mechanism of oxidative stress in
neurodegeneration. Oxid. Med. Cell. Longev. 2012;2012.
doi:10.1155/2012/428010
[2] Radi E, Formichi P, Battisti C, et al. Apoptosis and oxidative
stress in neurodegenerative diseases. J. Alzheimers Dis. 2014;4:
S125–S152.
[3] Ismail N, Ismail M, Fathy F, et al. Neuroprotective effects of
germinated brown rice against hydrogen peroxide induced cell
death in human SH-SY5Y cells. Int. J. Mol. Sci. 2012;13:9692–
9708.
[4] Yu YQ, Xue L, Wang H, et al. Determination of edible bird’s
nest and its products by gas chromatography. J. Chromatogr. Sci.
2000;38:27–32.
[5] Marcone MF. Characterization of the edible bird’s nest the
“Caviar of the East”. Food Res. Int. 2005;38:1125–1134.
[6] Guo CT, Takahashi T, Bukaw W, et al. Edible bird’s nest extract
inhibits in fluenza virus infection. Antiviral Res. 2006;70:140–
146.
[7] Yagi H, Yasukawa N, Yu SY, et al. The expression of sialylated
high-antennary N-glycans in edible bird’s nest. Carbohydr. Res.
2008;343:1373–1377.
[8] Moreira PI, Nunomura A, Honda K, et al. The key role of oxida-
tive stress in Alzheimer’s disease. Oxid. Stress Neurodegen.
Disord. 2007:451–866.
[9] Rousseau E, Michel PP, Hirsch EC. The iron-binding protein
lactoferrin protects vulnerable dopamine neurons from
Fig. 5. mRNA levels of SOD1, SOD2 and PARP1 genes in SH-SY5Y cells, following treatment with 1000 μg/ml EBN water extract, 5 μg/mL
LF, 10 μg/mL OVF and subsequent treatment with 250 μMH
2
O
2
, in comparison to untreated control and treatment with 250 μMH
2
O
2
. Results
are presented as the mean ± SD in triplicates.
a
p< 0.01 vs.H
2
O
2
,
b
p< 0.01 vs. control,
c
p< 0.05 vs.EBN.
8 H. Zhiping et al.
Downloaded by [Dr Imam Mustapha Umar] at 03:44 12 June 2015

degeneration by preserving mitochondrial calcium homeostasis.
Mol. Pharmacol. 2013;84:888–898.
[10] Ibrahim HR, Hoq MI, Aoki T. Ovotransferrin possesses SOD-
like superoxide anion scavenging activity that is promoted by
copper and manganese binding. Int. J. Biol. Macromol.
2007;41:631–640.
[11] Yew MY, Koh RY, Chye SM, et al. Edible bird’s nest amelio-
rates oxidative stress-induced apoptosis in SH-SY5Y human neu-
roblastoma cells. BMC Complement. Altern. Med. 2014;14.
doi:10.1186/1472-6882-14-391
[12] Kim K, Kang KA, Lim CM, et al. Water extract of edible bird’s
nest attenuated the oxidative stress-induced matrix metallopro-
teinase-1 by regulating the mitogen-activated protein kinase and
activator protein-1 pathway in human keratinocytes. J. Korean
Soc. Appl. Biol. Chem. 2012;55:347–354.
[13] Suematsu N, Hosoda M, Fujimori K. Protective effects of quer-
cetin against hydrogen peroxide-induced apoptosis in human
neuronal SH-SY5Y cells. Neurosci. Lett. 2011;504:223–227.
[14] Csiszar A, Pacher P, Kaley G, et al. Role of oxidative and nitro-
sative stress, longevity genes and poly (ADP-ribose) polymerase
in cardiovascular dysfunction associated with aging. Curr. Vasc.
Pharmacol. 2005;3:285.
[15] Huang D, Ou B, Prior RL. The chemistry behind antioxidant
capacity assays. J. Agric. Food. Chem. 2005;53:1841–1856.
[16] Anderson BF, Baker, HM, Norris, GE, et al. Structure of human
lactoferrin: crystallographic structure analysis and refinement at
2.8 A resolution. J. Mol. Biol. 1989;209:711–734.
[17] Van Snick JL, Masson PL. The binding of human lactoferrin to
mouse peritoneal cells. J. Exp. Med. 1976;144:1568–1580.
[18] Rainard P. Bacteriostatic activity of bovine milk lactoferrin
against mastitic bacteria. Vet. Microbiol. 1986;11:387–392.
[19] Giansanti F, Leboffe L, Pitari G, et al. Biochim. Biophys. Acta.
2012;1820:218–225.
[20] Giansanti F, Rossi P, Massucci MT, et al. Antiviral activity of
ovotransferrin discloses an evolutionary strategy for the
defensive activities of lactoferrin. Biochem. Cell Biol. 2002;80:
125–130.
[21] Imam MU, Musa ASN, Azmi NH, et al. Effects of white rice,
brown rice and germinated brown rice on antioxidant status of
type 2 diabetic rats. Int. J. Mol. Cell. Med. 2012;13:12952–
12969.
[22] Carr A, Frei B. Does vitamin C act as a pro-oxidant under
physiological conditions? FASEB J. 1999;13:1007–1024.
[23] Stohs SJ, Bagchi D. Oxidative mechanisms in the toxicity of
metal ions. Free Radical. Biol. Med. 1995;18:321–336.
[24] Cao G, Alessio HM, Cutler RG. Oxygen-radical absorbance
capacity assay for antioxidants. Free Radical. Biol. Med.
1993;14:303–311.
[25] Netzel M, Strass G, Bitsch I, et al. Effect of grape processing on
selected antioxidant phenolics in red wine. J. Food Eng.
2003;56:223–228.
[26] Ismail N, Ismail M, Latiff L, et al. Black cumin seed (Nigella
sativa L.) oil and its fractions protect against beta amyloid pep-
tide-induced toxicityin primary cerebellar granule neurons. J.
Food Lipids. 2008;15:519–533.
[27] Jacobs DR, Gross MD, Tapsell LC. Food synergy: an opera-
tional concept for understanding nutrition. Am. J. Clin. Nutr.
2009;89:1543S–1548S.
[28] Martindale JL, Holbrook NJ. Cellular response to oxidative
stress: signaling for suicide and survival. J. Cell Physiol.
2002;19:1–15.
[29] Xie H, Huff GR, Huff WE, et al. Effects of ovotransferrin on
chicken macrophages and heterophil-granulocytes. Dev. Comp.
Immunol. 2002;26:805–815.
[30] Okazaki Y, Kono I, Kuriki T, et al. Bovine lactoferrin amelio-
rates ferric nitrilotriacetate-induced renal oxidative damage in
rats. J. Clin. Biochem. Nutr. 2012;51:84–90.
[31] Ibrahim HR, Hoq MI, Aoki T. Ovotransferrin possesses SOD-
like superoxide anion scavenging activity that is promoted by
copper and manganese binding. Int. J. Biol. Macromol.
2007;41:631–640.
[32] Masson PL, Heremans JF. Lactoferrin in milk from different
species. Comp. Biochem. Physiol. B: Biochem. Mol. Biol.
1971;39:119–IN13.
[33] Leonardi A, Palmigiano A, Mazzola EA, et al. Identification
of human tear fluid biomarkers in vernal keratoconjunctivitis
using iTRAQ quantitative proteomics. Allergy. 2014;69:
254–260.
EBN lower oxidative stress 9
Downloaded by [Dr Imam Mustapha Umar] at 03:44 12 June 2015