Content uploaded by Gong Xun
Author content
All content in this area was uploaded by Gong Xun on Jul 07, 2023
Content may be subject to copyright.
Research Article
doi: 10.1111/jse.12153
Cycas chenii (Cycadaceae), a new species from China, and
its phylogenetic position
Wei Zhou
1,2
, Meng-Meng Guan
1,2
, and Xun Gong
1
*
1
Key Laboratory for Plant Diversity and Biogeography of East Asia, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201,
China
2
University of Chinese Academy of Sciences, Beijing 100049, China
*Author for correspondence. E-mail: gongxun@mail.kib.ac.cn. Tel./Fax: 86-871-65223625.
Received 11 June 2014; Accepted 12 February 2015; Article first published online xx Month 2015
Abstract Cycas chenii X. Gong & W. Zhou sp. nov., a new species of Cycas L., is described and illustrated here. The
morphological and karyomorphological comparisons are made between C. chenii and the closely related taxa for
defining its taxonomical status as a new species. Moreover, the phylogenetic position of C. chenii within 16 Cycas
species is determined using DNA sequences of two plastid regions, nuclear ribosomal internal transcribed spacers,
and two nuclear regions. Cycas chenii is readily distinguished from the related C. guizhouensis K. M. Lan & R. F. Zou by
an acaulescent stem. Phylogenetic evidence indicates that C. chenii is a distinct group related to C. guizhouensis in
the Section Stangerioides. The distribution and conservation status of C. chenii are also discussed.
Key words: China, Cycas chenii, new species, phylogenetic position.
The genus Cycas consists of approximately 100 species, chiefly
Indo-Chinese (about 40 species) and Australian (27 species).
The genus also occurs in the Malaysian region, Japan and
India, extending to Micronesia and Polynesia, Madagascar,
and East Africa (Lindstrom & Hill, 2007). In China, there are 22
Cycas species distinguished, based on wide investigations
(Hill, 2008). The Red River drainage area (China and Vietnam)
is recognized as a secondary diversification center of Cycas,
where more than 20 species occur. The majority of these
species are endemic to this area. During field investigations in
the Red River drainage areas in southeastern Yunnan, China, a
species belonging to the genus Cycas was observed that did
not conform to morphological features of any known species
in Cycas. The small plants were easily distinguished from
known species by the absence of an obvious stem and the
presence of only a few leaves on the crown. However, these
plants showed similarities to C. guizhouensis K. M. Lan & R. F.
Zou, C. simplicipinna (T. Smitinand) K. D. Hill, and C. tanqingii
D. Y. Wang in certain aspects of its morphology. In this paper,
we present a comprehensive study based on morphology,
karyomorphology, and molecular phylogenetics for determin-
ing the taxonomic status and the phylogenetic relationships
of these plants.
Material and Methods
Plant materials
Specimens of Cycas chenii were collected during our field
investigations in 2012, and some living individuals were
introduced and cultivated in Kunming Botanical Garden,
Kunming Institute of Botany (Kunming, China). DNA material
of eight individuals were sampled from four populations
(Dutian and Qingshuihe in Shuangbai county, Menglong and
Lianhua in Honghe county, Figs. 1–3), comprising two
individuals from each population. For the study of the
phylogenetic position of C.chenii,16Cycas species were
sampled (one to four individuals were sampled for each
species), being representatives of most sections of Cycas
based on morphological characters. Vouchers from all taxa
sequenced in this study are listed in Table 1 and the specimen
of C. chenii was deposited in the herbarium of Kunming
Institute of Botany, CAS.
Karyomorphological studies
For the observation of somatic chromosomes, we obtained
growing root tips from a living seedling of C.chenii. The root
tips were pretreated in 0.1% colchicine solution at 8–12 °C for
4 h then fixed in acetic alcohol (3:1, absolute ethanol : glacial
acetic acid) at 15–25°C for 12–24 h. They were macerated in 1:1
mixture of 1 mol/L hydrochloric acid and 45% acetic acid at 60°C
for 8 min and then stained and squashed in 1% aceto-orcein
solution. Karyotype formulas were derived on measurements
of metaphase chromosomes from photomicrographs. The
nomenclature used to describe the karyotype followed Levan
et al. (1964).
DNA extraction, polymerase chain reaction amplification,
and sequencing
Total genomic DNA was extracted from silica gel dried leaves
following a modified CTAB protocol (Doyle, 1991). After
preliminary screening of some chloroplast fragments and
J
SE Journal of Systematics
and Evolution
XXX 2015 | Volume 9999 | Issue 9999 | 1–10 © 2015 Institute of Botany, Chinese Academy of Sciences
nuclear genes, we chose to generate DNA sequences of the
five regions to reconstruct the phylogenetic relationship of C.
chenii within the genus Cycas. These regions included two
chloroplast internal transcribed spacer regions psbA–trnH
(Shaw et al., 2005) and trnL–trnF (Taberlet et al., 1991), the
nuclear internal transcribed spacer region (ITS4–ITS5, White
et al., 1990), and two nuclear genes, the phytochrome spacer
region PHYP, and the RNA polymerase II largest subunit spacer
region RPB1. Details of polymerase chain reaction (PCR)
primers are given in Table 2.
The PCR was carried out using a PTC-200 thermal cycler (MJ
Research, Bruno, Canada) with a reaction volume of 40 mL,
containing 4.0 mL template DNA (20–50 ng/mL), 4.0 mL10
PCR buffer, 2.4 mL MgCl
2
(25 mmol/L), 2.0 mL dNTP (10 mmol/
L), 2.0 mL DMSO, 0.7 mL each primer (10 mmol/L), 0.7 mLTaq
(5 U/mL; TaKaRa, Kyoto, Japan), and 24.6 mL double-distilled
water. The reaction of the nuclear genome was carried out
with an initial denaturation at 94 °C for 4 min, followed by 30
cycles of denaturation at 94 °C for 45 s, annealing at 53 °C for
1 min, extension 1 min at 72 °C, and a final extension at 72 °C for
10 min. The reaction of the chloroplast genome was carried
out under an initial denaturation at 80 °C for 5 min, followed by
30 cycles of denaturation at 80 °C for 45 s, annealing at 48 °C
for 1 min, extension at 65 °C for 1 min, and a final extension at
65 °C for 10 min. The purified PCR products were sequenced
with the same primers used for PCR amplifications in an ABI
3770 automated sequencer at Shanghai Sangon Biological
Engineering Technology and Services (Shanghai, China). DNA
sequences were edited by SeqMan (DNAStar, Madison, WI,
USA) and aligned with ClustalX1.81 (Thompson et al., 1997). All
DNA sequences produced in this study were deposited in
GenBank (accession numbers are listed in Table 1).
Phylogenetic analyses
Maximum parsimony and Bayesian inference of phylogeny
were used for determining the phylogenetic position of the
newly collected plants. Maximum parsimony analyses (MP)
were carried out using Paup* v.4.0b10 (Swofford, 2002). All
characters were weighted equally and unordered, gaps were
treated as missing data, and the branch-swapping algorithm
was set as tree bisection–reconnection. Robustness of the
obtained phylogeny was calculated by bootstrap analysis with
1000 replicates (Felsenstein, 1985). Consistency index (Kluge
& Farris, 1969) and retention index (Farris, 1989) were
calculated to estimate the level of homoplasy. Strict
consensus trees were calculated if more than one most
parsimonious tree was recovered. The incongruence length
difference test as implemented in Paup was calculated to
assess data congruency (Farris et al., 1994) by Paup* before
Fig. 1. Cycas chenii X. Gong & W. Zhou sp. nov. A, Whole plant and habitat. B, Female cone. C, Male cone. D, Megasporophylls and
seed. E, Seedlings and female plant.
2 Zhou et al.
J. Syst. Evol. 9999 (9999): 1–10, 2015 www.jse.ac.cn
Fig. 2. Holotype of Cycas chenii X. Gong & W. Zhou sp. nov. with details. A, Habit. B, Pinna. C, Microsporophyll. D,
Megasporophylls with seeds. E, Female cone. Drawn by G.-S. Yin.
Fig. 3. Distribution of Cycas chenii X. Gong & W. Zhou sp. nov in China. The circle indicates the type locality of C. chenii. DT, Dutian,
Shuangbai; LH, Lianhua, Honghe; ML, Menglong, Honghe; QS, Qingshuihe, Shuangbai. Original map downloaded from http://
www.arcgisonline.cn/portal/home/gallery.html.
A new Cycas species from China 3
www.jse.ac.cn J. Syst. Evol. 9999 (9999): 1–10, 2015
Table 1 List of taxa sampled and sequenced in this study, with distribution, located sections based on morphology, and voucher and GenBank accession numbers
Taxon Voucher Geographic
distribution
†
PHYP RPB1 trnL–trnF psbA–trnH ITS4–ITS5 Located in
morphological
section
Cycas aculeata K. D. Hill &
H. T. Nguyen
T.-H. Nguyen & J. Liu,
CK752 (HN)
Vietnam KP117123 KP117177 KP117204 KP117150 KP117099 Stangerioides
Cycas diannanensis Z. T. Guan &
G. D. Tao
X. Gong, PG200044 China KP117124 KP117178 KP117205 KP117151 KP117100 Stangerioides
Cycas dolichophylla K. D. Hill,
T. H. Nguyen & K. L. Phan
T.-H. Nguyen & Y.-M. Shui,
CK182 (KUN, HN)
China and Vietnam KP117125 KP117179 KP117206 KP117152 KP117101 Stangerioides
Cycas guizhouensis K. M. Lan &
R. F. Zou
X. Gong, GX002 China KP117126 KP117180 KP117207 KP117153 KP117102 Stangerioides
Cycas media R. Br. S.-Z. Zhang, SZ461A Australia KP117127 KP117181 KP117208 KP117154 KP117103 Cycas
Cycas multipinnata C. J. Chen &
S. Y. Yang
X. Gong, HHJP008 China and Vietnam KP117128 KP117182 KP117209 KP117155 KP117104 Stangerioides
Cycas pectinata Buch-Ham. J. Liu et al., GXC01 India, Nepal, Bhutan, Burma,
China, and Indochina
KP117129 KP117183 KP117210 KP117156 KP117105 Indosinenses
Cycas panzhihuaensis L. Zhou &
S. Y. Yang
X. Gong, KBG20141 China KP117130 KP117184 KP117211 KP117157 KP117106 Panzhihuanses
Cycas parvulus S. L. Yang X. Gong, PG20010 China KP117131 KP117185 KP117212 KP117158 KP117107 Stangerioides
Cycas revoluta Thunb. X. Gong, KBG20142 China and Japan KP117132 KP117186 KP117213 KP117159 KP117108 Asiorientales
Cycas siamensis Miq. T.-S. Yi, Yi13531 Thailand and Vietnam KP117133 KP117187 KP117214 KP117160 KP117109 Indosinenses
Cycas silvestris K. D. Hill S.-Z. Zhang, SZ141A Australia KP117134 KP117188 KP117215 KP117161 KP117110 Cycas
Cycas simplicipinna (Smitinand)
K. D. Hill
T.-H. Nguyen et al., CK759 Thailand, Burma, Laos,
and Vietnam
KP117135 KP117189 KP117216 KP117162 KP117111 Stangerioides
Cycas szechuanensis W. C. Cheng
&L.K.Fu
J. Liu, FL1401 China KP117136 KP117190 KP117217 KP117163 KP117112 Stangerioides
Cycas tanqingii D. Y. Wang X. Gong, HHJP001 China KP117137 KP117191 KP117218 KP117164 KP117113 Stangerioides
Cycas tropophylla K. D. Hill &
S. L. Yang
S.-Z. Zhang, SZ11134A Vietnam KP117138 KP117192 KP117219 KP117165 KP117114 Stangerioides
Cycas chenii DT5 W. Zhou & X. Gong,
PG20018
China KP117139 KP117193 KP117220 KP117166 KP117115 Stangerioides
Cycas chenii DT9 W. Zhou & X. Gong,
PG20019
China KP117140 KP117194 KP117221 KP117167 KP117116 Stangerioides
Cycas chenii LH9 W. Zhou & X. Gong,
PG20011
China KP117141 KP117195 KP117222 KP117168 KP117117 Stangerioides
Cycas chenii LH18 W. Zhou & X. Gong,
PG20012
China KP117142 KP117196 KP117223 KP117169 KP117118 Stangerioides
Cycas chenii ML3 W. Zhou & X. Gong,
PG20001
China KP117143 KP117197 KP117224 KP117170 KP117119 Stangerioides
Cycas chenii ML7 W. Zhou & X. Gong, China KP117144 KP117198 KP117225 KP117171 KP117120 Stangerioides
Continued
4 Zhou et al.
J. Syst. Evol. 9999 (9999): 1–10, 2015 www.jse.ac.cn
Table 1 Continued
Taxon Voucher Geographic
distribution
†
PHYP RPB1 trnL–trnF psbA–trnH ITS4–ITS5 Located in
morphological
section
PG20002
Cycas chenii QS2 W. Zhou & X. Gong,
PG20007
China KP117145 KP117199 KP117226 KP117172 KP117121 Stangerioides
Cycas chenii QS11 W. Zhou & X. Gong,
PG20007
China KP117146 KP117200 KP117227 KP117173 KP117122 Stangerioides
Cycas guizhouensis lw3 J. Liu et al., GZ011 China KP117147 KP117201 KP117228 KP117174 NA Stangerioides
Cycas guizhouensis lw5 J. Liu et al., GZ012 China KP117148 KP117202 KP117229 KP117175 NA Stangerioides
Cycas guizhouensis lw7 J. Liu et al., GZ010 China KP117149 KP117203 KP117230 KP117176 NA Stangerioides
†
Geographic distributions were referred from Hill et al. (2008). DT, Dutian, Shuangbai; HN, Herbarium of National Center for Natural Sciences and Technology, Vietnam; ITS, internal
transcribed spacer; KUN, Herbarium, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, China; LH, Lianhua, Honghe; ML, Menglong, Honghe; NA, missing data in
this study; QS, Qingshuihe, Shuangbai.
Table 2 DNA regions examined and primer information of two chloroplast internal spacers, internal transcribed spacer (ITS4–ITS5), and two nuclear sequences used in this study
Region Primer sequences (50to 30) References
psbA–trnH (cpDNA) F: GTTATGCATGAACGTAATGCTC R: CGCGCATGGTGGATTCACAATCC Shaw et al. (2005)
trnL–trnF (cpDNA) F: GGTTCAAGTCCCTCTATCCC R: ATTTGAACTGGTGACACGAG Taberlet et al. (1991)
ITS4–ITS5 (nDNA) F: TCCTCCGCTTATTGATATGC R: GGAAGTAAAAGTCGTAACAAGC White et al. (1990)
PHYP (nDNA) F: CCAGTCTCCCAGTATCATGG R: GCTGCATGATATTTCCAACC Chiang Y-C (2011, unpublished data)
RPB1 (nDNA) F: GTACCCCAGTCATTTGAGAC R: AGCCAGCAGTAACCATTGCC Chiang Y-C (2011, unpublished data)
cpDNA, chloroplast DNA; F, forward; nDNA, nuclear DNA; R, reverse.
A new Cycas species from China 5
www.jse.ac.cn J. Syst. Evol. 9999 (9999): 1–10, 2015
Table 3 Morphological and karyotypic comparison of Cycas chenii with related Cycas species
Character C. chenii C. tanqingii C. simplicipinna C. guizhouensis
Habit Subtropical evergreen
broad-leaved
forest, altitude
500–1300 m
Scattered in
rainforest,
altitude <800 m
Scattered in tropical
rainforests at
lower altitude
Scattered or patched in shrubs and forests
along Nanpanjiang River Valley, altitude
400–800 m, no more than 1100 m
Stem Acaulescent, 2–10
leaves in crown
Arborescent or
acaulescent, to 2 m
tall, 4–7 leaves in
crown
Acaulescent, 2–5
leaves in crown
Arborescent or acaulescent, to 2 m tall
9–30 leaves in crown
Cataphylls Narrowly triangular Narrowly triangular Lanceolate Long deltoid
Megasporophylls 5–7 cm long, 2–5cm
wide, rhombic or
ovate
5.0–5.5 cm long,
5.0–6.5 cm wide
orbicular
3–6 cm long, 3–5cm
wide,
subrhomboided or
ovate
4–10 cm long, 6–8 cm wide, ovate to
elliptical
Soft spines
(pairs)
6–96–95–11 7–23
Apex
accuminate
Obvious Unobvious Obvious Obvious
Ovules 2–42 2–54–9
Flowering Apr.–May Apr. Apr.–May Apr.–June
Seeds maturing Oct.–Nov. Aug.–Sep. Sep.–Oct. Oct.–Nov.
Karyotype 6m þ4sm þ12t 2m þ8sm þ2st þ10t 6m þ4sm þ12t 2m þ4sm þ4st þ12t
Authors Present authors Tian et al. (2002) Wang et al. (1996) Wu & Chen (1990)
6 Zhou et al.
J. Syst. Evol. 9999 (9999): 1–10, 2015 www.jse.ac.cn
combining the datasets. The entire dataset was analyzed
using DnaSP 4.0 (Rozas et al., 2003).
Bayesian Markov chain Monte Carlo analyses (Yang &
Rannala, 1997) were carried out by MrBayes version 3.1
(Huelsenbeck & Ronquist, 2001). The best fitting model of
sequences evolution was GTRþIþG for Akaike information
criterion and TPM2fuþI for Bayesian information criterion,
decided by JModelTest 2.1.5 (Posada, 2008; Dieg et al., 2012);
four simultaneous runs with four chains each were run for
combined data. Trees were sampled in every 1000 gener-
ations; the first 2500 trees (25%) of the sample trees from each
run were discarded. The sampling data after Bayesian analysis
was examined and determined by Tracer version 1.6 (Rambaut
et al., 2014). Accomplishment of the Bayesian runs was
determined using the web-based program AWTY (Nylander
et al., 2008).
Results
Morphological characters, chromosome counts, and
karyomorphology
Morphological characters of Cycas chenii and its close relative
species, including C. guizhouensis,C. simplicipinna, and C.
tanqingii, are listed in Table 3. The new species is similar to C.
guizhouensis in morphology, but its stem is acaulescent, and
its megasporophylls are rhombic or ovate, 5–7 cm long by 2–
5 cm wide, deeply pectinate with 12–18 soft spines. Cycas
guizhouensis is arborescent, the megasporophylls are
subrotund to ovate-elliptic, 4–10 cm long by 6–8 cm wide,
deeply pectinate with 14–46 soft spines. The new species is
also similar to C. simplicipinna, but differs in that leaves do not
turn black-brown when dry. The latter taxon is also distinct
from the new species by megasporophylls that are sub-
rhomboid or ovate, 3–6 cm long by 3–5 cm wide, simple
median pinnae is 17–30 cm long by 0.9–1.3 cm wide, apical
spine distinct from lateral spines. The new species is also
closely related to C. tanqingii, but can easily be distinguished
by its shorter leaves and leaflets.
The number of somatic chromosomes of C. chenii was
consistent with other Cycas species by showing a diploid
chromosome set of 2n¼22 and a karyotype formula of
2n¼2x¼6m þ4sm þ12t (Fig. 4; Table 3).
Phylogenetic analysis
Although the result of the incongruence length difference test
associated by all five markers showed P¼0.01 in this study,
the 132 consensus trees obtained from the individual markers
did not display a robust signal of topological conflicts
(bootstrap support values 80% and/or posterior probability
0.95). Sequence data from all markers were, therefore,
combined into a single dataset. All five sequence markers
were aligned and generated a matrix of 3571 characters, of
which variable sites were 338 (total number of mutations
were 372), singleton variable sites were 216, and parsimony
informative sites were 122 when gaps were treated as missing
characters. Detailed information on each molecular marker is
listed in Table 4.
The Bayesian tree and MP bootstrap consensus tree
showed the same phylogenic results as the trees in Figs. 5A
and 5B, respectively, with only small differences at the
bootstrap and posterior confidence value on each node
(Fig. 5). Both the MP and Bayesian consensus trees were
generally congruent with respect to well-supported clades,
Fig. 4. Mitotic metaphase of Cycas chenii.A, Micrograph of metaphase chromosomes. B, Karyotype of mitotic metaphase
chromosomes.
Table 4 Tree statistics for chloroplast psbA–trnH,trnL–trnF, nuclear internal transcribed spacer (ITS4–ITS5), PHYP,RPB1, and
combined datasets from maximum parsimony analysis using DnaSP 4.0
Chloroplast genes Nuclear genes Combined
Parameters psbA–trnH trnL–trnF ITS4–ITS5 RPB1 PHYP cpDNA þnDNA
Number of sequences (ingroup/outgroup) 24 (23/1) 24 (23/1) 24 (23/1) 24 (23/1) 24 (23/1) 24 (23/1)
Aligned length (bp) 542 709 833 519 968 3571
Variable characters (%) 10 (1.8) 18 (2.4) 248 (29.8) 27 (5.2) 35 (3.62) 372 (10.4)
Parsimony informative characters (%) 7 (1.3) 6 (0.8) 83 (10) 11 (2.1) 15 (1.5) 122 (3.4)
Consistency index 0.92 1 0.7123 0.6111 0.75 0.6437
Retention index 0.08 0 0.2877 0.3889 0.25 0.3563
cpDNA, chloroplast DNA; nDNA, nuclear DNA.
A new Cycas species from China 7
www.jse.ac.cn J. Syst. Evol. 9999 (9999): 1–10, 2015
Fig. 5. A, Bayesian consensus tree from the analysis of the combined nuclear DNA and chloroplast DNA sequences. Numbers are
Bayesian posterior probabilities. B, Single most parsimonious tree (tree length ¼3571) from the analysis of the combined nuclear
DNA and chloroplast DNA sequences. Numbers indicate bootstrap values. DT, Dutian, Shuangbai; LH, Lianhua, Honghe; ML,
Menglong, Honghe; QS, Qingshuihe, Shuangbai.
8 Zhou et al.
J. Syst. Evol. 9999 (9999): 1–10, 2015 www.jse.ac.cn
with all individuals of C. chenii located at the same clade.
This clade was nested in a polytomy sharing individuals of
C. guizhouensis. The two morphologically similar species
C. simplicipinna and C. tanqingii formed a separated clade.
Discussion
The phylogram constructed by the MP method and Bayesian
inference both showed that populations of Cycas chenii nested
in the same clade. However, this clade was nested within a
polytomy also consisting of four individuals of C. guizhouensis.
The two other species considered as closely related,
C. simplicipinna and C. tanqingii, were found to be sufficiently
separated in their genotype to allow unambiguous diagnoses
of species identity. These results are consistent with the
morphological characters described above. In contrast to the
available DNA data, C. chenii was distinct compared to all
three species mentioned. The lack of resolution concerning
C. guizhouensis may be caused by the lack of all five regions for
all four specimens.
The karyotype formula of C. chenii is identical to that of
C. simplicipinna and C. taitungensis C. F. Shen, K. D. Hill, C. H.
Tsou & C. J. Chen, namely 2n¼2x¼6m þ4sm þ12t (Wang
et al., 1996). Furthermore, neither the karyotype formula of
C. guizhouensis nor C. tanqingii was the same as that of
C. chenii, with the former being 2n¼2x¼2m þ4sm þ4st þ
12t (Wu & Chen, 1990) and the latter 2n¼2x¼2m þ8sm þ2
st þ10t (Tian et al., 2002). Thus, C. chenii differed from
C. guizhouensis in all molecular phylogenetic, morphological,
and cytological attributes. Although all the reported species
within Cycas shared the same chromosome number of 2n¼22
and the same karyotypic component of m, sm, st, and T, as
well as most of them belonging to Stebbins’3B type
(according to Stebbins, 1971), variations in karyotype could
be found throughout its distribution ranges or among
different sections of this genus (Hua & Chen, 1990; Tian
et al., 2002). Morphologically, C. chenii could be allocated to
Sect. Stangerioides with C. guizhouensis and C. tanqingii.
However, these three species share no known overlapping
geographic distribution area and occupy relatively discrepant
habitats, which may have derived different chromosomic
fission and fusion patterns in karyotypical evolution and
formed their respective karyotypes (Moretti, 1990; Zheng
et al., 2002). However, as the karyotypical data of Cycas
seemed to be disordered and lacking detail, much work
should be carried out in the subsequent karyotypic research of
Cycas.
Cycas chenii has morphological similarities to C. simplicipinna
and C. tanqingii, but they were located in different subclades
on the phylogenetic tree. In terms of morphology, the
three Cycas species could easily be discriminated by their
megasporophylls, leaves, and seeds (see Table 3). The
karyotype of C. chenii was identical to C. simplicipinna and
C. taitungensis (Wang et al., 1996), which suggested that
different species might have the same karyotype. All evidence
from morphology, cytology, and molecular phylogeny validly
supported that C. chenii is an independent species from other
closely related species, although they appeared to be sister
lineages and shared distribution areas in southern Yunnan
with a similar habitat and subtropical climate.
Both phylogeny and morphology supported that C. chenii
was located in section Stangerioides. Interestingly, C. aculeata
K. D. Hill & H. T. Nguyen and C. siamensis Miq. appeared to be
sister lineages, with both located in Section Indosinenses.
These results indicate some conflict between morphological
characters and genotypic data because C. aculeata is most
similar to the non-sampled C. balansae Warb. This species is
currently assigned to section Stangerioides. A possible reason
for this phenomenon is long-branch attraction (LBA, Bergsten,
2005) or the result of convergent evolution for these most
recent divergent plants (Nagalingum et al., 2011).
Taxonomic treatment
Cycas chenii X. Gong & W. Zhou, sp. nov. Type: China. Yunnan:
Shuangbai county, Dutian, 24°31015.500N, 101°31055.800 E, 1100 m
alt., 2012, W. Zhou 201235 (holotype, KUN!).
(Figs. 1, 2).
Diagnosis: Species nova Cycas simplicipinna (Smitinand)
K. D. Hill et C. guizhouensis K. M. Lan & R. F. Zou affinis ab illo
foliis in sicco non nigro-brunneis, pinna apicali pinnis
lateralibus dissimili differ, ab hoc caule carente differ.
Description: Stem acaulescent, or subterranean; 2–8 leaves
in crown, leaves bright to deep green, highly glossy, 70–
190 cm long, flat (not keeled) in section (opposing pinnae
inserted at 160–180° on rachis), with 26–74 pinnae; with rusty
tomentum shedding as leaf expands, by rachis consistently
terminated by paired pinnae. Petiole 20–80 cm long (25–40%
of total leaf), glabrous spinescent for 90–100% of length. Basal
pinnae are not gradually reducing to spines, the spines 0.2–
0.3 cm long. Median pinnae simple, 17–30 cm long, 0.9–1.3 cm
wide, inserted at 70–80° to rachis, not decurrent, margins flat
or undulate; apex acuminate, not spinescent; midrib raised
above, raised below. Cataphylls narrowly triangular, pilose,
3–6 cm long. Male cones yellowish-green, 10–15 cm long,
6–8 cm wide, with rusty puberulous. Microsporophyll lamina
stiff, apical spine slender, closely appressed, 0.1–0.3 cm long.
Megasporophylls 10–12 cm long, brown tomentose; ovules
2–4, glabrous; lamina rhombic or ovate, 5–7 cm long,
2.5–3.5 cm wide, deeply pectinate, with 12–18 soft spines,
apical spine distinct from lateral spines. Seeds ovoid, 2–3cm
long, 1.5–2.6 cm wide; sarcotesta yellow.
Distribution and habitat: Cycas chenii is only known from
four populations that were found in Shuangbai and Honghe
counties of Yunnan Province, China. Based on the known
occurrences, we conclude that this species mainly occurs in
the upstream region of the Yuangjiang River in the central part
of Yunnan province. As a consequence of land clearing for
agriculture, these populations have to be considered
threatened.
This species was found to grow on a range of substrates
from limestone to shale and schist, usually on steep slopes,
mainly in forests with the altitude ranging from 500 m to
1300 m. The vegetation type in the region is subtropical
evergreen broad-leaved forest. The dominant tree species of
the forest are Pistacia weinmannifolia J. Poisson ex Franch,
Phyllanthus emblica Linn, Dalbergia hupeana Hance, and Ficus
tinctoria subsp. gibbosa (Blume) Corner.
Conservation status: So far, there is no protected area
covering or adjacent to the known populations of C. chenii.
The total population size is estimated at less than 500. This
species will be assigned an IUCN Red List status of EN
A new Cycas species from China 9
www.jse.ac.cn J. Syst. Evol. 9999 (9999): 1–10, 2015
(endangered). Considering its living status, an urgent need of
in situ conservation should be carried out to protect the
existing populations of C. chenii. As a consequence of land
clearing for agriculture, the known populations must be
considered threatened.
Etymology: We named this species C. chenii after Professor
Jiarui Chen (Chia-Jui Chen), a botanist from the Institute of
Botany, Chinese Academy of Sciences, to honor his significant
work on the genus Cycas in China.
Acknowledgements
The authors would like to thank Yu-Fa Zhou for help with
sample collection and Cheng-Cheng Tao for producing the
distribution map. We also own special thanks to Prof. H. Peng
for writing Latin descriptions of the new species. This research
was supported by the United Fund of the National Natural
Science Foundation of China and the Yunnan Natural Science
Foundation (Grant No. U1136602 to X. G.).
References
Bergsten J. 2005. A review of long-branch attraction. Cladistics 21: 163–
193.
Dieg D, Guillermo LT, Ram
on D, David P. 2012. jModelTest 2: More
models, new heuristics and parallel computing. Nature Methods 9:
772.
Doyle J. 1991. DNA protocols for plants—CTAB total DNA isolation. In:
Hewitt GM, Johnston A eds. Molecular techniques in taxonomy.
Berlin: Springer. 283–293.
Farris JS. 1989. The retention index and the rescaled consistency
index. Cladistics 5: 417–419.
Farris JS, K€
allersj€
o M, Kluge AG, Bult C. 1994. Testing significance of
incongruence. Cladistics 10: 315–319.
Felsenstein J. 1985. Confidence limits on phylogenies: An approach
using the bootstrap. Evolution 39: 783–791.
Hill KD. 2008. The genus Cycas (Cycadaceae) in China. Telopea 12: 71–
118.
Hill KD, Stevenson DW, Osborne R. 2008. The world list of cycads.
Memoirs of the New York Botanical Garden 97: 454–483.
Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of
phylogenetic trees. Bioinformatics 17: 754–755.
Kluge AG, Farris JS. 1969. Quantitative phyletics and the evolution of
anurans. Systematic Biology 18: 1–32.
Levan A, Fredga K, Sandberg AA. 1964. Nomenclature for centromeric
position on chromosomes. Hereditas 52: 201–220.
Lindstrom AJ, Hill KD. 2007. The genus Cycas (Cycadaceae) in India.
Telopea 11: 463–488.
Moretti A. 1990. Karyotypic data on North and Central American
Zamiaceae (Cycadales) and their phylogenetic implications.
American Journal of Botany 77: 1016–1029.
Nagalingum N, Marshall C, Quental T, Rai H, Little D, Mathews S. 2011.
Recent synchronous radiation of a living fossil. Science 334: 796–
799.
Nylander JA, Wilgenbusch JC, Warren DL, Swofford DL. 2008. AWTY
(are we there yet?): A system for graphical exploration of MCMC
convergence in Bayesian phylogenetics. Bioinformatics 24: 581–
583.
Posada D. 2008. jModelTest: Phylogenetic model averaging. Molecular
Biology and Evolution 25: 1253–1256.
Rambaut A, Suchard MA, Xie D, Drummond AJ. 2014. Tracer
v1.6 [online]. Available from http://beast.bio.ed.ac.uk/Tracer
[accessed August 2014].
Rozas J, S
anchez-DelBarrio JC, Messeguer X, Rozas R. 2003. DnaSP,
DNA polymorphism analyses by the coalescent and other
methods. Bioinformatics 19: 2496–2497.
Shaw J, Lickey EB, Beck JT, Farmer SB, Liu W, Miller J, Siripun KC,
Winder CT, Schilling EE, Small RL. 2005. The tortoise and the hare
II: Relative utility of 21 noncoding chloroplast DNA sequences for
phylogenetic analysis. American Journal of Botany 92: 142–166.
Stebbins GL. 1971. Chromosomal evolution in higher plants. London:
Edward Arnold.
Swofford DL. 2002. PAUP*: Phylogenetic analysis using parsimony
(*and other methods), version 4. Sunderland: Sinauer Associates.
Taberlet P, Gielly L, Pautou G, Bouvet J. 1991. Universal primers for
amplification of three non-coding regions of chloroplast DNA.
Plant Molecular Biology 17: 1105–1109.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997.
The CLUSTAL_X windows interface: Flexible strategies for
multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Research 25: 4876–4882.
Tian B, Gong X, Zhang Q-T. 2002. Karyotypes of five species in Cycas.
Acta Botanica Yunnanica 24: 370–376.
Wang F-X, Liang H-B, Chen T-Q, Wang D-Y. 1996. Cycads in China.
Guangdong: Guangdong Science and Technology Press.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics. In:
Innis MA, Gelfand DH, Sninsky JJ, White TJ eds. PCR protocols: A
guide to methods and applications. New York: Academic Press.
315–322.
Wu H-M, Chen X. 1990. Karyotype analysis of Cycas guizhouensis.
Chinese Bulletin of Botany 7: 45–48.
Yang Z, Rannala B. 1997. Bayesian phylogenetic inference using DNA
sequences: A Markov chain Monte Carlo method. Molecular
Biology and Evolution 14: 717–724.
Zheng F-Q, Zhang X-P, Pan A-F, He T-H. 2002. Karyotypes and
karyotypical evolution in five Cycas species in China. Scientia Silvae
Sinicae 38: 50–52.
10 Zhou et al.
J. Syst. Evol. 9999 (9999): 1–10, 2015 www.jse.ac.cn
