Isolation and characterization of plant growth-promoting rhizobacteria from wheat rhizosphere and their effect on plant growth promotion

Abstract

The present study was conducted to characterize the native plant growth promoting (PGP) bacteria from wheat rhizosphere and root-endosphere in the Himalayan region of Rawalakot, Azad Jammu and Kashmir (AJK), Pakistan. Nine bacterial isolates were purified, screened in vitro for PGP characteristics and evaluated for their beneficial effects on the early growth of wheat (Triticum aestivum L.). Among nine bacterial isolates, seven were able to produce indole-3- acetic acid in tryptophan-supplemented medium; seven were nitrogen fixer, and four were able to solubilize inorganic phosphate in vitro. Four different morphotypes were genotypically identified based on IGS-RFLP fingerprinting and representative of each morphotype was identified by 16S rRNA gene sequencing analysis except Gram-positive putative Bacillus sp. Based on 16S rRNA gene sequence analysis, bacterial isolates AJK-3 and AJK-9 showing multiple PGP-traits were identified as Stenotrophomonas spp. while AJK-7 showed equal homologies to Acetobacter pasteurianus and Stenotrophomonas specie. Plant inoculation studies indicated that these Plant growth-promoting rhizobacteria (PGPR) strains provided a significant increase in shoot and root length, and shoot and root biomass. A significant increase in shoot N contents (up to 76%) and root N contents (up to 32%) was observed over the un-inoculated control. The study indicates the potential of these PGPR for inoculums production or biofertilizers for enhancing growth and nutrient content of wheat and other crops under field conditions. The study is the first report of wheat associated bacterial diversity in the Himalayan region of Rawalakot, AJK.

Full text

ORIGINAL RESEARCH
published: 17 March 2015
doi: 10.3389/fmicb.2015.00198
Edited by:
Adam Schikora,
Justus Liebig University Giessen,
Germany
Reviewed by:
Fanhong Meng,
Tex as A &M Univ ersi ty, U SA
Harsh Bais,
University of Delaware, USA
*Correspondence:
M. Kaleem Abbasi,
Department of Soil and Environmental
Sciences, The University of Poonch,
Rawalakot, Azad Jammu and
Kashmir, Pakistan
mkaleemabbasi@gmail.com
Specialty section:
This article was submitted to
Plant-Microbe Interaction, a section of
the journal Frontiers in Microbiology
Received: 24 December 2014
Accepted: 24 February 2015
Published: 17 March 2015
Citation:
Majeed A, Abbasi MK, Hameed S,
Imran A and Rahim N (2015) Isolation
and characterization of plant
growth-promoting rhizobacteria from
wheat rhizosphere and their effect on
plant growth promotion.
Front. Microbiol. 6:198.
doi: 10.3389/fmicb.2015.00198
Isolation and characterization of
plant growth-promoting
rhizobacteria from wheat
rhizosphere and their effect on plant
growth promotion
Afshan Majeed1,M. Kaleem Abbasi1*,Sohail Hameed2,Asma Imran 2and
Nasir Rahim 1
1Department of Soil and Environmental Sciences, The University of Poonch, Rawalakot, Azad Jammu and Kashmir,
Pakistan, 2National Institute for Biotechnology and Genetic Engineering, Faisalabad, Pakistan
The present study was conducted to characterize the native plant growth promoting
(PGP) bacteria from wheat rhizosphere and root-endosphere in the Himalayan region
of Rawalakot, Azad Jammu and Kashmir (AJK), Pakistan. Nine bacterial isolates were
purified, screened in vitro for PGP characteristics and evaluated for their beneficial
effects on the early growth of wheat (Triticum aestivum L.). Among nine bacterial
isolates, seven were able to produce indole-3- acetic acid in tryptophan-supplemented
medium; seven were nitrogen fixer, and four were able to solubilize inorganic phosphate
in vitro. Four different morphotypes were genotypically identified based on IGS-RFLP
fingerprinting and representative of each morphotype was identified by 16S rRNA gene
sequencing analysis except Gram-positive putative Bacillus sp. Based on 16S rRNA
gene sequence analysis, bacterial isolates AJK-3 and AJK-9 showing multiple PGP-
traits were identified as Stenotrophomonas spp. while AJK-7 showed equal homologies
to Acetobacter pasteurianus and Stenotrophomonas specie. Plant inoculation studies
indicated that these Plant growth-promoting rhizobacteria (PGPR) strains provided a
significant increase in shoot and root length, and shoot and root biomass. A significant
increase in shoot N contents (up to 76%) and root N contents (up to 32%) was observed
over the un-inoculated control. The study indicates the potential of these PGPR for
inoculums production or biofertilizers for enhancing growth and nutrient content of
wheat and other crops under field conditions. The study is the first report of wheat
associated bacterial diversity in the Himalayan region of Rawalakot, AJK.
Keywords: biofertilizers, diversity, plant growth-promoting rhizobacteria, 16S rRNA, wheat
Introduction
Chemical fertilizers are generally used to supply essential nutrients to the soil–plant system
throughout the world. However, the prices, availability, and the environmental concerns of
chemical fertilizers especially the N fertilizers are real issues of today’s agriculture. Application
of chemical fertilizers in slopping landscapes under high annual rainfall normally exist in the
mountain ecosystem of the Hindu Kush Himalayan (HKH) region may not be effective because
Frontiers in Microbiology | www.frontiersin.org 1March 2015 | Volume 6 | Article 198

Majeed et al. Screening of wheat rhizospheric PGPRs
of surface runoff and leaching. Therefore, there is an urgent
need to find alternative strategies that can ensure com-
petitive crop yields, provide environmental safety, and
protection while maintain long term ecological balance in
agro-ecosystem. Use of microbial inoculants or plant growth-
promoting rhizobateria (PGPR) for the enhancement of
sustainable agricultural production is becoming a more widely
accepted practice in intensive agriculture in many parts of the
world.
Plant growth-promoting rhizobacteria are free-living soil bac-
teria that aggressively colonize the rhizosphere/plant roots, and
enhance the growth, and yield of plants when applied to seed or
crops (Kumar et al., 2014). The plant growth promoting (PGP)
effect of the PGPR is mostly explained by the release of metabo-
lites directly stimulating growth. Several mechanisms have been
postulated to explain how PGPR benefit the host plant. These
include: (a) the ability to produce plant growth regulators or
phytohormones such as indole acetic acid (IAA), cytokinins,
and gibberellins (Glick, 1995;Marques et al., 2010); (b) enhanc-
ing asymbiotic N2fixation (Sahin et al., 2004;Khan, 2005); (c)
solubilizing inorganic phosphate and mineralization of organic
phosphate and/ or other nutrients (Glick, 1995;Jeon et al.,
2003); (d) antagonistic effect against phytopathogenic microor-
ganisms by production of siderophores, the synthesis of antibi-
otics, enzymes, and/or fungicidal compounds, and competition
with detrimental microorganisms (Dey et al., 2004;Lucy et al.,
2004).
Interest in the beneficial rhizobacteria associated with cere-
als has increased recently and several studies clearly demon-
strated the positive and beneficial effects of PGPR on growth
and yield of different crops especially wheat at different environ-
ment under variable ecological conditions (Ozturk et al., 2003;
Marques et al., 2010;Mehnaz et al., 2010;Zhang et al., 2012).
Inoculation with Pseudomonas fluorescens showed a significant
increase in root weight 19–43%, number of tillers per plant
10–21%, grain yield 15–43%, and straw yield 22–39% of wheat
compared to un-inoculated plants (Shaharoona et al., 2008).
Moreover, inoculation with PGPR strain Azotobacter saved 25–
30 kg N ha−1chemical fertilizer (Narula et al., 2005). More
recently, Kumar et al. (2014) conducted experiments on wheat
under pot and field condition to examine the effect of PGPRs on
the growth and yield of wheat and found that triple combination
of strains B. megaterium,A. chlorophenolicus, and Enterobacter
significantly increased 17.5, 79.8, 78.6, and 26.7% plant height,
grain yield, straw yield, and test weight under pot condition
and also 29.4, 27.5, 29.5, and 17.6% under field condition,
respectively.
Knowledge of the native bacterial population, their charac-
terization, and identification is required for understanding the
distribution and diversity of indigenous bacteria in the rhizo-
sphere of specific crops (Keating et al., 1995;Chahboune et al.,
2011). With increasing awareness about the-chemical-fertilizers-
based agricultural practices, it is important to search for region-
specific microbial strains which can be used as a growth pro-
moting/enhancing inoculum to achieve desired crop produc-
tion (Deepa et al., 2010). Recently, the bacterial diversity in the
forest soil of Kashmir, India was investigated and reported
(Ahmad et al., 2009) but no data is available regarding the
rhizosphere microbiome of wheat native to this area. Wheat
being a staple food has special importance in the economy of the
country.
Keeping in mid the study was planned to isolate the native
strains from rhizosphere and endo-rhizosphere of wheat grown
on different soils of Rawlakot, AJK. These bacteria were charac-
terized and screened in vitro for PGP potentials and represen-
tative isolates were identified by 16S rRNA sequence analysis.
Furthermore, the PGP potential was evaluated in vivo under
axenic conditions and effect on the growth, and N contents of
wheat at early growth stage was investigated.
Materials and Methods
The Study Site
The study site is located in an experimental farm of the University
of the Poonch Rawalakot, Azad Jammu and Kashmir (AJK),
Pakistan at the Faculty of Agriculture Rawalakot. Rawalakot
is located at latitude 33◦5132.18 N, longitude 73◦4534.93E,
and an elevation of 1638 m above the sea level in the north–
east of Pakistan under the foothills of great Himalayas. The
topography is mainly hilly and mountainous with valleys and
stretches of plains. The area is characterized by a temperate sub-
humid climate with annual average rainfall ranging from about
500−2000 mm, most of which is irregular and falls with intense
storms during monsoon and winter. The monthly mean temper-
ature ranges from a minimum of 0◦C to a maximum of 22◦C
accompanied by a severe cold and snow fall in winter. The soil
used in the study (0–15 cm) was silt loam in texture (Organic
carbon 9.5 g kg−1,totalN1.02gkg
−1,availableP2.5mgkg
−1,
available K 54 mg kg−1and pH 6.7).
Sample Collection and Isolation of Bacteria
Wheat (Triticum aestivum L.) variety Inqlab–91, plant sam-
ples were collected from Research farm fields of Faculty of
Agriculture Rawalakot along with bulk rhizospheric soil. Samples
were placed individually in plastic bags and brought to National
Institute of Biotechnology and Genetic Engineering (NIBGE),
Faisalabad for isolation of bacteria. Rhizospheric bacteria were
isolated from 1 g soil tightly adhering to the root by serial
dilution plating on Luria–Bertani (LB) agar plates as described
(Somasegaran and Hoben, 1994). Endophytic bacteria were iso-
lated by serial dilution plating of sterilized crushed root samples
on LB agar plates as described (Hameed et al., 2004). The plates
were incubated at 28 ±2◦C till the appearance of bacterial
colonies. Individual colonies were picked and streaked on LB
plates for further purification.
Biochemical Characterization
Colony morphology, size, color, shape, gum production, and
growth pattern were recorded after 24 h of growth on LB agar
plates at 28 ±2◦C as described by Somasegaran and Hoben
(1994). Cell size and motility was observed by light microscopy.
Acid/alkali production was tested on LB agar plates contain-
ing 0.025% (w/v) bromothymol blue as pH indicator. The Gram
Frontiers in Microbiology | www.frontiersin.org 2March 2015 | Volume 6 | Article 198

Majeed et al. Screening of wheat rhizospheric PGPRs
reaction was performed as described by Vincent and Humphrey
(1970). Amino-peptidase and cytochrome oxidase tests were
performed by using commercially available strips (Merck,
Darmstadt, Germany). Catalase production was checked by plac-
ing a drop of H2O2onto the bacterial colony on a glass slide.
Molecular Characterization
Total genomic DNA of bacterial strains was extracted by
alkaline lysis method (Maniatis et al., 1982)withslightmod-
ifications. DNA concentration was determined by DNA flu-
orometer (DYNA QuantTM 200). On the basis of cell and
colony morphology, nine different morphotypes were identified
from rhizosphere and endosphere of wheat. These morpho-
types were subjected to restriction fragment length polymor-
phism of IGS to distinguish among these genotypes. 16S rRNA–
23S rRNA intergenic spacer region was amplified as described
(Laguerre et al., 1996) using forward primer FGPS-1490 (5-
TGGGGCTGGATCACCTCCTT -3) and reverse primer FGPS-
132 (5- CCGGGTTTCCCCATTCGG-3). The PCR-product was
restricted using BamHI and HindIII bacterial isolates were clus-
tered. A representative of each IGS-RFLP type was identified
by analysis of 16S rRNA gene sequence. The complete 1.5-kb
16S rRNA region was amplified using the universal bacterial
16S rRNA primers P1 a forward primer (P1 =5- cgggatccA-
GAGTTTGATCCTGGTCAGAACGAACGCT -3)andP6;a
reverse primer (P6 =5- cgggatccTACGGCTACCTTGTTAC-
GACTTCACCCC -3) which correspond to Escherichia coli posi-
tions 8–37 and 1479–1506, respectively, and amplifies 1500 bp
full gene fragment (Tan et al., 1997).
The PCR amplification of the target sequence was done as
described (Imran et al., 2010). Amplified PCR products of 16S
ribosomal gene were confirmed on 1% agarose gel, purified using
QIAquick PCR purification kit (QIAGEN) and cloned into E.
coli TOP10 (Invitrogen). Plasmids DNA was isolated using Rapid
plasmid mini Prep kit (Marligen Bioscience) and restricted with
EcoRI and BamHI for the confirmation of transformed ampli-
cons. Cloned PCR products were sequenced commercially by
Macrogen (Korea).
The obtained gene sequences were compared with oth-
ers in the Gen Bank databases using the NCBI BLAST
at http://www.ncbi.n1m.nih.gov/blast/Blast.cgi. Sequences were
submitted to NCBI GenBank data base and accession numbers
were obtained.
Bioassays for Plant Growth Promoting Traits
Solubilization of Insoluble Phosphate and Zinc
Each bacterial culture was spot inoculated in the center
of agar plates containing tricalcium phosphate as insoluble
phosphate source (Pikovskaya, 1948)andontoLGImedium
(Cavalcante and Döbereiner, 1988) supplemented with 0.1% zinc
oxide and zinc sulfate. The plates were incubated at 28 ±2◦C
for 7–10 days and observed for the formation of halo zone
around the colonies. P-solubilization was quantified by Phospho-
molybdate blue color method using spectrophotometer (λ=882)
as described by Murphy and Riley (1962). The experiment was
repeated twice with three replicates each and mean was calcu-
lated.
Production of Indole-3-Acetic Acid
Bacterial cultures were grown in Okon et al.’s (1977) malate
medium supplemented with tryptophan (100 mg/L) as the
precursor of IAA and compared to those grown without
the addition of tryptophan precursor. IAA production was
determined using colorimetric methods (Gordon and Weber,
1951) and quantified on HPLC using ethyl acetate oxi-
dation method (Tien et al., 1979). The experiment was
repeated twice with three replicates each and mean was
calculated.
Nitrogen Fixation
Nitrogenase activity was detected by acetylene reduc-
tion/ethylene production assay as described earlier (Mirza et al.,
2001). Pure bacterial colonies were inoculated into NFM
(Nitrogen Free Malate) semisolid medium vials and incubated at
28 ±2◦C for 48 h. Acetylene (10% v/v) was injected to the vials,
incubated at 28 ±2◦C for 16 h and 100 µL of gas samples from
the vials were analyzed on a gas chromatograph (Thermoquest,
Trace G.C, Model K, Rodono Milan, Italy) equipped with a
Porapak Q column and a H2-flame ionization detector (FID)
using conditions described in Hardy et al. (1973). The experi-
ment was repeated twice with three replicates each and mean was
calculated.
Plant Inoculation and Root Colonization
Assays
Effect of bacterial inoculation on plant growth was examined
on wheat variety Inqalab–91 in a growth room experiment.
The Azospirillum brasilense strain Er-20 (Mirza et al., 2000)was
used as positive control while un-inoculated plants served as
negative control. Bacterial cultures were grown in 50 mL fal-
con tubes filled with 25 mL LB broth and were kept on
shaker at 200 rpm for 16 h. Seeds were germinated on water
agar plates and transferred aseptically to plant growth pouches
(Weaver and Frederick, 1982) after 4 days of seedling emer-
gence. Before transferring the germinated seeds to the pouches
(autoclaved), 20 mL of 1/2strength Hoagland’s nutrient solution
was poured in the pouches. The un-inoculated pouches were
watered with full strength Hoagland (with N, P) while inocu-
lated pouches received full strength Hoagland without N and P
along-with 1 g inorganic tri-calcium phosphate as sole P-source.
After 2 days of seedling transplant, 1 mL inoculum (cells sus-
pended in 0.85% saline; OD =0.45) was applied at the base of
each seedling. The un-inoculated pouches were supplied with
same amount of sterile saline. Two seedlings were maintained
per growth pouch and placed in growth chamber at 20–22◦C
with a day length of 12 h and relative humidity was set at
70%. The experiment was set up in randomized complete design
(CRD) using 10 replicate pouches per treatment. Plants were har-
vested 60 days after transplantation and data was recorded for
shoot and root length, shoot and root dry weight, and shoot
and root N contents. Total nitrogen contents of the plants
were determined by the Kjeldahl method (Keeney and Nelson,
1982).
Root colonization potential of inoculated bacteria was deter-
mined at every 15 day using serial dilution plating technique
Frontiers in Microbiology | www.frontiersin.org 3March 2015 | Volume 6 | Article 198

Majeed et al. Screening of wheat rhizospheric PGPRs
on LB agar and number of viable cells was estimated as colony
forming units (CFU) as described in Somasegaran and Hoben
(1994)onLBagarplates.
Statistical Analysis
The data were subjected to analysis of variance using statis-
tical program xxx (MSTATC, 1990). The differences among
various treatment means were compared using the least signif-
icant differences test (LSD) at 5% (P≤0.05) probability level
(Steel and Torrie, 1980).
Results
Culturable Bacteria in the Rhizosphere and
Endosphere of Wheat
Bacteria were obtained both from rhizospheric portion as well
as root interior of wheat. Six bacteria were obtained from wheat
rhizosphere soil while three from root interior (Tabl e 1). The
bacteria showed gummy, white-to milky white colonies with vari-
able sizes and margins (Tabl e 1) on LB agar plates. The cells
were mostly motile, rod shaped showing Gram-negative reaction
except AJK-4 and AJK-8 both of which were tentatively identified
as Bacillus sp. based on their colony and cell morphologies and
Gram reaction.
Identification of Bacteria
Nine wheat rhizo/endophytic bacteria yielded four IGS pat-
terns. Among these four patterns, one comprising of Bacillus
sp. was not sequenced but from other three types, one strain
each was sequenced based on 16S rRNA gene. The PGPR
isolate AJK-3 was identified as Stenotrophomonas rhizophila
strain having 99% similarity with the reported gene sequence.
AJK-7 showed 98% similarity with Acetobactor pasteurianus.
However, isolate AJK-9 95% similarity with Stenotrophomonas
specie. The new isolate, AJK-9 had many of its benefi-
cial characteristics resembling Stenotrophomonas strain AJK-
3, hence may be considered as a Stenotrophomonas species.
Nucleotide accession number for strain AJK-9,AJK-7, and
AJK-3 are GQ130134, GQ130133, and GQ130132, respec-
tively.
Plant Growth Promoting Potential
In vitro plant growth promotion traits of the rhzio/endophytic
bacteria are described in Table 2 . Seven out of nine bacterial iso-
lates (except isolates AJK-2, AJK-5) were able to produce IAA
with a range of 0.27–77.98 µgml
−1inthepresenceofIAApre-
cursor tryptophan. Stenotrophomonas sp. strain AJK-9 produced
maximum IAA (77.98 µgml
−1) followed by S. rhizophila strain
AJK-3. The isolates AJK-1, AJK-2, AJK-3, and AJK-9 produced
IAAevenwithoutIAAprecursortryptophan.
Acetylene reduction assay (ARA) showed seven isolates
including both rhizosphere and endophytic bacteria have the
nitrogenase activity ranging from 1.44 to 7.89 µmol C2H4mg
protein/h. Putative Stenotrophomonas sp. isolate AJK-6 showed
maximum ARA.
Four bacteria including three rhizospheric (AJK-1, AJK-2,
AJK-3) and one endophytic (AJK-8) were able to form clear
zone on Pikovskaia’s agar plates after 7 days of incubation. When
quantified spectrophotometrically, maximum P was solubilized
by putative Bacillus sp. AJK-8 which was an endophytic strain
and formed a clear zone of 3 mm diameter on Pikovskaia’s agar
plate (Figure 1). The range of P-solubilization varied from 2 to
19 µg/mL. We could not found any bacteria able to solubilized
zinc oxide or zinc sulfate during this study.
Root Colonization Potential
Bacterial population size was determined by plate count method
on LB agar at different time intervals. We observed that all rhi-
zospheric as well as endophytic bacteria were able to colonize
wheat plant roots and showed persistence in the rhizosphere up
to 60 days after inoculation (Figure 2). Plants were grown in
growth pouches for this experiment; hence, we could not deter-
mine the population size at maturity. Maximum colonization was
recorded between 30 and 45 days post inoculation. Rhizosphere
strain AJK-3 showed maximum number of bacteria at all times as
compared to other bacterial isolates.
Plant Growth Parameters
The bacterial isolates exerted a significant influence on wheat
growth characteristics (Tabl e 3;Figure 3). Comparisons were
made among Azospirillum (ER-20) inoculated positive con-
trol and a non-inoculated control (with Hoagland N and P).
TABLE 1 | Morphological characteristics of bacterial isolates from the wheat rhizosphere in the mountain region of Rawalakot, Azad Jammu and
Kashmir (AJK), Pakistan.
Strains Isolated from Colony size and shape Colony color Acid/alkali production on BTB Cell motility Cell shape Gram reaction
AJK-1 RHS Small, Wavy White Neutral Highly motile Small rods −
AJK-2 RHS Small, Round Milky white Neutral Motile Medium rods −
AJK-3 RHS Large, Round Dark Yellow Acidic Highly motile Oval −
AJK-4 RHS Medium, Wavy Off-white Neutral Slowly motile oval +
AJK-5 RHS Small, Round Off-white Acidic Slowly motile Medium rods −
AJK-6 RHS Large, Round Dark yellow Acidic Highly motile Small rods −
AJK-7 RI Medium, Round Milky white Neutral Highly motile Thin rods −
AJK-8 RI Medium, Round Milky white Neutral Highly motile Small rods +
AJK-9 RI Small, Round Milky white Neutral Highly motile Medium rods −
RHS, Rhizosphere soil; RI, Root interior.
Frontiers in Microbiology | www.frontiersin.org 4March 2015 | Volume 6 | Article 198

Majeed et al. Screening of wheat rhizospheric PGPRs
TABLE 2 | Biochemical and molecular analysis of rhizosphere and endophytic bacteria isolated from wheat rhizosphere from Rawlakot, AJK.
Isolates∗Biochemical analysis Molecular analysis
Catalase activity Cytochrome
oxidase
P-solubilization
(mg/mL)
IAA (µg/mL) (with
Tryptophan)
IAA (µg/mL) (without
Tryptophan)
ARA (µmole C2H4mg
protein/h)
Identification based on IGS type/biochemical/16S
rRNA gene sequencing
AJK-1 ++17 59.19 38.34 −ARS1
AJK-2 +−16 10.3 5.9 1.64 ARS2
AJK-3 ++16 72.32 62.45 1.78 ARS3 Stenotrophomonas rhizophila
AJK-4 ++2 1.88 0 2.25 ARS4 Bacillus sp.
AJK-5 +−20 0 1.44 ARS2
AJK-6 ++2 0.27 0 7.89 ARS3
AJK-7 ++8 7.56 0.12 1.53 ARS2 Acetobactor pasteurianus
AJK-8 ++19 0.56 0 −ARS4 Bacillus sp.
AJK-9 +−4 77.98 67.54 2.78 ARS3 Stenotrophomonas
∗All isolates produced substantial amount of gum on LB agar plates but non-solubilized Zinc oxide or Zinc sulfate in vitro.
ARA, Acetylene reduction assay; IAA, Indole acetic acid was tested with and without the addition of precursor; Data are the mean values of three replicates each and all experiments were repeated twice for confirmation
of results.
The symbol, +representing the positive reaction or the presence of the traits while the symbol, −shows the negative reaction or absence of the component/trait.
FIGURE 1 | Solubilization of inorganic tri-calcium phosphate in vitro by
bacterial isolate AJK-8 after 7 days of growth at 28 ±2◦C. The
formation of halo zone around the colonies shows the solubilization of the
inorganic phosphate.
The relative increase in shoot and root length due to bac-
terial isolates ranged between 25–45% and 29–52%, respec-
tively, over the un-inoculated control whilst the correspond-
ing increase in the shoot and root biomass ranged between
2–62% and 100–172%, respectively (Figures 3A,B). Similarly,
bacterial isolates significantly increased N content both in
shoot and root compared to un-inoculated control and Er-
20 (Figure 4A). The relative increase varied between 22–76%
for shoot and 10–32% for root over the un-inoculated con-
trol. The correlation between root length and shoot N con-
tents was positive and significant, i.e., R2=0.67 (Figure 4B).
The efficacy of different isolates for growth characteristics was
variable. Bacterial isolates AJK-2, AJK-9, AJK-3, and AJK-7
performed significantly better than others. Overall, the effect
of bacterial inoculation was more pronounced on root than
shoot.
Discussion
The PGP potential of Rhizobacteria isolated from rhizosphere
and endo-rhizosphere of wheat grown in the mountain region
(not previously explored) was examined and characterized
through polyphasic approach. Based on morphological obser-
vations, we found two putative Bacillus sp. strains includ-
ing one rhizospheric isolate AJK-4 and one endophytic iso-
late AJIK-8. Similarly, we found Stenotrophomonas sp. strains
both in the rhizosphere (AJK-3) as well as endosphere (AJK-9)
of wheat. The 16S rRNA sequence analysis of bacterial strain
AJK-3 showed 99% similarity with S. rhizophila type strain
Frontiers in Microbiology | www.frontiersin.org 5March 2015 | Volume 6 | Article 198

Majeed et al. Screening of wheat rhizospheric PGPRs
FIGURE 2 | Population density of different bacteria inoculated to wheat at different time intervals under axenic conditions. The error bars represent the
least significant difference among treatments at P≤0.05.
TABLE 3 | Effect of bacterial isolates on the growth characteristics of wheat grown in pouches under axenic conditions.
Treatments Shoot length
(cm)
Shoot fresh weight
(mg plant−1)
Shoot dry weight
(mg plant−1)
Root length
(cm)
Root fresh weight
(mg plant−1)
Root dry weight
(mg plant−1)
control 22.0 90 42 15.30 25 7
Er-20 18.61 82 51 15.58 18 9
AJK-1 23.3 105 43 19.73 35 14
AJK-2 26.0 129 68 22.15 42 16
AJK-3 27.0 109 49 20.85 36 19
AJK-4 24.57 118 53 20.83 47 14
AJK-5 23.20 111 54 20.63 41 17
AJK-6 24.49 108 52 21.20 38 15
AJK-7 23.69 10 67 20.77 39 15
AJK-8 23.46 117 52 19.36 51 17
AJK-9 23.40 135 61 19.13 49 11
LSD (P≤0.05) 3.96 6.84 5.30 3.67 2.51 5.34
SEM 1.34 12.0 8.0 1.25 13.0 1.4
Control, non-inoculated, no bacterial inoculums but plants were provided with full strength Hoagland containing N and P nutrients; Er-20, Positive control strain; SEM,
standard error of means; Data are the mean values of 10 replicates; LSD, least significant difference.
DSM 14405 which has been reported as a plant associated
bacterium showing separate physiological and genetic cluster
with low DNA–DNA hybridization value (<50%) from clini-
cal and environmental strains (Wolf et al., 2001). S. rhizophila
strains are plant associated and have been isolated from the
rhizosphere of oilseed rape and from the rhizosphere, and
potato tuber. Endophytic colonization of this bacterium has
also been reported along with its antagonistic activity against
plant pathogenic fungi, e.g., Verticillium dahliae, Rhizoctonia
solani, Sclerotinia sclerotiorum, and the human pathogenic fun-
gus Candida albicans. The endophytic isolate AJK-9 showed
95% similarity with Stenotrophomonas sp. and shared many of
its beneficial characteristics resembling Stenotrophomonas strain
AJK-3. We found that both Bacillus and Stenotrophomonas are
colonizers of wheat plant in the rhizosphere as well as root
interior in that region. Endophytic strain AJK-7 was identi-
fied as Acetobactor pasteurianus.Acetobacter sp. are obligatory
aerobic, nitrogen-fixing bacteria that are known for produc-
ing acid as a result of metabolic processes. Acetobacter dia-
zotrophicus is also a plant endophyte and has been said to
be capable of excreting about half of its fixed nitrogen in a
form that plants can use. The study indicated that the bio-
chemical tests of bacterial identification and characterization
can only be used to some extent to discriminate among the
bacterial strains, but could not distinguish among the closely
related ones. While, full-length 16S rRNA sequencing provides
Frontiers in Microbiology | www.frontiersin.org 6March 2015 | Volume 6 | Article 198

Majeed et al. Screening of wheat rhizospheric PGPRs
FIGURE 3 | Effect of PGPR inoculation on shoot and root length (A) and shoot/root dry weight (B) of wheat variety Inqlab grown in growth pouches
under axenic conditions. The error bars represent the least significant difference among treatments at P≤0.05.
information regarding separate entity of each isolate from the
wheat rhizosphere. Previous studies indicated I6S rRNA sequence
analysis as an authenticated technique used to study bac-
terial isolates at species level (Imran et al., 2010;Alam et al.,
2011).
In vitro screening for characteristics commonly associated
with plant growth promotion revealed that seven bacteria were
able to produce IAA in a range of 0.27–77.98 µg/mL, indi-
cating a substantial variability among rhizosphere and endo-
phytic wheat isolates for IAA production. The potential of
bacterial isolates to produce IAA indicates their ability to use
as growth hormones or growth regulators. Our results were
in agreement with the previous study where the PGPR from
the rhizosphere of Brassica campestris had shown to produce
6.02–29.75 µg/ml of IAA (Poonguzhali et al., 2008). The vari-
ation in the ability of PGPR to produce IAA found in the
present study had also been reported earlier (Mansour et al.,
1994;Zahir et al., 2000). This variation is attributed to the
various biosynthetic pathways, location of the genes involved,
regulatory sequences, and the presence of enzymes to con-
vert active free IAA into conjugated forms (Patten and Glick,
1996). The production of IAA by bacteria isolated from rhizo-
sphere of different crops, i.e., peanut, maize, wheat, and rice
had already been reported in number of studies (Dey et al., 2004;
Cakmakci et al., 2007;Mehnaz et al., 2010). The amount of IAA
detected in the present study (with and without tryptophan)
seems relatively higher than reported earlier, indicating that soils
under investigation have bacteria that have the characteristics
Frontiers in Microbiology | www.frontiersin.org 7March 2015 | Volume 6 | Article 198

Majeed et al. Screening of wheat rhizospheric PGPRs
FIGURE 4 | Nitrogen contents (mg g−1) in shoots and roots (A) and relationship between shoot N contents vs. root length, the error bars represent
the least significant difference (LSD) among different treatments at P≤0.05 (B) of PGPR-inoculated wheat variety Inqlab grown in growth pouches
under axenic conditions.
most commonly sought for use in growth enhancement of
plants.
The beneficial effect of PGPR in maintaining adequate lev-
els of mineral nutrients especially the P in crop produc-
tion had been previously reported (Rodriguez and Fraga, 1999;
Saravanan et al., 2007). In our study, four bacterial isolates
were found efficient solubilizer of phosphate. The ability of
PGPR strains to solubilize insoluble P and convert it to plant
available form is an important characteristic under conditions
where P is a limiting factor for crop production. In two dif-
ferent studies, very limited number of P-solubilizers (23.5% of
the total tested strains and five out of the 207 isolates) has
been reported (Hameeda et al., 2006;Islam et al., 2010). The soil
phosphate solubilizing strains can increase the availability of
phosphorus to plant by mineralizing organic phosphorus com-
pounds and by converting inorganic phosphorus into more
available form (Bar-Yosef et al., 1999). Phosphate solubiliza-
tion is mainly due to the production of microbial metabolites
including organic acids which decreases the pH of the cul-
ture media (Puente et al., 2004;Sahin et al., 2004;Shahid et al.,
2012). The presence of P-solubilizing microbial population in
soils may be considered a positive indicator of utilizing the
microbes as biofertilizers for crop production and beneficial
for sustainable agriculture. The results of nitrogen fixation by
ARA method indicated that fairly large population of wheat
associated nitrogen fixers are present in the soils and can be
beneficial to improve nitrogen nutrition of wheat and other
crops.
Frontiers in Microbiology | www.frontiersin.org 8March 2015 | Volume 6 | Article 198

Majeed et al. Screening of wheat rhizospheric PGPRs
All the bacterial isolates significantly increased shoot and root
length, shoot and root dry weight, and also enhanced the N
contents of inoculated wheat seedlings. The plant growth pro-
motion could be the result of the beneficial functions of applied
PGPR isolates, like plant growth hormone production, nitro-
gen fixation, and P solubilization. As the inoculated plants were
not supplied with any additional source of N or any form of
soluble P, the higher amount of N detected in the shoot or
roots of inoculated plants as well as growth promotion may
be attributed to the bacterial-assisted growth enhancement phe-
nomenon. In addition to some other parameters positively influ-
enced the growth of plant, auxin production by the isolates
is proposed as a major means of attaining growth promotion
(Deepa et al., 2010). Furthermore, the inoculation of PGPR hav-
ing multi-functional traits is better than having single traits
(Imran et al., 2014). IAA is involved in root initiation, cell divi-
sion, cell enlargement, increases root surface area, and conse-
quent access to soil nutrients by enhanced formation of roots
(Dey et al., 2004;Gray and Smith, 2005). Auxin production has
been proposed as a major means of attaining early growth pro-
motion in wheat (Khalid et al., 2004) along-with P-solubilization
(Rajput et al., 2013). The response of plants to different isolates
was variable which may be attributed to their individual traits
and rhizospheric competencies. Most of the bacteria showed
good survival and persistence in the rhizosphere. The signifi-
cant increase in growth and N level both in shoot and root upon
isolates application is a clear indicative of the fact that the bacte-
rial isolates have been able to provide better nutrient flux to the
plant host which resulted in the increase of the plant biomass and
N accumulation. The increase in root length due to the applied
isolates may also contributed to increase N uptake in plant shoot
as both the parameters were significantly correlated in the study
(R2=0.67).
Conclusion
This is a basic study that has provided an insight into the
bacterial community present in the mountainous region of
Rawalakot, AJK, Pakistan. We have demonstrated efficient N2-
fixing, P-solubilizing, and IAA-producing bacteria present among
the natural population. These characteristics are considered as
important PGP traits and have been found effective in positively
improving the growth and N contents of tested wheat plants.
These isolates offer potential in field applications as PGP agents in
wheat. Further studies should be focused on the detailed molec-
ular and functional characterization of these PGPR for practical
applications in the field.
Acknowledgments
This research work was kindly supported by the National
Institute for Biotechnology and Genetic Engineering (NIBGE),
Faisalabad and the University of Azad Jammu and Kashmir,
Pakistan. The authors are grateful to the technical staff of the
Department of Soil and Environmental sciences, Faculty of
Agriculture, Rawalakot-AJK for their technical assistance and
help in collecting soil samples.
References
Ahmad, N., Johri, S., Abdin, M. Z., and Qazi, G. N. (2009). Molecular character-
ization of bacterial population in the forest soil of Kashmir, India. World J.
Microbiol. Biotechnol. 25, 107–113. doi: 10.1007/s11274-008-9868-2
Alam, S. I., Bansod, S., Goel, A. K., and Singh, L. (2011). Characterization of an
environmental strain of Bacillus thuringiensis from a hot spring in western
Himalayas. Curr. Microbiol. 62, 547–556. doi: 10.1007/s00284-010-9743-x
Bar-Yosef, B., Rogers, R. D., Wolfram, J. H., and Richman, E. (1999).
Pseudomonas cepacia – mediated rock phosphate solubilization in kaolinite
and montmorillonite suspensions. Soil Sci. Soc. Am. J. 63, 1703–1708. doi:
10.2136/sssaj1999.6361703x
Cakmakci, R., Erat, M., Erdogan, U., and Dönmez, M. F. (2007). The influ-
ence of plant growth-promoting rhizobateria on growth and enzyme activi-
ties in wheat and spinach plants. J. Plant Nutr. Soil Sci. 170, 288–295. doi:
10.1002/jpln.200625105
Cavalcante, V. A., and Döbereiner, J. (1988). A new acid-tolerant nitrogen
fixing bacterium associated with sugarcane. Plant Soil 108, 23–31. doi:
10.1007/BF02370096
Chahboune, R., Barrijal, S., Moreno, S., and Bedmar, E. J. (2011). Characterization
of Bradyrhizobium species isolated from root nodules of Cytisus villosus grown
in Morocco. Syst. Appl. Microbiol. 34, 440–445.
Deepa, C. K., Dastager, S. G., and Pandey, A. (2010). Isolation and characterization
of plant growth promoting bacteria from non-rhizospheric soil and their effect
on cowpea (Vigna unguiculata (L.) Walp.) seedling growth. World J. Microbiol.
Biotechnol. 26, 1233–1240. doi: 10.1007/s11274-009-0293-y
Dey, R., Pal, K. K., Bhatt, D. M., and Chauhan, S. M. (2004). Growth promo-
tion and yield enhancement of peanut (Arachishypogaea L.) by application
of plant growth promoting rhizobacteria. Microbiol. Res. 159, 371–394. doi:
10.1016/j.micres.2004.08.004
Glick, B. R. (1995). The enhancement of plant growth by freeliving bacteria. Can.
J. Microbiol. 4, 1109–1114.
Gordon, S. A., and Weber, R. P. (1951). Colorimetric estimation of indoleacetic
acid. Plant Physiol. 26, 192–195.
Gray, E. J., and Smith, D. L. (2005). Intracelluler and extracellular PGRP:
commonalities and distinctions in the plant-bacterium signaling pro-
cesses. Soil Biol. Biochem. 37, 395–412. doi: 10.1016/j.soilbio.2004.
08.030
Hameed, S., Yasmin, S., Malik, K. A., Zafar, Y., and Hafeez, F. Y. (2004).
Rhizobium,Bradyrhizobium and Agrobacterium strains isolated from cul-
tivated legumes. Biol. Fertil. Soils 39, 179–185. doi: 10.1007/s00374-003-
0697-z
Hameeda, B., Rupela, O. P., Reddy, G., and Satyavani, K. (2006). Application of
plant growth-promoting bacteria as sociated with composts and macrofauna for
growth promotion of pearl millet (Pennisetum glaucum L.). Biol. Fertil. Soils 43,
221–227. doi: 10.1007/s00374-006-0098-1
Hardy, R. W. F., Burns, R. C., and Holsten, R. D. (1973). Applications of
the acetylene-ethylene assay for measurement of nitrogen fixation. Soil Biol.
Biochem. 5, 47–81. doi: 10.1016/0038-0717(73)90093-X
Imran, A., Hafeez, F. Y., Frühling, A., Schumann, P., Malik, K. A., and
Stackebrandt, E. (2010). Ochrobactrum ciceri sp. nov., isolated from nod-
ules of Cicer arietinum. Int. J. Syst. Evol. Microbiol. 60, 1548–1553. doi:
10.1099/ijs.0.013987-0
Imran, A., Saadalla, M. J. A., Khan, S. U., Mirza, M. S., Malik, K. A., and Hafeez,
F. Y. (2014). Ochrobactrum sp. Pv2Z2 exhibits multiple traits of plant growth
promotion, biodegradation and N-acyl-homoserine-lactone quorum sensing.
Ann. Microbiol. 64, 1797–1806. doi: 10.1007/s13213-014-0824-0
Islam, M. R., Ahamed, R., Rahman, M. O., Akbar, M. A., Al-Amin, M., Alam, K.
D., et al. (2010). In vitro antimicrobial activities of four medicinally important
plants in Bangladesh. Eur. J. Sci. Res. 39, 199–206.
Frontiers in Microbiology | www.frontiersin.org 9March 2015 | Volume 6 | Article 198

Majeed et al. Screening of wheat rhizospheric PGPRs
Jeon, J. S., Lee, S. S., Kim, H. Y., Ahn, T. S., and Song, H. G. (2003). Plant
growth promotion in soil by some inoculated microorganisms. J. Microbiol. 41,
271–276.
Keating, J. D., Beck, L., Materon, A., Yurtsever, N., Karuc, K., and Altuntas,
S. (1995). The role of D.P rhizobial diversity in legume crops pro-
ductivity in the west Asian Highlands. Exp. Agric. 31, 473–483. doi:
10.1017/S0014479700026454
Keeney, D. R., and Nelson, D. W. (1982). “Nitrogen-inorganic forms,” in Methods
of Soil Analysis,Part2,Chemical and Microbiological Properties, eds A. L. Page,
R. H. Miller, and D. R. Keeney (Madison, WI: SSSA), 643–693.
Khalid, A., Arshad, M., and Zahir, Z. A. (2004). Screening plant growth promoting
rhizobacteria for improving growth and yield of wheat. J. Appl. Microbiol. 46,
473–480. doi: 10.1046/j.1365-2672.2003.02161.x
Khan, A. G. (2005). Role of soil microbes in the rhizospheres of plants growing on
trace metal contaminated soils in phytoremediation. J. Trace Elem. Med. Biol.
18, 355–364. doi: 10.1016/j.jtemb.2005.02.006
Kumar, A., Maurya, B. R., and Raghuwanshi, R. (2014). Isolation and characteri-
zation of PGPR and their effect on growth, yield and nutrient content in wheat
(Triticum aestivum L.). Biocatal.Agric.Biotechnol.3, 121–128.
Laguerre, G., Mavingui, P., Allard, M. R., Charnay, M. P., Louvrier, P., Mazurier,
S. I., et al. (1996). Typing of rhizobia by PCR DNA fingerprinting and PCR-
restriction fragment length polymorphism analysis of chromosomal and sym-
biotic gene regions: application to Rhizobium leguminosarum and its different
biovars. Appl. Environ. Microbiol. 62, 2029–2036.
Lucy, M., Reed, E., and Glick, B. R. (2004). Application of free living
plant-promoting rhizobacteria. Antonie van Leeuwenhoek. 86, 1–25. doi:
10.1023/B:ANTO.0000024903.10757.6e
Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982). Molecular cloning: A
Laboratory Manual.NewYork:ColdSpringHarborLaboratory,45.
Mansour, F. A., Ildesuguy, H. S., and Hamedo, H. A. (1994). Studies on plant
growth regulators and enzyme production by some bacteria. J. Qatar Univ. Sci.
14, 81–288.
Marques, A. P. G. C., Pires, C., Moreira, H., R angel, A. O. S. S., and Castro, P. M. L.
(2010). Assessment of the plant growth promotion abilities of six bacterial iso-
lates using Zea mays as indicator plant. Soil Biol. Biochem. 42, 1229–1235. doi:
10.1016/j.soilbio.2010.04.014
Mehnaz, S., Kowalik, T., Reynolds, B., and Lazarovits, G. (2010). Growth promot-
ing effects of corn (Zea mays) bacterial isolates under greenhouse and field
conditions. Soil Biol. Biochem. 42, 1848–1856. doi: 10.1016/j.soilbio.2010.07.003
Mirza, M. S., Rasul, G., Mehnaz, S., Ladha, J. K., So, R. B., Ali, S., et al. (2000).
“Beneficial effects of nitrogen-fixing bacteria on rice,” in The Quest for Nitrogen
Fixation in Rice, eds J. K. Ladha and P. M. Reddy (Los Baños: IRRI), 191–204.
Mirza, M. S., Waseem, A., Farooq, L., Jacqueline, H. B., Rene, N. P., and Malik,
K. A. (2001). Isolation, partial characterization, and the effect of plant growth
promoting bacteria (PGPB) on micro propagated sugarcane in vitro. Plant Soil
237, 47–54. doi: 10.1023/A:1013388619231
MSTATC. (1990). A Microcomputer Program for the Design, Management, and
Analysis of Agronomic Research Experiments. East Lansing, MI: Michigan State
University.
Murphy, J., and Riley, J. P. (1962). A modified single solution method for the
determination of phosphate in natural waters. Anal. Chim. Acta 27, 31–36. doi:
10.1016/S0003-2670(00)88444-5
Narula, N., Kumar, V., Singh, B., Bhatia, R., and Laxminarayana, K. (2005).
Impact of biofertilizers on grain yield in spring wheat under varying fertility
conditions and wheat-cotton rotation. Arch.Agron.SoilSci.51, 79–89. doi:
10.1080/03650340400029382
Okon, Y., Albercht, S. L., and Burris, R. H. (1977). Methods for growing Spirillum
lipoferum and for counting it in pure culture and in association with plants.
Appl. Environ. Microbiol. 22, 85–88.
Ozturk, A., Caglar, O., and Sahin, F. (2003). Yield response of wheat and
barley to inoculation of plant growth promoting rhizobacteria at various
levels of nitrogen fertilization. J. Plant Nutr. Soil Sci. 166, 262–266. doi:
10.1002/jpln.200390038
Patten, C., and Glick, B. R. (1996). Bacterial biosenthesis of indole-3-acetic acid.
Can. J. Microbiol. 42, 207–220. doi: 10.1139/m96-032
Pikovskaya, R. I. (1948). Mobilization of phosphorus in soil in connection with the
vital activity of some microbial species. Mikrobiologya 17, 362–370.
Poonguzhali, S., Madhaiyan, M., and Sa, T. M. (2008). Isolation and identifica-
tion of phosphate solubilizing bacteria from Chinese cabbage and their effect
on growth and phosphorus utilization of plants. J. Microbiol. Biotechnol. 18,
773–777.
Puente, M. E., Bashan, Y., Li, C. Y., and Lebsky, V. K. (2004). Microbial popula-
tions and activities in the rhizoplane of rock-weathering desert plants. I. Root
colonization and weathering of igneous rocks. Plant Biol. (Stuttg.) 6, 629–642.
doi: 10.1055/s-2004-821100
Rajput, L., Imran, A., Mubeen, F., and Hafeez, F. Y. (2013). Salt-tolerant PGPR
strain Planococcus rifietoensis promotes the growth and yield of wheat (Triticum
aestivum L.) cultivated in saline soil.Pak.J.Bot.45, 1955–1962.
Rodriguez, H., and Fraga, R. (1999). Phosphate solubilizing bacteria and their role
in plant growth promotion. Biotechnol. Adv. 17, 319–339. doi: 10.1016/S0734-
9750(99)00014-2
Sahin, F., Cakmakci, R., and Kanta, F. (2004). Sugar beet and barley yields in rela-
tion to inoculation with N2-fixing and phosphate solubilizing bacteria. Plant
Soil 265, 123–129. doi: 10.1007/s11104-005-0334-8
Saravanan, V. S., Madhaiyan, M., and Thangaraju, M. (2007). Solubilization
of zinc compounds by the diazotrophic, plant growth promoting bac-
terium Gluconacetobacter diazotrophicus.Chemosphere 66, 1794–1798. doi:
10.1016/j.chemosphere.2006.07.067
Shaharoona, B., Naveed, M., Arshad, M., and Zahir, Z. A. (2008). Fertilizer-
dependent efficiency of Pseudomonads for improving growth, yield, and nutri-
ent use efficiency of wheat (Triticum aestivum L.). Appl. Microbiol. Biotechnol.
79, 147–155. doi: 10.1007/s00253-008-1419-0
Shahid, M., Hameed, S., Imran, A., Ali, S., and van Elsas, J. D. (2012). Root
colonization and growth promotion of sunflower (Helianthus annuus L.) by
phosphate solubilizing Enterobacter sp. Fs-11. World J. Microbiol. Biotechnol.
28, 2749–2758. doi: 10.1007/s11274-012-1086-2
Somasegaran, P., and Hoben, H. J. (1994). Handbook for Rhizobia. Methods in
Legume–Rhizobium Technology. Heidelberg, NY: Springer. doi: 10.1007/978-1-
4613-8375-8
Steel, R. G. D., and Torrie, J. H. (1980). Principles and Procedures of Statistics,2nd
Edn. New York, NY: McGraw Hill Book Co. Inc.
Tan, Z., Xiao-Dong, X., En-Tao, W., Jun-Lian, G., Esperanza, M., and Wen-Xin,
C. (1997). Phylogenetic and genetic relationships Mesorhizobium tianshanense
and related Rhizobia. Int. J. Syst. Bacteriol. 47, 874–879. doi: 10.1099/00207713-
47-3-874
Tien, T. M., Gaskins, M. H., and Hubbell, D. H. (1979). Plant growth substances
produced by Azospirillum brasilense and their effect on the growth of pearl
millet (Pennisetum americanum L.). Appl. Environ. Microbiol. 37, 1016–1024.
Vincent, J. M., and Humphrey, B. (1970). Taxonomically significant group antigens
in Rhizobium. J. Gen. Microbiol. 63, 379–382. doi: 10.1099/00221287-63-3-379
Weaver, R. W., and Frederick, L. R. (1982). “Rhizobium,” in Methods of Soil
Analysis, Part 2. Chemical and Microbiological Properties,edsA.L.Page,R.H.
Miller, and D. R. Keeney (Madison, WI: SSSA), 1043–1067.
Wolf, Y. I., Rogozin, I. B., Grishin, N. V., Tatusov, R. L., and Koonin, E. V. (2001).
Genome trees constructed using five different approaches suggest new major
bacterial clades. BMC Evol. Biol. 1:8. doi: 10.1186/1471-2148-1-8
Zahir, A., Abbas, S. A., Khalid, M., and Arshad, M. (2000). Structure dependent
microbially derived plant hormones by improving growth of maize seedlings.
Pak. J. Biol. Sci. 3, 289–291. doi: 10.3923/pjbs.2000.289.291
Zhang, J., Liu, J., Meng, L., Ma, Z., Tang, X., Cao, Y., et al. (2012). Isolation and
characterization of plant growth-promoting rhizobacteria from wheat roots by
wheat germ agglutinin labeled with fluorescein isothiocyanate. J. Microbiol. 50,
191–198. doi: 10.1007/s12275-012-1472-3
Conflict of Interest Statement: The authors declare that the research was con-
ducted in the absence of any commercial or financial relationships that could be
construed as a potential conflict of interest.
Copyright © 2015 Majeed,Abbasi, Hameed, Imran andRahim. This is an open-access
article distributed under the terms of the Creative Commons Attribution License
(CC BY). The use, distribution or reproduction in other forums is permitted, provid ed
the original author(s) or licensor are credited and that the original publication in this
journal is cited, in accordance with accepted academic practice. No use, distribution
or reproduction is permitted which does not comply with these terms.
Frontiers in Microbiology | www.frontiersin.org 10 March 2015 | Volume 6 | Article 198