First archaeogenetic results verify the mid-Holocene occurrence of Dalmatian pelican Pelecanus crispus far out of present range

Abstract

The paper presents an evaluation of subfossil bird bones from archaeological and geological sites in Europe that shows that birds of the genus Pelecanus occurred far out of their present range between 7.4 and 5.0 ka BP in the Danish archipelago. Additionally, from other northwestern European regions mid-Holocene records of pelicans are known. However, due to morphological similarities there are difficulties in species identification. In this paper ancient DNA barcoding techniques were used to clarify the species assignment of one of these records for the first time. Our results show that the bone derives from Dalmatian pelican Pelecanus crispus, a species that today breeds in 15 colonies in the eastern Mediterranean. This species identification is especially remarkable since the Dalmatian pelican is known to be less migratory. We demonstrate that the appearance and disappearance of pelicans in northwestern Europe coincide with climate parameters, since all records fall within warm periods. This applies for the larger group of Danish records during the Holocene thermal maximum in northern Europe as well as for two more groups of records from central Europe and Britain dating to 1.9 and 0.8 ka ago. Recent ecological research on the Dalmatian pelican shows that the species seems to profit from the modern climate changes and is starting to expand its range. Our paper documents that under special circumstances short-distance migrant birds are also able to expand their ranges to areas far outside of the former distribution areas. Finally, the Dalmatian pelican is presented as an indicator species reflecting special climate conditions.

Full text

344
First archaeogenetic results verify the mid-Holocene occurrence of
Dalmatian pelican Pelecanus crispus far out of present range
Elena A. Nikulina and Ulrich Schmölcke
E. A. Nikulina (elena.nikulina@schloss-gottorf.de) and U. Schmölcke, Schleswig-Holstein State Museums Foundation Schloss Gottorf, Centre for
Baltic and Scandinavian Archaeology (ZBSA), Archaeogenetics, DE-24837 Schleswig, Germany.
e paper presents an evaluation of subfossil bird bones from archaeological and geological sites in Europe that shows that
birds of the genus Pelecanus occurred far out of their present range between 7.4 and 5.0 ka BP in the Danish archipelago.
Additionally, from other northwestern European regions mid-Holocene records of pelicans are known. However, due to
morphological similarities there are difficulties in species identification. In this paper ancient DNA barcoding techniques
were used to clarify the species assignment of one of these records for the first time. Our results show that the bone derives
from Dalmatian pelican Pelecanus crispus, a species that today breeds in 15 colonies in the eastern Mediterranean. is spe-
cies identification is especially remarkable since the Dalmatian pelican is known to be less migratory. We demonstrate that
the appearance and disappearance of pelicans in northwestern Europe coincide with climate parameters, since all records
fall within warm periods. is applies for the larger group of Danish records during the Holocene thermal maximum
in northern Europe as well as for two more groups of records from central Europe and Britain dating to 1.9 and 0.8 ka
ago. Recent ecological research on the Dalmatian pelican shows that the species seems to profit from the modern climate
changes and is starting to expand its range. Our paper documents that under special circumstances short-distance migrant
birds are also able to expand their ranges to areas far outside of the former distribution areas. Finally, the Dalmatian pelican
is presented as an indicator species reflecting special climate conditions.
e present study demonstrates not only the possibility to recover avian DNA from at least 7 ka old bones, but the
relevance of such genetic analysis in combination with archaeological data, particularly if bones could not be assigned
to species level by morphological features. In such cases, aDNA is shown as a valuable tool for the reconstruction of the
avifauna of the past.
It has long been recognized that the geographical ranges of
vertebrate species have expanded and contracted in Europe
continuously since the end of the last glacial period and the
onset of the Holocene 11.6 ka BP (thousand years before
present). e most important faunal change, occurring in
the following 2 ka, was caused by successive reforestation
in the course of the climate warming (Hewitt 1999).
In those millennia, many animal species expanded their
ranges from Ice Age refugia in the Mediterranean area to
the north (Stewart et al. 2010). is fundamental change of
the fauna, which includes the whole boreal and temperate
avifauna, is quite well known by analyses of archaeological
remains of birds (Ericson and Tyrberg 2004, von den
Driesch and Pöllath 2010), but also by phylogeographic
analyses of single species (Liukkonen-Anttila et al. 2002,
Kvist et al. 2004, Brito 2005, Langguth et al. 2013).
Ongoing changes in climate towards the North Atlan-
tic mid-Holocene thermal optimum (Jansen et al. 2008,
Renssen et al. 2009) and consequently in vegetation (Davis
et al. 2003, Kalis et al. 2003), also allowed the immigration
of Mediterranean taxa to the northwestern European area
between ∼10 and ∼6 ka BP. Well known examples are the
European pond turtle Emys orbicularis (Sommer et al. 2007)
and several marine fish species (Enghoff et al. 2007). Exotic
birds have also been recorded in archaeological animal assem-
blages of Britain, central Europe and southern Scandinavia
(cf. Stewart 2004), amongst others pygmy cormorant
Phalacrocorax pygmeus, in Britain, today ranging from south-
eastern Europe to central Asia (Cowles 1981), and specimens
of the genus Pterodroma (seabirds of subtropical and tropi-
cal Atlantic Ocean) recorded in Scotland (Serjeantson 2005)
and even Sweden (Lepiksaar 1958). Some published archae-
ological records of exotic species seem to be questionable,
in particular taking the general methodological problems in
bird bone identification into account (Stewart 2005). Not
surprisingly, some records of exotic bird species have been
corrected by morphological re-analysis (Allen 2009). A good
example of a complete revision of the distribution history
after the implementation of genetic analyses of archaeologi-
cal material are sturgeons Acipenser sturio and A. oxyrinchus
(Chassaing et al. 2013, Popović et al. 2014). In birds,
however, no comparable studies have been published yet.
One of the bird taxa whose former range requires
revision is Pelecanus. From the 19th century onwards, in
© 2015 e Authors. Journal of Avian Biology © 2015 Nordic Society Oikos
Subject Editor: Martin Paeckert. Editor-in-Chief: omas Alerstam. Accepted 3 February 2015
Journal of Avian Biology 46: 344–351, 2015
doi: 10.1111/jav.00652

345
archaeological literature there are several spreading reports
about mid-Holocene pelican finds in northwestern Europe,
but these reports have not been gathered and discussed in
detail. More than this, the morphometrical identification of
pelican bones to species level is problematic (Hatting 1963,
Lorch 1992). Furthermore, keeping the present distribution
of the two European pelican species in mind, the possibil-
ity is not ruled out that the subfossil remains derive from
an extinct species or sub-species. A combination of classical
archaeozoological data with ancient and modern DNA data
is a reliable method to assess the taxonomic status of subfos-
sil bird bones, even when the species is extinct (Steeves et al.
2010).
In this paper we present the first archaeogenetic analy-
ses of an ancient Pelecanus bone. We applied genetic analy-
ses to identify the species of the pelican. It is further the
aim to present a compilation and analysis of all subfossil
records of pelicans in northwest Europe. Both results will
be linked together at the end, forming a picture of the
range development of a Mediterranean bird species.
Material and methods
In accordance with our research goals, the study had two
parts. Firstly, to get knowledge about the pelican species that
occurred during the mid-Holocene in northwestern Europe,
a key study was conducted. In the key study the pelican bones
from the archaeological coastal site of Rosenhof (Hartz and
Lübke 2006, Goldhammer 2008) in northern Germany were
in focus. At this Stone Age settlement one of the most
complete mid-Holocene pelican skeletons was excavated,
which can be considered as representative for the other
findings from diverse archeological sites in the northwestern
Europe. From this skeleton, the left ulna was 14C AMS-dated
to 6232  39 yr BP (KIA-30007), accordingly 7145  40
calendar yr BP (calibrated using CalPal; Weninger et al.
2008) and the right radius was used for genetic analyses.
Genetic analyses
e aDNA study was done in the aDNA Laboratory of the
Center of Baltic and Scandinavian Archeology in Schleswig,
Germany. No avian DNA, neither recent nor ancient was
analysed in this laboratory prior to the published study.
To obtain material for DNA extraction from the studied
bone, a hand-held electric drill with a 2.35 mm ball cutter was
used. Prior to drilling, the bone surface was cleaned (washed)
with a solution containing 1% of sodium hypochlorite and
additionally irradiated for 60 min with UV light (254 nm) to
reduce surficial contamination. About 0.4 g of bone powder
was sampled from the diaphysis. e material was dissolved
in a solution containing 300 ml 0.5 M (pH 8.0) EDTA,
300 ml MagNA Pure DNA Tissue Lysis Buffer (Roche Diag-
nostics), and 20 ml Proteinase K (20 mg ml–1). e mixture
was incubated for 24 h at 37°C. Finally, the temperature
was increased to 55°C for 2 h after addition of a fresh por-
tion of 20 ml Proteinase. e mixture was centrifuged at
3000 rpm for 1 min and 400 ml of supernatant was used
for the automated silica-based extraction with MagnaPure
Compact System and Nucleic Acid Isolation Kit I (Roche
Diagnostics). Blank extractions were processed. Addition-
ally, to test authenticity the obtained results DNA from three
sheep bones from Medieval (Haithabu) was co-extracted.
We designed and applied several universal PCR primers
for the genus Pelecanus to amplify fragments of mitochon-
drial cytochrome c oxidase subunit 1 (COI) and 12S rRNA
genes. e primer pairs that generated reproducible results
are listed in Table 1.
e PCR reaction volume was 10 ml including 2 ml of
the DNA extract. Each reaction consisted of Pfu recombi-
nant, 0.06 mM KCl, 16 mM (NH4)2SO4, 2 mM MgSO4,
1 mM dNTPs, 20 mM Tris-HCl (pH 8.8), 0.1% Triton
X-100, 0.1 mg ml–1 BSA (GeneON), and 0.5 mM of each
primer.
Amplifications were performed using the follow-
ing cycling conditions: initial denaturation at 95°C
for 3 min, followed by 50 cycles of at 95°C for 30 s,
annealing at 45°C for 30 s, extension at 72°C for 40
s, and final extension at 72°C for 5 min. PCR prod-
ucts were one time re-amplified in 20 ml reaction vol-
ume with similar composition and cycling parameters,
but the number of cycles was reduced to 30. Blank
PCR controls, blank extractions and co-extracted sheep
DNA were implemented in the PCR reaction. Such
obtained amplicons were gel-purified and cloned using
E. coli JM107 and CloneJET PCR Cloning Kit (Fermentas),
and Roti®-Transform (Carl Roth) to prepare calcium
chloride competent bacterial cells.
Transformed E. coli were incubated at 37°C for 18 h
on agar ampicillin plates. Eight to ten colonies per plate
were transferred onto a fresh selective plate and addi-
tionally incubated at 37°C for 8–10 h. We used these
colonies to perform PCR with the primer pair pJET1.2
Forward und pJET1.2 Reverse (Fermentas). e reaction
mix was as follows: 1U Taq DNA Polymerase, 0.8 mM
dNTPs, 2 mM MgSO4, 10 mM KCl, 8 mM (NH4)2SO4,
10 mM Tris-HCl (pH 8.8) (GeneON), and 0.25 mM of
each primer. Cycling parameters were: 95°C for 3 min
followed by 25 cycles at 94°C for 30 s, 60°C for 30 s,
72°C for 30 s.
PCR products were sequenced using the Sanger method
(Sanger et al. 1977) at the Inst. of Clinical Molecular
Biology, Kiel. An average three to four clones per amplicon
were sequenced. To test the reproducibility of results, all
analyses were repeated at least three times (PCR, cloning,
sequencing).
e obtained sequences were analysed using DNASTAR
and the online Basic Local Alignment Search Tool (BLAST)
(Altschul et al. 1990).
Database
In the second part of our study, starting with the data-
base ‘Holocene History of the European Vertebrate fauna’
(Benecke 1999, von den Driesch and Pöllath 2010), all
archaeological records for central and northern European
pelicans were compiled based on a careful reconsideration of
the original publications (Table 2). e database mentioned
contains information from more than 7500 Late Pleistocene
and Holocene faunal assemblages.

346
Table 1. PCR primer for the genus Pelecanus used in this study to amplify fragments of mitochondrial cytochrome c oxidase subunit 1 (COI)
and 12S rRNA genes.
Primer name Nucleotide sequence Fragment length in base pairs
with/without primer region
Pel-F1-(COI) GCCGTTCTACTACTACTGTCC
Pel-R1-(COI) AGAATGTAGTGTTTAGGTTTCGGTC 85/39
Pel-F2-(COI) ACTGTCCCTCCCAGTCTTAGCC
Pel-R2-(COI) AGCAGGGTCGAAGAATGTAGTG 82/38
Pel-F3-(COI) GGAGGCTTTGGAAACTGACTAG
Pel-R3-(COI) ATACGTGGGAATGCTATGTCTGG 65/20
Pel-F2-(12S) GGAAGGCGGATTTAGCAGTAAAG
Pel-R2-(12S) ATGTACGTGCTCCAGAGCCAG 68/24
Table 2. Holocene pelican bones out-of-range. All bones are context dated.
No. Site Date (years BP) Pelican bones Reference
1 Skateholm I 7400–5900 1, identification uncertain (ulna) Jonsson 1988
2 Østenkær 6500–5900 5 (3 fragments of a humerus, radius, ulna) Enghoff 2011
3 Havnø 7000–5700 1 (sternum) Hatting 1963
4 Mejlgård 6500–5900 2 (kind of elements not published) Ljungar 1996
5 Todbjerg Mose uncertain (bog find) 3 (coracoid, humerus, ulna) Hatting 1963
6 Brabrand Sø 6500–5900 1 (humerus) Hatting 1963
7 Syvhøje 6500–5900 14 (cranium, mandibula, 2 vertebrae, pelvis, scapula,
coracoid left and right, humerus left and right,
ulna, radius left and right, tibiotarsus)
Hatting 1963
8 Vedbæk 6500–5900 3 (coracoid, humerus, ulna) Hatting 1963
9 Stensballe Sund 6500–5900 1 (kind of element not published) Ljungar 1996
10 Kongemose 8400–7400 1 (ulnare) Noe-Nygaard 1995
11 Præstelyng 6500–5900 4 (ulna, ulnare, scapula, vertebra) Noe-Nygaard 1995
12 Sandhuse 5600–5000 2 fragments of sternum Hatting 1963
13 Åmose 6100–5700 1 (kind of element not published) Ljungar 1996
14 Ølby Lyng 6500–5900 1 (radius) Møhl 1971
15 Troldebjerg 5300–4800 1 (radius) Hatting 1963
16 Rosenhof 6800–6500 25 (tarsometatarsus left and right, ulna, two
phalanges of wings, 20 phalanges of legs)
17 Hüde I 5700–5100 2 (scapula, metatarsus) Boessneck 1978
18 Weinberg/Hitzacker 900–800 1 (vertebra) Boessneck 1982
19 Berlin-Köpenick 900–800 1 (coracoid) Müller 1977
20 Derenburg 5200–4800 1 (radius) Müller 1977
21 Trier 2000–1800 Schindler 1974
22 Assendelft F 2000–1800 11 (fragments of a skull and a vertebra) van Wijngaarden-Bakker 1988
23 Vlaardingen 5400–4500 7 (among others humerus, ulna; details unpublished) Clason and Prummel 1978
24 Hull uncertain (bog find) 1 (femur) Forbes et al. 1958
25 King’s Lynn 3000–2000 3 fused vertebrae Forbes et al. 1958
26 Feltwell Fen uncertain (bog find) 1 (humerus) Forbes et al. 1958
27 Burnt Fen uncertain (bog find) 4 (humerus, radius, ulna, tarsometatarsus) Forbes et al. 1958
28 Cambridgeshire uncertain (bog find) 1 (humerus) Forbes et al. 1958
29 Glastonbury 2100–1900  21 (all parts of the skeleton) of minimum five
birds Andrews 1899
Results
Genetic analyses
In the pelican bone from Rosenhof, all four primer systems
provided reproducible amplifications, all blanks remained
negative. In PCR reaction with sheep samples there was no
signal. Reciprocally, no amplification was obtained in the
pelican sample with application of sheep-specific primer
systems, but in reaction with DNA from sheep. Overall
34 clones were sequenced. ere was no commixture of
sequences (with exception of some single bacterial DNA and
artificial products, e.g. primer dimers or vector fragments).
e sequences resulted from three independent PCR repeti-
tions with identical results. ree fragments of COI and one
fragment of 12S genes were obtained. BLAST search showed
in all cases 100% identity between the obtained sequence
and the relevant gene fragments of Pelecanus crispus (Fig. 1).
No nucleotide variations or errors introduced by DNA
damage were detected.
All sequences are submitted to the European Nucleotide
Archive. e accession numbers are as follows: LM993796,
LM993797 and LM993798 for the COI gene and
LM993799 for 12S rRNA gene.
Database
e inventory of all reported subfossil pelican remains
outside of the modern distribution area resulted in a list of
more than 119 bones from 29 different sites in Britain, the

347
Figure 1. An alignment of the obtained sequences from the studied Pelecanus bone (designated as Pelecanus sp. from Rosenhof ) with
mitochondrial sequences of the genus Pelecanus in the following genomic regions: (1–3) cytochrome c oxidase subunit 1 (LM993796,
LM993797 and LM993798), and (4) 12S rRNA (LM993799).
Netherlands, Germany and Denmark, supplemented by an
uncertain record from southern Sweden (Table 2). e list
shows the archipelago in the western Baltic Sea as a remark-
able core area, of which alone 16 records originate (Fig. 2).
Further, seven records are from the northern European plain
and six from Britain. e number of excavated pelican bones
at the sites ranges from one to 25, but with the exception of
British Glastonbury (minimum number of specimens  5)
the collected remains can derive from single individuals.
Exclusively adults, no juveniles are recorded, again with
Glastonbury as the only exception. At this archaeological
site, in addition to the remains of adults there are also some
bones from juvenile and immature birds. Apart from some
bog finds, the majority of Pelecanus records were recovered
during excavations from anthropogenic contexts. All these
records from archaeological excavations are more or less
exactly context dated by archaeological artifacts from the
same find layer, added by the pelican bone from the archaeo-
logical site Rosenhof in the western Baltic Sea area, which
was directly dated to 7145  40 calendar yr BP. e bone
is a part of skeleton, used for our genetic analyses. Chrono-
logically, the finds cluster in the three different time frames:
between ∼7.4 and ∼5.0 ka BP, ∼2.0 ka BP and finally ∼0.9
ka BP (Fig. 3). e most conspicuous presence in these records
takes place between 7.4 and 5.0 ka BP, with 18 of the 29 records,
all located in the coastal area of the western Baltic Sea.
Discussion
In subfossil mammal bones it has been repeatedly demon-
strated that ancient DNA is able to provide insights into the
long-term dynamics of species and of population distribu-
tions (de Bruyn et al. 2011). Successful genetic analysis of
thin-walled bird bones is more difficult and therefore
very few aDNA studies about birds are published so far.
ey mainly discuss evolutionary, taxonomical, or biogeo-
graphical aspects of different bird species of the Pacific and
Australian region (ratites: Cooper et al. 2001, Bunce et al.
2005; geese: Paxinos et al. 2002; petrels: Welch et al. 2014;
eagles: Fleischer et al. 2000, Hailer et al. 2015). However,
for birds there are no studies comparable to this one that
trace historic distribution ranges using archeological data in
combination with genetic analysis.
Our genetic result gives evidence for the presence of a
short-distance migrant eastern Mediterranean bird species,

348
Figure 2. Present breeding colonies (stars) of the Dalmatian pelican
(Pelecanus crispus; combined after Crivelli 1996 and Deinet et al.
2013) and the geographic position of the subfossil pelican records
mentioned in Table 1 (dots). Dark blue dots: mid-Holocene
records, light blue dots: late Holocene records, grey dots: not
dated.
Figure 3. Dating of Holocene pelican (Pelecanus sp.) remains (num-
bers as in Table 2) and reconstructed area-average mean annual
temperature anomalies for north-west Europe (dark) and south-east
Europe (light) (after Davis et al. 2003, Fig. 4).
Pelecanus crispus in mid-Holocene northwestern Europe.
Probably also other subfossil finds of pelicans in this region
far outside of the present range also belong to the
Dalmatian pelican. is would be in agreement with the
identifications by some morphologists that had already
assumed that most of the subfossil pelican remains from
Denmark (Hatting 1963), England (Andrews 1899), and
Germany (Müller 1977) could derive from this species.
e proven occurrence of P. crispus far north of the
modern range is somewhat surprising: its present range is in
the eastern Mediterranean and Black Sea area, it is known to
be less migratory, and, furthermore, the few archaeological
records of pelicans in the Balkan area are all identified as
P. onocrotalus on the basis of morphologic criteria (Boev
1996, Gál 2007). Today, these two species occur syntopically
in south-eastern Europe. In light of the results of the present
study, the morphological identification of pelican records in
the Balkan area should be reviewed by archaeogenetic tests.
Anyway, between ∼7.4 and ∼5.0 ka BP, the number of
pelican records in the western Baltic Sea area is so numerous
that they probably do not originate from vagrants but point
to a regular expansion of the species range. In this context,
the radiocarbon dated bone from the Rosenhof site is of
special interest, because its age is approximately 300 yr older
than all the other non-pelican radiocarbon dated organic
remains and their archaeological context (Hartz and Lübke
2006, Table 1). According to Andrén et al. (2000), due to
the marine reservoir effect a correction of 300 yr should be
calculated for the remains of animals with marine diet depos-
ited during the mid-Holocene in the southwestern Baltic Sea
area. is congruence provides strong evidence of an exclu-
sively marine diet of the bird, and indicates a long stay in
a coastal area. Since there are no bones of juveniles found
yet, this is the only indication of a presence of pelicans in
mid-Holocene northwestern Europe during the whole year,
inclusive the breeding period.
Climatic (see below) as well as environmental conditions
should have been suitable for pelicans, especially because
the slowly rising water level in the Baltic basin produced
large reed beds in the coastal areas (Schmölcke et al. 2006).
Since there is a geographical gap between the records in
the broader North Sea area from England to Scania and
the main distribution area in the south-eastern Mediterra-
nean, the mid-Holocene population of P. crispus in Europe
seems to have been disjunct and divided into two main
distribution areas.
An obvious correlation between the former range of
Dalmatian pelicans far north and climate develop-
ments exists. e main observed time frame of P. crispus
occurrence in northwestern Europe corresponds with the
Holocene thermal maximum in that region, a period of rela-
tively warm climate (Renssen et al. 2009). As a reconstruc-
tion of the temperature based on pollen data shows (Davis
et al. 2003), at the maximum ∼6.0 ka BP the mean tempera-
ture of the warmest month in the area newly colonized by
pelicans reached  1.5°C compared to modern values, while
the winter temperature was slightly lower (cf. Seppä et al.
2009). Annual temperatures in northern Europe rose until
6.5 ka BP, before stabilizing at the modern level (Fig. 3).
At the same time, the eastern Mediterranean, the main
distribution area of Dalmatian pelicans in Europe, was also
affected by shifts in climate. During the mid-Holocene the
annual precipitation in the eastern Mediterranean was higher
than today, probably in the range of 800–1300 mm, without
summer droughts (Rossignol-Strick 1999), even if there was
a general trend towards drier climate (Roberts et al. 2011).
Contrasting to northern European conditions, the mid-
Holocene temperatures followed a different pattern, since
during mid-Holocene the temperatures were up to 1.5°C
lower compared to present day values (Davis et al. 2003).
Also, the second and the third group of pelican records
in northern parts of Europe appear in periods with wet-
ter and warmer summers than today (Büntgen et al. 2011,
Fig. 4). Remarkably, the pelican records from these two
younger phases do not reach the Danish area anymore. ey
are located more to the south, both at the North Sea coastal
region of Britain and the Netherlands and in central Europe
(Fig. 2). Significantly, the ancient Roman author Pliny the
Elder states in his Naturalis Historia (book 10, chapter 66)

349
Deutsche Forschungsgemeinschaft (DFG) Clusters of Excellence
‘Inflammation at Interfaces’ and ‘Future Ocean’. We thank the
technicians S. Greve, S. Arndt and T. Henke for technical support.
References
Allen, M. G. 2009. e re-identification of great bustard (Otis
tarda) from Fishbourne Roman Palace, Chichester, west Sussex,
as common crane (Grus grus). – Environ. Arch. 14: 184–190.
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. and Lipman, D.
J. 1990. Basic local alignment search tool. – J. Mol. Biol. 215:
403–410.
Andrén, E., Andrén, T. and Kunzendorf, H. 2000. Holocene
history of the Baltic Sea as a background for assessing records
of human impact in the sediments of the Gotland Basin.
– Holocene 10: 687–702.
Andrews, C. W. 1899. On some remains of birds from the Lake-
dwellings of Glastonbury, Somersetshire. – Ibis 41: 351–358.
Benecke, N. 1999. e Holocene history of the European verte-
brate fauna. Modern aspects of research. – Marie Leidorf.
Boessneck, J. 1978. Die Vogelknochen aus der Moorsiedlung Hüde
I am Dümmer, Kreis Grafschaft Diepholz. – Neue Ausgr.
Forsch. Niedersachsen 12: 155–169.
Boessneck, J. 1982. Vogelknochenfunde aus der Burg auf dem
Weinberg in Hitzacker/Elbe und dem Stadtkern von Dannen-
berg/Jeetzel (Mittelalter). – Neue Ausgr. Forsch. Niedersachsen
15: 345–394
Boev, Z. 1996. e Holocene avifauna of Bulgaria (a review of the
ornitho-archaeological studies). – Hist. Nat. Bulg. 6: 59–81.
Brito, P. H. 2005. e influence of Pleistocene glacial refugia on
tawny owl genetic diversity and phylogeography in western
Europe. – Mol. Ecol. 14: 3077–3094.
Bunce, M., Szulkin, M., Lerner, H. R., Barnes, I., Shapiro, B.,
Cooper, A. and Holdaway, R. N. 2005. Ancient DNA provides
new insights into the evolutionary history of New Zealand’s
extinct giant eagle. – PLoS Biol. 3: 1–4.
Büntgen, U., Tegel, W., Nicolussi, K., McCormick, M., Frank, D.,
Trouet, V., Kaplan, J. O., Herzig, F., Heussner, K.-U., Wanner,
H., Luterbacher, J. and Esper, J. 2011. 2500 years of European
climate variability and human susceptibility. – Science 331:
578–582.
Chassaing, O., Desse-Berset, N., Duffraisse, M., Hughes, S.,
Hänni, C. and Berrebi, P. 2013. Palaeogenetics of western
French sturgeons spotlights the relationships between Acipenser
sturio and Acipenser oxyrinchus. – J. Biogeogr. 40: 382–393.
Clason, A. T. and Prummel, W. 1978. Een glimp van de Nederlandse
avifauna uit het verleden. – Het Vogeljaar 26: 209–217.
Cooper, A., Lalueza-Fox, C., Anderson, S., Rambaut, A., Austin,
J. and Ward, R. 2001. Complete mitochondrial genome
sequences of two extinct moas clarify ratite evolution. – Nature
409: 704–707.
Cowles, G. S. 1981. e first evidence of demoiselle crane
Anthropoides virgo and pygmy cormorant Phalacrocorax pyg-
meus in Britain. – Bull. Brit. Ornithol. Club 101: 383–386.
Crivelli, A. J. 1996. Action plan for the Dalmatian pelican
(Pelecanus crispus) in Europe. – Council of Europe Publishing,
pp. 53–66.
Davis, B. A. S., Brewer, S., Stevenson, A. C. and Guiot, J. 2003.
e temperature of Europe during the Holocene reconstructed
from pollen data. – Quat. Sci. Rev. 22: 1701–1716.
de Bruyn, M., Hoelzel, A. R., Carvalho, G. R. and Hofreiter, M.
2011. Faunal histories from Holocene ancient DNA. – Trends
Ecol. Evol. 26: 405–413.
Deinet, S., Ieronymidou, C., McRae, L., Burfield, I. J., Foppen,
R. P., Collen, B. and Böhm, M. 2013. Wildlife comeback
in Europe: the recovery of selected mammal and bird species.
– Zoological Society of London.
written at ∼50 AD that pelicans live at the northern coast of
Gallia, i.e. in the present Belgium and the Netherlands.
In this context the English site Glastonbury is of special
interest. In this settlement, in addition to the remains of
adults there are also some bones from juvenile and immature
birds, suggesting that the pelicans bred in the neighborhood
of the humans and that they were used as food (Andrews
1899). e find of juvenile pelicans in England ∼2 ka ago is
an important difference to the older group of records in the
western Baltic Sea area.
It is not just subfossil bird remains that can demonstrate
changes in distribution ranges caused by climate warming
(Tyberg 2010). Since the 1940s there are detailed observa-
tions about modern changes in the occurrence and distri-
bution of European bird species and argumentations that
the most important factor for such developments seems to
be the present climatic changes (Kalela 1949). During the
last decades several studies have verified effects of the North
Atlantic Oscillation on birds, in particular in the Mediter-
ranean (Gordo et al. 2011). However, to explain range shifts
not only an increasing annual temperature, but also a row
of biotic and abiotic as well as anthropogenic factors have
to be considered (Ławicki 2014; for pelicans cf. Jiguet et al.
2008).
e observed temporal coherence between the former
occurrence of Dalmatian pelican outside of its present range
and the climate development corresponds with special adap-
tations of the species, in particular with its breeding success.
Ecological studies of P. crispus have recently demonstrated
that the breeding success as well as the mortality of these
birds is significantly dependant on atmospheric condi-
tions: in contrast to other pelican species, breeding suc-
cess is especially high in wet years. Consequently, increased
precipitation results in an increase in colony size due to the
enhanced survival of juvenile pelicans (Doxa et al. 2010,
2012). Because the current climate changes cause an increas-
ing number of wet and hot summers at breeding places of
P. crispus in the eastern Mediterranean, the number of breed-
ing pairs has started significantly to increase and even several
new colonies have been established since 2010 (Deinet et al.
2013, Crivelli pers. comm.). Over the long term the current
climate change might provoke a new range expansion to the
north. In the last decades, there were occasional observations
of P. crispus in Hungary and Poland (Jiguet et al. 2008), and
the first certified record both for Germany and Denmark
occurred in 2006 (Wegst 2008). In this perspective, the
Dalmatian pelican is an excellent example that an under-
standing of the way bird species have responded to past
climate changes has relevance for models about their reaction
to the current climate development (Stewart et al. 2010).
Acknowledgements – e authors would like to thank the following
colleagues for valuable comments and support: Alain Jean Crivelli
(Arles), Inge B. Enghoff (Copenhagen), Dirk Heinrich (Flensburg),
Martyn Kennedy (Dunedin), John Meadows (Kiel), Wietske
Prummel (Groningen), Kenneth Ritchie (Schleswig), John R.
Stewart (London), and Wim J. Wolff (Groningen). Special thanks
go to the Subject Editor of the journal, to Frank E. Zachos (Vienna)
who made helpful and very constructive comments that improved
the paper. We further thank the Inst. of Clinical Molecular Biology
in Kiel for providing Sanger sequencing as supported in part by the

350
Langguth, T., Honnen, A. C., Hailer, F., Mizera, T., Skoric, S., Väli,
Ü. and Zachos, F. E. 2013. Genetic structure and phylogeog-
raphy of a European flagship species, the white-tailed sea eagle
Haliaeetus albicilla. – J. Avian Biol. 44: 263–271.
Ławicki, Ł. 2014. e great white egret in Europe: population
increase and range expansion since 1980. – British Birds 107:
8–25.
Lepiksaar J. 1958. Fossilfynd av stormfåglar (Procellariformes) från
Sveriges västkust. – Zool. Revy 20: 77–85.
Liukkonen-Anttila, T., Uimaniemi, L., Orell, M. and Lumme,
J. 2002. Mitochondrial DNA variation and the phylogeogra-
phy of the grey partridge (Perdix perdix) in Europe: from
Pleistocene history to present day populations. – J. Evol. Biol.
15: 971–982.
Ljungar, L. 1996. Littorinahavets fuglefauna. – Zoologisk Museum,
Københavns Univ.
Lorch, R. 1992. Vergleichend morphologische Untersuchungen
am Skelett von Pelecanus onocrotalus, Pelecanus crispus und
Pelecanus rufescens. – PhD thesis, München Univ.
Møhl, U. 1971. Oversigt over dyreknoglerne fra Ølby Lyng. En
østsjællandsk kystboplads med Ertebøllekultur. – Aarbøger for
nordisk Oldkyndighet og Historie 1970: 43–77.
Müller, H.-H. 1977. Subfossile Pelikanfunde aus dem Gebiet der
DDR. – Hercynia 14: 352–354.
Noe-Nygaard, H. 1995. Ecology, sedimentary, and geochemical
evolution of the late-glacial to postglacial Åmose lacustrine
basin, Denmark. – Fossils and Strata 37.
Paxinos, E. E., James, H. F., Olson, S. L., Sorenson, M. D.,
Jackson, J. and Fleischer, R. C. 2002. mtDNA from fossils
reveals a radiation of Hawaiian geese recently derived from the
Canada goose (Branta canadensis). – Proc. Natl Acad. Sci. USA
99: 1399–1404.
Popović, D., Panagiotopoulou, H., Baca, M., Stefaniak, K.,
Mackiewicz, P., Makowiecki, D., King, T. L., Gruchota, J.,
Weglenski, P. and Stankovic, A. 2014. e history of sturgeon
in the Baltic Sea. – J. Biogeogr. 41: 1590–1602.
Renssen, H., Seppä, H., Heiri, O., Roche, D. M., Goosse, H. and
Fichefet, T. 2009. e spatial and temporal complexity of the
Holocene thermal maximum. – Nat. Geosci. 2: 411–414.
Roberts, N., Eastwood, W. J., Kuzucuoğlu, C., Fiorentino, G.
and Caracuta, V. 2011. Climatic, vegetation and cultural
change in the eastern Mediterranean during the mid-Holocene
environmental transition. – Holocene 21: 147–162.
Rossignol-Strick, M. 1999. e Holocene climatic optimum and
pollen records of sapropel 1 in the eastern Mediterranean,
9000–6000 BP. – Quat. Sci. Rev. 18: 515–530.
Sanger, F., Nicklen, S. and Coulson, A. R. 1977. DNA sequencing
with chain-terminating inhibitors. – Proc. Natl Acad. Sci. USA
74: 5463–5467.
Schindler, R. 1974. Der Pelikan als Opfertier im römischen Trier.
– Kurtrierisches Jb. 14: 228–232.
Schmölcke, U., Endtmann, E., Klooss, S., Meyer, M., Michaelis,
D., Rickert, B.-H. and Rößler, D. 2006. Changes of sea level,
landscape and culture: a review of the south-western Baltic area
between 8800 and 4000BC. – Palaeogeogr. Palaeoclimatol.
Palaeoecol. 240: 423–438.
Seppä, H., Bjune, A. E., Telford, R. J., Birks, H. J. B. and Veski,
S. 2009. Last nine-thousand years of temperature variability
in northern Europe. – Clim. Past Disc. 5: 1521–1552.
Serjeantson D. 2005. Archaeological records of a gadfly petrel
Pterodroma sp. from Scotland in the first millennium AD. – In:
Grupe, G. and Peters, J. (eds), Feathers, grit and symbolism.
Birds and humans in the ancient Old and New World. Marie
Leidorf, pp. 235–246.
Sommer, R. S., Persson, A., Wieseke, N. and Fritz, U. 2007.
Holocene recolonization and extinction of the pond turtle,
Emys orbicularis (L., 1758), in Europe. – Quat. Sci. Rev. 26:
3099–3107.
Steeves, T. E., Holdaway, R. N., Hale, M. L., McLay, E., McAllan,
I. A., Christian, M., Hauber, M. E. and Bunce, M. 2010.
Doxa, A., eodorou, K., Hatzilacou, D., Crivelli, A. and Robert,
A. 2010. Joint effects of inverse density-dependence and
extreme environmental variation on the viability of a social
bird species. – Écoscience 17: 203–215.
Doxa, A., Robert, A., Crivelli, A., Catsadorakis, G., Naziridis, T.,
Nikolaou, H., Jiguet, F. and eodorou, K. 2012. Shifts in
breeding phenology as a response to population size and cli-
matic change: a comparison between short-and long-distance
migrant species. – Auk 129: 753–762.
Enghoff, I. B. 2011. Regionality and biotope exploitation in
Danish Ertebølle and adjoining periods. – Det Kongelige
Danske Videnskabernes Selskab.
Enghoff, I. B., MacKenzie, B. R. and Nielsen, E. E. 2007. e
Danish fish fauna during the warm Atlantic period (ca. 7000–
3900bc): forerunner of future changes? – Fish. Res. 87:
167–180.
Ericson, P. G. and Tyrberg, T. 2004. e early history of the
Swedish avifauna: a review of the subfossil record and early
written sources. – Kungliga Vitterhets Historie och Antikvitets
Akademiens Handlingar, Antikvariska Serien 45: 1–349.
Fleischer, R. C., Olson, S. L., James, H. F. and Cooper, A. C. 2000.
Identification of the extinct Hawaiian eagle (Haliaeetus) by
mtDNA sequence analysis. – Auk 117: 1051–1056.
Forbes, C. L., Joysey, K. A. and West, R. G. 1958. On post-glacial
pelicans in Britain. – Geol. Mag. 95: 153–160.
Gál, E. 2007. Fowling in lowlands: Neolithic and Chalcolithic bird
exploitation in south-east Romania and the Great Hungarian
Plain. – Archaeolingua Alapítvány.
Goldhammer, J. 2008. Untersuchungen zur Stratigraphie,
Fundverteilung und zum Fundspektrum der mittleren Erte-
bøllekultur in Ostholstein. Die Nachgrabungen in Grube-
Rosenhof aus den Jahren 2001 und 2002. – Habelt Verlag.
Gordo, O., Barriocanal, C. and Robson, D. 2011. Ecological
impacts of the North Atlantic Oscillation (NAO) in Mediter-
ranean ecosystems. – Adv. Global Change Res. 46: 153–170.
Hailer, F., Olsson, S. L., James, H. F. and Fleischer, R. C. 2015.
Distinct and extinct: genetic differentiation of the Hawaiian
eagle. – Mol. Phylogenet. Evol. 83: 40–43.
Hartz, S. and Lübke, H. 2006. New evidence for a chronostrati-
graphic division of the Ertebølle culture and the earliest funnel
beaker culture on the Southern Mecklenburg Bay. – Material-
hefte Arch. Baden-Württemberg 78: 61–77.
Hatting, T. 1963. On subfossil finds of Dalmatian pelican
(Pelecanus crispus Bruch.) from Denmark. – Videnskabelige
Medd. fra Dansk. Naturhist. Forenning 125: 337–351.
Hewitt, G. M. 1999. Post-glacial re-colonization of European
biota. – Biol. J. Linn. Soc. 68: 87–112.
Jansen, E., Andersson, C., Moros, M., Nisancioglu, K. H., Nyland,
B. F. and Telford, R. J. 2008. e early to mid-Holocene ther-
mal optimum in the North Atlantic. – In: Battarbee, R. W.
and Binney, H. A. (eds), Natural climate variability and global
warming – a Holocene perspective. Wiley–Blackwell, pp.
123–137.
Jiguet, F., Doxa, A. and Robert, A. 2008. e origin of out-of-range
pelicans in Europe: wild bird dispersal or zoo escapes? – Ibis
150: 606–618.
Jonsson, L. 1988. e vertebrate faunal remains from the Late
Atlantic settlement Skateholm in Scania, south Sweden. – In:
Larsson, L. (ed.), e Skateholm project I, man and environ-
ment. Almqvist and Wiksell International, pp. 56–89.
Kalela, O. 1949. Changes in geographic ranges in the avifauna of
northern and central Europe in relation to recent changes in
climate. – Bird Banding 20: 77–103.
Kalis, A. J., Merkt, J. and Wunderlich, J. 2003. Environmental
changes during the Holocene climatic optimum in central
Europe – human impact and natural causes. – Quat. Sci. Rev.
22: 33–79.
Kvist, L., Viiri, K., Dias, P. C., Rytkönen, S. and Orell, M. 2004.
Glacial history and colonization of Europe by the blue tit Parus
caeruleus. – J. Avian Biol. 35: 352–359.

351
J. H. F. (ed.), Archeologie en oecologie van Holland tussen
Rijn en Vlie. Van Gorcum, pp. 154–185.
von den Driesch, A. and Pöllath, N. 2010. Distribution history
of European wild birds based on archaeozoological records.
– In: Grupe, G., McGlynn, G. and Peters, J. (eds), Archaeo-
biodiversity. A European perspective. Marie Leidorf,
pp. 71–216.
Wegst, C. 2008. Der Krauskopfpelikan Pelecanus crispus, eine neue
Art für Deutschland. – Limicola 22: 161–175.
Welch A. J., Olson, S. L. and Fleischer, R. C. 2014. Phylogenetic
relationships of the extinct St. Helena petrel, Pterodroma rupi-
narum Olson (Procellariiformes: Procellariidae), based on
ancient DNA. – Zool. J. Linn. Soc. 170: 494–505.
Weninger, B., Jöris, O. and Danzeglocke, U. 2008. CalPal 2007.
– Cologne Radiocarbon Calibration and Palaeoclimate
Research Package,  www.calpal.de .
Merging ancient and modern DNA: extinct seabird taxon
rediscovered in the North Tasman Sea. – Biol. Lett. 6: 94–97.
Stewart, J. R. 2004. Wetland birds in the recent fossil record of
Britain and northwest Europe. – British Birds 97: 33–43.
Stewart, J. R. 2005. e use of modern geographical ranges in the
identification of archaeological bird remains. – In: Grupe, G.
and Peters, J. (eds), Feathers, grit and symbolism. Birds and
humans in the ancient Old and New Worlds. ICAZ Bird
Working Group. Marie Leidorf, pp. 43–54.
Stewart, J. R., Lister, A. M., Barnes, I. and Dalén, L. 2010.
Refugia revisited: individualistic responses of species in space
and time. – Proc. R. Soc. B 277: 661–671.
Tyrberg, T. 2010. Avifaunal responses to warm climate: the message
from Last Interglacial faunas. – Rec. Aust. Mus. 62: 193–205.
van Wijngaarden-Bakker, L. H. 1988. Zoöarcheologisch onderzoek
in de west-Nederlandse delta 1983–1987. – In: Bloemers,