Content uploaded by Bindumadhava H
Author content
All content in this area was uploaded by Bindumadhava H on Apr 10, 2015
Content may be subject to copyright.
This article was downloaded by: [Bindumadhava H]
On: 20 October 2014, At: 19:49
Publisher: Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered
office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Journal of Crop Improvement
Publication details, including instructions for authors and
subscription information:
http://www.tandfonline.com/loi/wcim20
Fulvic Acid (FA) for Enhanced Nutrient
Uptake and Growth: Insights from
Biochemical and Genomic Studies
Priya B. N. V.a, Mahavishnan K.a, Gurumurthy D. S.a, Bindumadhava
H.a, Ambika P. Upadhyaya & Navin K. Sharmaa
a ITC – Life Sciences & Technology Centre, ITC Limited, Bangalore,
India
Published online: 15 Oct 2014.
To cite this article: Priya B. N. V., Mahavishnan K., Gurumurthy D. S., Bindumadhava H., Ambika
P. Upadhyay & Navin K. Sharma (2014) Fulvic Acid (FA) for Enhanced Nutrient Uptake and Growth:
Insights from Biochemical and Genomic Studies, Journal of Crop Improvement, 28:6, 740-757, DOI:
10.1080/15427528.2014.923084
To link to this article: http://dx.doi.org/10.1080/15427528.2014.923084
PLEASE SCROLL DOWN FOR ARTICLE
Taylor & Francis makes every effort to ensure the accuracy of all the information (the
“Content”) contained in the publications on our platform. However, Taylor & Francis,
our agents, and our licensors make no representations or warranties whatsoever as to
the accuracy, completeness, or suitability for any purpose of the Content. Any opinions
and views expressed in this publication are the opinions and views of the authors,
and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content
should not be relied upon and should be independently verified with primary sources
of information. Taylor and Francis shall not be liable for any losses, actions, claims,
proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or
howsoever caused arising directly or indirectly in connection with, in relation to or arising
out of the use of the Content.
This article may be used for research, teaching, and private study purposes. Any
substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing,
systematic supply, or distribution in any form to anyone is expressly forbidden. Terms &
Conditions of access and use can be found at http://www.tandfonline.com/page/terms-
and-conditions
Journal of Crop Improvement, 28:740–757, 2014
Copyright © Taylor & Francis Group, LLC
ISSN: 1542-7528 print/1542-7536 online
DOI: 10.1080/15427528.2014.923084
Fulvic Acid (FA) for Enhanced Nutrient Uptake
and Growth: Insights from Biochemical and
Genomic Studies
PRIYA B. N. V., MAHAVISHNAN K., GURUMURTHY D. S.,
BINDUMADHAVA H., AMBIKA P. UPADHYAY,
and NAVIN K. SHARMA
ITC – Life Sciences & Technology Centre, ITC Limited, Bangalore, India
Potassium (K), one of the essential elements required for plant
growth and development, determines leaf quality in tobacco
(Nicotiana tabacum L.). Potassium (K) levels are relatively high in
black soils (vertisols), but K uptake is severely hindered by the pres-
ence of remarkably high levels of calcium and magnesium. Our
major objective was to enhance potassium uptake in black soils,
which cover the major tobacco growing regions of Andhra Pradesh,
India. Among several agronomic inputs such as soil amendments,
fertilizer application, and plant growth regulators, we found that
foliar application of fulvic acid (FA), one of the most bioactive
humate molecules, enhanced K levels in leaves. Using next-gen-
eration sequencing (NGS), we identified changes in expression
levels of a number of genes related to metabolic pathways impli-
cated in plant growth and nutrient uptake upon FA application.
Interestingly, starch levels in leaves were reduced concomitant with
an increase in K attributable to FA application. We attempt to
provide plausible reasons for these observed FA-induced changes.
Our results suggested that FA acts in a manner similar to the
plant hormone auxin in tobacco, influencing expression of key
genes encoding transporters and enzymes involved in K uptake and
Received 26 February 2014; accepted 7 May 2014.
Current affiliation for Navin K. Sharma: The World Agroforestry Centre, NASC complex,
PUSA, New Delhi, India.
Address correspondence to Bindumadhava H., AVRDC – The World Vegetable Center,
South Asia Regional Office, ICRISAT campus, Patancheru 502 324, Hyderabad, Andhra
Pradesh, India. E-mail: bindu.madhava@worldveg.org
Color versions of one or more of the figures in the article can be found online at www.
tandfonline.com/wcim.
740
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
Fulvic Acid and Nutrient Uptake 741
starch metabolism. While fulvic acid has beneficial effects on plant
growth, its mechanism of action is still unclear.
KEYWORDS FCV tobacco, humus, NGS, potassium, starch
ABBREVIATIONS. (C and N) carbon and nitrogen; (FCV) flue-cured Virginia;
(FA) fulvic acid; (HA) humic acid; (NAA) naphthylacetic acid; (NGS) next-
generation sequencing; (PCR) polymerase chain reaction; (K) potassium;
(QC) quality control; (SBCS) southern black cotton soil.
INTRODUCTION
Potassium is the lone essential plant nutrient that is not a constituent of
any plant part (Marschner 1995; Cakmak 2005). Potassium acts as a cat-
alyst for many of the necessary enzymatic processes in the plant and is
also involved in osmoregulation, i.e., regulation of water transport in the
xylem and opening and closing of the stomata (Raschke 1975). Potassium
exists in several forms in the soil, including mineral K (90% to 98% of total),
non-exchangeable K, exchangeable K, and dissolved or solution K (K ions)
(Tisdale et al. 1985). Even though K is abundant in many soils, the bulk of
it is in the form unavailable to plants. Potassium uptake by plants is also
influenced by type of soil. Calcareous soils tend to have high concentra-
tions of calcium ions (Ca) that dominate clay surfaces and limit K sorption.
High concentrations of Ca and magnesium (Mg) tend to limit K uptake by
competing for binding sites on root surfaces (Havlinet al.1999). Enhancing
potassium content in plants is key to improving yield and quality in several
crops (Geraldson 1985; Kanai et al. 2007;Lesteretal.2010). Potassium fertil-
izers are either applied directly to the soil or in the form of foliar spray. Foliar
application has been consistently shown to improve fruit quality attributes
in cucumber, mango, and muskmelon; soil application had little or no effect
(Tisdale et al. 1985; Brady and Weil 1999). Potassium enhanced color and
glossiness of chili fruits (Prabhavathi et al. 2008). Earlier studies have shown
that foliar application of potassium fertilizers, humic acids, and their deriva-
tives had improved K uptake in several crops (Wuzhong 2002; Demiral and
Koseoglu 2005;Lesteretal.2005,2006; Jifon and Lester 2009).
Many beneficial effects are attributed to foliar application of fulvic acid
(FA), including stimulation of plant metabolism, increased enzyme activity
(transaminase, invertase), increased bioavailability and uptake of nutrients
(Pascual et al. 1999), and increased crop growth and yield (Mylonas and Mc
Cants 1980; Xudan 1986). Fulvic acid has maximum influence on chemical
reactions because of the presence of more electronegative oxygen atoms
than any other humate molecules, which enhances membrane permeability
(Pascual et al. 1999).
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
742 P. B. N. V . et al .
Potassium is considered one among organic and inorganic compounds
that influence the quality of tobacco; potassium is considered the element
of quality (Srinivas and Seshaiah 1993). Cured leaf color, grade, body, tex-
ture, fire-holding capacity, and aroma are significantly influenced by K
concentration (Krishnamurthy and Ramakrishnayya 1997;Juanetal.2005;
Mahavishnan, Priya, and Upadhyay, personal communication, July 2011).
In India, flue-cured Virginia (FCV) tobacco is grown mainly in the states of
Andhra Pradesh (southern black cotton soils [SBCS]) of Prakasam district)
and Karnataka.
In a previous study, we established positive effect of FA on carbon
translocation (Priya et al. 2011). In the same study, we also noted an increase
in K content of leaves. K-deficient plants had several-fold increase in sucrose
concentration and marked reduction in root growth compared with control
plants (Cakmak et al. 1994; Huber 1984; Marschner et al. 1996). The accu-
mulation of sugars and apparent increase in partitioning of fixed carbon
into starch was associated with declined sucrose phosphate synthase activ-
ity attributable to nutrient deficiency (Rufty and Huber 1983). Hence, along
with K uptake, we determined the starch content in leaf and explained
its association with leaf K. In the present study, we explore FA-associated
physiological, biochemical, and molecular changes that possibly enhance
K uptake and decrease starch content in FCV tobacco grown in the SBCS
region.
MATERIALS AND METHODS
Experimental Design
The SBCS soils are clay-to-clay loams throughout the profile, slightly alkaline
in reaction (pH 7.5 to 8.8). The experiments were laid out in a random-
ized complete-block design (RCBD) for first growing season (2007–2008).
However growing seasons of 2008–09 and 2009–10 were on-farm large-scale
trials. Sixty-day-old seedlings of variety CY 135 were planted during winter
(Oct–Nov) with a standard spacing of 65 cm x 65 cm. Recommended fertiliz-
ers dose of 50:50:50 (N:P2O5:K2O) were applied 20 days before transplanting.
Need-based prophylactic measures were taken to control pest and diseases.
Commercial grade FA (81% pure: MW-308.24) was obtained from East Coast
Seaweed Inc., India, and a concentration of 2mM was applied twice, i.e.,
45 and 60 days after planting (DAP). The first priming was done at 60 DAP
and subsequent primings were carried out at 7- to 10-day intervals. Leaves
from each harvest were cured, stripped, conditioned, and graded separately.
Analysis of variance (ANOVA) of phenotypic data was carried out using the
general linear model (GLM) of SAS software (version 9.3, 2011) (http://www.
sas.com).
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
Fulvic Acid and Nutrient Uptake 743
Sampling
Cured leaf samples were drawn based on plant positions from the bottom
of the plant (P, X, L, and T; see Figure S-1) as per the recommendation of
Central Tobacco Research Institute, India (CTRI). Priming (P) contains leaves
1–3 from the lower-most position, cutter (X) has leaves 4–9, leaf (L) position
has leaves from 10-15, and final top (T) position consists of leaves from
16–21 (Figure S-1). Laminas of the cured leaves were separated and ground
to a fine powder. Leaves from all the positions were analyzed for K and
starch content. Green leaf samples from only the “X” position were collected
7 days after first foliar application, snap-frozen in liquid nitrogen and used
for RNA extraction.
Potassium and Starch Analysis
K content of the leaf samples was analyzed using Atomic Absorption
Spectrophotometer (AAS) (Shimadzu, AA6300) in a measured quantity
(100mg) of sample wet-digested with Di-acid mix (nitric acid: perchloric acid,
9:4 ratio) (Jackson 1967). Estimation of starch was done as per McCready
et al. (1950) with slight modifications. Leaf tissue (200mg) was extracted
thrice with 10ml of sodium chloride-saturated methanol, followed by diges-
tion with 5ml of 6M perchloric acid for 10 min. Contents were filtered
(through Whatman filter paper grade 1) and filtrate was made up to 100ml
with distilled water. Ten ml of sample was mixed with 2.5ml iodine reagent
and final volume made up to 25ml with distilled water. Absorbance of sam-
ple was recorded at 600 nm using spectrophotometer (Agilent, 8453). Starch
estimation was done using a standard curve.
Potassium Uptake Assay
Two month-old tobacco seedlings were placed in Hoagland solution with
and without FA (2mM). Experiment consisted of 3 sets, i.e., absolute control
(100ml Hoagland solution), FA-Solution (0.0625g FA in 100ml of Hoagland
solution), and FA-Spray (100 ml Hoagland solution in a jar +foliar spray
of FA). Fulvic acid solution for foliar application was prepared by dissolv-
ing 0.0625g FA in 100ml water, and then 10ml of solution was sprayed on
each seedling. Samples (left over Hoagland solution) were taken at 72h and
analyzed for K using AAS (Shimadzu, AA6300).
Quantitative Real-Time PCR (qRT-PCR) Analysis
Tobacco plants grown in greenhouse were sprayed with FA (2mM) 45 days
after transplanting. Green leaf samples (X position) were collected after
6, 7, 8, 12, 18, and 24 h of foliar application of FA. Total RNA was
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
744 P. B. N. V . et al .
isolated from tobacco leaf samples using RNA aqueous Kit (Ambion).
Synthesis of cDNA was carried out with an equal concentration of RNA for
each sample using high-capacity cDNA synthesis kit (Applied Biosystems)
after DNase treatment. Real-time PCR for AGPase small subunit (F-
5TAGCTGAGTGGAGCAGAGCA 3and R- 5AGAAACAGCCTTAGGCGACA
3) and 18s rRNA (F- 5CGCGCTACACTGATGTATTC 3and R- 5GTACAA
AGGGCAGGGACGTA 3) was carried out using Power SYBR Green Master
Mix (Applied Biosystems). The PCR was carried out with 7500 RT PCR sys-
tem (Applied Biosystems) with following steps: initial denaturation at 94◦C
for 2 min, followed by 35 cycles of denaturation at 94◦C for 15 s, annealing
at 60◦C,andextensionat72
◦C for 15 s. The experiment was repeated at least
thrice, along with three independent biological replicates.
Next-Generation Sequencing (NGS) Analysis
The total RNA was extracted using TRIzol (Invitrogen) and the quality of RNA
checked by Bioanalyzer (Agilent 2100). Transcriptome libraries (single library
with average size of 250bp) for sequencing were constructed according to
the Illumina protocol outlined in “mRNA Sequencing Sample Preparation
Guide” (Cat #RS-931-1001, Rev. D). Next generation sequencing was carried
out at Genotypic Pvt Ltd, India, using Illumina Genome Analyzer IIx via syn-
thesis method with the read length of 72 bases single-end sequencing. Raw
reads were filtered using SeqQC_V2.1, a genotypic proprietary tool (http://
www.genotypictech.com/SeqQC.html?mnu=1), for quality control (Example
number of reads, bases, sequence length, nucleotide composition, and
adapter sequence search, etc.).
Transcriptome alignment was carried out using Bowtie V0.12.7, and
post-alignment was done by SAM 0.1.7. The aligned contigs were annotated
by homology sequence search with The Arabidopsis Information Resources
(TAIR) (www.arabidopsis.org) database. Expression value was calculated
using custom Perl code, based on which fold change was calculated by
comparing the FA-treated expression values with control values. Transcripts
with a fold change of <−1 were regarded as down regulated, and the range
between −1to+1 as neutral and >+2 as up regulated. Pathways used to
illustrate changes in gene expression were obtained from KEGG Pathway
database (http://www.genome.jp/kegg/pathway.html).
RESULTS AND DISCUSSION
Effect of FA Application on Leaf K and Starch Content
Foliar application of FA resulted in a significant increase in mean leaf K con-
tent and a reduction in the mean leaf starch content at all the leaf positions
of the plant (Table 1, Figure S-1). This result was consistent across the three
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
Fulvic Acid and Nutrient Uptake 745
TABLE 1 Analysis of variance (ANOVA) using means across all leaf positions (P, X, L, and T)
for leaf K content (%) and starch content (%) following application of fulvic acid in flue-cured
Virginia tobacco for growing season 2007–08
Mean squares
Source of variation Df K content Starch content
Replications 2 0.01 0.05
Treatments 5 0.54∗∗ 10.27∗∗
Residual 12 0.01 0.84
CD (5%) 0.12 1.63
∗∗Denotes significance at the 1% probability level.
growing seasons (2007 to 2009), of which 2008 and 2009 were on-farm large-
scale trials. Potassium content in these samples ranged from 0.5% to 3.6%
across all three seasons with highest K content observed in P position leaf.
Average K content of all the leaf positions was clearly higher in FA-treated
samples than that in control leaves. The mean percent increase in K in FA-
treated samples was 33% over the control (Figure 1A). Leaf starch content
varied from 1.0% to 6.0% among FA-treated and control plants across all
three growing seasons, with lowest starch content in the P position leaf.
The mean percent decrease in leaf starch content was 22% over the con-
trol (Figure 1B). Among the other treatments explored in our earlier study
(Mahavishnan et al. 2011), application of naphthylacetic acid (NAA) led to an
increase in K content by 40% and a decrease in starch content by 30% com-
pared with the control. Though the humic substances (HS) have been shown
to contain auxin and an “auxin-like” activity, support for this hypothesis is
still fragmentary (Trevisan et al. 2010).
Numerous studies have shown that HS, not particularly FA, enhance
root, leaf, and shoot growth by stimulating water and nutrient uptake
(Piccolo et al. 1993; Trevisan et al. 2009, and references therein). These pos-
itive effects are explained as an interaction between HS and physiological
and metabolic processes (Nardi et al. 2002; Muscolo et al. 1999). The addi-
tion of HS stimulates nutrient uptake, cell permeability, and seems to regulate
mechanisms involved in plant growth stimulation (Canellas et al. 2008).
However, it is not easy to distinguish between the direct and indirect
effects of HS as some of the positive effects may be ascribed to a general
improvement of soil fertility, leading to a higher nutrient availability for plants
(Quaggiotti et al. 2004). While in other cases, HS seem to positively influence
metabolic and signaling pathways involved in the plant development by
acting directly on specific physiological targets (Trevisan et al. 2009;Figure
S-2). It is interesting to note that, in our experiments, only foliar spray of FA
but not soil application was found to be effective (Mahavishnan, Priya, and
Upadhyay, personal communication, July 2011).
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
746 P. B. N. V . et al .
FIGURE 1 Effect of fulvic acid application on mean potassium (A) and starch (B) content
of flue-cured Virginia tobacco in different growing seasons (2007–2009). Error bars represent
standard deviation of the replicates (n =24). The alphabet represents the level of significance
(same alphabet indicates non-significance and different alphabet indicates significance of
treatment means for that particular growing season).
Relationship Between Leaf K And Starch Content
Foliar application of FA was found to enhance K and decrease starch con-
tent of the cured leaf at all leaf positions. We observed a strong inverse
relationship between K and starch in tobacco-cured leaf. Wherever K content
was higher than 2%, starch content was lower than 2% (r2=0.31, Figure 2).
Although the correlation coefficient was highly significant, it explained only
31% of the variation. This result was highly consistent across the three
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
Fulvic Acid and Nutrient Uptake 747
FIGURE 2 Relationship between leaf potassium and starch content in flue-cured Virginia
tobacco (values represent the data obtained from control and fulvic acid treated samples of
three different growing seasons, 2007–2009). Values were significant at P =0.001 (∗∗∗).
seasons. Elevated starch content in tobacco has a negative effect on its
quality. Potassium is a highly mobile element that helps in maintaining
cell turgor (Krishnamurthy et al. 2001) and general plant growth (Taiz and
Zieger 2010). It is envisaged that potassium-induced cell expansion ener-
gizes normal metabolism mainly associated with carbon and nitrogen. This
activation leads to production of more carbohydrate (mainly sucrose) and
its translocation to growing parts, leaving behind less substrate for starch
synthesis in chloroplasts (Priya et al. 2011).
Similar results have been shown in cotton where low leaf K content was
associated with elevated leaf carbohydrate concentrations because of delay
in translocation (Pettigrew 1999) and high amounts of sugars under low K
condition in all parts of peanut (Mahaboob and Rao 1980). According to Rufty
and Huber (1983), limitation in translocation of sugars from source leaves
leads to enhanced partitioning of accumulated photosynthates into starch.
Decreased sink capacity has been shown to inhibit sugar transport, enhance
accumulation of sugars in leaves with concurrent increase in expression of
genes involved in carbohydrate storage, and suppress photosynthetic genes
and subsequent growth (Sheen 1990; Paul and Pellny 2003; Stitt et al. 2010).
Further, reportedly K plays a major role in the regulation of the carbohydrate
metabolism through control of starch-sugar balance and starch content is
higher under K starvation (White 1936).
Effect of FA Application on K Uptake
Hydroponic uptake assay revealed that the untreated control plants absorbed
around 0.5 mM of K only as against FA-treated plants (1 mM). Fulvic acid
applied either in solution or spray form increased the K uptake by 95% and
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
748 P. B. N. V . et al .
FIGURE 3 Effect of fulvic acid on potassium uptake in seedlings. Data indicates that treated
plants absorbed more K (∼twofold) from nutrient medium than control plants. Values are
means with SD (minimum three replicates). The alphabet represents the level of significance
(same alphabet indicates non significance and different alphabet indicates the significance of
treatment means).
92% over untreated control (Figure 3). Fulvic acid application on tobacco
seedlings grown in a controlled environment caused in leaves about a 16%
increase in K content (Mylonas and McCants 1980). Rauthan and Schnitzer
(1981) reported that FA application led to a significant increase in K con-
centration in shoots of cucumber seedlings grown in hydroponics. Similar
HS-derived response of increased uptake of macro and micro-elements was
reported by several workers in other crop species (Chen and Aviad 1990;
Varanini and Pinton 1995; Nardi et al. 2002;Yaofu2005;Asiketal.2009).
Further, HS-stimulated uptake of nutrients and its involvement in regula-
tion of plant growth in maize was demonstrated (Canellas et al. 2008).
These studies suggested an increased ion influx was partially attributable
to transcriptional activation of major gene H+-ATPase, which possibly leads
to generation of favorable electrochemical gradient (Millerand Smith 1996).
Spraying humic acid has been shown to have a significant effect on physio-
logical traits, including nutrient uptake, improved plant growth, and yield of
eggplant (Ebrahim et al. 2012).
Quantitative Real-Time PCR (qRT-PCR) Analysis for Starch
Metabolism Gene
Expression of ADP-glucose pyrophosphorylase (AGPase) small subunit was
assayed by q-RT PCR in RNA isolated from the control and FA-treated tobacco
leaves collected at different time intervals post-FA application. The RNA from
leaves treated with NAA was used as a positive control in the experiment.
Application of FA and NAA resulted in ∼threefold reduction in AGPase
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
Fulvic Acid and Nutrient Uptake 749
FIGURE 4 Gene expression profile of ADP glucose pyrophosphorylase post fulvic acid and
naphthylacetic acid application (A), and time course of gene expression profile of ADP glu-
cose pyrophosphorylase (AGPase) in fulvic acid treated samples (B). Experiment was repeated
three times and similar pattern of down-regulation was observed.
transcript level (Figure 4A). A time course study found that the AGPase tran-
script levels were lowest at 12h post-application of FA (Figure 4B) and slowly
recovered by 48h. Down-regulation of AGPase, a rate-limiting enzyme in
starch biosynthesis (Taiz and Zieger 2010), reportedly reduces starch content
(Kwak et al. 2007; Sanjaya et al. 2011). Similar results were obtained by appli-
cation of NAA on small subunit of AGPase in tobacco cell lines (Miyazawa
et al. 1999). A decrease in AGPase transcript level was observed after 6h; a
maximum level was achieved at 12h and the level then slowly came down
to normal after 48h of application of 2, 4 dichlorophenoxyacetic acid, a
synthetic auxin (Miyazawa et al. 2002). The FA, which has an auxin-like
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
750 P. B. N. V . et al .
activity, could have induced similar changes in AGPase gene expression and
starch levels.
Global Gene Expression Changes Upon FA Application with Specific
Emphasis on Potassium and Starch Metabolism
Transcriptome sequencing was carried out to elucidate the global gene
expression changes in FA- and NAA-treated leaf samples. High through-
put RNA sequencing with Illumina HiSeq2000 generated 20 and 40 million
single-end reads for the control and treated samples, respectively, with more
than 90% being high-quality reads. These reads were assembled and then
aligned against contigs assembled from tobacco transcriptome data (D. S.
Gurumurthy, personal comm. 2013) to obtain information on expression lev-
els for specific transcripts. Contigs that showed differential expressions were
annotated against TAIR database (www.arabidopsis.org).
Transcriptome sequence of the treated plants revealed significant differ-
ences in gene expression pattern relative to the control. Gene expression
changes induced by FA application were similar to those induced by NAA,
but the fold-change was much higher with NAA treatment. A few genes
were down regulated 7-fold and many others were up regulated 12-fold
(Figure 5A and 5B). Expression of 5177 transcripts affected by foliar appli-
cation of FA was annotated and categorized based on their GO-ontology
function (Figure 6A-D). Many auxin-related pathways were up regulated,
including photosynthesis (Calvin cycle, light harvesting complexes), gly-
colysis (pyruvate kinase), cell division (cyclins, cyclin-dependent kinases,
mitogen-activated protein kinases [MAPK]), nitrogen fixation (nitrate trans-
porters, nitrate reductase), starch (amylases, water dikinase, glucosidases),
transcription factors, protein synthesis (translation initiation factors, ribo-
somes), and translocation of sugars (plastidic glucose translocator [PGLCT],
glucose phosphate translocator [GPT2]).
Annotated gene list was used to identify genes involved in K transport,
sugar, and starch metabolism to deduce the effect of FA on expression of
enzymes/proteins involved in their respective pathways. Many transporters
and channels involved in K uptake and mobilization were up regulated in FA-
and NAA-treated samples (Table 2). Ashley et al. (2006) and Philippar et al.
(1999) explained that auxin acted as a signal for low potassium and triggered
the plant to express high affinity transporters/channels for its uptake. One of
the reasons for enhanced K content in FA-treated leaves could be the auxin-
like effect of FA. Auxin-like effect of humic substances is not uncommon, as
reported by several workers (Nardi et al. 1994; Muscolo et al. 1998,1999)on
the basis of analytical and biochemical assays. Our NGS data indicate that
mode of action of FA in facilitating K absorption and transport may be similar
to that of auxin as it activates auxin-signaling pathway.
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
Fulvic Acid and Nutrient Uptake 751
FIGURE 5 Gene expression pattern of whole genome as obtained by next generation
sequencing is expressed as Whisker plot for fulvic acid (A) and naphthylacetic acid (B) treated
leaves. The chart represents gene expression levels that have a range of −5to+15 fold (+2to
+15 fold: up regulated genes; −0.5 to +2 fold: neutral genes; −0.5 to −5 fold: down regulated
genes).
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
752 P. B. N. V . et al .
FIGURE 6 Functional classification of transcripts (number indicated in parenthesis) of fulvic
acid (A and B) and naphthylacetic acid (C and D) treated leaves. Most of the up-regulated
genes are involved in photosynthesis and cell division followed by potassium transport and
starch degradation.
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
Fulvic Acid and Nutrient Uptake 753
TABLE 2 List of transporters/channels that get over-expressed because of fulvic acid
application and their role in potassium mobilization (root to leaves)
S. No Transporters Function
1KUP/AKT1/PIP Transporters involved in K uptake from root
2 AKT 2 and 3 Phloem loading and transport of K to other parts
3 CNGC Transport of K to other parts
4KCO/KAT Transporter involved in mesophyll movement (in leaves) of K ion
Global gene expression profile indicates that various enzymes involved
in degradation of large molecules (starch) to simple sugars were up regulated
upon FA or NAA application (Figures S-3a & b). Enzymes such as amy-
lase, isoamylase, and glucan water dikinase, which catalyze initial reactions
of starch degradation (leads to glucans of different chain length), were
highly up regulated in FA-treated plants. The FA not only affects synthesis of
starch but also activates enzymes that degrade stored starch (Supplementary
Table 1). Sugar metabolism in wheat seedlings implicates involvement of FA
in up-regulation of starch-degrading enzymes (α-amylases) (Xu et al. 1998).
Our results are in agreement with a similar report on application of humic
acid in reducing starch synthesis in tobacco (Ye et al. 2009).
Thus, based on results obtained from biochemical and molecular stud-
ies, we can conclude that foliar application of FA enhances K uptake and
reduces starch in FCV tobacco of the SBCS region. Further, FA elicits almost
similar gene expression changes as those caused by auxin. These findings
also support the use of FA for crop species grown in soils where bioavail-
ability and accessibility of nutrients is a constraint in achieving higher yields.
CONCLUSION
Foliar application of FA has a significant beneficial influence on general qual-
ity of FCV tobacco of the SBCS region. Specifically, FA resulted in increased
leaf K and reduced starch contents. Molecular analysis revealed that FA
activated expression of high-affinity K transporters (enhanced K uptake),
degraded stored starch, and energized plant metabolism (efflux of trios-
PO4 for sucrose synthesis). We believe this is the first report on FCV tobacco
grown on black soils that provides encouraging and consistent results that
comprehensively highlight inclusive benefits of FA both from agronomic and
molecular dimensions.
ACKNOWLEDGEMENTS
We thank Dr. C.C. Lakshmanan, Head, ITC-LSTC, ITC Ltd., Bangalore, India,
for his continued support during the study. We appreciate Dr. M. Mani, Chief
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
754 P. B. N. V . et al .
Scientist, Research division, research & technical staff of ILTD, Rajahmundry,
India, for supporting us to conduct field experiments and sample analysis.
We also thank Dr. PRS Reddy, CTRI, Rajahmundry, India, for his crucial input
for field experiment and Dr. Venkata Reddy (Agriscience) for useful sugges-
tions during the preparation of the manuscript. Ms. Priya personally thanks
Sravanthi and Pavani for their help during starch analysis. Editorial and use-
ful tips from the Corp R&D in-house manuscript committee are appreciated.
Overall support from team Agriscience, LSTC, is gratefully acknowledged.
SUPPLEMENTAL MATERIAL
Supplemental data for this article can be accessed on the publisher’s website.
REFERENCES
Ashley, M. K., M. Grant, and A. Grabov. 2006. Plant responses to potassium
deficiencies: A role for potassium transport proteins. J. Exp. Bot. 57:425–436.
Asik, B. B., M. A. Turan, H. Celik, and A. V. Katkat. 2009. Effects of humic substances
on plant growth and mineral nutrients uptake of wheat (Triticum durum cv.
Salihli) under conditions of salinity. Asian J. Crop. Sci. 1:87–95.
Brady, N. C., and R. R. Weil. 1999. The nature and properties of soils, 9th ed. New
York, NY: Macmillan.
Cakmak, I., C. Hengeler, and H. Marschner. 1994. Changes in phloem export
of sucrose in leaves in response to phosphorus, potassium and magnesium
deficiency in bean plants. J. Exp. Bot. 45:1251–1257.
Cakmak, I. 2005. The role of potassium in alleviating detrimental effects of abiotic
stresses in plants. J. Plant Nutr. Soil Sci. 168:521–530.
Canellas, L. P., L. R. L. Teixeira Junior, L. B. Dobbss, C. A. Silva, L. O. Medici, D. B.
Zandonadi, and A. R. Façanha. 2008. Humic acids cross interactions with root
and organic acids. Ann. Appl. Biol. 153:157–66.
Chen, Y., and T. Aviad. 1990. Effect of humic substances on plant growth. In Humic
substances in soil and crop science, edited by P. McCarthy, C. E. Clapp, R. L.
Malcolm, P. R. Bloom, 161–186. Madison, WI: American Society of Agronomy,
Demiral, M. A., and A. T. Koseoglu. 2005. Effect of potassium on yield, fruit quality,
and chemical composition of greenhouse-grown Galia melon. J. Plant Nutr.
28:93–100.
Ebrahim, A., K. M. Mohammad, M. Maral, R. Hamid, and Bozorgi. 2012. Effects of
bio, mineral nitrogen fertilizer management, under humic acid foliar spraying on
fruit yield and several traits of eggplant (Solanum melongena L.). Afr. J. Agric.
Res. 7:1104–1109.
Geraldson, C. M. 1985. Potassium nutrition of vegetable crops. In Potassium in
agriculture, edited by R. S. Munson, 915–927. Madison, WI: ASA-CSSA-SSSA.
Havlin, J. L., J. D. Beaton, S. L. Tisdale, and W. L. Nelson. 1999. Soil fertility and
fertilizers, 6th ed. Upper Saddle River, NJ: Prentice Hall.
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
Fulvic Acid and Nutrient Uptake 755
Huber, S. C. 1984. Biochemical basis for effects of K deficiency on assimilate export
rate and accumulation of soluble sugars in soybean leaves. Plant Physiol.
76:424–430.
Jackson, M. L. 1967. Soil and plant chemical analysis. New Delhi, India: Prentice
Hall of India, Pvt. Ltd.
Jifon, J. L., and G. E. Lester. 2009. Foliar potassium fertilization improves fruit quality
of field-grown muskmelon on calcareous soils in south Texas. J. Sci. Food Agric.
89:2452–2460.
Juan, L., Z. Mingqing, and L. Qiong. 2005. Effects of interaction of potassium, calcium
and magnesium on flue-cured tobacco growth and nutrient absorption. J. Anhui
Agric. Univ. 32:529–533.
Kanai, S., K. Ohkura, J. J.Adu-Gyamfi, P. K. Mohapatra, N. T. Nguyen, H. Saneoka,
and K. Fujita. 2007. Depression of sink activity precedes the inhibition of
biomass production in tomato plants subjected to potassium deficiency stress.
J. Exp. Bot. 58:2917–2928.
Krishnamurthy, V., and B. V. Ramakrishnayya. 1997. Potassium fertility of flue-cured
tobacco growing soils of India. J. Potassium Res. 13:159–169.
Krishnamurthy, V., B. V. Ramakrishnayya, and K. Deo Singh. 2001. Potassium man-
agement for improving yield and quality of flue-cured tobacco. J. Potassium Res.
17:231–235.
Kwak, M. S., S. R. Min, S. M. Lee, K. N. Kim, J. R. Liu, K. H. Paek, J. S. Shin,
and J. M. Bae. 2007. A sepal-expressed ADP-glucose pyrophosphorylase gene
(NtAGP) is required for petal expansion growth in ‘Xanthi’ tobacco. Plant
Physiol. 145:277–289.
Lester, G. E., J. L. Jifon, and G. Rogers. 2005. Supple-mental foliar potassium appli-
cations during muskmelon fruit development can improve fruit quality, ascorbic
acid, and 13-carotene contents. J. Amer. Soc. Hort. Sci. 130: 649–653.
Lester, G. E., J. L. Jifon, and D. J. Makus. 2006. Supplemental foliar potassium appli-
cations with or without a surfactant can enhance netted muskmelon quality.
Hort Sci. 41:741–744.
Lester, G. E., J. L. Jifon, and J. M. Donald. 2010. Impact of potassium nutrition on
food quality of fruits and vegetables: A condensed and concise review of the
literature. Better Crops. 94:1.
Mahaboob Basha, S. K., and G. RajeswaraRao. 1980. Effect of potassium deficiency
on growth & metabolism of peanut (Arachis hypogaea L.) plants. Proc. Indian
Acad. Sci. (Plant. Sci.) 89:415–420.
Mahavishnan, K., V. N. V. Priya, A. P. Upadhyay, and N. Sharma. 2011. Patent on
Fulvic Acid; an effective foliar nutrition for enhancing the quality and yield of
SBCS tobacco. Ref No. 1210/Kol/2011.
Marschner, H. 1995. Functions of mineral nutrients: macronutirents. In Mineral nutri-
tion of higher plants,2
nd ed., edited by H. Marschner, 299–312. New York, NY:
Academic Press.
Marschner, H., E. A. Kirkby, and I. Cakmak. 1996. Effect of mineral nutritional status
on shoot-root partitioning of photo assimilates and cycling of mineral nutrients.
J. Exp. Bot. 47:1255–1263.
McCready, R. M., J. Guggolz, V. Silviera, and H. S. Owens. 1950. Determination of
starch & amylase in vegetables. Anal. Chem. 22:1156–1158.
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
756 P. B. N. V . et al .
Miller, A. J., and S. J. Smith. 1996. Nitrate transport and compartmentation in cereal
root cells. J. Exp. Bot. 300:843–54.
Miyazawa, Y., A. Sakai, S. Miyagishima, H. Takano, S. Kawano, and T. Kuroiwa.
1999. Auxin &cytokinin have opposite effects on amyloplast development &
the expression of starch synthesis genes in cultured bright yellow-2 tobacco
cells. Plant Physiol. 121:461–470.
Miyazawa, Y., N. Kutsuna, H. Kuroiwa, T. Kuroiwa, N. Inada, and S. Yoshida.
2002. Dedifferentiation of starch-storing cultured tobacco cells: effects of 2, 4-
dichlorophenoxy acetic acid on multiplication, starch content, organellar DNA
content, & starch synthesis gene expression. Plant Cell Rep. 21:289–295.
Muscolo, A., S. Cutrupi, and S. Nardi. 1998. IAA detection in humic substances. Soil
Biol. Biochem. 30:1199–1201.
Muscolo, A., F. Bovalob, F. Gionfriddob, and S. Nardi. 1999. Earthworm humic matter
produces auxin-like effects on Daucuscarota cell growth & nitrate metabolism.
Soil Biol. Biochem. 31:1303–1311.
Mylonas, V. A., and C. B. McCants. 1980. Effects of humic & fulvic acids on growth
of tobacco. 2. Tobacco growth & ion uptake. J. Plant Nutr. 2:377–393.
Nardi, S., M. R. Panuccio, M. R. Abenavoli, and A. Muscolo. 1994. Auxin-like effect of
humic substances extracted from faeces of Allolobophoracaliginosa & A. Rosea.
Soil Biol. Biochem. 26:1341–1346.
Nardi, S., D. Pizzeghello, A. Muscolo, and A. Vianello. 2002. Physiological effects of
humic substances on higher plants. Soil Biol. Biochem. 34:1527–1536.
Pascual, J. A., C. Garcia, and T. Hernandez. 1999. Comparison of fresh and com-
posted organic waste in their efficacy for the improvement of arid soil quality.
Bioresour. Technol. 68:255–264.
Paul, M. J., and T. K. Pellny. 2003. Carbon metabolite feedback regulation of leaf
photosynthesis and development. J. Exp. Bot. 54:539–547.
Pettigrew, W. T. 1999. Potassium deficiency increases specific leaf weights and leaf
glucose levels in field-grown cotton. Agron. J . 91:962–968.
Philippar, K., I. Fuchs, H. Luthen, S. Hoth, and C. S. Bauer. 1999. Auxin-induced
K channel expression represents an essential step in coleoptile growth and
gravitropism. Proc. Natl. Acad. Sci. U.S.A. 96:186–191.
Piccolo, A., G. Celano, and G. Pietramellara. 1993. Effects of fractions of coal-derived
humic substances on seed germination and growth of seedlings (Lactuga sativa
and Lycopersicumesculentum). Biol. Fertil. Soil. 16:11–15.
Prabhavathi, K., B. I. Bidari, G. B. Shashidhara, and J. C. Mathad. 2008. Influence of
sources and levels of potassium on quality attributes and nutrient composition
of red chilies. Karnataka J. Agric. Sci. 21:379–381.
Priya, V. N. V., H. Bindumadhava, K. Mahavishnan, A. P. Upadhyay, and N. Sharma.
2011. Effect of fulvic acid in improving carbon (14C) uptake and translocation in
tobacco. J. Plant Biol. 38:67–70.
Quaggiotti, S., B. Ruperti, D. Pizzeghello, O. Francioso, V. Tugnoli, and S. Nardi.
2004. Effect of low molecular size humic substances on nitrate uptake and
expression of genes involved in nitrate transport in maize (Zea mays L.). J. Exp.
Bot. 55:803–813.
Rauthan, B. S., and M. Schnitzer. 1981. Effect of soil fulvic acid on the growth and
nutrient content of cucumber plants. Plant Soil. 63:491–495.
Raschke, K. 1975. Stomatal action. Annu Rev Plant Physiol. 26:309–340.
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
Fulvic Acid and Nutrient Uptake 757
Rufty, T. W., and S. C. Huber. 1983. Changes in starch formation and activities of
sucrose phosphate synthase and cytoplasmic fructose-1, 6-bisphosphatase in
response to source-sink alterations. Plant Physiol. 72:474–480.
SanjayaDurett, T. P., S. E. Weise, and C. Benning. 2011. Increasing the energy den-
sity of vegetative tissues by diverting carbon from starch to oil biosynthesis in
transgenic Arabidopsis. Plant Biotechnol. J . 9:874–883.
Sheen, J. 1990. Metabolic repression of transcription in higher plants. Plant Cell.
2:1027–1038.
Srinivas, D., and B. V. Seshaiah. 1993. Quantity-intensity parameters of potassium in
tobacco growing soils of and Andhra Pradesh [India]. Tob. Res. 19:37–40.
Stitt, M., J. Lunn, and B. Usadel. 2010. Arabidopsis and primary photosynthetic
metabolism: More than the icing on the cake. Plant J . 61:1067–1091.
Taiz, L., and E. Zeiger. 2010. Plant physiology, 5th ed. Sunderland, MA: Sinauer
Associates.
Tisdale, S. L., W. L. Nelson, and J. D. Beaton. 1985. Soil and fertilizer potassium. In
Soil Fertility and Fertilizers,4
th ed., edited by S. L. Tisdale, W. L. Nelson, and J.
D. Beaton, 249–291. New York, NY: Macmillan.
Trevisan, S., D. Pizzeghello, B. Ruperti, O. Francioso, A. Sassi, and K. Palme. 2009.
Humic substances induce lateral root formation and expression of the early
auxin responsive IAA19 gene and DR5 synthetic element in Arabidopsis. Plant
Biol. 12:604–614.
Trevisan, S., O. Francioso, S. Quaggiotti, and S. Nardi. 2010. Humic substances
biological activity at the plant-soil interface. From environmental aspects to
molecular factors. Plant Signal Behav. 5:635–643.
Varanini, Z., and R. Pinton. 1995. Humic substances and plant nutrition. Prog. Bot.
56:97–117.
White, H. L. 1936. The interaction of factors in the growth of Lemna.7. The effect of
potassium on growth and multiplication. Ann. Bot. 5:175–196.
Wuzhong, N. 2002. Yield and quality of fruits of solanaceous crops as affected by
potassium fertilization. Better Crops Inter. 16:1.
Xu, Y., J.H. Liu, A. Peng, and Z. J. Wang. 1998. Effect of selenium and fulvic acid
on the sugar metabolism in wheat seedling. Acta Scientiae Circumstantiae.
18:401–405.
Xudan, X. 1986. The effect of foliar application of fulvic acid on water use, nutrient
uptake & yield in wheat. Aust. J. Agric. Res. 37:343–350.
Yaofu, W. 2005. Effect of irrigation and rate of humic acid on concentration of
nutrients and yield and quality of flue-cured tobacco. J. Anhui Agric. Sci.
33:96–97.
Ye, X., A. Ling, B. Zhang, X. Liu, Y. Li, and G.Liu. 2009. Effect of humic acid fertilizer
on soil properties and leaf qualities of tobacco. Acta Agriculturae Boreali Sinica.
24:170–173.
Downloaded by [Bindumadhava H] at 19:49 20 October 2014
