ArticlePDF Available

Taxonomy of the tribe Apieae (Apiaceae) revisited as revealed by molecular phylogenies and morphological characters

June 2015
Phytotaxa

DOI:10.11646/phytotaxa.212.1.2

Authors:

Pedro Jiménez-Mejías

Universidad Pablo de Olavide

Pablo Vargas

Spanish National Research Council

The family Apiaceae is in the process of major systematic rearrangements at different taxonomic levels. In particular, molecular phylogenies of the tribe Apieae are generating heterogeneous assemblages of morphologically diverse taxa. We analysed a nearly complete taxonomic sample to evaluate the phylogenetic relationships within this tribe, and to review the most informative taxonomic characters of the fruit. Nuclear (ITS) and plastid (rps16) sequences allowed inferring phylogenetic relationships of species and genera of Apieae. Fruit morphology was studied with stereomicroscope, including overall observations and anatomical cross-sections. Both phylogenetic reconstructions were incongruent. Based on the ITS phylogeny, Apieae is arranged in two main clades, one containing most species of Stoibrax and the other clade formed by the rest of species of the tribe grouped into three well-supported subclades. The rps16 phylogeny shows the Anethum alliance to be basal, recovered in a weakly supported clade sister to the rest of the tribe, and a clade subdivided in six well-supported subclades. Nevertheless, three genera are revealed to be non-monophyletic in both phylogenetic reconstructions: Anethum, Seseli and Stoibrax. In the interest of the recognition of natural groups within Apieae, we proposed to create three new genera to accommodate the species that split from the three polyphyletic genera: Canaria for Seseli webbii, Modesciadium for Stoibrax involucratum, and Schoenoselinum for Anethum foeniculoides.

Majority rule consensus tree obtained from the Bayesian analysis of the rps16 matrix with coded indels. Bayesian posterior probabilities are given in regular typeface next to the respective branches when greater than 0.9; bootstrap values from the corresponding maximum parsimony consensus tree are given in italics when greater than 75%. Well supported major clades and subclades are named according Results. The white arrows at right point the placement of the different accessions of Stoibrax . The black arrows point the placement of the different accessions of Seseli .

…

. Reconstruction of the eight selected morphological characters on the majority consensus tree obtained from the Bayesian analysis of the ITS matrix. Only clades belonging to tribe Apieae, and one terminal per species are displayed. A. Life form; B. Leaf blade shape; C. Presence and persistence of bracts; D. Presence and persistence of bracteoles; E. Flower colour; F. Mericarp indumentum; G. Mericarps dorsal ribs morphology; H. Mericarps marginal ribs morphology. Legend for G is as follow: a, ribs keeled; b, ribs narrowly winged; c, ribs not prominent but visible as lines; d, ribs inconspicuous. At the right, accepted taxa names are showed in regular italics.

…

Figures - uploaded by Pedro Jiménez-Mejías

Content may be subject to copyright.

Content uploaded by Pedro Jiménez-Mejías

Content may be subject to copyright.

Phytotaxa 212 (1): 057–079

www.mapress.com/phytotaxa/

ISSN 1179-3155 (print edition)

ISSN 1179-3163 (online edition)

Accepted by Marcus Lehnert: 3 Oct. 2014; published: 2 Jun. 2015

http://dx.doi.org/10.11646/phytotaxa.212.1.2

Taxonomy of the tribe Apieae (Apiaceae) revisited as revealed by molecular

phylogenies and morphological characters

PEDRO JIMÉNEZ-MEJÍAS1,2 & PABLO VARGAS1

1 Real Jardín Botánico de Madrid, Plaza de Murillo s.n., 28014 Madrid, Spain

2 Author for correspondence: pjimmej@gmail.com

Abstract

The family Apiaceae is in the process of major systematic rearrangements at different taxonomic levels. In particular, mo-

lecular phylogenies of the tribe Apieae are generating heterogeneous assemblages of morphologically diverse taxa. We anal-

ysed a nearly complete taxonomic sample to evaluate the phylogenetic relationships within this tribe, and to review the most

informative taxonomic characters of the fruit. Nuclear (ITS) and plastid (rps16) sequences allowed inferring phylogenetic

relationships of species and genera of Apieae. Fruit morphology was studied with stereomicroscope, including overall ob-

servations and anatomical cross-sections. Both phylogenetic reconstructions were incongruent. Based on the ITS phylogeny,

Apieae is arranged in two main clades, one containing most species of Stoibrax and the other clade formed by the rest of spe-

cies of the tribe grouped into three well-supported subclades. The rps16 phylogeny shows the Anethum alliance to be basal,

recovered in a weakly supported clade sister to the rest of the tribe, and a clade subdivided in six well-supported subclades.

Nevertheless, three genera are revealed to be non-monophyletic in both phylogenetic reconstructions: Anethum, Seseli and

Stoibrax. In the interest of the recognition of natural groups within Apieae, we proposed to create three new genera to ac-

commodate the species that split from the three polyphyletic genera: Canaria for Seseli webbii, Modesciadium for Stoibrax

involucratum, and Schoenoselinum for Anethum foeniculoides.

Key words: Carpology, polyphyly, taxonomy, Umbelliferae

Introduction

The family Apiaceae (446 genera, 3540 spp; Mabberley 1997) is undergoing one of the major taxonomic re-arrangements

within the angiosperms. The current systematic knowledge of Apiaceae has changed in the light of recent molecular

phylogenies. Whereas some authors considered two major subfamilies, Saniculoideae (ca. 250 spp.; Mathias 1965) and

Apioideae (2827–2935 spp; Downie et al. 2010) plus the much smaller Azorelloideae and Mackinlayoideae (Nicolas &

Plunkett 2009), other authors circumscribed Saniculoideae as a tribe (Saniculeae) within Apioideae (Magee et al. 2010a).

Conciliation of taxonomy and molecular phylogenetics provides a more natural classification of the family, although

it implies changes that are taxonomically unexpected from a morphological point of view. Previous studies showed

the former subfamily Hydrocotyloideae to be polyphyletic (Nicolas & Plunkett 2009). The type genus (Hydrocotyle

L.) and allied genera were transferred to the family Araliaceae, whereas the remaining members (36 genera) were kept

in Apiaceae in a polyphyletic fashion. At least 18 genera of the subfamily Apioideae have been identified as “highly

polyphyletic” (Downie et al. 2010), some of them being artificial assemblages distributed worldwide, such as Angelica

L., Ligusticum L., Pimpinella L., Seseli L. or the so-called “Peucedanum problem” (Winter et al. 2008). The tribal

re-arrangement of the Apiaceae based on molecular phylogenies resulted in the circumscription of morphologically

heterogeneous genera (Downie et al. 2010), in some cases still without nomenclatural recognition. Subsequently,

previously evaluated morphological and anatomical data need to be re-appraised in the light of solid phylogenetic

relationships.

In particular, morphological polymorphisms within genera, together with extreme reduction of key taxonomic

characters and convergence of characters between distantly related groups, appear to account for misleading

classification of some Apiaceae groups. Within Apioideae, the comprehensive analysis performed by Downie et al.

(2010), which comprises more than half of the genera presently included in the subfamily (292 of 404), provided a

systematic scheme at the tribe and genus levels. These authors reported that tribe Apieae is composed of 12 genera,

most of them monotypic, plus Seseli webbii (see Table 1 for authors of the studied species). Although small, Apiae is a

JIMÉNEZ-MEJÍAS & VARGAS

complex tribe, displaying the complex variation detected in the other tribes within the family. The tribe includes plants

from annual to shrubby habit and from sub-aquatic to arid habitats; aromatic or not; with flat to linear, sometimes

promptly deciduous leaves; simple or composed inflorescences (umbellae) with or without bracts and bracteoles;

white, yellowish or greenish flowers; sometimes with calyx-like appendages; and with fruits smooth, finely tuberculate

or hairy, mostly with apparent ribs, and in a few cases even winged. Anatomical traits of the fruit have great taxonomic

interest in Apiaceae, although it has not been examined in detail within the current concept of the tribe Apieae as

a whole. Given the significant morphological variation, finding characters to define well-supported clades would

contribute to support a stable classification of the tribe.

From a biogeographic standpoint, the tribe Apieae displays a mainly Mediterranean distribution, spreading eastward

to the Arabian Peninsula, with a main diversity centre in the western Mediterranean. From the 12 genera, eleven occur

in the Iberian Peninsula, Balearic Islands, northwestern Africa and Macaronesia. Moreover, Naufraga Constance &

Cannon, Petroselinum Hill, Pseudoridolfia Reduron, Mathez & S.R.Downie, Sclerosciadium W.D.J.Koch ex DC.,

Seseli webbii Coss. and Stoibrax Raf. are entirely endemic to some of those areas. In addition, Ammi L., Anethum L.

and Deverra DC. have endemic species in northern Africa and Macaronesia, and two taxa of Deverra are known from

arid areas of southern Africa (Podlech 1986). Billburttia, endemic to Madagascar, is the only genus absent from the

Mediterranean basin. Apium has the widest distribution across the world: Europe (1 sp.), South America (6–7 spp.),

South Africa (1 sp.) and Australasia (4 spp.) (Spalik et al. 2010).

In this paper, we used an extended sampling of the species of the tribe (see Downie et al. 2010) to contribute to the

phylogenetic hypothesis of the group. Our main goal was to revisit the systematics of the tribe based on phylogenetic

and morphological results. In particular, we addressed the following objectives: (1) to test monophyletic groups using

nuclear and plastid sequences; (2) to describe anatomical key characters of the fruit; and (3) to propose a new generic

circumscription in the interest of a more natural taxonomy of tribe Apieae.

Materials and Methods

Molecular study

A total of 84 samples of 38 species (39 of these samples taken from GenBank; Table 1) from the tribe Apieae plus 14

species from other Apiaceae tribes (11 from GenBank) were included in the molecular study. This sample constitutes

an almost complete taxonomic coverage of the entire tribe Apiae at species level, and only five accepted species are

missing: Ammi procerum Lowe, Anethum theurkauffii Maire (taxa only known from the type collections; but see Table

3 for considerations about Ammi procerum), Apium larranagum M.Hiroe (a poorly known South American species),

and the North African Deverra reboudii Coss & Durieu and Stoibrax hanotei (Braun.-Blanq. & Maire) B.L. Burtt. All

the newly included plant materials were confirmed following specialized taxonomic literature (Maire 1926; Braun-

Blanquet and Maire 1931; Maire 1936; Short 1979; Podlech 1986; Nieto Feliner et al. 2003; El Alaoui Faris & Ibn

Tattou 2007).

Total DNA was extracted from herbarium specimens (M, MA, MADM, MEL, MPU, MSB, RNG, and UPOS) and

silica dried-materials using DNeasy plant mini kit (Qiagen, California). Total DNA extractions from Azorean Ammi

and most Southern Hemisphere Apium taxa were provided by S.R. Downie and H. Schaefer from materials already

included in previous studies (Spalik et al. 2010; Schaefer et al. 2011; respectively). We amplified and sequenced the

nuclear ribosomal ITS region and the plastid rps16, regions previously used to address phylogenetic relationships

in Apiaceae (Kadereit et al. 2008; Magee et al. 2009a; Downie et al. 2010; Spalik et al. 2010; among others). For

sequencing the ITS region we used primers and procedures given in Vargas et al. (2004). The primers described

in Oxelman et al. (1997) for rps16 intron were used for a pilot study for amplification and sequencing. From the

results, we designed two new primers: rps16ApiF (5’–GTGCGACTTGAAGGACACGA) and rps16ApiR (5’–

ACTTTGATTCTTTATCGGATC), which were successfully used to amplify and sequence the rps16 intron in nearly

all samples. The PCR conditions were: 5 min pre-treatment at 94ºC; 35 cycles of 1 min at 94ºC, 1 min at 58ºC, and 1.5

min at 72ºC; and a final amplification cycle of 8 min at 72ºC. Products were sequenced using the Macrogen Europe

sequencing service (Amsterdam, The Netherlands).

Sequences were automatically aligned in Geneious ver. 5.1. using the MAFFT algorithm and manually corrected.

Informative indels were coded following simple Coding (Simons and Ochoterena 2000) for both the ITS and rps16

intron matrices, as implemented in SeqState (Müller 2005). Prior to the indel coding, ambiguous poli-T and poli-A

regions were removed from the matrix.

TABLE 1. Material included in the DNA and carpological studies, including voucher information followed by herbarium

acronym according to Index Herbariorum (if applicable), source (when available) and Genbank accession number between

brackets (ITS and rps16, in the given order; missing sequences are represented by an underdash). “Y” indicates materials

used for fruit morphology and anatomy.

Species /

individual

Voucher Source ITS rps16 Fruit

morphology

and anatomy

TRIBE APIEAE

Ammi majus L.

1P. Jiménez-Mejías 54PJM06, UPOS Spain, Seville KJ473864 KJ473901 -

2J.G. Quinn 344, MADM Madeira KJ473863 KJ473902 -

3A. Hansen 70, MADM Madeira KJ473862 - Y

4G.M. Plunkett 1309, WS California, Solano County GQ148786 - -

5J. Lahham & A. El-Oqlah s.n. Jordan GQ148787 - -

6SBB–1158 India JQ230973 - -

Ammi seubertianum (H.C.Watson) Trel.

1H. Schaefer 2008–668, BM Azores, Santa María HQ202136 - -

2H. Schaefer 2008–629, BM Azores, São Miguel KJ486461 KJ473903 -

3E. Sjogren 6686, MO Azores, Flores GQ148788 - -

Ammi trifoliatum (H.C.Watson) Trel.

1H. Schaefer 2011–1021 Azores, Flores KJ486462 KJ473904 -

2G. Belo Maciel et al. AT–TERC–1, AZB, BM Azores, Terceira HQ202142 - -

Anethum foeniculoides Maire & Wilczek

1F. Schuhwerk 90/297, M Morocco, Tarfaya KJ473869 KJ473905 -

2D. Podlech 48741, MSB Morocco, Tarfaya KJ473870 KJ473906 Y

Anethum graveolens L.

1um14 Not available AY548225 - -

2E.A. Leadlay & B. Petty 89, MO Spain, Valencia GQ148794 AF110542 -

3C.A. Danderson s.n., ILL Cultivated GQ148795 - -

4P. M. Uribe-Echevarría sn, MA Spain, Álava - - Y

Apium annuum P.S. Short

N. G: Walsh 5239, MEL Australia, Victoria KJ473892 KJ473907 Y

Apium australe Thouars

1Prance 28611 14–XII–1983, NY Chile, Isla Hornos GQ379279 KJ473936 -

2Goodall 344, NY Argentina, Tierra del Fuego GQ379280 KJ473937 -

3Biese 1652, NY Chile, Ibgallares GQ379282 - -

Apium chilense Hook. & Arn.

1Zöllner 1346, MO Chile, Valparaíso GQ379284 -

2Zöllner 14983, MO Chile, Coquimbo GQ379283 -

Apium commersonii DC.

Prina 1672, ILL Argentina, Mendoza GQ379285 KJ473938 -

Apium decumbens Eckl. & Zeyh.

1Boucher 1831, PRE South Africa, SW Cape GQ379296 KJ473911 -

2Jordaan 1023, PRE South Africa, Transkei GQ379297 - -

Apium fernandezianum Johow

Hildenbrand (C.B.M. 01059A) Chile, Juan Fernández (cultivated) GQ379286 -

Apium filiforme (A.Rich.) Hook.f.

1Allan s.n. New Zealand, Wellington

(cultivated)

GQ379299 -

2Astridge 4192, CHR New Zealand, N Auckland GQ379300 -

......continue on next page

JIMÉNEZ-MEJÍAS & VARGAS

TABLE 1 (Continued)

Species /

individual

Voucher Source ITS rps16 Fruit

morphology

and anatomy

Apium graveolens L.

1A. García-Nogales et al. 548AGN09, UPOS Spain, Seville KJ473893 KJ473908 -

2 Downie 453, ILL Cultivated GQ148789 - -

3Downie sn Cultivated GQ379287 - -

4Rivas Goday et al.sn, MA Spain, Madrid, Valdemoro - - Y

Apium insulare P.S.Short

Ross 3450, E Australia, Victoria GQ379289 KJ473909 -

Apium panul Reiche

1Eyerdam 10326, NY Chile, Malleco GQ379292 KJ473910 -

2Chandler & Bayer s.n., NY Argentina, Mendoza GQ379293 - -

Apium prostratum Labill.

1Bartlett s.n., CHR New Zealand, Auckland GQ379298 - -

2Rixon et al. ENZAT No. 58 New Zealand, Auckland GQ148790 -

Apium sellowianum H.Wolff

Schinini & Ahumada 15957 Argentina, Corrientes GQ379301 KJ473939 -

Billburttia capensoides Sales & Hedge

1Du Puy et al. M660, P Madagascar FM986437 FM986441 -

2Keraudren 119, P Madagascar FM986438 FM986442 -

3Razafindrabe 193, P Madagascar FM986439 - -

Billburttia vaginoides Sales & Hedge

Bojer s.n., P Madagascar FM986440 - -

Deverra aphylla DC.

1S. Castroviejo 14915SC, MA South Africa, Cape KJ473871 KJ473912 Y

2Vlok 2270, JRAU South Africa, Beaufort West, AM408888 AY838419 -

Deverra battandieri (Maire) Chrtek.

1D. Podlech 33632, MSB Algeria, Wilaya Bechar KJ473878 KJ473940 -

2D. Podlech 33763, MSB Algeria, Wilaya Bechar KJ473876 KJ473913 -

3Iter Maroccanum 10084, RNG Morocco, Haut-Guir KJ473877 KJ473941 -

Deverra burchellii Eckl. & Zeyh.

B-E van Wyk & P M Tilney 4114, JRAU South Africa, Polokwane AM408887 AY838418 -

Deverra denudata (Viv.) R. Pfisterer & Podlech

1M.A. Mateos & S. Silvestre sn, MA Morocco, Guercif KJ473886 KJ473942 Y

2Ait Lafkih & al. 4928, E Morocco EU169255 - -

Deverra intermedia Chevall.

1S.L. Jury & al. 9231, MA Morocco, Errachidia KJ473874 KJ473943 Y

2D. Podlech 35584, MSB Algeria, Wilaya Ouargla KJ473875 KJ473914 -

Deverra juncea Ball

D. Podlech 47666, MA Morocco, Beni-Mellal KJ473885 KJ473915 -

Deverra scoparia Coss. & Durieu subsp. scoparia

1A. Herrero & al. AH393, MA Tunisia, Jerid KJ473887 KJ473944 -

2Davis & Lamond D57330, E Tunisia EU169256 - -

Deverra tortuosa DC.

1 C. Aedo & al. CA16206 Tunisia, Gabès KJ473888 KJ473918 -

2 Collenette 5761, E Saudi Arabia EU169257 - -

Deverra tritadiata subsp. musilii (Chrtek, Osbron. & Šourková) R.Pfisterer & Podlech

1A. Rawi & H. El Kholy s.n., RNG Kuwait KJ473872 KJ473916 -

......continue on next page

TABLE 1 (Continued)

Species /

individual

Voucher Source ITS rps16 Fruit

morphology

and anatomy

2Collenette 6568, E Saudi Arabia AF073561 AF164815 -

Deverra triradiata (Chevall.) R.Pfisterer & Podlech subsp. triradiata

D. Al-Eisawi 2075, RNG Jordan, Petra KJ473873 KJ473917 -

Foeniculum vulgare Mill.

1A. Silvestre-Alsina et al. 38ASA10, UPOS Spain, Seville KJ473896 KJ473919 -

2 T. Buira & J. Calvo s.n., MA Morocco, Guelmim KJ473897 KJ473920 Y

3S. Downie 157, ILL Jordan, Irbid GQ148792 - -

4RF–178 Cultivated HQ377215 - -

5S. Downie 117, ILL Cultivated GQ148791 - -

6A. Aparicio & J. G. Rowe, MA Spain, Cádiz; - - Y

Naufraga balearica Constance & Cannon

1P. Vargas 81PV11, MA Balearic Islands, Majorca KJ473894 KJ473945 Y

2McBeath 2760, E Balearic Islands, Majorca

(cultivated)

AF073563 - -

Petroselinum crispum (Mill.) Fuss.

1S.L. Jury et al. 11912, RNG Morocco, Tazzeka KJ473879 KJ473921 -

2S.L. Jury et al. 17527, RNG Morocco, El-Ksiba KJ473880 KJ473922 -

3S.L. Jury et al. 17913, RNG Morocco, Azrou KJ473881 KJ473923 -

4D. Podlech 47947, MSB Morocco, Marrakech KJ473882 KJ473946 -

5S. Downie 34, ILL Cultivated GQ148798 -

6S. L. Jury et al. 11572, RNG Morocco, betweem Ketama and Fes - - Y

7E. San Miguel ESM278, MA Spain, Asturias - - Y

Pseudoridolfia fennanei J.-P. Reduron, J. Mathez & S.R. Downie

J. Mathez 6979ter (MPU, paratype) Morocco, Plateau Central

(cultivated)

KJ473884 KJ473924 Y

Ridolfia segetum (L.) Moris

1C. Morales et al. s.n. (MA) Spain, Granada KJ473895 KJ473925 -

2J.-P. Reduron 01047 Cultivated GQ148796 - -

3A. Quintanar 897, MA Italy, Sardinia - - Y

Sclerosciadium nodiflorum Coss.

1T. Buira & J. Calvo s.n., MA Morocco, Agadir KJ473865 KJ473926 Y

2Lewalle 11357 19–IV–1986, MO Morocco GQ379303 -

Seseli webbii Coss.

1A. Charpin & M.C. León s.n., MA Canary Islands, Tenerife KJ473866 KJ473927 -

2C. Pardo s.n., MA Canary Islands, Gran Canaria KJ473867 KJ473928 -

3E. Bourgeau 22.Jun.1855, MA Canary Islands, Tenerife - - Y

Stoibrax dichotomum (L.) Raf.

1M. Luceño 1500ML, UPOS Spain, Seville KJ473890 KJ473932 -

2Sanchez Mata & Molina Abril 17, MO Spain, Madrid, Aranjuez DQ516366 - -

3Sanchez-Mata & Molina Abril s.n, K Spain, Madrid, Aranjuez FM201531 AM982519 -

4J. Cantero et al. 13853JC, MA Spain, Madrid, Aranjuez - - Y

Stoibrax involucratum (Maire) B. L. Burtt

1E. Rico & al. MS1136, MA Morocco, Temsaman KJ473868 KJ473929 -

2D. Podlech 47751, MSB Morocco, Marrakech KJ473883 KJ473930 -

3J. Calvo & al. sn, MA Morocco, Agadir - - Y

......continue on next page

JIMÉNEZ-MEJÍAS & VARGAS

TABLE 1 (Continued)

Species /

individual

Voucher Source ITS rps16 Fruit

morphology

and anatomy

4D. Podlech 47218, MSB Morocco, Meknes - - Y

5D. Podlech 47679, MSB Morocco, Middle Atlas - - Y

Stoibrax pomelianum (Maire) B. L. Burtt

1S. Andrés et al. 21.Jun.2008, MA Morocco, Jerada KJ473891 KJ473931 Y

2Reading Univ. B.M. Exped. 906, RNG Morocco, Midelt KJ473889 KJ473947 -

OUTGROUP

Ammoides pusilla (Brot.) Breistr.

E. Rico et al MS1136, MA Morocco, Temsaman / Tafersite KJ473898 KJ473933 -

Angelica archangelica L.

DL Erickson NMNH 06–8344 Not available EF590754 - -

Downie 79, ILL Cultivated - AF110536 -

Conium maculatum L.

Not available Not available EF437224 - -

Oenanthe fistulosa L.

WA 075167 Poland, Nowe Warpno DQ005664 - -

Lee & Downie 165 Cultivated - DQ168948 -

Pimpinella saxifraga L.

ESSE 13924 Turkey, Kars AY581801 - -

Seseli hippomarathrum Jacq.

Not available Cultivated AY179033 - -

Seseli mairei H.Wolff

KUN:J045 China, Yunnan FJ385061 FJ385245 -

Seseli squarrulosum R.H.Shan & M.L.Sheh

Wang.Q.Z. & Pu F.D. 361539 Not available EU001350 EU220961 -

Seseli montanum L.

Downie 239, ILL Cultivated AH003552

(ITS1)

U30579

(ITS2)

- -

Seseli tortuosum L.

Hildenbrand et al. s.n., ILL Portugal, Lisboa, Sintra AY179031 EF185265 -

Sison segetum L.

P. Goetghebeur 2221, MA Belgium, Flandres KJ473899 KJ473934 -

Torilis arvensis Link

Bulgaria FJ415110 - -

USA, Illinois - AF110548 -

Torilis japonica DC.

Not available AY548223 - -

Cultivated - AF123741 -

Visnaga daucoides Gaertn

J. Solís & S. Martín-Bravo 151JESOGA, UPOS Spain, Seville KJ473900 KJ473935 -

Maximum parsimony (MP) and Bayesian inference (BI) analyses were performed on the datasets. MP analyses

were carried out in Paup 4.0b10 (Swofford 2002) using PaupUp graphical interface (Calendini & Martin 2005).

Heuristic searches were performed with tree-bisection-reconnection branch swapping algorithm, retaining a maximum

of 10,000 trees. Branch support was estimated by full-heuristic bootstrapping with bootstrap analysis with 1000

replicates. For BI, the simplest model sequence evolution was determined separately for each matrix under Akaike

Information Criterion (AIC) as implemented in jModeltest (Posada 2008). The Bayesian analysis was performed with

the selected models using MrBayes 3.2 (Ronquist & Huelsenbeck 2012). Four Markov Chain Monte Carlo runs were

performed simultaneously in each Bayesian analysis for 5,000,000 generations, with an interval of 100 generations. To

ensure a likelihood stationary phase, the 25% of the generated trees from the beginning of each chain were discarded,

and log-likelihood scores checked with Tracer 1.5 (Rambaut & Drummond 2009).

Fruit morphology and anatomy

A total of 22 samples of fruits from herbarium specimens of 18 species from all the genera of the tribe Apieae (except

Billburttia) were included in the carpological study (Table 1). Nevertheless, the characterization of the fruit of Billburttia

has already been accurately performed and photographed by Magee et al. (2009b). In most cases, we could not study the

same DNA and fruits specimens given the fact that most umbellifers from Mediterranean and arid/semiarid climates do

not bear green leaves and ripe fruits at the same time. General fruit morphology was studied using a stereomicroscope.

For the anatomic study the materials were rehydrated in distilled water and then fixed in ethanol. The samples were

included in Spurr’s resin for 13 h, and polymerized at 70ºC during 7 h. Transversal sections at midpoint, each 1–3 μm

thick, were cut and stained with toluidine blue. Resin inclusion and cut processes were performed at the microscopy

service of the CITIUS (Universidad de Sevilla, Spain).

Previous carpological work in Apieae members were taken into account to provide an important source of

complementary information and to contrast our own results (Short 1979; Arenas Posada & García Martín 1993; Magee

et al. 2009b; Reduron et al. 2009; Ronse et al. 2010). We followed the standardised terminology for taxonomically key

morphological characters proposed in Kljuvkov et al. (2004).

Morphological character evolution

Morphological characters were reconstructed on the BI consensus tree from the ITS tree using maximum parsimony

with Mesquite 2.75 (Maddison & Maddison, 2011). We chose the ITS tree because it is better resolved than the rps16

tree. Eight key characters were chosen for the taxonomy of the tribe Apieae, two vegetative (life form and morphology

of leaf blade), and six reproductive (presence of bracts, presence of bracteoles, flower colour, mericarp indumentum,

morphology of dorsal ribs, and morphology of marginal ribs). Character scores for each taxon were based on our own

observations on herbarium specimens, including types from Global Plants (JSTOR, 2014), and from literature (Maire

1926; Braun-Blanquet & Maire 1931; Maire 1936; Tutin 1968; Short 1979; Podlech 1986; Nieto Feliner et al. 2003;

El Alaoui Faris & Ibn Tattou 2007; Magee et al 2009b), and photographs provided by the webpage of the Viña del Mar

Botanical Garden, Chile (http://www.flickr.com/photos/fjbn/).

Rresults

Phylogenetic analyses

Length of ITS sequences of the tribe Apieae was 596 to 602 bp; length of rps16 sequences was 848 to 881 bp. The

complete ITS matrix had a total length of 638 characters, of which 338 were variable and 274 parsimony informative,

plus 62 coded indels. The complete rps16 matrix had a total length of 1080 characters, of which 384 were variable and

56 parsimony informative, plus 100 coded indels.

Phylogenetic MP analysis of the ITS matrix reached the maximum limit of 10,000 trees of 1032 steps (CI=0.58;

RI=0.87; RC=0.50; tree not shown). Phylogenetic MP analysis of the rps16 matrix also reached the maximum of

10,000 trees of 653 steps (CI=0.64; RI=0.62; RC=0.40; tree not shown). The simplest model selected by jModeltest

for ITS and rps16 matrices was GRT+G in both cases. The tribe Apieae was strongly supported as monophyletic in all

the analysis based on the ITS matrix (≥0.99 pp, ≥99 bs), but not in those of the rps16 matrix, from which it was well

supported only in the Bayesian analysis (0.99 pp). Our results mostly agreed with previous reconstructions (Magee

et al. 2009a,b; Reduron et al. 2009; Spalik et al. 2010). The genera Ammi, Apium and Billburtia are shown to be

monophyletic. The genus Deverra was monophyletic in the ITS tree, but non-monophyletic (polytomy) in the rps16

tree. Failure in obtaining monophyletic groups was found for the species of three genera (Anethum, Seseli and Stoibrax)

in the two analyses using both matrices. Sison segetum and Visnaga daucoides, previously classified as Petroselinum

segetum and Ammi visnaga (e.g. Tutin 1968; Nieto Feliner et al. 2003) were displayed not closely related to the type

species of Ammi and Petroselinum respectively, supporting previous results (Downie et al. 2010).

JIMÉNEZ-MEJÍAS & VARGAS

FIGURE 1. Majority rule consensus tree obtained from the Bayesian analysis of ITS matrix with coded indels. Bayesian posterior

probabilities are given in regular typeface next to the respective branches; bootstrap values from the corresponding maximum parsimony

consensus tree are given in italics when greater than 75%. Well supported major clades and subclades are named according to Results.

The white arrows at right point the placement of the different accessions of Stoibrax. The black arrows point the placement of the different

accessions of Seseli.

The entire tribe was arranged in two main well-supported clades in the ITS analysis (Fig. 1), being Stoibrax s.s.

(clade A; 1 pp, 100 bs) sister to the rest of the tribe (clade B; 1 pp, 97 bs). Clade A includes the Ibero-North African

Stoibrax dichotomum and the North African S. pomelianum. Clade B was subdivided in three well-supported subclades:

the “Anethum alliance” (subclade B1; 1 pp, 90 bs); Apium clade (subclade B2; 1 pp, 100 bs), and a heterogeneous

subclade B3 (1 pp, 95 bs). Subclade B1 contained the Anethum alliance, where the two representatives of Anethum

are not monophyletic and grouped together with species of Pseudorifoldia, Foeniculum and Ridolfia. Subclade B2

consisted of Naufraga balearica, sister to the genus Apium, which was shown to be monophyletic in its current

circumscription (Ronse et al. 2010). Subclade B3 was mainly formed by African taxa, with a lineage containing the

genus Deverra (1 pp, 96 bs), one more lineage with the genus Billburtia (1 pp, 100 bs), and a third highly hierarchized

lineage (1 pp, 99 bs). This latter lineage included the genera Ammi, Petroselinum and Sclerosciadium together with the

species Stoibrax involucratum and Seseli webbii. Ammi majus is sister to the Azorean endemics A. seubertianum and

A. trifoliatum (0.94 pp), whereas Petroselinum crispum is sister to Stoibrax involucratum (1 pp, 97 bs).

The analysis of the rps16 matrix (Fig. 2) revealed members of the “Anethum alliance” unresolved and basal,

whereas the rest of the tribe was recovered monophyletic in a single clade (clade a; 0.98 pp, no bootstrap support).

Within this clade, six well-supported subclades were found: Stoibrax s.s. (subclade b; 1 pp, 100 bs), Apium (displaying

Naufraga sister to Apium; subclade c; 1 pp, 98 bs), two subclades with different species of Deverra (subclades d

and e; 1 pp, no bootstrap support; and 1 pp, 99 bs, respectively), Billburttia clade (subclade f; 1 pp, 99 bs), and a

last heterogeneous lineage (subclade g; 1 pp, support) with Ammi, Petroselinum, Sclerosciadium, Seseli webbii and

Stoibrax involucratum).

Fruit morphology

The carpological features observed in the different taxa, together with those reported in the literature, are summarized

in Table 2. Photographs of external mericarps of representatives of all the Apieae genera (except for Billburttia)

are shown in Fig. 3, and their sections in Fig. 4. The fruits displayed a varied morphology, even within genera or at

low differentiation levels (sister taxa). Fruits always consisted of two symmetrical mericarps that tend to separate at

maturity, except in Naufraga (see below). The fruits vary considerably in size, Anethum and Foeniculum having the

biggest ones (up to 6(-9) mm; Figs. 3A,B, 4B,I), and Naufraga the smallest ones (0.7–1 mm, Figs. 3D, 4J) (see also

Tutin 1968; Arenas Posada & García Martín 1993; Nieto Feliner et al. 2003; El Alaoui Faris & Ibn Tattou 2007). The

morphology of the primary ribs (those that contain vascular bundles; see Fig. 4C) is also variable, inconspicuous in

Naufraga (Figs. 3D, 4J), not clearly prominent but visible in Pseudoridolfia, Ridolfia and Stoibrax involucratum (Figs.

3F,H,K, 4L,M,Q), and conspicuous and prominent in most of the Apieae species. No clear differences exist between

the median and the two lateral ribs in any of the species. Marginal ribs (those at the borders of the commissure; see

Fig. 4I) are mostly similar in size and form to the dorsal ones, being more prominent than these (narrowly winged)

in Foeniculum vulgare (Figs. 3A, 4I) and Anethum foeniculoides (Figs. 3B, 4B), and widely winged in Anethum

graveolens (Figs. 3C, 4C). In Sclerosciadium the ending of the primary and commissural ribs at the top form a sepal-

like appendage (Figs. 3N), whereas in the rest of the species the ribs are attenuated towards the stylopodium. In

a few taxa, the valleculae (i.e., the space between primary ribs) is convex and forms a low secondary rib, as in

Anethum graveolens, Deverra denudata, Petroselinum crispum, and Stoibrax s.l. (Figs. 4C,G,K,P,Q,R). Most genera

lack epidermic pubescence. Representatives of Deverra (Figs. 3O,P, 4F,G,H) display hairy fruits, and to some extent

also Stoibrax pomelianum (Fig. 4R), whereas those of Stoibrax dichomum, Stoibrax involucratum. (Figs. 3H,L, 4P,Q)

and Sclerosciadium nodiflorum (Figs. 3N, 4N) are finely tuberculate. Also, Seseli webbii has very low tubercles in the

valleculae (Fig. 4O). The epidermis was formed by small cells, flt to rnd in cross section. The extent of the commissure

is intermediate in most taxa, but it is narrow in Naufraga, Petroselinum, Seseli webbii, Sclerosciadium and Stoibrax s.l.

(Fig. 4J,K,N,O,P,Q,R). Placement of the vascular bundles in the primary ribs ranges between the base and the middle of

the rib. Vascular bundles were homomorphic or heteromorphic, from almost rnd to deltoid in cross section. The vittae

(oil ducts) were also monomorphic (except for Naufraga, see below). We observed the typical vittae arrangement of

a single main vitta in each vallecula and two commissural vittae (see Fig. 4B). This is mostly in agreement with the

observations of Arenas Posada & García Martín (1993) for Iberian Apiaceae. Apart from the morphology, number and

arrangement of the vittae are considered of taxonomic importance in Apiaceae (Ronse et al. 2010). However, they do

not appear to be key characters shared by all the taxa of tribe Apieae, as a higher number of main commissural vittae

has been reported as characteristic for Billburttia (5–6 commisural vittae; Magee et al. 2009b) and also for Apium

graveolens (2–3 vittae in each intercostal space; Arenas Posada & García Martín 1993). We observed accessorial vittae

in the Petroselinum crispum samples (cultivated and wild; Fig. 4K), a structure also observed in Apium graveolens and

JIMÉNEZ-MEJÍAS & VARGAS

demonstrated to be branches of the main oil ducts (Ronse et al. 2010). Endosperm varies from flat to forming a broad

shallow groove, being a bit deeper in Stoibrax s.s. taxa. No crystalline inclusions like those observed in Billburttia

(Magee et al. 2009b) were found among our samples. However, the presence of such crystals should not be excluded

completely because these inclusions may have been not visible due to our staining method.

FIGURE 2. Majority rule consensus tree obtained from the Bayesian analysis of the rps16 matrix with coded indels. Bayesian posterior

probabilities are given in regular typeface next to the respective branches when greater than 0.9; bootstrap values from the corresponding

maximum parsimony consensus tree are given in italics when greater than 75%. Well supported major clades and subclades are named

according Results. The white arrows at right point the placement of the different accessions of Stoibrax. The black arrows point the

placement of the different accessions of Seseli.

TABLE 2 Main characters of the fruit of the tribe Apieae chosen from our own observations and literature. Characteristics of epidermic cells, marginal ribs, vittae, and vascular bundles are described

based on the cross-sections (see Figs 3–4). Character descriptions follow the standardized terminology given by Kljuvkov et al. (2004), with the following abbreviations: acc-vtt (accessorial vittae),

cms (commissural), drs (dorsal), h-morph (heteromorphic), flt (flattened), glb (glabrous), hry (hairy), m-morph (monomorphic), rct (rectangular), rounded (rnd), subeq (subequal), tbc (tuberculated),

vb (vascular bundles), vlc (vallecula/vallecular), vtt (vittae)

Taxon External characters Cross-section characters

(and proposed name) Dorsal ribs1Valleculae2Marginal

ribs3

Commisure

extent

Section Epidermis Vittae4Vascular bundles5

Ammi majus Conspicuous,

keeled

Convex Conspicuous,

keeled

Medium Not

compressed,

subpentagonal

glb, rugulose, mostly flt

cells

vlc-vtt 1 per vlc; cms-vtt, 2; m-

morph, oblong to ± rnd; vlc-vtt

width ~ ½ vlc.

m-morph, ± rnd to oblong,

width slightly > than vtt

Anethum foeniculoides

(= Schoenoselinum

foeniculoides)

Conspicuous,

keeled

Flt to scarcely

convex

Narrowly

winged

Medium Slightly

compressed,

subtrapezoidal

glb, ± lignified, flt cells vlc-vtt 1 per vlc; cms-vtt 2; m-

morph, oblong; vlc-vtt width > ½

vlc width

h-morph, drs-vb rnd to oblong,

widht = vtt; cms-vb deltoid,

width > than vtt

Anethum graveolens Conspicuous,

keeled

Flt to convex

and forming

secondary ribs

Broadly

winged

Medium Slightly

compressed

glb, flt cells vlc-vtt 1 per vlc; cms-vtt 2; m-

morph, oblong; vlc-vtt width < ½

vlc

h-morph; drs-vb rnd, widht =

vtt; cms-vb oblong, placed ~ ½

of the wing

Apium anuum Conspicuous,

narrowly

winged

Flt to scarcely

convex

Narrowly

winged

Medium Not

compressed,

pentagonal

glb, mostly rct cells vlc-vtt 1 per vlc; cms-vtt 2; m-

morph, oblong; vlc-vtt width > ½

vlc

m-morph, oblong, width > vtt

Apium graveolens Conspicuous,

keeled

Flt to scarcely

convex

Conspicuous,

keeled

Medium Not

compressed,

pentagonal

glb, ± lignified, flt cells vlc-vtt 1 per vlc; cms-vtt 2;, rarely 3

vtt in each vlc and several cms-vtt6;

m-morph, oblong; vlc-vtt width ~ ½

vlc; sometimes acc-vtt present7

m-morph, subdeltoid, width

slightly > vtt

Apium insulare and A.

prostratum8

Conspicuous,

broadly keeled

Concave,

compressed

between the

adjacent ribs

Conspicuous,

broadly

keeled

Medium Not

compressed,

star-like

glb, prominently corky vlc-vtt 1 per vlc; cms-vtt 2; m-

morph, oblong; vlc-vtt width > vlc

m-morph, oblong, width > vtt

Billburttia capensoides

and B. vaginoides9

Conspicuous,

keeled

Flt to concave

valleculae

Narrowly

winged

Medium Slightly

compressed

glb, rugulose, lignified in

the ribs, rct cells; crystalline

inclusions observed

vlc-vtt 1–2 per vlc, 5–6 cms-vtt; m-

morph; vlc-vtt widht < vlc

m-morph, ~ rnd width ~ vtt,

located at the tips of the ribs

Deverra aphylla Conspicuous,

keeled

Flt to convex Conspicuous,

keeled

Medium Not

compressed,

pentagonal

Sparcely hry, lignified, rct to

rnd cells

vlc-vtt 1 per vlc; cms-vtt 2; m-

morph, oblong; vlc-vtt widht = ½

vlc

m-morph, ~ rnd, width = vtt

Deverra denudata Conspicuous,

keeled

Convex, forming

secondary ribs

Conspicuous,

keeled

Medium Not

compressed,

± rnd

hry, lignified, rct cells vlc-vtt 1 per vlc; cms-vtt 2; m-

morph, oblong; vlc-vtt = ½ vlc

Subeq, oblong, drs-vb width =

vtt, filling most the rib llumina,

cms-vb width > vtt

.......continued on the next page

JIMÉNEZ-MEJÍAS & VARGAS

TABLE 2. (Continued)

Taxon External characters Cross-section characters

Deverra intermedia Conspicuous, slightly

keeled

Flt to convex Conspicuous,

keeled

Medium Not compressed,

± rnd

Densely hry,

lignified rnd

cells

vlc-vtt 1 per vlc; cms-vtt 2; m-

morph, ± rnd; vlc-vtt width = vlc

m-morph, ± rnd, width = vtt

Foeniculum vulgare Conspicuous, keeled Flt to scarcely

convex

Conspicuous,

keeled

Medium Slightly compressed,

trapezoidal

glb, ± lignified,

rct cells

vlc-vtt 1 per vlc; cms-vtt 2; m-

morph, oblong; vlc-vtt widht < ½ vlc

h-morph, drs-vb ± rnd, width

slightly > vtt; cms-vtt oblong,

width > vtt

Naufraga balearica Inconspicuous,

obsolete

Mostly flt Conspicuous,

keeled,

assymetrical

Narrow Not compressed, ±

rnd, asymmetrical

glb, rugulose,,

flt cells

vlc-vtt 1, cms-vtt absent or 17;

h-morph; drs-vlc-vtt ± rnd, lateral

vlc-vtt flt

Subeq, reduced, one of the cms-

vb apparently lost

Petroselinum

crispum

Conspicuous, keeled Convex Conspicuous,

keeled

Narrow Not compressed, ±

rnd to pentagonal

glb, rct cells vlc-vtt 1 per vlc; cms-vtt 2; m-

morph, oblong; vlc-vtt width = or >

½ vlc; acc-vtt observed

m-morph, oblong to subdeltoid,

width = or slightly > vtt

Pseudoridolfia

fennanei

Inconspicuous, not

keeled but visible as

lines

Flt to scarcely

convex

Obsolete, scarcely

developed

Medium Not compressed,

± rnd

glb, formed by

flt cells

vlc-vtt 1 per vlc; cms-vtt 2; m-

morph, oblong; vlc-vtt width < ½ vlc

m-morph, ,± rnd, width = vtt

Ridolfia segetum Inconspicuous, not

keeled but visible as

lines

Inconspicuous Obsolete, scarcely

developed

Medium Not compressed,

± rnd

glb, lignified,

formed by flt

cells

vlc-vtt 1 per vlc; cms-vtt 2; m-

morph, rnd; vlc-vtt width < ½ vlc

h-morph, ± rnd to oblong, drs-

vb width = vtt, cms-vb > vtt

Sclerosciadium

nodiflorum

Narrowly winged,

ending in a sepal-like

appendage, at the top

Flt Narrowly winged Narrow Not compressed,

star-like

Sparsely tbc on

vlc, lignified,

mostly flt cells

vlc-vtt 1 per vlc; cms-vtt 2; m-

morph, oblong to ± concave; vlc-vtt

width ~ ½ vlc

m-morph, subdeltoid, width >

vtt, filling most the rib llumina

Seseli webbii

(= Canaria tortuosa)

Narrowly winged Flt Narrowly winged Narrow Not compressed,

star-like

Very finely tbc,

lignified, formed

by fattened cells

vlc-vtt 1 per vlc; cms-vtt 2; m-

morph, oblong; vlc-vtt width > or

= vlc

Subeq, deltoid, width > vtt,

filling most the rib llumina; drs-

vb width < cms-vb

Stoibrax

dichotomum

Conspicuous, keeled Convex, forming

secondary ribs

Conspicuous,

keeled

Narrow Not compressed, ±

rnd to subpentagonal

tbc, mostly flt

cells

vlc-vtt 1 per vlc; cms-vtt 2; m-

morph, oblong; vlc-vtt width < ½ vlc

m-morph, ± rnd, width < or = vtt

Stoibrax

involucratum

(= Modesciadium

involucratum)

Inconspicuous, not

keeled but visible as

lines

Flt Obsolete Narrow Not compressed,

subpentagonal

tbc, flt cells vlc-vtt 1 per vlc; cms-vtt 2; m-

morph, oblong; vlc-vtt width ~ ½ vlc

m-morph, ± rnd, width = vtt

Stoibrax

pomelianum

Conspicuous, keeled Convex, forming

secondary ribs

Conspicuous,

keeled

Narrow Not compressed,

± rnd

tbc, mostly rct

cells

vlc-vtt 1 per vlc; cms-vtt 2; m-

morph; oblong; vlc-vtt width ~ ½ vlc

m-morph, ± rnd, width < vtt

1Fig. 4C pr. 2Fig 4O v. 3Fig 4I mr. 4Fig 4B cv, vv. 5Fig 4F vb. 6Arenas Posadas & García Martín (1993) 7Ronse et al. (2010) 8Data taken from Short (1974) 9Data taken from Magee et al. (2009b)

FIGURE 3. Mericarps of species representing of all the genera of tribe Apieae (except Billburttia). Pictures represent the adaxial view

of a single mericap unless specified otherwise. A. Foeniculum vulgare. B. Anethum foeniculoides, C. Anethum graveolens. D. Naufraga

balearica (two mericarps on the pedicelle). E. Petroselinum crispum (lateral view). F. Ridolfia segetum. G. Ammi majus. H. Stoibrax

involucratum. I. Apium graveolens. J. Apium annuum. K. Pseudoridolfia fennanei. L. Stoibrax dichotomum. M. Seseli webbii. N.

Sclerosciadium nodiflorum. O. Deverra denudata. P. Deverra aphylla (two mericarps kept together).

JIMÉNEZ-MEJÍAS & VARGAS

FIGURE 4. Transverse section of the mericarps of species representing of all the genera of tribe Apieae except Billburttia. All the

photographs show mericarps in cross section except for Naufraga (J) which is a complete schizocarp. Scale bar = 1 mm. Lower cases

indicate in the different slides the main carpological features commented in this work: c, commissure; mr, marginal ribs; pr, primary

dorsal ribs; sr, secondary ribs; v, vallecula; cv, commissural vitta; vv, vallecular vitta; vb, vascular bundles. Dash lines in figures C and

O depicts the break of fruit layers due to manipulation. For voucher information see Table 1. Species are provided in alphabetical order.

A. Ammi majus. B. Anethum foeniculoides. C. Anethum graveolens, arrow depicts the vascular bundles within a broken winged marginal

rib. D. Apium anuum. E. Apium graveolens. F. Deverra aphylla. G. Deverra denudata. H. Deverra intermedia. I. Foeniculum vulgare (A.

Aparicio & J. G. Rowe s.n., MA). J. Naufraga balearica, arrow depicts commissural vascular bundles. K. Petroselinum crispum, arrow

depicts an accessorial vitta (E. San Miguel ESM278, MA). L. Pseudoridolfia fennanei (paratype J. Mathez 6979ter, MPU). M. Ridolfia

segetum. N. Sclerosciadium nodiflorum. O. Seseli webbii. P. Stoibrax dichotomum. Q. Stoibrax involucratum. R. Stoibrax pomelianum.

The interesting modified morphology of Naufraga balearica differs notably from all the other studied taxa, as it

has been previously noted (Ronse et al. 2010). The analysed mericarps were asymmetrical in cross section (Fig.4J),

and tend to keep together instead to separate when ripe. The commissural vittae seemed to be missing, in contrast to

a sample reported by Ronse et al. (2010). Perhaps these vittae are very short and are not retrieved in the midpoint

transverse section. The two vittae placed towards an abaxial position were almost rnd in cross section, whereas the

two lateral ones were flt. All the vascular bundles were extremely reduced, especially the commissural ones. No well

developed ribs were observed.

Morphological character evolution

Character reconstruction reveals that the key characters used in the taxonomy of Apieae have been very dynamic in

the course of evolution (Fig. 5). Although none of the morphological characters turned out to be synapomorphic, some

supported certain groupings. Apart from monotypic genera, the genera best supported by the selected characters were

Ammi (characterized by the eight characters), followed by Deverra and Stoibrax s.s. (seven characters) and Apium (6

characters). Remarkably, Deverra is quite heterogeneous in petal colour whereas Apium is so in the development of

the dorsal and commissural ribs.

These results indicate that not only molecular phylogenies are incongruent with taxonomy, but also that

morphological characters do not support genera in their current circumscription. The splitting of genera and creation

of new taxa somehow circumvent this conflict.

FIGURE 5. Reconstruction of the eight selected morphological characters on the majority consensus tree obtained from the Bayesian

analysis of the ITS matrix. Only clades belonging to tribe Apieae, and one terminal per species are displayed. A. Life form; B. Leaf blade

shape; C. Presence and persistence of bracts; D. Presence and persistence of bracteoles; E. Flower colour; F. Mericarp indumentum; G.

Mericarps dorsal ribs morphology; H. Mericarps marginal ribs morphology. Legend for G is as follow: a, ribs keeled; b, ribs narrowly

winged; c, ribs not prominent but visible as lines; d, ribs inconspicuous. At the right, accepted taxa names are showed in regular italics.

JIMÉNEZ-MEJÍAS & VARGAS

Discussion

A high degree of morphological variation has been found not only between genera but also between species of the

same genera. This led to the interpretation that morphological characters have been very labile during differentiation

of Apieae.

Fruit variability and taxonomy

The broad variability of fruit features observed in the tribe Apieae, together with the absence of unique characters for

some clades and the incongruence between phylogenies, make it difficult to describe synapomorphies supporting natural

groups. Despite other tribes or genera having been readily morphologically delimitated, the lack of morphological

synapomorphies is a common pattern in Apiaceae (Downie et al. 2001; Hardway et al. 2004). Two external characters,

marginal ribs and mericarp induments, broadly used in Apiaceae, turned out to be highly homoplastic. Only one

taxon, Anethum graveolens, displayed well developed fruit wings (Figs. 3C, 4C), whereas four monophyletic groups

displayed tubercles or hairs on the fruit surface (Deverra, Sclerosciadium-Seseli webbii clade, Stoibrax s.s., and Stoibrax

involucratum; (Figs. 3H,L,N–P, 4F–H,N,P–R, 5). As these ornamentation characters are mostly absent in most fruits

of Apieae, when present they have been given great importance and misled the taxonomy of the group. The clearest

example is the inclusion of Stoibrax involucratum in Stoibrax because of the the presence of epidermic tubercles. This

illustrates the intricate taxonomy of this tribe that has historically had a complex generic delimitation.

Phylogenetics and a taxonomic proposal for the tribe Apieae

Phylogenetic analysis also indicates taxonomic complexity. The nearly complete taxonomic coverage for the

phylogenetic reconstructions, together with the taxonomic characters revisited and the information provided by

previous studies, help to circumscribe Apieae genera and species. Although it has been early stated that ITS was not

an accurate marker for phylogenetic studies in Apiaceae (Downie et al. 1998; Katz-Downie et al. 1999), the results

are in accord with the current, extensive usage of this marker (Downie et al. 2010). Indeed, despite ITS reconstruction

display incongruences with rps16 reconstruction, the ITS tree disagree mainly with inter-generic relationships rather

than with the delimitation of genera, which help to evaluate generic circumscription. In any case, we only focused on

congruent results between nuclear and plastid sequences. Representatives of three genera of Apieae have been found

to be non-monophyletic in any of the phylogenetic reconstructions: Seseli (previously noted by Spalik et al. (2004) and

Reduron et al. (2009)), Anethum and Stoibrax. In addition, our morphological analysis (Figs. 3–5) reveals that some

fruit characters were externally similar, but a closer study displayed differences. The morphological characters chosen

here (Fig. 5) readily allowed distinction of the different genera as well as supported the split of those species from non-

monolyphyletic genera from their closest relatives, rather than including these in previously recognized genera.

In Apiaceae, it has been stated that both monotypic and very large genera should not be taxonomically considered

(Spalik et al. 2004). In most cases, failure to find synapomorphies for single species lineages is not helped by combining

them into larger genera. This is a historical problem. Indeed, the taxonomic trend in the tribe Apieae has been to consider

small or monotypic genera, and only Apium and Deverra have been considered well defined to morphologically

circumscribe some species. The three major disagreements between phylogenetic analysis and taxonomy are described

here.

Perhaps the most striking case is this found within the Anethum alliance (Figs. 1–2), which actually comprises

monotypic genera all previously treated under Anethum (except the recently described Pseudoridolfia fennanei).

Characters that readily define the Anethum alliance species as different from other Apieae are linear leaf segments

(although these are evanescent in A. foeniculoides), absence of bracts and bracteoles, yellowish flowers and fruits without

hairs or tubercles (Fig. 5; Tutin 1968; Nieto Feliner et al. 2003; El Alaoui Faris & Ibn Tattou 2007). The redefinition

of a broader morphologically conceived genus Anethum could be a reasonable solution if the observed carpological

character had not resulted to be so heterogeneous, and relationships among these genera were not unresolved in the

rps16 phylogeny. The morphologically distinct fruits of Anethum graveolens (Figs. 3C, 4C) together with the strong

differences in mericarp size and rib morphology of Ridolfia and Pseudoridolfia (Figs. 3F,G, 4L,M) when compared

with the Anethum foeniculoides and Foeniculum vulgare (Figs. 3A,B, 4B,I), do not lead to consider all these taxa under

a single genus. Given such situation we suggest splitting Anethum into two and placing A. foeniculoides in a different

genus. Future phylogenetic and taxonomic studies should include the rare taxon Anethum theurkauffii, only known

from the depauperate type specimen (Theurkauff 38, MPU).

Previous phylogenetic analyses indicated that Seseli webbii neither grouped together with other Seseli species nor

was part of the tribe Selineae (Spalik et al. 2004). However, S. webbii was never formally transferred to other genera

since its original description. Phylogenetic reconstructions show that Seseli webbii is closely related to Sclerosciadium

nodiflorum and Stoibrax dichotomum (Figs.1–2), from which it shows significant morphological differences (Fig 5).

Surprisingly, Stoibrax involucratum has been revealed to be unrelated to Stoibrax but related to Petroselinum crispum

(parsley) in the ITS reconstructions and to Sclerosciadium nodiflorum and Seseli webbii in the rps16 reconstruction.

Reduction of characters and the small size of Stoibrax species has probably led to a misinterpretation of this genus.

Indeed, the single South African representative of the genus, Stoibrax capense (Lam.) B.L. Burtt, was recently

transferred to the tribe Tordylieae (as Dasispermum capense (Lam.) Magee & B.-E. van Wyk; Magee et al. 2009a).

The case of S. involucratum seems to be similar within tribe Apieae, and with fruit features similar to those of Stoibrax

s.s. (Figs. 3H,L, 4P–R). However, the presence of umbel bracteoles, a character generally considered relevant in

Apiaceae taxonomy, appears to have been overlooked by most authors when treating this taxon within Stoibrax.

Stoibrax involucratum displays marked differences in reproductive characters from its true phylogenetic relatives

(Figs. 3–4), as well as differences in vegetative features (e.g. leaf shape; El Alaoui Faris & Ibn Tattou 2007) (Fig. 4).

This, together with its incongruent phylogenetic placement, prevented the circumscription of this species within any of

the already existing genera. Because of that, we propose the creation of a new monotypic genus, Modesciadium (see

below), to accommodate S. involucratum in the evolutionary and taxonomic context of tribe Apieae.

Some other taxonomic conclusions can be drawn. The consideration of many Deverra taxa at subspecies rank

by Podlech’s (1986) is discordant with their placement in the phylogenetic scheme of the genera. In particular, the

independent species status is fully supported for D. aphylla and D. intermedia in the ITS phylogeny (previously

considered subspecies of D denudata and D. triradiata respectively). Given these findings, the relationships of the

remaining D. scoparia subspecies (subsp. tripolitania, not included in the present study) should also be tested in order

to evaluate its taxonomic rank.

Opposed to this, other taxa lack sufficient phylogenetic resolution to evaluate their species rank. The holophyly

(monophyly s.s.; Hörandl & Stuessy 2010) alone should not be taken as an indispensable prerequisite to consider a

species as “natural” (e.g. island endemics and their relationships with their continental counterparts, e.g. Azorean Ammi

in Figs.1, 2). However, our phylogenetic results may indicate phylogenetic discrepancies with previous taxonomic

treatments. The two studied Stoibrax s.s. taxa (S. dichotomum and S. pomelianum) are not resolved in the phylogenetic

reconstructions (Figs. 1, 2). The three species considered in this paper under Stoibrax s.s. (S. dichotomum, S. hanotei,

and S. pomelianum) were described on the basis of characters difficult to observe (presence of hairs or tubercles on

fruits, presence of crystalline inclusions on pedicels, shape of leaves and sheaths; Maire 1926; Braun-Blanquet &

Maire 1931; El Alaoui Faris & Ibn Tattou 2007) and, in fact, the identification of Stoibrax materials is problematic due

to the intermediate features detected in many materials (pers. obs.). In our opinion, testing the existence of taxonomic

units within Stoibrax is desirable in order to evaluate if the detected variation is clinal or there are real discrete

morphological units. The same consideration could be made for Deverra juncea, which is associated with D. denudata

in our study (Fig. 1). This taxon is described as a poorly branched plant with small terminal umbels (Podlech 1986).

Future studies using multi-gene phylogenetic reconstructions may provide a better resolution to determinate whether

it represents a proper taxon or just depauperated forms of D. denudata.

On the basis of our results we propose a revised taxonomic treatment for the tribe Apieae (Table 3). In particular,

we propose to consider the above cited Apium and Deverra subspecies at species level, as well as the description of three

additional genera, Canaria gen. nov. (former Seseli webbii), Modesciadium gen. nov. (former Stoibrax involucratum)

and Schoenoselinum gen. nov. (former Anethum foeniculoides) on the basis of their morphological distinctiveness

from its closest relatives. We provide a key to genera to depict the new generic circumscription of the tribe after our

taxonomical proposal.

Taxonomy

1. Canaria Jim.-Mejías & P.Vargas, gen. nov. Type:—Canaria tortuosa (Webb & Berthelot 1834: 161, t. 77) Jim.-

Mejías & P. Vargas.

A new genus similar in fruit morphology to Sclerosciadium, from which can be distinguished by the absence of apical

sepal-like appendages on the mericarps, larger size and yellowish petals.

JIMÉNEZ-MEJÍAS & VARGAS

Etymology:—The genus is named after the Canary Islands, using the Latin denomination “Canaria”, which is the

earliest reference to the archipelago, given by Pliny the Elder in his “Naturalis Historiae”.

TABLE 3 Revised taxonomic scheme of the tribe Apieae

Genus Species Genus Species

Ammi A. majus (incl. A. procerum1)Deverra D. aphylla

A. seubertianum D. battandieri

A. trifoliatum D. burchellii

Anethum A. graveolens D. denudata

A. theurkauffii2D. intermedia

Apium A. anuum D. juncea2

A. australe D. reboudii3

A. commersonii D. scoparia (subsp. scoparia and subsp. tripolitania2)

A. chilense D. tortuosa

A. decumbens D. triradiata

A. fernandezianum Foeniculum F. vulgare

A. filiforme Modesciadium M. involucratum (= Stoibrax involucratum)

A. graveolens Naufraga N. balearica

A. insulare Petroselinum P. crispum

A. larranagum2Pseudoridolfia P. fennanei

A. panul Ridolfia R. segetum

A. prostratum Schoenoselinum S. foeniculoides (= Anethum foeniculoides)

A. sellowianum Sclerosciadium S. nodiflorum

Billburttia B. capensoides Stoibrax S. dichotomum

B. vaginoides S. hanotei2

Canaria C. tortuosa

(= Seseli webbii)

S. pomelianum2

1 Ammi procerum was described from Madeira (Lowe 1868). However, the characters that distinguish it from A. majus (both are reported

from Madeira) overlap with those given for populations from mainland Europe (see Nieto Feliner et al. 2003). After the examination of

the type material (Gonçallo 994, K) we suggest to consider A. procerum just a big-sized form of A. majus.

2 Taxa in need of revision (see Discussion).

3 Although we have not studied materials of this taxon, it is morphologically strongly divergent from the other Deverra species (Podlech

1986) and its taxonomical autonomy and conservation of species rank should be expected.

Distribution:—This monotypic genus comprises only Canaria tortuosa (see below); it is a Canarian endemic

occurring on cliffs and rocky soils close to the coast (Branwell & Branwell 1990), particularly from the islands of El

Hierro, La Palma, La Gomera, Tenerife, and Gran Canaria (Hand 2011).

Canaria tortuosa (Webb & Berthelot) Jim.-Mejías & P.Vargas, comb. nov.

Basionym: Ferula tortuosa Webb & Berthelot (1834: 161, t. 77). Holotype: Webb & Berthelot 1834: t. 77. Epitype (here designated):—

CANARY ISLANDS. “Teneriffa, in rupestribus convallis Tamadaya”, 22 Jun 1855, Bourgeau 1353 (WAG!; iso-G, MPU, photo!).

≡ Seseli webbii Cosson (1856: 57).

Notes:—Canaria tortuosa was originally described by Webb & Berthelot (1834) as Ferula tortuosa and later transferred

to Seseli as S. webii by Cosson (1856) on the basis of the fruit characters. The genus Seseli was long considered to

be polyphyletic and several attempts to divide it in different genera have been already made (cf. Spalik et al. 2004).

However, S. webbii was never transferred to another genus, despite its distant relationship with the remaining members

of the genus, which was already noted by several authors (Spalik et al., 2004; Reduron et al., 2009). According to

previous results (see above), our phylogenetic reconstructions show that Canaria may be closely related to the SW

Moroccan endemic Sclerosciadium nodiflorum, which is also corroborated by the carpological features (Fig. 3M,P).

The presence of well-developed apical sepal-like appendages and conspicuous tubercles in Sclerosciadium (El Alaoui

Faris & Ibn Tattou, 2007), which are respectively absent and inconspicuous in Canaria, as well as the differences in

petal color (white vs. yellow), supports the consideration of both as independent genera.

In the original description of Ferula tortuosa, Webb & Berthelot (1834) included a question mark (“Ferula ?

tortuosa”) and did not include a Latin diagnosis, but was accompanied by an analytical drawing. None of these apparent

irregularities affect the valid publication of the name (ICN, McNeill et al 2012; see Art. 36.1 for names published with

a question mark, and Arts. 38.5, 38.7 and 38.9 for the valid publication of names based on illustrations). The analytical

drawing must be considered the original description and therefore the holotype (Cheek 1989). When transferred to

Seseli by Cosson (1856), the new name Seseli webii was given, to avoid homonymy with the already existing Seseli

tortuosum L.

Webb & Berthelot (1834) clearly stated in the protologue of Ferula tortuosa that they did not observe fruits

(“Fructu ignoto…”). In concordance, the holotype plate lacks fruits too, although the taxon can be unambiguously

recognized among Canarian umbellifers by the habit and leaf morphology. To avoid further taxonomical problems,

and to ensure the precise application of the species name, we propose the designation of an epitype (ICN McNeill et

al. 2012, art. 9.7; see also Martín-Bravo & Jiménez-Mejías (2009) for further discussion in epitipification). We select

an specimen with ripe fruits (Bourgeau 1353), which was cited by Cosson (“…in convalle Tamadaya (…) Bourgeau

pl. Can. Exsicc.”; 1856) as epitype.

2. Modesciadium P.Vargas & Jim.-Mejías, gen. nov. Type:—Modesciadium involucratum (Maire 1922: 186) Vargas

& Jim.-Mejías.

A new genus similar to Stoibrax, from which can be distinguished by the presence of bracteoles at the base of the

second-level umbels.

Etymology:—The genus is named after our friend and colleague Modesto Luceño, Spanish botanist specialized in

the Cyperaceae and flora of the Iberian Central Range, also expert in mosses and especially in male sexual structures.

The etymology of the name indicates his nickname “Modes”, combined with the ancient Greek word Sciadium, which

means “umbrella” together forming Modesciadium as an acronym.

Distribution:—This monotypic genus only comprises Modesciadium involucratum (see below). It is endemic to

central southwestern Morocco (from Zaïane to N Sahara) where it inhabits forest clearings, steppes and rocky places,

mainly in basic soils (El Alaoui Faris & Ibn Tattou 2007).

Modesciadium involucratum (Maire) P.Vargas & Jim.-Mejías, comb. nov.

Basionym: Trachyspermum involucratum (Maire 1926: 186). Lectotype (here designated):—MOROCCO. “Maroc, Marrakech, rochers

calcaires du Gueliz”, 7 April 1921, Maire (P, photo!).

≡ Brachyapium involucratum (Maire) Maire (1932: 186).

≡ Stoibrax involucratum (Maire) Burtt (1989: 146).

Notes:—This taxon resembles superficially forms of Ammoides pusilla (Brot.) Breistroffer (1947), with tuberculate

fruits (Nieto Feliner et al. 2003), from which it can be easily distinguished by the dimorphic bracteoles (three linear

and two to three conspicuously spatulate), whereas all the bracteoles of M. involucratum are linear or linear-lanceolate.

Two other alternative genera have been considered for North African Stoibrax species: Trachyspermum Link, and

Brachyapium (Baill.) Maire. However, Trachyspermum is typified on T. ammi (tribe Pyramidoptereae; Downie et

al. 2010), and Brachyapium, based on Carum sect. Brachyapium Baill., is typified on Ptychotis didyma Sond. (tribe

Tordylieae; Magee et al. 2010b).

3. Schoenoselinum Jim.-Mejías & P.Vargas, gen. nov. Type:—Schoenoselinum foeniculoides (Maire & Wilczek

1936: 66) Jim.-Mejías & P. Vargas.

A new genus similar to Anethum and Foeniculum, from which can be distinguished by the shrubby habit and rod-like

leafless flowering stems.

Etymology:—The etymology of the name comes from Schoenos “rush”, combined with the latin word Selinum,

which means “celery”.

Distribution:—This monotypic genus comprises only Schoenoselinum foeniculoides (see below). It is an endemic

JIMÉNEZ-MEJÍAS & VARGAS

from southwestern Morocco (from Chtouka to N Sahara) where it inhabits subcoastal ravines and rocky places on

sandstones (El Alaoui Faris & Ibn Tattou, 2007).

Schoenoselinum foeniculoides (Maire & Wilczek) Jim.-Mejías & P. Vargas, comb. nov.

Basionym:—Anethum foeniculoides Maire & Wilczek (1936: 66). Lectoype (here designated):—MOROCCO. “Maroc,

in rupestribus arenaceis secus flumen Noun infra Abouda”, 4 April 1935, Maire 2556 (P, photo!).

Notes:—The name Anethum foeniculoides was first published by Maire & Wilczek (1946), and again as a “new

species” several months later by Maire (1936), which has led to some nomenclatural confusion. It was described as

being similar in habit to fennel, but was included within Anethum based on the narrowly winged mericarps.

Key to the genera of tribe Apieae (Apiaceae)

1. Shrubs or subshrubs ......................................................................................................................................................................… 2

- Herbs ................................................................................................................................................................................................. 4

2. Mericarps conspicuously hairy ............................................................................................................................................. Deverra

- Mericarps glabrous .......................................................................................................................................................................… 3

3. Bracts and bracteoles present; commisural vittae 5–6 ....................................................................................................... Billburttia

- Bracts and bracteoles absent; commissural vittae 2 .................................................................................................. Schoenoselinum

4. Primary ribs forming sepal-like appendages at the top of the mericarp ................................................................ … Sclerosciadium

- Mericarps without sepal-like appendages ......................................................................................................................................... 5

5. Mericarps conspicuously hairy or tuberculate ..............................................................................................................................… 6

- Mericarps glabrous, except sometimes very low papillae confined to valleculae ............................................................................ 7

6. Bracteoles absent ................................................................................................................................................................... Stoibrax

- Bracteoles present ........................................................................................................................................................ Modesciadium

7. Mericarps didym; dorsal ribs completely inconspicuous, not visible; leaf segments ovate to suborbicular, entire, rarely 2-lobed ....

.............................................................................................................................................................................................. Naufraga

- Mericarps not didym; dorsal ribs conspicuous or at least visible as lines on mericarp surface; leaf segments linear to broad, several

times divided to dentate, rarely distal ones entire, but then segments narrow elliptic ...................................................................... 8

8. Leaf segments linear or filiform; bracts and bracteoles absent ....................................................................................................… 9

- Leaf segments broader, flat; bracts and bracteoles absent or present .........................................................................................… 12

9. Commisural ribs broadly winged .................................................................................................................................... … Anethum

- Commisural ribs not broadly winged ...........................................................................................................................................…10

10. Plants perennial ................................................................................................................................................................ Foeniculum

- Plants annual … ............................................................................................................................................................................... 11

11. Mericarps ovoid … ...................................................................................................................................................... Pseudoridolfia

- Mericaps elliptic to oblong .................................................................................................................................................... Ridolfia

12. Distal leaf segments elliptical, ovate, or oblanceolate, with margins entire to serrate or dentate ........................................ … Ammi

- Distal leaf segments lobate, pinnatifid or pinnatisect ..................................................................................................................... 13

13. Bracts present ................................................................................................................................................................. Petroselinum

- Bracts absent ................................................................................................................................................................................... 14

14. Bracteoles absent; flowers whitish .......................................................................................................................................... Apium

- Bracteoles deciduous; flowers yellowish ............................................................................................................................. Canaria

Acknowledgements

We are very grateful to the editor and two anonymous reviewers for their comments, all of which highly improved

the quality of this manuscript; curators of the M, MA, MADM, MEL, MSB, RNG, and UPOS herbaria for the loan

of materials and granting permission for DNA extraction; J. Mathez and J.-P. Reduron from MPU for the materials of

a paratype specimen of Pseudoridolfia fennanei; H. Schaefer and S.R. Downie for kindly sending DNA of Azorean

Ammi species and Southern Hemisphere Apium respectively; E. Cano and A. Herrero from the Real Jardín Botánico

(Madrid), and J.L. Ribas from CITIUS (Seville) provided technical support; C. Baranda and the technical staff of MA

for all the managing of herbarium specimens needed; M. Fernández-Mazuecos, J.C. Zamora and J.V. Sandoval helped

during analysis and image processing, and gave comments on earlier versions of this manuscript. This study has been

made within the project “Do all endangered species hold the same value?: origin and conservation of living fossils of

flowering plants endemic to Spain”, funded by a Fundación General CSIC-Banco Santander research project.

References

Arenas Posada, J.A. & Martín, G.F. (1994) Atlas carpológico y corológico de la subfamilia Apioideae Drude (Umbelliferae) en España

Peninsular e Islas Baleares. Ruizia 12: 1–244.

Bramwell, D. & Bramwell, Z.I. (1990) Flores silvestres de las Islas Canarias, 3rd edn. Rueda, Madrid, 376 pp.

Braun-Blanquet, J. & Maire, R. (1931) Bulletin de la Société d’Histoire Naturelle de l’Afrique du Nord 22: 103–110.

Burtt, B.L. (1989) The adoption of Stoibrax for Tragiopsis and Brachyapium (Umbelliferae), and its N-S African disjunction. In: Tan, K.

(Ed.) The Davis and Hedge Festschrift. Edinburgh University Press, Edinburgh, pp 143–147.

Calendini, F. & Martin, J.-F. (2005) PaupUP v1.0.3.1 A free graphical frontend for Paup* Dos software. Available from: http://www.agro-

montpellier.fr/sppe/Recherche/JFM/PaupUp/main.htm (accessed 27 May 2015)

Cheek, M. (1989) On typifying names validated by plates unaccompanied by text. Taxon 38: 636–638.

http://dx.doi.org/10.2307/1222652

Cosson, M.E. (1856) Notes sur quelques plantes des Iles Canaries. Bulletin de la Société Botanique de France 3: 56–59.

http://dx.doi.org/10.1080/00378941.1856.10826084

Downie, S.R., Ramanath, S., Katz-Downie, D.S. & Llanas, E. (1998) Molecular systematics of Apiaceae subfamily Apioideae: phylogenetic

analyses of nuclear ribosomal DNA internal transcribed spacer and plastid rpoC1 intron sequences. American Journal of Botany 85:

563–591.

Downie, S.R., Spalik, K., Katz-Downie, D.S. & Reduron, J.-P. (2010) Major clades within Apiaceae subfamily Apioideae as inferred by

phylogenetic analysis of nrDNA ITS sequences. Plant Diversity and Evolution 128: 111–136.

http://dx.doi.org/10.2307/2446441

Drummond, A.J., Ashton, B., Buxton, S., Cheung, M., Cooper, A., Duran, C., Field, M., Heled, J., Kearse, M., Markowitz, S., Moir, R.,

Stones-Havas, S., Sturrock, S., Thierer, T. & Wilson, A. (2011) Geneious v5.4. Available from: http://www.geneious.com (accessed

4 October 2013)

El Alaoui Faris, F.E. & Ibn Tattou, M. (2007) Umbelliferae. In: Fennane, M., Ibn Tattou, M., Ouyahya, A. & El Oualidi, J. (Eds.) Flore

practique du Maroc 2. Institut Scientifique, Rabat, pp 281–336.

Hand, R. (2011) Apiaceae. Euro+Med Plantbase-the information resource for Euro-Mediterranean plant diversity. Available from: http://

ww2.bgbm.org/EuroPlusMed/ (accessed 30 July 2013)

Hardway, T.M., Spalik, K., Watson, M.F., Katz-Downie, D.S. & Downie, S.R. (2004) Circumscription of Apiaceae tribe Oenantheae.

South African Journal of Botany 70: 393–406.

Hörandl, E. & Stuessy, T.F. (2010) Paraphyletic groups as natural units of biological classification. Taxon 59: 1641–1653.

JSTOR (2014) JSTOR Global Plants. Available from http://about.jstor.org/content/global-plants-formerly-jstor-plant-science (accessed 9

October 2014)

Kadereit, J.W., Repplinger, M., Schmalz, N., Uhink, C.H. & Wörz, A. (2008) The phylogeny and biogeography of Apiaceae subf.

Saniculoideae tribe Saniculeae: from south to north and south again. Taxon 57: 365–382

Katz-Downie, D.S., Valiejo-Roman, C.M., Terentieva, E.I., Troitsky, A.V., Pimenov, M.G., Lee, B. & Downie, S.R. (1999) Towards a

molecular phylogeny of Apiaceae subfamily Apioideae: additional information from nuclear ribosomal DNA ITS sequences. Plant

Systematics and Evolution 216: 167–195.

http://dx.doi.org/10.1007/BF01084397

Kliuvkov, E.V., Liu, M., Ostroumova, T.A., Pimenov, M.G., Tilney, P.M. & van Wyk, B.-E. (2004) towards a standardised terminology for

taxonomically important morphological characters in the Umbellifera. South African Journal of Botany 70: 488–496.

Lowe, R.T. (1868) A manual flora of Madeira and the adjacent islands of Porto Santo and the Desertas. Vol. 1. J. van Voorst, London,

618 pp.

Mabberley, D.J. (1997) The plant-book. 2nd Edition. Cambridge University Press, Cambridge, 857 pp.

Maddison, W.P. & Maddison, D.R. (2011) Mesquite; a modular system for evolutionary analysis. v2.75. Available from: http://

mesquiteproject.org (accessed 30 January 2014)

Magee, A.R., van Wyk, B.-E., Tilney, P.M. & Downie, S.R. (2009a) Generic delimitations and relationships of the Cape Genera

Capnophyllum, Dasispermum, and Sonderina, the North African genera Krubera and Stoibrax, and a new monotypic genus of the

subfamily Apioideae (Apiaceae). Systematic Botany 34: 580–594.

http://dx.doi.org/10.1600/036364409789271218

Magee, A.R., van Wyk, B.-E., Tilney, P.M., Sales, F., Hedge, I. & Downie, S.R. (2009b) Billburttia, a new genus of Apiaceae (tribe Apieae)

endemic to Madagascar. Plant Systematics and Evolution 283: 237–245.

http://dx.doi.org/10.1007/s00606-009-0223-3

Magee. A.R., Calviño, C.I., Liu, M.R., Downie, S.R., Tilney, P.M. & van Wyk, B.-E. (2010a) New tribal delimitations for the early

JIMÉNEZ-MEJÍAS & VARGAS

diverging lineages of Apiaceae subfamily Apioideae. Taxon 59: 567–580.

Magee, A.R., van Wyk, B.-E., Tilney, P.M. & Downie, S.R. (2010b) A taxonomic revision of the South African endemic genus Dasispermum

(Apiaceae, Apioideae). South African Journal of Botany 76: 308–323.

http://dx.doi.org/10.1016/j.sajb.2009.12.002

Maire, R. (1926) Contribution à l’étude de la Flore de l’Afrique du nord 10. Bulletin de la Société d’Histoire Naturelle de l’Afrique du

Nord 17: 104–126.

Maire, R. (1936) Contribution à l’étude de la Flore de l’Afrique du nord 24. Bulletin de la Société d’Histoire Naturelle de l’Afrique du

Nord 27: 203–238.

Maire, R. & Wilczek, E. (1936) Sertulum austro-maroccanum tertium. Bulletin de la Société d’Histoire Naturelle de l’Afrique du Nord

37: 66–67.

Martín-Bravo, S. & Jiménez-Mejías, P. (2009) Molecular data helps traditional taxonomy: re-evaluation of Reseda collina (Resedaceae),

and a new record for Europe. Folia Geobotanica 44: 399–421.

http://dx.doi.org/10.1007/s12224-009-9052-y

Mathias, M.E. (1965) Distribution patterns of certain Umbelliferae. Annals of the Missouri Botanical Garden 53: 387–398.

http://dx.doi.org/10.2307/2394801

McNeill, J., Barrie, F.R., Buck, W.R., Demoulin, V., Greuter, W., Hawksworth, D.L., Herendeen, P.S., Knapp, S., Marhold, K., Prado, J.,

Prud’Homme van Reine, W.F., Smith, G.F., Wiersema, J.H. & Turland, N.J. (2012) International Code of Nomenclature for algae,

fungi and plants (Melbourne Code). Regnum Vegetabile 154.

Müller, K. (2005) SeqState-primer design and sequence statistics for phylogenetic DNA data sets. Applied Bioinformatics 4: 65–69.

Nicolas, A.N. & Plunkett, G.M. (2009) The demise of subfamily Hydrocotyloideae (Apiaceae) and the re-alignment of its genera across

the entire order Apiales. Molecular Phylogenetics and Evolution 53: 134–151.

http://dx.doi.org/10.1016/j.ympev.2009.06.010

Nieto Feliner, G., Herrero, A. & Jury, S.L. (2003) Umbelliferae. In: Castroviejo, S. (Coord.) Flora Iberica. Vol. 10. CSIC, Madrid, pp.

14–410.

Oxelman, B. & Lidén, M. (1997) Chloroplast rps 16 intron phylogeny of the tribe Sileneae (Caryophyllaceae). Plant Systematics and

Evolution 206: 393–410.

http://dx.doi.org/10.1007/BF00987959

Podlech, D. (1986) Revision der gattung Deverra DC. (Umbelliferae). Mitteilungen der Botanischen Staatssammlung München 22: 571–

604

Posada, D. (2008) jModeltest 0.1.1. Available from: http://darwin.uvigo.es/ (accessed 30 July 2013)

Rambaut, A., Drummond, A.J. (2009) Tracer 1.5.0. Available from http://beast.bio.ed.ac.uk/Tracer (accessed 1 Febuary 2014)

Reduron, J.-P., Mathez, J., Downie, S.R., Danderson, C.A. & Ostroumova, T. (2009) Pseudoridolfia, nouveau genre d’Apiaceae découvert

au Maroc. Acta Botanica Gallica 156: 487–500.

http://dx.doi.org/10.1080/12538078.2009.10516173

Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Höhna, S., Larget, B., Liu, L., Suchard, M.A. & Huelsenbeck, J.P.

(2012) MrBayes 3.2.: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Systematic Biology

61: 539–542.

http://dx.doi.org/10.1093/sysbio/sys029

Ronse, A.C., Popper, Z.A., Preston, J.C. & Watson, M.F. (2010) Taxonomic revision of European Apium L. s.l.: Helosciadium W.D.J.Koch

restored. Plant Systematics and Evolution 287: 1–17.

http://dx.doi.org/10.1007/s00606-010-0284-3

Schaefer, H., Hardy, O.J., Silva, L., Barraclough, T.G. & Savolainen, V. (2011) Testing Darwin’s naturalization hypothesis in the Azores.

Ecology Letters 14: 389–396.

http://dx.doi.org/10.1111/j.1461-0248.2011.01600.x

Short, P.S. (1979) Apium L. sect. Apium (Umbelliferae) in Australasia. Journal of the Adelaide Botanical Garden 1: 205–235.

Simmons, M.P. & Ochoterena, H. (2000) Gaps as characters in sequence-based phylogenetic analyses. Systematic Biology 49: 369–381.

http://dx.doi.org/10.1093/sysbio/49.2.369

Spalik, K., Reduron, J.-P. & Downie, S.R. (2004) The phylogenetic position of Peucedanum sensu lato and allied genera and their placement

in tribe Selineae (Apiaceae, subfamily, Apioideae). Plant Systematics and Evolution 243: 189–210.

http://dx.doi.org/10.1007/s00606-003-0066-2

Spalik, K., Piwczyński, M., Danderson, C.A., Kurzyna-Młynik, R., Bone, T.S. & Downie, S.R. (2010) Amphitropic amphiantarctic disjunctions

in Apiaceae subfamily Apioideae. Journal of Biogeography 37: 1977–1994.

Swofford, D.L. (2002) PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland,

Massachusetts.

Tutin, T.G. (1968) Umbelliferae. In: Tutin, T.G., Heywood, V.H., Burges, N.A., Moore, D.M., Valentine, D.H., Walters, S.M. & Webb,

D.A. (Eds.) Flora Europaea. Vol. 2. Cambridge University Press, Cambridge, pp. 315–275.

Vargas, P., Rosselló, J.A., Oyama, R. & Güemes, J. (2004) Molecular evidence for naturalness of genera in the tribe Antirrhineae

(Scrophulariaceae) and three independent evolutionary lineages from the New World and the Old. Plant Systematics and Evolution

249: 151–172.

http://dx.doi.org/10.1007/s00606-004-0216-1

Webb, M.P.B. & Berthelot, S. (1834) Historie naturelle des Iles Canaries. Phytographia canariensis 2. Bureaux rue Pavée-Saint-André-

des-Arts 17, Paris, 192 pp.

Winter, P.J.D., Magee, A.R., Phephu, N., Tilney, P.M., Downie, S.R. & van Wyk, B.-E. (2008) A new generic classification for African

peucedanoid species (Apiaceae). Taxon 57: 347–364.

The phylogeny of Seseli (Apiaceae, Apioideae): insights from molecular and morphological data

Article

Full-text available

Nov 2022
BMC PLANT BIOL

Background The genus Seseli L., which consists of 125–140 species distributed in the Old World from western Europe and northwestern Africa to China and Japan, is one of the largest and most taxonomically difficult genera of Apiaceae Lindl. Although several previous studies have been conducted on Seseli based on limited morphological characteristics and molecular fragments, a robust and comprehensive phylogeny of Seseli remains elusive. Plastomes provide abundant genetic information and have been widely used in studying plant phylogeny and evolution. Consequently, we newly generated the complete plastomes of eleven Seseli taxa. We combined plastome data and morphological characteristics to investigate the phylogeny of Seseli . Results In our study, we observed that the genome length, gene numbers, IR/SC borders, and repeat composition of the eleven Seseli plastomes were variable. Several appropriate mutation hotspot regions may be developed as candidate DNA barcodes for evolution, phylogeny, and species identification of Seseli . The phylogenetic results identified that Seseli was not a monophyletic group. Moreover, the eleven newly sequenced Seseli taxa did not cluster with S. tortuosum (the type species of Seseli , belonging to the tribe Selineae), where S. delavayi clustered with Eriocycla belonging to the tribe Echinophoreae and the other ten belonged to Selineae. The comparative plastome and morphological characteristics analyses confirmed the reliability of the phylogenetic analyses and implied the complex evolution of Seseli . Conclusion Combining molecular and morphological data is efficient and useful for studying the phylogeny of Seseli . We suggest that “a narrow sense” of Seseli will be meaningful for further study and the current taxonomic system of Seseli needs to be revised. In summary, our study can provide new insights into the phylogenetic relationships and taxonomic framework of Seseli .

Relationship Between Phylogenetic of Apium and Foeniculum Plants from Central Java, Indonesia, and Their Secondary Metabolites Potency against COVID-19 Protease

Article

Full-text available

Aug 2022

BACKGROUND: The emergence of COVID-19 in the late of 2019 resulted in the massive screening of drugs, including natural products, to support the current vaccines. Apium and Foeniculum vegetables are members of the Apiaceae family that potentially used to be natural immunosuppressant. AIM: The purpose of this research is to analyze the phylogenetic position between these two plants as well as find out their secondary metabolites potency against COVID-19 main protease (Mpro) and the papain-like protease (PLpro). METHODS: The phylogenetic analysis of Apium and Foeniculum from Indonesia was carried out based on internal transcribed spacer (ITS) region and the bioactive virtual screening assay was completed through AutoDock Vina software. CONCLUSION: Overall, Apium and Foeniculum have close relationships among the members of Apiaceae after maximum likelihood analysis. Furthermore, it also has 70 similar bioactive compounds that some of these potentially inhibit both of COVID-19 proteases.

Neither Seseli nor Eriocycla: a new Iranian relict genus Shomalia (Apiaceae), related to Azilia

Article

Full-text available

Jun 2022
PLANT SYST EVOL

Based on molecular and morphological evidence, two species of Seseli sect. Eriocycla subsect. Cordata are described as a new genus, Shomalia. The new genus is related to the Iranian endemic genus Azilia; the taxa have the following common diagnostic features: similar plant architecture, imparipinnate leaves, leaf segments ovate or orbiculate, with obtuse or cuneate basis and dentate or dissected margin coming down over abaxial surface, up to five linear bracts present, and late blooming and fruiting. At the same time, Shomalia, gen. nov. differs from Azilia in carpological features: it has elongated or lanceo-late mericarps, terete in cross-section, covered with non-branching simple hairs or glabrous (vs. elliptic glabrous mericarps strongly compressed from the dorsal side in Azilia), morphology of the underground part (multi-branched woody rootstock vs. thickened and non-branching rootstock), and number of stems (numerous vs. solitary).

The Study of Crystals in the Fruits of Some Apiaceae Species Using Energy-Dispersive Spectroscopy

Article

Full-text available

Apr 2023

Crystals in the fruits of Apiaceae are of great importance for taxonomy. The presence/absence and location of large prismatic crystals, druses, and spherical aggregates characterize genera, tribes, and subfamilies. When the fruits of Apiaceae split into mericarps, cell separation occurs, and probably cell death and the destruction of their walls. In clades Saniculeae and Scandicinae, this process is accompanied by the accumulation of calcium oxalate crystals in the abscission layer. However, reports of smaller crystals are rare, and their taxonomic significance is unknown. To fill this gap, we started research with four species of the clade Apieae: Ammi majus, Modesciadium involucratum, Deverra aphylla, and Rutheopsis tortuosa; in the last two species, crystals were described for the first time. We also studied crystals in Chaerophyllum bulbosum from the clade Scandicinae, and in Sanicula rubriflora from the clade Saniculeae. Conventional optical and polarizing microscopy, scanning electron microscopy, and energy dispersive spectroscopy (EDS) were used. In the clade Apieae, the studied species contained crystals in the exocarp and on the commissure, and often in the mesocarp parenchyma as well; the shapes of the crystals are small druses and crystal sand. The calcium content in the crystals was determined as 10–31%; crystals contain also carbon and oxygen and are most likely composed of calcium oxalate. In the fruits of Apiaceae studied, the silicon content is low (<0.3%).

Typification of the names Anethum pusillum and Meum segetum (Apiaceae)

Article

Jul 2022

Evolutionary relationships of poorly known Aegean endemic monotypic genus Microsciadium (Apiaceae)

Article

Jul 2022

In this study, the Aegean endemic genus Microsciadium was first evaluated in light of both ribosomal and chloroplast DNA datasets. According to the literature, Microsciadium minutum was determined as Cuminum minutum, then transferred to Carum (as C. minutum), and then Azorella (as A. minuta). Interestingly, these three genera belong to different tribes, even to different subfamilies. Since the phylogenetic position of Microsciadium was unknown, we analyzed this monotypic genus with a broad sampling of Apiaceae based on rps16 intron and an internal transcribed spacer. Microsciadium is well nested in the tribe Pyramidoptereae in Apioideae based on both datasets. Also, this genus is closely related to Hellenocarum. In addition, the detailed description, photographs, and micrographs of M. minutum are presented. The name is lectotypified here.

Morphology, anatomy and micromorphology of the genus Oliveria (Apiaceae)

Article

Full-text available

Dec 2021

Oliveria is a little-known, monotypic genus of the family Apiaceae. The only accepted species, O. decumbens, is distributed throughout Mesopotamia. It is an annual, aromatic plant that has been used in traditional medicine since ancient times. The aim of this study was to examine morphological, micromorphological, and anatomical characters of O. decumbens in order to increase the current botanical knowledge of this genus.

Berberocarum (Apiaceae), a new genus from the High Atlas Mountains (Morocco), with notes on some other NW African Umbelliferae–Apioideae

Article

Dec 2021

In Northwest Africa (Morocco), Carum (Apiaceae/Umbelliferae) is represented by six little known species. In order to clarify the relationships of these species within Carum, we conducted detailed morphological studies and molecular sequence analysis of four species (C. atlanticum, C. jahandiezii, C. lacuum and C. proliferum) based on the nuclear DNA internal transcribed spacer (ITS) and plastid rps16 intron (rps16) regions. According to the molecular data, the Moroccan Carum species form three isolated evolutionary lines distant from that of the generitype C. carvi. The morphological study demonstrated that fruits of C. atlanticum belong to a carpological type markedly different from that of other Carum species. Based on the correlation of obtained carpological and molecular data, we propose to transfer C. atlanticum to the new monotypic genus Berberocarum, endemic to the High Atlas Mountains.

Plastid phylogenomic insights into relationships, divergence, and evolution of Apiales

Article

Full-text available

Nov 2022
PLANTA

Main conclusion Members of Apiales are monophyletic and radiated in the Late Cretaceous. Fruit morphologies are critical for Apiales evolution and negative selection and mutation pressure play important roles in environmental adaptation. Abstract Apiales include many foods, spices, medicinal, and ornamental plants, but the phylogenetic relationships, origin and divergence, and adaptive evolution remain poorly understood. Here, we reconstructed Apiales phylogeny based on 72 plastid genes from 280 species plastid genomes representing six of seven families of this order. Highly supported phylogenetic relationships were detected, which revealed that each family of Apiales is monophyletic and confirmed that Pennanticeae is a member of Apiales. Genera Centella and Dickinsia are members of Apiaceae, and the genus Hydrocotyle previously classified into Apiaceae is confirmed to belong to Araliaceae. Besides, coalescent phylogenetic analysis and gene trees cluster revealed ten genes that can be used for distinguishing species among families of Apiales. Molecular dating suggested that the Apiales originated during the mid-Cretaceous (109.51 Ma), with the families’ radiation occurring in the Late Cretaceous. Apiaceae species exhibit higher differentiation compared to other families. Ancestral trait reconstruction suggested that fruit morphological evolution may be related to shifts in plant types (herbaceous or woody), which in turn is related to the distribution areas and species numbers. Codon bias and positive selection analyses suggest that negative selection and mutation pressure may play important roles in environmental adaptation of Apiales members. Our results improve the phylogenetic framework of Apiales and provide insights into the origin, divergence, and adaptive evolution of this order and its members.

VARIABILIDAD GENÉTICA DE SIETE CULTIVARES DE ARRACACHA (Arracacia xanthorrhiza Bancroft) PRODUCIDOS EN LOS MUNICIPIOS DE BOYACÁ Y TURMEQUÉ (BOYACÁ) UTILIZANDO MARCADORES MICROSATÉLITES MADELEYNE PARRA FUENTES UNIVERSIDAD MILITAR NUEVA GRANADA FACULTAD DE CIENCIAS BÁSICAS Y APLICADAS

Thesis

Jan 2018

Este trabajo se presenta en tres capítulos: el primer capítulo abarca una descripción general sobre la arracacha (A. xanthorrhiza). El segundo capítulo presenta el artículo publicado sobre la estandarización y selección de los marcadores microsatélites para el análisis de variabilidad genética de arracacha. Finalmente, el capítulo 3 aborda el estudio de la diversidad genética de siete cultivares de la arracacha de Boyacá.

Pseudoridolfia, new genus of Apiaceae from Morocco

Article

Full-text available

Oct 2009

A morphological study of a new species of Apiaceae and a molecular systematic analysis based on ITS sequences has led to the description of the new genus Pseudoridolfia that is related to Foeniculum, Ridolfia and Anethum. The new species, P. fennanei, occurs in the Tetraclinis articulala formations of the semi-arid valleys located on the northern fringe of the Central Plateau of Morocco.

Circumscription of Apiaceae tribe Oenantheae

Article

Full-text available

Aug 2004
S AFR J BOT

Previous molecular systematic investigations into the higher-level relationships of Apiaceae subfamily Apioideae have revealed a strongly supported clade recognised as tribe Oenantheae Dumort. These plants may have clusters of fibrous or tuberous-thickened roots, corky-thickened fruits, and other adaptations for existence in wet or aquatic habitats. In some species, the leaves may be finely dissected or linear-septate and much reduced. We have initiated collaborative studies to produce a comprehensive estimate of phytogeny of the tribe, but such investigations are thwarted because information on the composition of the tribe is lacking. Herein, tribe Oenantheae is circumscribed to include the following genera: Afrocarum, Berula, Bifora (pro parte), Cicuta, Cryptotaenia (pro parte), Cynosciadium, Daucosma, Helosciadium, Lilaeopsis, Limnosciadium, Neogoezia, Oenanthe, Oxypolis, Perideridia, Ptilimnium, Sium and Trepocarpus. Relationships inferred from phylogenetic analyses of nuclear rDNA ITS sequences from 64 accessions representing all 17 genera reveal that four genera are not monophyletic. Bifora and Cryptotaenia have members that fall outside of the tribe; Berula and Sium each comprise two or more lineages within Oenantheae. The St Helena endemics, Sium bracteatum and S. burchellii, ally with African Berula erecta; this clade is sister to the African endemic species Sium repandum and Afrocarum imbricatum, and this entire group is allied closely with north temperate Berula erecta. Nomenclatural changes are in order, but must await further study. Representatives of eight genera native to North America comprise a monophyletic group, and results from relative rate tests suggest that this lineage is evolving much faster than any other major clade recognised within the tribe.

Towards a standardised terminology for taxonomically important morphological characters in the Umbelliferae

Article

Full-text available

Aug 2004
S AFR J BOT

Taxonomically important structural characters and their states are given in an attempt to clarify and standardise the confusing and ambiguous terminology that is currently used in descriptions and identification keys of Umbelliferae taxa. The proposed terms to be used for characters and character states are listed, illustrated and discussed.

Paraphyletic groups as natural units of biological classification

Article

Dec 2010

Despite the broad acceptance of phylogenetic principles in biological classification, a fundamental question still exists on how to classify paraphyletic groups. Much of the controversy appears due to (1) historical shifts in terminology and definitions, (2) neglect of focusing on evolutionary processes for understanding origins of natural taxa, (3) a narrow perspective on dimensions involved with reconstructing phylogeny, and (4) acceptance of lower levels of information content and practicability as a trade‐off for ease of arriving at formal classifications. Monophyly in evolutionary biology originally had a broader definition, that of describing a group with common ancestry. This definition thus includes both paraphyletic and monophyletic groups in the sense of Hennig. We advocate returning to a broader definition, supporting use of Ashlock's term holophyly as replacement for monophyly s.str. By reviewing processes involved in the production of phylogenetic patterns (budding, merging, and splitting), we demonstrate that paraphyly is a natural transitional stage in the evolution of taxa, and that it occurs regularly along with holophyly. When a new holophyletic group arises, it usually coexists for some time with its paraphyletic stem group. Paraphyly and holophyly, therefore, represent relational and temporal evolutionary stages. Paraphyletic groups exist at all levels of diversification in all kingdoms of eukaryotes, and they have traditionally been recognized because of their descent‐based similarity. We review different methodological approaches for recognition of monophyletic groups s.l. (i.e., both holophyletic and paraphyletic), which are essential for discriminating from polyphyly that is unacceptable in classification. For arriving at taxonomic decisions, natural processes, information content, and practicability are essential criteria. We stress using shared descent as a primary grouping principle, but also emphasize the importance of degrees of divergence plus similarity (cohesiveness of evolutionary features) as additional criteria for classification.

Umbelliferae

Article

Jan 1968

T.G. Tutin

Histoire naturelle des îles Canaries

Article

Distribution Patterns of Certain Umbelliferae

Article

Sep 1965

Mildred E. Mathias

In a Miscellany in Honor of Merrit Lyndon Fernald, Woodson (1947) discussed the "Historical Factor" in plant geography. Now almost twenty years later it seems appropriate to continue the discussion in a miscellany in honor of Robert Everard Woodson. For years Woodson was intrigued by the relations of paleography to present patterns of distribution and variation, particularly of Apocynaceae and Asclepiadaceae, and we engaged in many discussions on possible interpretations of Angiosperm distributions. The Angiosperm family Umbelliferae is cosmopolitan primarily in temperate areas where it exhibits many interesting patterns of distribution and variation (Fig. 1, 2, 3, 4). Even though the fossil record for the family is inadequate it may be informative to generalize and speculate on the evolution of some of the present distributional patterns. The two families Araliaceae and Umbelliferae are a closely related and natural group probably derived from a pro-araliaceous stock. Baumann's (1946) comparative study of the fruit of the New Caledonia genus Myodocarpus (Araliaceae) and of the Umbelliferae supports this view and indicates that the Umbelli

Notes Sur Quelques Plantes Des Iles Canaries

Article

Jul 2014

M. E. Cosson

Contributions a l'etude de la Flore de l'Afrique du Nord, 25

Article

Jul 2014

M. R. Maire

On Typifying Names Validated by Plates Unaccompanied by Text

Article

Nov 1989

Martin Cheek

It is shown here that names validated by analytical plates unaccompanied by text should, according to the articles of the current Code, be typified by using the plates as holotypes rather than by attempting to select, as lectotypes, specimens on which the plates might be based.

Taxonomy of the tribe Apieae (Apiaceae) revisited as revealed by molecular phylogenies and morphological characters

Abstract and Figures

Recommendations

Molecular Phylogeny of Monoraphid Diatoms and Raphe Significance in Evolution and Taxonomy

The taxonomic affinity of Carum piovanii Chiov. and some Bunium species (Apiaceae)

Revised generic delimitations for Oxypolis and Ptilimnium (Apiaceae) based on leaf morphology, compa...

Systematic placement of the Turkish endemic genus Ekimia (Apiaceae)based on morphological and molecu...

Most important carpological anatomical characters in the taxonomy of Apiaceae