Content uploaded by Patrick Joseph Waters
Author content
All content in this area was uploaded by Patrick Joseph Waters on Apr 02, 2015
Content may be subject to copyright.
Patrick Waters, PhD*
Mark Woodhall, PhD*
Kevin C. O’Connor, PhD
Markus Reindl, PhD
Bethan Lang, PhD
Douglas K. Sato, MD
Maciej Jurynczyk, MD
George Tackley, MBBCh
Joao Rocha, MD
Toshiyuki Takahashi, MD
Tatsuro Misu, MD
Ichiro Nakashima, MD
Jacqueline Palace, MD
Kazuo Fujihara, MD
M. Isabel Leite, DPhil
Angela Vincent, FRS
Correspondence to
Dr. Waters:
paddy.waters@ndcn.ox.ac.uk
Supplemental data
at Neurology.org/nn
MOG cell-based assay detects non-MS
patients with inflammatory neurologic
disease
ABSTRACT
Objective: To optimize sensitivity and disease specificity of a myelin oligodendrocyte glycoprotein
(MOG) antibody assay.
Methods: Consecutive sera (n 51,109) sent for aquaporin-4 (AQP4) antibody testing were
screened for MOG antibodies (Abs) by cell-based assays using either full-length human MOG
(FL-MOG) or the short-length form (SL-MOG). The Abs were initially detected by Alexa Fluor goat
anti-human IgG (H 1L) and subsequently by Alexa Fluor mouse antibodies to human IgG1.
Results: When tested at 1:20 dilution, 40/1,109 sera were positive for AQP4-Abs, 21 for SL-
MOG, and 180 for FL-MOG. Only one of the 40 AQP4-Ab–positive sera was positive for SL-
MOG-Abs, but 10 (25%) were positive for FL-MOG-Abs (p50.0069). Of equal concern, 48%
(42/88) of sera from controls (patients with epilepsy) were positive by FL-MOG assay. However,
using an IgG1-specific secondary antibody, only 65/1,109 (5.8%) sera were positive on FL-MOG,
and AQP4-Ab–positive and control sera were negative. IgM reactivity accounted for the remain-
ing anti-human IgG (H 1L) positivity toward FL-MOG. The clinical diagnoses were obtained in 33
FL-MOG–positive patients, blinded to the antibody data. IgG1-Abs to FL-MOG were associated
with optic neuritis (n 511), AQP4-seronegative neuromyelitis optica spectrum disorder (n 54),
and acute disseminated encephalomyelitis (n 51). All 7 patients with probable multiple sclerosis
(MS) were MOG-IgG1 negative.
Conclusions: The limited disease specificity of FL-MOG-Abs identified using Alexa Fluor goat anti-
human IgG (H 1L) is due in part to detection of IgM-Abs. Use of the FL-MOG and restricting to
IgG1-Abs substantially improves specificity for non-MS demyelinating diseases.
Classification of evidence: This study provides Class II evidence that the presence of serum
IgG1- MOG-Abs in AQP4-Ab–negative patients distinguishes non-MS CNS demyelinating
disorders from MS (sensitivity 24%, 95% confidence interval [CI] 9%–45%; specificity
100%, 95% CI 88%–100%). Neurol Neuroimmunol Neuroinflamm 2015;2:e89; doi: 10.1212/
NXI.0000000000000089
GLOSSARY
Abs 5antibodies; ADEM 5acute disseminated encephalomyelitis; AQP4 5aquaporin-4; CBA 5cell-based assay; CI 5
confidence interval; EDTA 5ethylenediaminetetraacetic acid; FACS 5fluorescent-activated cell sorting; FL-MOG 5full-
length human MOG; LETM 5longitudinally extensive TM; MOG 5myelin oligodendrocyte glycoprotein; MS 5multiple scle-
rosis; NMO 5neuromyelitis optica; NMOSD 5NMO spectrum disorder; ON 5optic neuritis; PEI 5polyethylenimine; SL-
MOG 5short-length MOG; TM 5transverse myelitis.
Antibodies (Abs) that bind the CNS-restricted membrane protein myelin oligodendrocyte gly-
coprotein (MOG) were first described by ELISA or Western blot predominantly in patients with
multiple sclerosis (MS), but they have also been described in patients with bacterial or viral CNS
inflammation or neuromyelitis optica (NMO).
1–11
These findings were not reproducible using
*These authors contributed equally to the manuscript.
From the Nuffield Department of Clinical Neurosciences (P.W., M.W., B.L., M.J., G.T., J.R., J.P., M.I.L., A.V.), John Radcliffe Hospital, Oxford,
UK; Department of Neurology (K.C.O.), Yale School of Medicine, New Haven, CT; Clinical Department of Neurology (M.R.), Innsbruck
Medical University, Innsbruck, Austria; Department of Neurology (D.K.S., I.N.) and Department of Multiple Sclerosis Therapeutics (T.M., K.F.)
Tohoku University School of Medicine, Sendai, Japan; and Department of Neurology (T.T.), Yonezawa National Hospital, Yonezawa, Japan.
Funding information and disclosures are provided at the end of the article. Go to Neurology.org/nn for full disclosure forms. The Article Processing
Charge was paid by the authors.
This is an open access article distributed under the terms of the Creative Commons Attribution-Noncommercial No Derivative 3.0 License, which
permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially.
Neurology.org/nn © 2015 American Academy of Neurology 1
ª2015 American Academy of Neurology. Unauthorized reproduction of this article is prohibited.
similar methods,
12–18
but serologic findings and
different experimental approaches suggested
that MOG-Abs may be pathogenic.
19–23
More-specific assays using soluble, tetramerized
extracellular domain of native MOG identified
Abs in a subset of patients with acute dissemi-
nated encephalomyelitis (ADEM) but rarely in
adult-onset MS cases, now suggesting that the
test could be of relevance for discriminating MS
from other demyelinating syndromes.
24
This
was confirmed by cell-based assay (CBA) that
also used a truncated MOG, in which MOG-
Abs were found in patients with aquaporin-4
(AQP4)–seronegative NMO but not those
with MS.
25,26
CBA using full-length human
MOG (FL-MOG) appears to be more sensi-
tive, and a clinical phenotype of ADEM and
AQP4-seronegative NMO spectrum disorder
(NMOSD), often optic neuritis (ON), is
emerging.
27–36
However, positivity in healthy
individuals and patients with MS, even at rela-
tively high serum dilutions (up to 1:640), af-
fects its clinical use.
Here we confirm that C-terminal truncation
of the MOG antigen reduces assay sensitivity
and that many of the low positive Abs found
to bind to FL-MOG result from cross-
reactivity of the anti-human IgG secondary
antibody with IgM Abs. Using IgG1-specific
secondary antibody allows use of lower serum
dilutions with FL-MOG, with improved spec-
ificity for patients with ON, transverse myelitis
(TM), AQP4-Ab–negative NMO, or ADEM.
METHODS Patients. Consecutive serum samples from 1,109
individuals sent for routine AQP4-Ab testing over 3 months were
studied. Samples are sent to Oxford via clinical immunology
laboratories with very limited or no clinical information. Sera from
118 of the 180 FL-MOG–positive samples were used to assess
different secondary Abs, and 15/180 FL-MOG–seropositive
samples were used for flow cytometry (a flow diagram of which
samples were tested on the different assays is shown in figure 1).
To assess the clinical relevance, a brief anonymized questionnaire was
sent after the analyses to 48 identifiable referring clinicians requesting
patient diagnosis, treatment responses, and relapses, if any. Controls
were sera from previously archived cohorts. To validate the results, 2
other cohorts were screened. Patients seen at the National NMO
Specialised Services who had already been tested for AQP4-Abs were
tested for MOG-IgG1-Abs. After testing was completed, the
diagnoses and follow-up times from the seropositive patients were
obtained from a database. A further cohort of 101 Japanese patients
with a range of demyelinating diagnoses (see Results) followed by or
referred to Tohoku University Hospital and who had been previously
tested for AQP4-Abs were tested for MOG-IgG1-Abs. All assays
were carried out blinded to the clinical diagnoses.
Ethics. Ethics have been approved for the study of any patients
whose samples have been referred to the Neuroimmunology lab-
oratory in Oxford for diagnostic testing (Oxfordshire REC A;
07/Q1604/28 Immune factors in neurological disease). Since
January 2010, data on all patients seen within the Oxford clinical
NMO service have been entered prospectively into a clinical data-
base and patient serum samples have been routinely tested for
AQP4-Abs and MOG-Abs. The ethics committee of Tohoku
University Graduate School of Medicine approved this study,
and all participants provided written informed consent.
Constructs. The cloning of M23 isoform of human AQP4 has
been described previously.
7
FL-MOG was cloned into
pIRES2-DsRed2 using the forward primer (59-39):
gatcctcgagccaccatggcaagcttatcaagaccctctctg and the reverse
primer (59-39): gatccccgggtcagaagggatttcgtagctcttcaagg. A
C-terminal–truncated MOG construct was created from the
full-length construct by insertion of a stop codon after Gly155
and excision of the remainder of the C-terminus. The 2 forms
differ only in the intracytoplasmic domain (figure 2A).
Cell-based assays. HEK293T cells, polyethylenimine (PEI)
transfected with human M23-AQP4, FL-MOG, or C-
terminal–truncated human MOG (short-length MOG; SL-
MOG) were used as the substrate for live CBAs, which were
performed as described elsewhere.
7–9
Patient sera were tested at
1:20 dilution. The Alexa Fluor 488 goat anti-human IgG (H 1L)
from Invitrogen (A1013, Carlsbad, CA) was used at 1:750 dilution.
A semiquantitative scoring system was used: 0, no binding;
1, low-level binding; 2–4, increasing level of specific binding.
Figure 1 Flow diagram of the assays and the samples that were evaluated
A total of 1,109 samples were initially screened at a serum dilution of 1:20 for antibodies to
aquaporin-4 (AQP4), short-length MOG (SL-MOG), and full-length human MO G (FL-MOG). Dif-
ferent secondary antibodies were then evaluated on FL-MOG–positive serum samples by FL-
MOG cell-based assay (CBA) or flow cytometry. When the assay was established, 2 patient
cohorts with clinical diagnoses from Oxford, UK and Sendai, Japan were used to calculate
assay metrics.
2Neurology: Neuroimmunology & Neuroinflammation
ª2015 American Academy of Neurology. Unauthorized reproduction of this article is prohibited.
Samples scoring .1 were considered positive. The average of 2
individual’sscoresisplotted(M.W.,P.W.).
Subclasses. Alexa Fluor 488 mouse anti-human IgG1 (A10631,
Invitrogen) and mouse anti-human IgM (A21215, Invitrogen),
both at 1:500 dilution, or anti-human IgG3 (1:50 dilution,
I7260, Sigma-Aldrich, Gillingham, UK) followed by Alexa
Fluor 488 goat anti-mouse IgG (H 1L; A11001, Invitrogen)
were used as secondary or tertiary Abs. These assays were carried
out as described previously except cells were fixed after the final
antibody incubation.
Flow cytometry. A similar method to that used for detection of
AQP4-Abs (as described in Waters et al.
37
) was used here for FL-
MOG detection. Briefly, HEK293T cells were transfected using
PEI for 16 hours with the pIRES2-DsRed2 plasmid that contained
the complementary DNA for FL-MOG. After washing and
incubation for 24 hours at 37°C in 5% CO
2
, the cells were
trypsinized and resuspended in Dulbecco’smodifiedEagle’s
medium, 1% fetal calf serum, 1 mM ethylenediaminetetraacetic
acid (EDTA) (fluorescent-activated cell sorting [FACS] buffer) at
1.0 310
6
cells/mL. The cells were rotated at 4°C for 1 hour. All
further steps were carried outat 4°C. Patient serum (diluted 1:10 in
FACS buffer) was mixed with 1.0 310
5
cells (100 mL). After
rocking for 1 hour, the cells were washed, and bound IgG was
detected with Alexa Fluor 488 goat anti-human IgG (diluted
1:500 in FACS buffer), Alexa Fluor 488 anti-human IgG1, or
Alexa Fluor anti-human IgM for 30–45 minutes. The cells were
washed, resuspended in 400 mL phosphate-buffered saline/2 mM
EDTA, and analyzed by FACScalibur. The level of transfection was
determined by measuring DsRed intensity (PE-Texas red channel)
in live cells (figure 3D, y-axis). Two gates were created: the upper
gate captured cells expressing high levels of DsRed; the lower gate
captured untransfected or poorly transfected cells and served as a
negative control for each sample (figure 3Da). Bound IgG was
measured in the green channel (a shift to the right on the x-axis).
A score for each serum was determined by subtracting the median
green fluorescence in the lower gate from the median green
fluorescence in the upper gate.
Statistics. A 2-tailed Wilcoxon matched-pairs signed-rank test
was used to compare the FL-MOG and SL-MOG assays. The
Mann-Whitney unpaired 2-tailed ttest or Fisher exact test was
used to compare groups (p,0.05 was considered significant).
Primary research question. Does this MOG assay using an
anti-human IgG1-specific secondary antibody identify a
Figure 2 Antibodies to MOG detected with anti-human IgG (H 1L) as the secondary antibody
(A) Schematic of the human MOG proteins tested. The extracellular and transmembrane domains are identical, but the short-length MOG (SL-MOG) is 73
amino acids shorter at the C-terminus than full-length MOG (FL-MOG). (B) Screening 1,109 consecutive samples sent for aquaporin-4 (AQP4) antibody test-
ing. With anti-human IgG (H 1L) as the secondary antibody, 21 SL-MOG–positive samples and 180 FL-MOG–positive samples were identified; however, a
cohort of epilepsy sera demonstrates the striking lack of specificity in the FL-MOG assay. Comparing the AQP4 seropositivity in the 2 MOG assays, 1/38
AQP4-positive samples were also positive for SL-MOG antibodies (C), compared with 10/38 for FL-MOG antibodies (D). CBA 5cell-based assay.
Neurology: Neuroimmunology & Neuroinflammation 3
ª2015 American Academy of Neurology. Unauthorized reproduction of this article is prohibited.
subgroup of AQP4-antibody–seronegative patients with a non-
MS CNS demyelinating disease?
This study provides Class II evidence that the presence of
serum IgG1-Abs specific for MOG can distinguish AQP4-Ab–
negative patients with non-MS CNS demyelinating diseases from
those with MS. The Japanese patients were used to calculate the
assay metrics: 6 of 25 AQP4-Ab–negative patients with non-MS
demyelinating diseases were MOG-IgG1 positive, for a sensitivity
of 24% (95% confidence interval [CI] 9%–45%), and 0 of 27
patients with MS were MOG-IgG1 positive, for a specificity of
100% (95% CI 88%–100%).
RESULTS Out of 1,109 samples sent for diagnostic
testing for AQP4-Abs, 40 sera were positive at 1:20
dilution. The SL-MOG assay detected Abs in 21
patients, including 1 (low positive) who was strongly
positive for AQP4 (figure 2, B and C). However, the
FL-MOG assays detected antibodies in 180 sera (16%
of the test cohort), and 10 of these sera were also
positive for AQP4-Abs (figure 2D). Positive results
for FL-MOG were also found in 42/88 sera from
patients with epilepsy (48%, figure 2B).
Control groups and 118/180 FL-MOG–positive
sera that were available were retested by CBA using
either anti-IgG1 or anti-IgM class-specific secondary
Abs (figure 3). With anti-IgM, 101/118 test sera,
7/10 healthy individuals, and 11/17 patients with MS
were positive. The secondary antibody alone did not
bind to FL-MOG–transfected HEK cells, and the con-
trol sera were negative on AQP4-transfected cells. With
anti-IgG1, by contrast, only 65 of 118 sera had scores
of greater than 1, and negative results were found in 49
patients with MS, 13 healthy sera, and 14 AQP4-Ab–
positive controls (figure 3C).
Figure 3 Antibodies to MOG using different secondary antibodies: Anti-human IgG (H 1L), IgG1, or IgM
(A) Comparison of binding to full-length myelin oligodendrocyte glycoprotein (FL-MOG) using anti-human IgG (H 1L), anti-IgM, or anti-IgG1 secondary
antibodies with 3 different test sera (a-c) and a healthy control serum (con). (B) IgM and (C) IgG1 binding scores for patients and healthy controls (HC).
(D.a) PIRES2-DsRed2-FL-MOG transiently transfected HEK cells are separated into cells that express MOG and DsRed2 well (in the upper section of the
graph) or poorly or not at all (lowest section of the graph). (D.b) Healthy control sera (upper panels) causes a specific shift in the MOG-transfected cells
compared to the untransfected cells when anti-human IgG (H 1L) or anti-human IgM secondary antibodies are used (arrows), but not when anti-human IgG1
secondary antibodies are used. The lower panels show higher shifts in sera positive for FL-MOG antibodies compared to controls in the upper panel. (E)
Fifteen samples that were IgG (H 1L) positive and 5 healthy controls were tested on flow cytometry with anti-IgM or IgG1. A high cutoff is generated with
anti-human IgM secondary antibody (DMFI of 270) vs a DMFI of 2.5 for the anti-human IgG1 antibody. Of note, one IgM-positive patient is IgG1 negative (blue
circle). Ab 5antibody; AQP4 5aquaporin-4; CBA 5cell-based assay; MFI 5mean fluorescence intensity; MS 5multiple sclerosis.
4Neurology: Neuroimmunology & Neuroinflammation
ª2015 American Academy of Neurology. Unauthorized reproduction of this article is prohibited.
Table 1 Antibody subclass specificity, IgG (H 1L) endpoint titration, SL-MOG cell-based assay score, sex, age at testing, and clinical description of 33 patients
Isotype
IgG (H 1L)
endpoint titer
SL-MOG
score Sex, age, y
Presentation or initial
diagnosis Diagnosis Treatment Recovery Relapse
IgG1 1,200 4.0 M, 32 NMO NMOSD IVMP and steroid taper, PEX Substantial No
800 0 M, 23 BON rON IVMP and steroid taper Partial No
1,600 0 F, 36 Sequential BON BON IVMP and steroid taper No Yes
800 0 F, 38 BON BON IVMP Good No
200 0 F, 54 CRION CRION Steroids, cyclosporin, MMF Yes Yes
300 0 M, 55 NMO historic case NMOSD pre AQP4 Steroids, azathioprine Yes Yes
3,200 3.0 F, 48 RON rON Steroids, azathioprine Incomplete No
3,200 1.0 F, 45 NMOSD-like NMOSD None Substantial No
200 0 M, 47 BON BON Steroids only Yes No
200 0 F, 57 Tumefactive lesions, ? CNS vasculitis Vasculitis? Steroids, cylcophosphamide Yes No
800 2.5 F, 39 ON ON Steroids only Very good No
1,200 0 F, 3.3 ADEM ADEM IVMP Full No
1,600 0 F, 29 ON ON None Partial Not clear
800 3.5 F, 67 NMO-like but AQP4 antibody negative rLETM Steroids only Good Not after
treatment
300 0 F, 33 BON BON Steroids only Very good No
800 0 F, 28 Sequential BON rBON Steroids only Yes (third episode) No
100 0 M, 30 rBON rON None Spontaneous Yes
IgG3 3,200 0 M, 51 ON, myelitis, patchy cord lesions Probable MS IVMP Full No
IgM 25 0 F, 50 6 years pain, aching, fatigue, visual
disturbance, ? TM
Other Steroids only No
75 0 F, 30 Single episode ON, some focal
WM lesions
ON None Spontaneous No
20 0 F, 34 Tumefactive MS, homonymous
hemianopia, ON, cord lesions;
OCB positive
Probable MS Steroids and DMT Yes Yes
20 0 F, 30 Probable MS Probable MS None Yes but not full Yes
20 0 M, 44 Probable MS, many previous minor events Probable MS None Partial Yes
20 0 F, 24 Pain and tingling, perineal numbness,
bladder disturbance, patchy cord
lesions
Probable MS,
probable CIS
Steroids only Yes No
Continued
Neurology: Neuroimmunology & Neuroinflammation 5
ª2015 American Academy of Neurology. Unauthorized reproduction of this article is prohibited.
To further examine the lack of specificity in this
assay, a group of 15 FL-MOG–seropositive samples
and 5 healthy controls were tested by flow cytometry
(figure 3D). IgG in healthy control sera bound to FL-
MOG–transfected cells when compared to the un-
transfected control cells in the same test sample when
using anti-human IgG (H 1L) or anti-human IgM
secondary Abs, but not with the anti-human IgG1
secondary antibody (figure 3D, horizontal arrows).
Using the median score 16 SDs of the 5 healthy
control sera, very different cutoffs were generated:
270 for the IgM antibody and 2.5 for the IgG1 anti-
body. One sera (large bluecircle) demonstrated strong
positivity using anti-human IgM secondary antibody
but was negative for IgG-Abs (IgG3, 4 were also neg-
ative on this sample; data not shown).
Clinical phenotypes. Questionnaires on 38/48 patients
(selected because the referring clinician could be iden-
tified) who were positive for IgG (H 1L) Abs were
returned, but complete IgG1 and IgM antibody re-
sults were only available in 33 (17 IgG1-specific,
1 IgG3, and 15 IgM only). The isotype, FL-MOG
endpoint titers, SL-MOG scores, and clinical
diagnoses are shown in table 1. Seven patients with
MS were positive with anti-human IgG (H 1L) or
anti-IgM but not with anti-IgG1. In contrast, all of
the anti-IgG1–positive patients had a clinical
diagnosis of non-MS inflammatory demyelinating
CNS disease. ON was more common with IgG1-
MOG-Abs (11/17 vs 3/15; p50.02). In addition,
one 51-year-old male patient with ON and myelitis
with patchy cord lesions and high levels of IgG3
antibodies (endpoint titer of 3,200) was diagnosed
with probable MS.
The majority of patients in each group substan-
tially improved (13/17 IgG1 group vs 7/13 IgM on-
ly), and relapses were found in both groups (5/16
IgG1 and 6/12 IgM only).
Confirmatory cohorts. AQP4-seropositive NMOSD
patients (37 NMO, 11 TM, 33 ON) seen by the
Oxford NMO service were negative for MOG-IgG1-
Abs; however, 23 AQP4-seronegative patients
(8NMO,1TM,9ON,1ON1TM, 4 ADEM)
were MOG-IgG1 positive (figure 4A, table 2).
Thirteen patients with NMO were double
seronegative. Hence, of the 58 patients seen in
Oxford that fulfill the 2006 Wingerchuk criteria for
NMO, 37 (63.8%) are AQP4 seropositive, 8 (13.8%)
MOG-IgG1 positive, and 13 (22.4%) double
seronegative.
A second cohort of 101 Japanese patients with
inflammatory CNS diseases was screened with anti-
IgG1/FL-MOG without knowledge of the clinical
phenotype or AQP4 status. None of the AQP4-
seropositive patients (28 NMO, 5 recurrent ON, 6
Table 1 Continued
Isotype
IgG (H 1L)
endpoint titer
SL-MOG
score Sex, age, y
Presentation or initial
diagnosis Diagnosis Treatment Recovery Relapse
75 0 F, 33 MRI multiple lesions, progressive
disease
Progressive MS Steroids only Yes Relapses now
progressing
100 0 F, 19 Myelitis and ON thickening, ? NMOSD rLETM/? MS Steroids only Yes No
100 0 M, 77 LETM LETM Steroids only Partial No
100 0 M, 42 TM, not LETM TM (thoracic) IVMP Very good No
75 0 F, 28 BON, 2 cerebellar lesions, CSF:
18 WBC
BON IV steroids Yes No
400 0 F, 56 Recurrent TM Not clear Steroids Partial Yes
100 0 M, 32 Probable atypical MS,
myelitis but only small patch
Probable MS IVMP Partial Stepwise progression
150 0 F, 22 Probable relapsing MS Probable MS Steroids only No Yes
20 0 M, 55 Left visual loss, atypical ON ON None Partial Not clear
Abbreviations: ADEM 5acute disseminated encephalomyelitis; AQP4 5aquaporin-4; BON 5bilateral ON; CIS 5clinically isolated syndrome; CRION 5chronic relapsing inflammatory ON; DMT 5disease-modifying
therapy; IVMP 5IV methylprednisolone; LETM 5longitudinally extensive TM; MMF 5mycophenolate mofetil; MS 5multiple sclerosis; NMO 5neuromyelitis optica; NMOSD 5NMO spectrum disorder; OCB 5
oligoclonal band; ON 5optic neuritis; PEX 5plasma exchange; rBON 5recurrent BON; rLETM 5recurrent LETM; rON 5recurrent ON; SL-MOG 5short-length myelin oligodendrocyte glycoprotein; TM 5transverse
myelitis; WBC 5white blood cell; WM 5white matter.
All patients were seronegative for AQP4 antibodies.
6Neurology: Neuroimmunology & Neuroinflammation
ª2015 American Academy of Neurology. Unauthorized reproduction of this article is prohibited.
monophasic longitudinally extensive TM [LETM], 10
recurrent LETM) were MOG-IgG1 positive, but 6
samples had IgG1-MOG-Abs, with a clinical diagnosis
of bilateral ON (3/3), monophasic LETM (1/10), or
ADEM (2/11). The remainder of the cohort was dou-
ble seronegative (3 NMO, 4 recurrent ON, 3 mono-
phasic LETM, 27 MS, and 9 ADEM (figure 4). In
contrast to the Oxford cohort, in which 8/23 AQP4-
seronegative NMO patients were MOG-IgG1 posi-
tive, none of the 3 AQP4-seronegative NMO patients
from Tohoku were MOG-IgG1 positive. The majority
of the MOG-IgG1–seropositive patients had a single
attack and good recovery after steroid treatment, but 2
children with ADEM relapsed (table 2).
DISCUSSION MOG-Abs have been detected using
different methods, which affects the patient groups
that are identified as seropositive. Initially, using
peptide Western blots or ELISAs, patients with MS
or viral or bacterial encephalitis were identified as
MOG seropositive. More recently, the extracellular
domain of native MOG has been used in immuno-
precipitation assays in which the majority of patients
with MS were seronegative but one-third of patients
with ADEM were seropositive. The advent of the
CBA enabled native human MOG to be expressed
on the cell surface as a target for these Abs.
Unfortunately, sera from many healthy individuals
diluted 1:20 were seropositive using this assay;
therefore, a “high-titer”serum cutoff of 1:160 is
used to differentiate patient cohorts from healthy
individuals. A few patients with MS, AQP4-
seropositive patients, and healthy controls are still
positive using this “high-titer”cutoff.
30
We confirm the lack of disease specificity of the
MOG CBA at 1:20: 16% of sera sent for AQP4
Figure 4 Confirmatory cohorts to assess MOG-IgG1 assay
(A) All 81 aquaporin-4 (AQP4)- seropositive patients (blue) from the Oxford National neuromyelitis optica (NMO) service
were negative for IgG1 antibodies to myelin oligodendrocyte glycoprotein (MOG); however, 23 AQP4-seronegative patients
were identified as MOG-IgG1 seropositive (red). Of the 58 patients with NMO, 37 (63.4%) were AQP4 seropositive, 8
(13.8%) were MOG-IgG1 seropositive, and 13 (22%) were double seronegative. (B) A second cohort from Japan was
screened blinded to clinical information. None of the 49 AQP4-seropositive patients (blue) or 27 patients with multiple scle-
rosis (MS) were positive for MOG antibodies, but 6/25 patients with acute disseminated encephalomyelitis (ADEM), trans-
verse myelitis (TM), optic neuritis (ON), or AQP4-seronegative NMO were MOG antibody positive (red). CBA 5cell-based
assay.
Neurology: Neuroimmunology & Neuroinflammation 7
ª2015 American Academy of Neurology. Unauthorized reproduction of this article is prohibited.
testing and nearly 50% of patients with epilepsy were
MOG positive. Similar positivity is seen in healthy
control sera (data not shown). The secondary anti-
body IgG (H 1L) binds to more than the IgG anti-
body class, which appears to affect the MOG CBA
more than CBAs in which other targets are expressed
(e.g., AQP4, GlyR). When examined by flow cytom-
etry, the “low- level”binding of healthy control sera
visualized by CBA is replicated by a specific shift in
the MOG-transfected cells when compared to the
untransfected or poorly transfected cells. Two advan-
tages of this quantitative system are that the
background binding can be quantified and a cutoff
can be generated based on healthy sera. Using 6 SDs
above the mean of a group of healthy control sera, the
IgG (H 1L) antibody gave a cutoff of 470, with the
top of the assay 10 times this cutoff value (data not
shown). Using the same control and test samples, the
anti-human IgM secondary antibody gave a cutoff of
270, with the top of the assay only 3 times the cutoff
and with very few positive samples, whereas the anti-
human IgG1 antibody cutoff was just 2.5 and the top
of the assay was 220 times this cutoff. The specificity
of the MOG-IgG1 assay was confirmed by CBA in
Table 2 Demographics, diagnoses, treatment, and response to treatment in the confirmatory cohorts tested
from Oxford and Japan
Sex, age, y Diagnosis Treatment Recovery Relapse
Oxford F, 12 ADEM IVMP 1steroid tapering Complete No
F, 6 ADEM Acyclovir 1IVIg followed by oral steroids Substantial No
M, 3 ADEM ON Steroids, IVIg, and PEX, then azathioprine
and prednisolone
Substantial Yes
M, 27 ADEM, LETM IVMP then oral steroids Partial Yes
F, 37 BON IVMP and oral steroids Substantial Yes
M, 33 BON IVMP 1steroid tapering and PEX Partial No
M, 4 BON IVMP 1steroid tapering Substantial No
F, 59 LETM IVMP 1steroid tapering Complete No
F, 34 NMO IVMP, oral steroids Substantial Yes
F, 23 NMO None Complete Yes
M, 16 NMO IVMP 1steroid tapering Partial Yes
M, 36 NMO IVMP 1steroid tapering, azathioprine Partial Yes
M, 24 NMO IVMP, oral steroids, azathioprine Partial Yes
M, 31 NMO IVMP, PEX, oral steroids Complete No
F, 34 NMO IVMP, oral steroids Substantial Yes
M, 17 NMO IVMP, oral steroids Substantial Yes
F, 14 ON IVMP, oral steroids Substantial No
F, 54 ON brain IVMP, oral steroids, MMF Partial Yes
M, 27 ON TM brain IVMP, oral steroids, interferon bPartial Yes
F, 43 RION IVMP, oral steroids, methotrexate None Yes
F, 42 RION IVMP, methotrexate, oral steroids Partial Yes
M, 8 RION IVMP, oral steroids, PEX, azathioprine Partial Yes
M, 34 RION None Partial Yes
Japan M, 28 BON IVMP 1steroid tapering Yes No
M, 70 BON IVMP 1steroid tapering Yes No
M, 37 BON IVMP 1steroid tapering Yes No
M, 50 Myelitis IVMP Yes No
M, 1.3 ADEM IVMP 1steroids Yes Yes
F, 9 ADEM IVMP 1steroids Yes Yes
Abbreviations: ADEM 5acute disseminated encephalomyelitis; BON 5bilateral ON; Brain 5changes seen on brain MRI;
IVIg 5IV immunoglobulin; IVMP 5IV methylprednisolone; LETM 5longitudinally extensive TM; MMF 5mycophenolate
mofetil; NMO 5neuromyelitis optica; ON 5optic neuritis; PEX 5plasma exchange; RION 5relapsing inflammatory ON;
TM 5transverse myelitis.
None of the patients were aquaporin-4 antibody positive.
8Neurology: Neuroimmunology & Neuroinflammation
ª2015 American Academy of Neurology. Unauthorized reproduction of this article is prohibited.
which 49 patients with MS, 13 healthy control sera,
and 14 AQP4-seropositive serum samples were all neg-
ative at a dilution of 1:20, whereas 65 of the 118
samples that were positive using IgG (H 1L) second-
ary antibody remained positive using the IgG1-specific
antibody. None of the MOG-IgG1–positive patients
with an available clinical diagnosis had MS, suggesting
that this assay may be valuable to help distinguish
patients with MS from those with ADEM or AQP4-
Ab–negative NMOSD. Furthermore, 60/65 (92%)
IgG1-positive samples had IgG (H 1L) endpoint
titers $1:200, indicating that the IgG1 assay identifies
not only the patients above cutoff with the anti-IgG
(H 1L) but also disease-relevant Abs that fall below
this cutoff. These findings are consistent with a previ-
ous report that high-titer MOG-Abs were exclusively
of the IgG1 isotype.
30,36,38
Detection of IgM by CBA at a serum dilution of
1:20 did not distinguish different patient groups from
healthy controls, limiting its diagnostic use. The flow
cytometry data show that something in healthy and
patient sera binds to the surface of MOG-
transfected cells at low levels and is detected by
anti-human IgG (H 1L) or IgM antibodies. This
is consistent with other studies reporting high levels
of MOG-IgM-Abs using immunoblot or ELISA
1,18,39
and might be explained by the observation that MOG
binds to components of the immune system such as
C1q or DC-SIGN.
40,41
The SL-MOG assay was previously shown to be
negative in patients with MS and healthy controls,
26,27
but here it only identified 32.3% of the IgG1 FL-
MOG-Abs–positive samples (see table 1). As the extra-
cellular domains are identical in the 2 constructs, the
differences in assay sensitivity may be due to expression
level on the surface, glycosylation, or ability to multi-
merize. Two of the 21 SL-MOG–positive patients
were IgM positive only. The low sensitivity of the
SL-MOG assay limits its use in clinical practice.
Although this work is retrospective with limited
clinical descriptions of the patients, it does suggest
that the anti-IgG1/FL-MOG antibody assay can be
useful in identifying MOG-Abs in patients with
demyelinating diseases who are unlikely to have
MS. Prospective studies with longer-term follow-up
are needed to establish the clinical utility of this assay.
AUTHOR CONTRIBUTIONS
Drafting/revising the manuscript: all authors. Study concept or design:
P.W. Analysis or interpretation of data: P.W., A.V. Contribution of vital
reagents/tools/patients: K.C.O., M.R., D.K.S., M.J., G.T., J.R., T.T.,
T.M., I.N., K.F. Acquisition of data: P.W., M.W., D.K.S., A.V. Statis-
tical analysis: P.W., A.V. Study supervision or coordination: P.W.
Obtaining funding: J.P., A.V.
STUDY FUNDING
NHS National Specialised Services for Neuromyelitis Optica (P.W.,
M.W., J.P., M.I.L., A.V.), the Oxford Biomedical Research Centre
(M.I.L., P.W., A.V.), the ERA-net E-rare EDEN project (P.W., M.R.,
A.V.), KAKENHI (22229008) of The Ministry of Education, Culture,
Sports, Science and Technology (MEXT) of Japan, and the Health and
Labour Sciences Research Grant on Intractable Diseases (Neuroimmuno-
logical Diseases) from the Ministry of Health, Labour and Welfare of
Japan (D.K.S., T.T., T.M., I.N., K.F.). M.J. received research fellowship
from the Polish Ministry of Science and Higher Education program
Moblinosc Plus (1070/MOB/2013/0).
DISCLOSURE
P. Waters has received speaker honoraria from Biogen Idec Japan and
Euroimmun AG; has been a review editor for Frontiers in Molecular
Innate Immunity; holds a patent for assays for the detection and anti-
bodies to lGi1, Caspr2, and tag-1; and has submitted a patent for
GABARR. M. Woodhall reports no disclosures. K.C. O’Connor has
received travel funding and speaker honorarium from ACTRIMS-
CMSC and has received research support from NIH and Nancy Davis
Foundation for Multiple Sclerosis. M. Riendl is an academic editor for
PLOS ONE; is on the editorial board for Current Medicinal Chemistry
and Autoimmune Diseases; and has received research support from
Austrian Science Fund, Austrian Federal Ministry of Science, and Jubi-
laeumsfonds of the Austrian National Bank. M. Reindl and Medical
University of Innsbruck receive payments for antibody assays (AQP4
and antineuronal antibodies) and for AQP4 antibody validation experi-
ments organized by Euroimmun. B. Lang is a member of the Medical
Committee of Mayaware; holds a patent for use of LGI1 as an antigen in
detection of autoantibodies and use of GABAa gamma subunit in detec-
tion of autoantibodies; receives research support from Epilepsy Research
UK; and received royalties for use of LGI1 as an antigen in detection of
autoantibodies. Her department receives payment for running diagnostic
assays for a range of autoantibodies. D.K. Sato has received research
support from Ministry of Education, Culture, Sports, Science & Tech-
nology (MEXT) in Japan, Japanese Government Scholarship Program,
and Ichiro Kanehara Foundation. M. Jurynczyk has received research
support from the Polish Ministry of Science and Higher Education.
G. Tackley and J. Rocha report no disclosures. T. Takahashi has received
speaker honoraria from Biogen Idec and Cosmic Corporation. T. Misu
has received speaker honoraria from Bayer Schering Pharma, Biogen Idec,
and Mitsubishi Pharma; has received research support from Bayer
Schering Pharma, Biogen Idec Japan, Asahi Kasei Kuraray Medical
Co., The Chemo-Sero-Therapeutic Research Institute, Teva Pharmaceu-
tical K.K., Mitsubishi Tanabe Pharma Corporation, and Teijin Pharma;
and has received Grants-in-Aid for Scientific Research from the Ministry
of Education, Science and Technology and the Ministry of Health, Labor
and Welfare of Japan. I. Nakashima has received travel funding/and or
speaker honoraria from Biogen Idec Japan, Tanabe Mitsubishi, and
Novartis Pharma; is an editorial board member for Multiple Sclerosis
International; and received research support from LSI Medience Corpo-
ration. J. Palace has been a UK advisory board participant for Merck
Serono, Bayer Schering Pharma, Biogen Idec, Teva Pharmaceutical
Industries Ltd, Novartis Pharmaceuticals UK Ltd, Sanofi-Aventis, and
Alexion; has received travel funding and/or speaker honoraria from
ECTRIMS, Merck Serono, Novartis, Biogen Idec, Bayer Schering, and
ISIS Innovation Limited, a wholly owned subsidiary of the University of
Oxford; has filed a patent application to protect for the use of metab-
olomics as a method to diagnose and stage disease in multiple sclerosis;
has consulted for Ono Pharmaceuticals Ltd, Chigai Pharma Ltd, CI
Consulting, Biogen Idec, and GlaxoSmithKline; and has received research
support from Bayer Schering, Merck Serono, Novartis, Department of
Health, MS Society, and UK Guthy Jackson Foundation. K. Fujihara
serves on scientific advisory boards for Bayer Schering Pharma, Biogen
Idec, Mitsubishi Tanabe Pharma Corporation, Novartis Pharma, Chugai
Pharmaceutical, Ono Pharmaceutical, Nihon Pharmaceutical, Merck
Serono, Alexion Pharmaceuticals, Medimmune, and Medical Review;
has received funding for travel and speaker honoraria from Bayer Schering
Pharma, Biogen Idec, Eisai Inc., Mitsubishi Tanabe Pharma Corporation,
Novartis Pharma, Astellas Pharma Inc., Takeda Pharmaceutical Company
Limited, Asahi Kasei Medical Co., Daiichi Sankyo, Nihon Pharmaceuti-
cal, and Cosmic Corporation; is on the editorial board for Clinical and
Experimental Neuroimmunology; is an advisory board member of Sri
Lanka Journal of Neurology; and has received research support from Bayer
Neurology: Neuroimmunology & Neuroinflammation 9
ª2015 American Academy of Neurology. Unauthorized reproduction of this article is prohibited.
Schering Pharma, Biogen Idec Japan, Asahi Kasei Medical, The Chemo-
Sero-Therapeutic Research Institute, Teva Pharmaceutical, Mitsubishi
Tanabe Pharma, Teijin Pharma, Chugai Pharmaceutical, Ono Pharma-
ceutical, Nihon Pharmaceutical, Genzyme Japan, Ministry of Education,
Science and Technology of Japan, and Ministry of Health, Welfare and
Labor of Japan. M.I. Leite has received travel funding and/or speaker
honoraria from Biogen Idec and has received research support from NHS
specialised commissioning group for neuromyelitis optica, UK and
NIHR Oxford Biomedical Research Centre. A. Vincent has received
travel funding and speaker honoraria from Baxter International Inc and
Biogen Inc; is on the editorial board for Neurology; was an associate editor
for Brain; holds a patent with Oxford University for LGI1/CASPR2
antibodies, licensed to Euroimmun AG, and for GABAAR antibodies,
in negotiation with Euroimmun AG; received royalties from Athena
Diagnostics, Euroimmun AG, Blackwell Publishing, and Mac Keith
Press; has consulted with Athena Diagnostics; and has received research
support from NIHR. Go to Neurology.org/nn for full disclosure forms.
Received December 13, 2014. Accepted in final form January 20, 2015.
REFERENCES
1. Berger T, Rubner P, Schautzer F, et al. Antimyelin antibod-
iesasapredictorofclinicallydefinite multiple sclerosis after a
first demyelinating event. N Engl J Med 2003;349:139–145.
2. Klawiter EC, Piccio L, Lyons JA, et al. Elevated intrathecal
myelin oligodendrocyte glycoprotein antibodies in multi-
ple sclerosis. Arch Neurol 2010;67:1102–1108.
3. Zhou D, Srivastava R, Nessler S, et al. Identification of a
pathogenic antibody response to native myelin oligoden-
drocyte glycoprotein in multiple sclerosis. Proc Natl Acad
Sci USA 2006;103:19057–19062.
4. Zadro I, Brinar V, Horvat G, Brinar M. Clinical relevance
of antibodies against myelin oligodendrocyte glycoprotein
in different clinical types of multiple sclerosis. Clin Neurol
Neurosurg 2007;109:23–26.
5. Lalive PH, Menge T, Delarasse C, et al. Antibodies to
native myelin oligodendrocyte glycoprotein are serologic
markers of early inflammation in multiple sclerosis. Proc
Natl Acad Sci USA 2006;103:2280–2285.
6. Gaertner S, de Graaf KL, Greve B, Weissert R. Antibodies
against glycosylated native MOG are elevated in patients
with multiple sclerosis. Neurology 2004;63:2381–2383.
7. Markovic M, Trajkovic V, Drulovic J, et al. Antibodies
against myelin oligodendrocyte glycoprotein in the cere-
brospinal fluid of multiple sclerosis patients. J Neurol Sci
2003;211:67–73.
8. Reindl M, Linington C, Brehm U, et al. Antibodies
against the myelin oligodendrocyte glycoprotein and the
myelin basic protein in multiple sclerosis and other neu-
rological diseases: a comparative study. Brain 1999;122:
2047–2056.
9. Bernard CC, Johns TG, Slavin A, et al. Myelin oligoden-
drocyte glycoprotein: a novel candidate autoantigen in
multiple sclerosis. J Mol Med (Berl) 1997;75:77–88.
10. Xiao BG, Linington C, Link H. Antibodies to myelin-
oligodendrocyte glycoprotein in cerebrospinal fluid
from patients with multiple sclerosis and controls.
J Neuroimmunol 1991;31:91–96.
11. Haase CG, Schmidt S. Detection of brain-specific autoan-
tibodies to myelin oligodendrocyte glycoprotein, S100beta
and myelin basic protein in patients with Devic’s neuro-
myelitis optica. Neurosci Lett 2001;307:131–133.
12. Pittock SJ, Reindl M, Achenbach S, et al. Myelin oligo-
dendrocyte glycoprotein antibodies in pathologically
proven multiple sclerosis: frequency, stability and clinico-
pathologic correlations. Mult Scler 2007;13:7–16.
13. Karni A, Bakimer-Kleiner R, Abramsky O, Ben-Nun A.
Elevated levels of antibody to myelin oligodendrocyte gly-
coprotein is not specific for patients with multiple sclero-
sis. Arch Neurol 1999;56:311–315.
14. Lim ET, Berger T, Reindl M, et al. Anti-myelin antibodies
do not allow earlier diagnosis of multiple sclerosis. Mult
Scler 2005;11:492–494.
15. Wang H, Munger KL, Reindl M, et al. Myelin oligoden-
drocyte glycoprotein antibodies and multiple sclerosis in
healthy young adults. Neurology 2008;71:1142–1146.
16. Pelayo R, Tintoré M, Montalban X, et al. Anti-myelin
antibodies with no progression to multiple sclerosis. N
Engl J Med 2007;356:426–428.
17. Kuhle J, Pohl C, Mehling M, et al. Lack of association
between anti-myelin antibodies and progression to multi-
ple sclerosis. N Engl J Med 2007;356:371–378.
18. Lampasona V, Franciotta D, Furlan R, et al. Similar low
frequency of anti-MOG IgG and IgM in MS patients and
healthy subjects. Neurology 2004;62:2092–2094.
19. DaleRC,TantsisEM,MerhebV,etal.AntibodiestoMOG
have a demyelination phenotype and affect oligodendrocyte
cytoskeleton. Neurol Neuroimmunol Neuroinflamm 2014;
1:e12; doi: 10.1212/NXI.0000000000000012.
20. Ikeda K, Kiyota N, Kuroda H, et al. Severe demyelination
but no astrocytopathy in clinically definite neuromyelitis
optica with anti-myelin-oligodendrocyte glycoprotein anti-
body. Mult Scler Epub 2014 Sep 25.
21. Marta CB, Bansal R, Pfeiffer SE. Microglial Fc receptors
mediate physiological changes resulting from antibody
cross-linking of myelin oligodendrocyte glycoprotein.
JNeuroimmunol 2008;196:35–40.
22. vonBüdingenHC,HauserSL,FuhrmannA,etal.Molecular
characterization of antibody specificities against myelin/oligo-
dendrocyte glycoprotein in autoimmune demyelination. Proc
Natl Acad Sci USA 2002;99:8207–8212.
23. Marta CB, Oliver AR, Sweet RA, Pfeiffer SE, Ruddle NH.
Pathogenic myelin oligodendrocyte glycoprotein antibod-
ies recognize glycosylated epitopes and perturb oligoden-
drocyte physiology. Proc Natl Acad Sci USA 2005;102:
13992–13997.
24. O’Connor KC, McLaughlin KA, De Jager PL, et al. Self-
antigen tetramers discriminate between myelin autoanti-
bodies to native or denatured protein. Nat Med 2007;13:
211–217.
25. Kitley J, Woodhall M, Waters P, et al. Myelin-oligoden-
drocyte glycoprotein antibodies in adults with a neuromy-
elitis optica phenotype. Neurology 2012;79:1273–1277.
26. Kitley J, Waters P, Woodhall M, et al. Neuromyelitis
optica spectrum disorders with aquaporin-4 and myelin-
oligodendrocyte glycoprotein antibodies: a comparative
study. JAMA Neurol 2014;71:276–283.
27. Sato DK, Callegaro D, Lana-Peixoto MA, et al. Distinc-
tion between MOG antibody-positive and AQP4
antibody-positive NMO spectrum disorders. Neurology
2014;82:474–481.
28. Reindl M, Di Pauli F, Rostasy K, Berger T. The spectrum
of MOG autoantibody-associated demyelinating diseases.
Nat Rev Neurol 2013;9:455–461.
29. Rostásy K, Mader S, Hennes EM, et al. Persisting myelin
oligodendrocyte glycoprotein antibodies in aquaporin-4
antibody negative pediatric neuromyelitis optica. Mult
Scler 2013;19:1052–1059.
30. Mader S, Gredler V, Schanda K, et al. Complement
activating antibodies to myelin oligodendrocyte
10 Neurology: Neuroimmunology & Neuroinflammation
ª2015 American Academy of Neurology. Unauthorized reproduction of this article is prohibited.
glycoprotein in neuromyelitis optica and related disor-
ders. J Neuroinflammation 2011;8:184.
31. Ramanathan S, Reddel SW, Henderson A, et al. Antibodies
to myelin oligodendrocyte glycoprotein in bilateral and recur-
rent optic neuritis. Neurol Neuroimmunol Neuroinflamm
2014;1:e40; doi: 10.1212/NXI.0000000000000040.
32. Mayer MC, Breithaupt C, Reindl M, et al. Distinction
and temporal stability of conformational epitopes on mye-
lin oligodendrocyte glycoprotein recognized by patients
with different inflammatory central nervous system dis-
eases. J Immunol 2013;191:3594–3604.
33. Rostasy K, Mader S, Schanda K, et al. Anti-myelin oligo-
dendrocyte glycoprotein antibodies in pediatric patients
with optic neuritis. Arch Neurol 2012;69:752–756.
34. Kezuka T, Usui Y, Yamakawa N, et al. Relationship
between NMO-antibody and anti-MOG antibody in
optic neuritis. J Neuroophthalmol 2012;32:107–110.
35. Brilot F, Dale RC, Selter RC, et al. Antibodies to native
myelin oligodendrocyte glycoprotein in children with
inflammatory demyelinating central nervous system dis-
ease. Ann Neurol 2009;66:833–842.
36. Probstel AK, Dornmair K, Bittner R, et al. Antibodies to
MOG are transient in childhood acute disseminated
encephalomyelitis. Neurology 2011;77:580–588.
37. Waters PJ, McKeon A, Leite MI, et al. Serologic diagnosis
of NMO: a multicenter comparison of aquaporin-4-IgG
assays. Neurology 2012;78:665–671.
38. McLaughlin KA, Chitnis T, Newcombe J, et al. Age-
dependent B cell autoimmunity to a myelin surface anti-
gen in pediatric multiple sclerosis. J Immunol 2009;183:
4067–4076.
39. Egg R, Reindl M, Deisenhammer F, Linington C,
Berger T. Anti-MOG and anti-MBP antibody subclasses
in multiple sclerosis. Mult Scler 2001;7:285–289.
40. Johns TG, Bernard CC. Binding of complement compo-
nent Clq to myelin oligodendrocyte glycoprotein: a novel
mechanism for regulating CNS inflammation. Mol Immu-
nol 1997;34:33–38.
41. García-Vallejo JJ, Ilarregui JM, Kalay H, et al. CNS mye-
lin induces regulatory functions of DC-SIGN-expressing,
antigen-presenting cells via cognate interaction with
MOG. J Exp Med 2014;211:1465–1483.
Neurology: Neuroimmunology & Neuroinflammation 11
ª2015 American Academy of Neurology. Unauthorized reproduction of this article is prohibited.
DOI 10.1212/NXI.0000000000000089
2015;2; Neurol Neuroimmunol Neuroinflamm
Patrick Waters, Mark Woodhall, Kevin C. O'Connor, et al.
MOG cell-based assay detects non-MS patients with inflammatory neurologic disease
This information is current as of March 19, 2015
Services
Updated Information & http://nn.neurology.org/content/2/3/e89.full.html
including high resolution figures, can be found at:
Supplementary Material http://nn.neurology.org/content/suppl/2015/03/19/2.3.e89.DC1.html
Supplementary material can be found at:
References http://nn.neurology.org/content/2/3/e89.full.html##ref-list-1
This article cites 40 articles, 12 of which you can access for free at:
Subspecialty Collections
http://nn.neurology.org//cgi/collection/multiple_sclerosis
Multiple sclerosis http://nn.neurology.org//cgi/collection/devics_syndrome
Devic's syndrome
myelitis
http://nn.neurology.org//cgi/collection/acute_disseminated_encephalo
Acute disseminated encephalomyelitis
following collection(s):
This article, along with others on similar topics, appears in the
Permissions & Licensing
http://nn.neurology.org/misc/about.xhtml#permissions
its entirety can be found online at:
Information about reproducing this article in parts (figures,tables) or in
Reprints http://nn.neurology.org/misc/addir.xhtml#reprintsus
Information about ordering reprints can be found online:
2015 American Academy of Neurology. All rights reserved. Online ISSN: 2332-7812.
Published since April 2014, it is an open-access, online-only, continuous publication journal. Copyright ©
is an official journal of the American Academy of Neurology.Neurol Neuroimmunol Neuroinflamm
