CNR1 Gene Polymorphisms on Bipolar Disorder Patients

Full text

Rs6454674, Rs806368 and Rs1049353 CNR1 Gene Polymorphisms in
Turkish Bipolar Disorder Patients: A Preliminary Study
Gökay Alpak1, Sertan Çöpoğlu1, Esra Geyik2, Ahmet Ünal1, Mehri İğci2, Yusuf Ziya İğci2, İbrahim Bozgeyik2, Feridun Bülbül1,
Haluk A. Savaş1
Author aliations:
1
Department of Psychiatry,
2
Department of Medical
Biology, Gaziantep University, Gaziantep, Turkey
Correspondence to: gokayalpak@gmail.com (G.Alpak)
Received: April 10, 2014
Accepted: Apr 28, 2014
Dis Mol Med 2014;2: 28-31
DOI:10.5455/dmm.20140428011918
Key words: CNR1 gene,
polymorphisms, bipolar disorder
Abstract
Bipolar disorder (BD) is one of the most prevalent psychiatric disorders in clinical prac-
tice. The etiology of the BD is not thoroughly understood. Endocannabinoid system,
which is involved in regulation of emotion, stress, memory, and cognition, may have an
important role in the pathophysiology of BD. Mutations on the cannabinoid-1 receptor
(CNR1) gene are associated with several psychiatric disorders. The main cannabinoid
(CB) receptor is CB1 and its activation inhibits neuronal depolarization. One previous
study showed rs1049353 polymorphism of CNR1 gene is associated with major depres-
sion but not with BD. In this study, we aimed to investigate the rs6454674, rs806368
and rs1049353 CNR1 gene polymorphisms in Turkish BD patients. A total of 96 patients
and 58 healthy controls were included in the current case-control study. Blood samples
of study participants were collected into sterile tubes and processed to obtain genom-
ic DNA. Restriction Fragment Length Polymorphism analysis were done by digesting
the PCR products with HpyCH4III and BseGI enzymes for the rs6454674 and rs806368
restriction sites, respectively. Single-Strand Conformation Polymorphism (SSCP) analy-
sis was also performed. Among three polymorphisms investigated in this study, only
rs6454674 polymorphism was signicantly dierent between BD patients and controls
(rs6454674 T/G; p=0.042, rs806368 T/C; p>0.05, rs1049353 A/G; p>0.05). Furthermore,
we found that the mean of the yearly manic attacks was statistically higher in patients
who have heterozygote (0.91±0.67) rs6454674 T/G polymorphisms compared to those
with homozygote (p=0.043) polymorphism. The post-hoc analysis showed that the
main dierences were between the heterozygotes genotype and non-mutant (GG) ho-
mozygotes (0.42±0.31; p=0.037) but not in homozygote mutant genotype (0.74±0.74;
p=0.149). When patients were compared with the other clinical parameters, and mu-
tated alleles and genotypes for each polymorphism, we did not nd any signicant dif-
ference. These results suggest that a heterozygote advantage exists for the CNR1 gene
rs6454674 polymorphism in manic episode frequency in Turkish BD patients. The results
of our study should be conrmed in future studies with larger sample size.
Introduction
Bipolar disorder (BD) is one of the most prevalent
psychiatric disorders in clinical practice. BD is classi-
ed among aective disorders because the main issue
about the illness is aective component. Biochemical
substances, neurotransmitters, genetics, environmen-
tal circumstances, oxidative stress…etc. were associ-
ated with the etiology of the BD (1). Although there are
©2014 Disease and Molecular Medicine.
is is an Open Access article distributed under the terms of the Creative Commons Aribution Non-Commercial License (hp://creativecommons.org/licenses/by-nc/3.0)
which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Original Article
Disease and Molecular Medicine
disease &
molecular
medicine
www.dismolmed.org
Dis Mol Med 2014;2: 28-31
OPEN ACCESS
dm m
dm m

many reports about the etiology of BD, it is not thor-
oughly understood. The main accepted theory of aec-
tive disorders is the dysregulation of monoamine neu-
rotransmitters (1). Besides this in the human brain there
are several modulatory systems that may also play an
important role in the pathophysiology of BD such as
endocannabinoid system, which is involved in regula-
tion of emotion, stress, memory, and cognition (2). On
the other hand, dysfunction of this system may lead to
various psychiatric disorders such as schizophrenia, BD,
anxiety disorders, and depression (3).
Mutations on the cannabinoid-1 receptor (CNR1)
gene that codes for cannabinoid 1 (CB1) receptors are
associated with several psychiatric disorders. CB1 recep-
tors are highly expressed in olfactor receptor system,
hippocampal formation, basal ganglion, cerebellum,
and neocortex in the brain (4). The main cannabinoid
receptor is CB1 and by the activation of them leads an
inhibition on neuronal depolarization; diminish in the
production of action potential, and releasing of excita-
tory and inhibitory neurotransmitters. Thus causes a
decrease in impulse propagation. Receptor agonists for
CB1 act like antidepressants by the activation of sero-
tonin neurotransmission. Moreover, antagonism of CB1
receptors may lead depression like clinical pictures in
some patients (5,6). Cannabinoid usage may lead the
early onset of BD, and sometimes induce BD in suscep-
tible individuals (7).
There was only one study that investigated the pos-
sible relationship of CNR1 gene polymorphisms and af-
fective disorders. The results of the study showed that
there might be an association between the CNR1 gene
(rs1049353) polymorphisms and major depression but
not in BD (8). Taken all together, we aimed to research
the possible association between the additional CNR1
gene polymorphisms and BD.
Materials and Methods
Study Populations
A total of 96 patients and 58 healthy controls were
included in the current case-control study. The study
approved by the local ethics committee in accordance
with the Declaration of Helsinki. All study participants
gave informed consent before enrollment.
Blood Samples and DNA Isolation
Blood samples of study participants were collected
into sterile Vacutainer tubes with disodium ethylenedi-
aminetetraacetic acid and processed to obtain genomic
DNA. To obtain genomic DNA proteinase K digestion
and salt-chloroform method was utilized (9). Genomic
DNA samples were stored at -20 °C for the next applica-
tions.
Polymerase Chain Reaction and Restriction Fragment
Length Polymorphism Analysis
Amplication of DNA samples was achieved in AB
Thermal Cycler (ABI Inc. CA, USA). Amplied PCR prod-
ucts were veried by running through 2% agarose gel
and visualized using ethidium bromide stain. Restriction
Fragment Length Polymorphism analysis were analyzed
digesting the PCR products with HpyCH4III and BseGI
enzymes for the rs6454674 and rs806368 restriction
sites, respectively. Restriction fragments were assessed
after resolving at 3% agarose gel and ethidium bromide
visualization. Studied CNR1 gene polymorphisms, prim-
er sequences, sizes of the amplicons, and annealing
temperatures are presented in Table 1.
Single-Strand Conformation Polymorphism
Single-Strand Conformation Polymorphism analy-
ses were performed on 7% acrylamide/bisacrylamide gel
with a ratio of 49:1 as previously described (10). All SSCP
gels were neutralized with low-concentrated acetic acid
and visualized by silver staining. Further direct sequenc-
ing analysis was performed for the some of the samples
to conrm banding patterns.
Statistical Analysis
Overall statistical analysis was performed using
GraphPad Prism (v6.02, GraphPad Software Inc., San
Diego, CA, USA) and SPSS (v16.0) programs. For the
Statistical analysis of more than two groups Student-
Newman-Keuls test, for the signicance in the geno-
type and allele frequency dierences the χ2 test (with
Yate’s correction) or Fisher’s exact tests. Haplotypes
under 3% population frequency were excluded. All ap-
plied tests were two-tailed and p <0.05 was considered
as signicant.
Results
The mean ages (F=5.587, p=0.923) and the gen-
der distribution (x2=0.06; df = 1, p=0.806) of the study
groups were similar.
The distribution of the CNR1 rs6454674 (T/G), and
rs806368 (T/C) genotypes did not deviate from the Har-
29Disease and Molecular Medicine - www.dismolmed.org
DOI:10.5455/dmm.20140428011918 CNR1 gene polymorphisms in bipolar disorder patients

Table 1. Studied CNR1 gene polymorphisms, primer sequences, sizes of the amplicons, and annealing temperatures.
Reference SNP no Primer Sequences (5’ → 3’) Expected size of PCRproduct (bp) Annealing temperature (°C)
rs6454674 F: ATGCAACTGAGCTAACATGGAAT
R: ACGGGGAAATTTAGACAGGCTT 510 58
rs806368 F: GTTTCCCGCTTGAAACATTGGA
R: GAAATAGGCCCAACCACCAGA 510 59
rs1049353 F: GATCATGGTGACAATCACCTTTTCA
R: TGCGCAGCCTCTGGATAAC 300 57
F: Forward, R: Reverse
Table 2. The comparisons of the polymorphisms and alleles according to the study groups.
Genotype/Allele p OR (95% CI)
Rs6454674 Healthy Control (n=58) % Patient (n=96) %
TT 22 (37,9) 52 (54,2)
TG 27 (46,6) 32 (33,3) 0.042 2.03 (1.026-4.009)
GG 9 (15,5) 12 (12,5) 0.103 0.57 (0.294-1.119)
T 71 (61,2) 136 (70,8)
G45 (38,8) 56 (29,2) 0.082 1.53 (0.946-2.502)
HWE (x2, p) Yes (0.02, 0.988) Yes (3.58, 0.166)
Rs806368 Healthy Control (n=56) % Patient (n=92) %
TT 28 (50) 46 (50)
TC 26 (46,4) 44 (47,8) 1.000 1.00 (0.514-1.943)
CC 2 (3,6) 2 (2,2) 0.868 1.06 (0.543-2.058)
T 82 (73,2) 136 (73,9)
C30 (26,8) 48 (26,1) 0.894 1.04 (0.608-1.764)
HWE (x2, p) Yes (0.53, 0.765) Yes (5.30, 0.070)
Rs1049353 Healthy Control (n=57) % Patient (n=88) %
AA 0 0
AG 57 (100) 88 (100) 1.000
GG 0 0
A 57 (50) 88 (50)
G57 (50) 88 (50) 1.000 1.00 (0.624-1.602)
HWE (x2, p) No (57, <0.001) No (88, <0.001)
dy–Weinberg equilibrium in both healthy controls and
BD patients, but rs1049353 (G/A) genotype deviated in
both study groups. The comparison of the patients and
control groups according to the three polymorphisms
showed that any signicance except in the rs6454674
polymorphism (rs6454674 T/G; p=0.042, rs806368 T/C;
p>0.05, rs1049353 A/G; p>0.05). The comparisons of
the polymorphisms and alleles according to the study
groups are presented in Table 2.
The mean of the yearly manic attacks were statis-
tically higher in patients with heterozygote (0.91±0.67)
rs6454674 T/G polymorphism compared to those with
homozygote polymorphism (p=0.043). The post-hoc
analysis showed that the main dierences were be-
tween the heterozygotes and non-mutant (GG) ho-
mozygotes (0.42±0.31; p=0.037) but not in homozygote
mutant genotype (0.74±0.74; p=0.149). When patients
were compared with the other clinical parameters such
as; presence of past suicide attempts, total number of
episodes, onset age of BD, duration of the illness, and
mutated alleles and genotypes for each polymorphisms
we did not nd any signicant dierence.
Discussion
The main ndings of the study were; a relationship
between the rs6454674 polymorphism and BD patients,
30 Disease and Molecular Medicine - www.dismolmed.org
Alpak G et al. Dis Mol Med 2014;2: 28-31

31
DOI:10.5455/dmm.20140428011918
Disease and Molecular Medicine - www.dismolmed.org
CNR1 gene polymorphisms in bipolar disorder patients
and mean yearly manic attacks higher in heterozygotes
than non-mutant homozygotes. In recent years, BD and
major depressive patients were enrolled in a study that
found the parallel results about the rs1049353 polymor-
phism with the present study (8). In recent years there
were several studies that found a possible association
polymorphism of the CNR1 gene with aective symp-
toms and mainly with depression (11-14). However we
studied two more CNR1 polymorphisms and found that
a statistically signicant dierence in rs6454674. The
mutant allele in rs6454674 was detected as T. The distri-
bution of the genotypes showed that TT genotype was
seen more in patient groups.
Another important nding of the study was relation-
ship between the heterozygote genotype of rs6454674
polymorphism with yearly manic episodes. One may
think that the dierence should be more apparent
between the mutant and non-mutant homozygotes.
These results suggest that a heterozygote advantage
exists for the CNR1 gene rs6454674 polymorphism in
manic episode frequency in Turkish BD patients.
The small number of subjects enrolled in the groups
might be accepted as the rst limitation of the study. Al-
though the limited number of samples the Hardy–Wein-
berg equilibrium showed that the distribution of the
variables were normal. A second limitation for the pre-
sent study was the discordant number of the groups.
The results of the present study suggested that
there might be an association between CNR1 gene mu-
tation, and clinical picture of BD and prevalence of BD.
There is a need for replication of these ndings by large
sample size studies.
Conict of Interest: None
Acknowledgments: None
References
1. Akiskal HS. Mood Disorders: Historical Introduction and
Conceptual Overview. In: Sadock BJ, Sadock VA, editors.
Kaplan and Sadock’s Comprehensive Textbook of Psychi-
atry. 9th ed. Philadelphia: Lippincott Williams & Wilkins;
2009. p. 1629-45.
2. Brown JA, Horvath S, Garbett K, Schmidt MJ, Everheart
M, Gellert L, et al.The role of cannabinoid 1 receptor
expressing interneurons in behavior. Neurobiol Dis.
2014;63:210-21.
3. Ashton CH, Moore PB. Endocannabinoid system dysfunc-
tion in mood and related disorders. Acta Psychiatr Scand.
2011;124:250-61.
4. Ashton CH, Moore PB, Gallagher P, Young AH. Cannabi-
noids in bipolar aective disorder: a review and discus-
sion of their therapeutic potential. J Psychopharmacol.
2005;19:293-300.
5. Bambico FR, Katz N, Debonnel G, Gobbi G. Cannabinoids
elicit antidepressant-like behavior and activate seroton-
ergic neurons through the medial prefrontal cortex. J
Neurosci. 2007;27:11700-11.
6. Horder J, Browning M, Di Simplicio M, Cowen PJ, Harmer
CJ. Eects of 7 days of treatment with the cannabinoid
type 1 receptor antagonist, rimonabant, on emotional
processing. J Psychopharmacol. 2012;26(1):125-32.
7. Lagerberg TV, Sundet K, Amino SR, Berg AO, Ringen PA,
Andreassen OA, et al.Excessive cannabis use is associat-
ed with earlier age at onset in bipolar disorder. Eur Arch
Psychiatry Clin Neurosci. 2011;261:397-405.
8. Monteleone P, Bifulco M, Maina G, Tortorella A, Gazzerro
P, Proto MC et al.Investigation of CNR1 and FAAH endo-
cannabinoid gene polymorphisms in bipolar disorder and
major depression. Pharmacol Res. 2010;61(5):400-4.
9. Müllenbach R, Lagoda PJ, Welter C. An ecient salt-chlo-
roform extraction of DNA from blood and tissues. Trends
Genet. 1989;5:391.
10. Gögebakan B, Igci YZ, Arslan A, Igci M, Erturhan S, Oz-
tuzcu S et al.Association between the T-593A and C6982T
polymorphisms of the osteopontin gene and risk of de-
veloping nephrolithiasis. Arch Med Res. 2010;6:442-8.
11. Barrero FJ, Ampuero I, Morales B, Vives F, de Dios Luna
Del Castillo J, Hoenicka J, et al.Depression in Parkinson’s
disease is related to a genetic polymorphism of the can-
nabinoid receptor gene (CNR1). Pharmacogenom J.
2005;5:135–41.
12. Chakrabarti B, Kent L, Suckling J, Bullmore E, Baron-
Cohen S. Variations in the human cannabinoid receptor
(CNR1) gene modulate striatal responses to happy faces.
Eur J Neurosci. 2006;23:1944–8.
13. Domschke K, Dannlowski U, Ohrmann P, Lawford B, Bau-
er J, Kugel H, et al.Cannabinoid receptor 1 (CNR1) gene:
impact on antidepressant treatment response and emo-
tion processing in major depression. Eur Neuropsychop-
harmacol. 2008;18:751–9.
14. Christensen R, Kristensen PK, Bartels EM, Bliddal H,
Astrup A. Ecacy and safety of the weight-loss drug ri-
monabant: a metaanalysis of randomised trials. Lancet.
2007;370:1706–13.