ArticlePDF Available

Development and characterization of novel microsatellite loci for Lusitanian toadfish, Halobatrachus didactylus

Taylor & Francis
PeerJ
Authors:

Abstract and Figures

The Lusitanian toadfish Halobatrachus didactylus is an eastern Atlantic polygynous species showing male paternal care. In this paper we describe 5 novel microsatellite loci obtained by 454 GS-FLX Titanium pyrosequencing of a microsatellite-enriched library. The number of alleles per polymorphic locus varied between 2 and 4, and the observed heterozygosity ranged from 0.082 to 0.600. No significant deviation from Hardy-Weinberg equilibrium was found and there was no evidence for linkage disequilibrium. These markers will be of great value for paternity studies and population genetics of this species.
Content may be subject to copyright.
Submitted 22 October 2014
Accepted 20 December 2014
Published 20 January 2015
Corresponding author
Carla Sousa-Santos,
carla.santos@ispa.pt
Academic editor
Mar´
ıa ´
Angeles Esteban
Additional Information and
Declarations can be found on
page 6
DOI 10.7717/peerj.731
Copyright
2015 Sousa-Santos et al.
Distributed under
Creative Commons CC-BY 4.0
OPEN ACCESS
Development and characterization of
novel microsatellite loci for Lusitanian
toadfish, Halobatrachus didactylus
Carla Sousa-Santos1, Paulo J. Fonseca2and Maria Clara P. Amorim1
1MARE—Marine and Environmental Sciences Centre, ISPA—Instituto Universit´
ario,
Rua Jardim do Tabaco, Lisbon, Portugal
2Departamento de Biologia Animal and Centro de Biologia Ambiental, Faculdade de Ciˆ
encias,
Universidade de Lisboa, Campo Grande, Lisbon, Portugal
ABSTRACT
The Lusitanian toadfish Halobatrachus didactylus is an eastern Atlantic polygynous
species showing male paternal care. In this paper we describe 5 novel microsatellite
loci obtained by 454 GS-FLX Titanium pyrosequencing of a microsatellite-enriched
library. The number of alleles per polymorphic locus varied between 2 and 4, and the
observed heterozygosity ranged from 0.082 to 0.600. No significant deviation from
Hardy–Weinberg equilibrium was found and there was no evidence for linkage dise-
quilibrium. These markers will be of great value for paternity studies and population
genetics of this species.
Subjects Animal Behavior, Aquaculture, Fisheries and Fish Science, Marine Biology, Molecular
Biology
Keywords Batrachoididae, Paternity, Polymorphic loci, Microsatellite development, Pyrose-
quencing
INTRODUCTION
Microsatellite markers (Tautz, 1989), i.e., highly variable DNA sequences of tandem
repeats of 1–6 nucleotides with codominant inheritance, are widely used genetic markers
in areas as diverse as phylogeography (e.g., Fauvelot & Borsa, 2011), molecular ecology
(e.g., Gardner et al., 2011) and parentage analysis (e.g., Jones et al., 2010). Despite their
widespread use, the development of species-specific microsatellites can be challenging,
especially when a genomic library needs to be constructed and microsatellites must be
developed de novo. This need arises when there are no microsatellite primers developed for
closely related species.
In this work we describe novel microsatellite loci for Lusitanian toadfish Halobatrachus
didactylus (Bloch & Schneider, 1801) (Batrachoididae), obtained by 454 GS-FLX Titanium
pyrosequencing that will be of great value for population genetics studies, namely to
conduct paternity studies aiming to clarify the mating dynamics of this species.
The Lusitanian toadfish H. didactylus is a benthic fish species usually inhabiting shallow
waters down to 50 m depth. It occurs in the eastern Atlantic, from Ghana to the Iberian
Peninsula, and has its northernmost distribution limit at the Tagus estuary, in Portugal
(Roux, 1986;Bauchot, 1987;Costa, Almeida & Costa, 2003). In the breeding season males
How to cite this article Sousa-Santos et al. (2015), Development and characterization of novel microsatellite loci for Lusitanian toadfish,
Halobatrachus didactylus.PeerJ 3:e731;DOI 10.7717/peerj.731
of H. didactylus defend nests under rocks, where they vocalize to attract females to mate
with them (Vasconcelos et al., 2012). Each female spawns a single batch of eggs annually, but
males can guard the eggs of several females (Modesto & Can´
ario, 2003;Amorim et al., 2010).
In addition to nest-holder (type I) males there is a second male morphotype (type II) that
shows morphological and physiological dierences from type I males (Modesto & Can´
ario,
2003). Type II males diverge in reproductive tactics and are specialised in sneaking fertil-
izations (Modesto & Can´
ario, 2003). Interestingly, in the coast of Portugal there are several
populations that dier in the degree of incidence of alternative reproductive tactics (ART).
While in Tagus estuary type II males are relatively rare (ca. 10%), in Mira estuary they
represent 70% of the male population (Pereira et al., 2011). This divergence makes the Lusi-
tanian toadfish an excellent model to study the evolution of mating systems and of ARTs.
MATERIALS & METHODS
Total genomic DNA was isolated from 10 individuals using a NucleoSpin tissue 96 kit
(Macherey-Nagel) following the manufacture’s protocol, except for elution volume (we
used 70 µL of elution buer instead of 100 µL to increase DNA concentration). A total
of 1 µg was used for the development of microsatellite libraries through 454 GS-FLX
Titanium pyrosequencing of enriched DNA libraries, as described in Malausa et al. (2011).
Briefly, total DNA was enriched for AG, AC, AAC, AAG, AGG, ACG, ACAT, and ATCT
repeat motifs and subsequently amplified. PCR products were purified and quantified,
and GsFLX libraries were then constructed following manufacturer’s protocols (Roche
Diagnostics) and sequenced on a GsFLX-PTP. The bioinformatics program QDD (Megl´
ecz
et al., 2010) was used to analyse sequences. QDD treats all bioinformatics steps from raw
sequences until obtaining PCR primers, including removal of adapters/vectors, detection
of microsatellites, detection of redundancy/possible mobile element association, selection
of sequences with target microsatellites and primer design by using BLAST, ClustalW and
Primer3 programs. Finally, among 10,442 sequences comprising microsatellites motifs, 427
bioinformatic validated pairs of primer were retrieved.
For the validation step, a sub-group of 48 primers pairs was tested for amplification
on 14 DNA samples. PCR amplifications were performed in 25 µL reactions containing
20 ng of template DNA, 1×reaction buer, 37.5 pmol MgCl2, 6 pmol dNTP, 10 pmol of
each primer, and 1U Taq polymerase (FastStart—Roche Diagnostics). The PCR cycling
consisted of an initial denaturation at 95 C for 10 min, followed by 40 cycles comprising
denaturation at 95 C for 30 s, annealing at 55 C for 30 s, and extension at 72 C for 1 min
and a final extension at 72 C for 10 min.
Primer pairs were discarded if they failed to amplify or led to multiple fragments. From
the 48 tested primers pairs, 15 were validated. From these, 12 microsatellite loci were
selected for polymorphism study on seven DNA samples.
PCR amplifications were performed with the same conditions as previously but with
labelled primers. Each PCR product was diluted with dH2O (1:50), mixed with Hi-Di
Formamide and GeneScan 500 LIZ Size Standard (Applied Biosystems). Fragments were
Sousa-Santos et al. (2015), PeerJ, DOI 10.7717/peerj.731 2/9
separated using an Applied Biosystems 3730XL DNA Analyser. Alleles were scored using
GeneMapper v5.0 software (Applied Biosystems).
Finally, polymorphic markers (sequences available in Table S1 and deposited in
GenBank under the accession numbers KP250581KP250585) were used to optimize
multiplexed PCR and afterwards for population genotyping following the above
mentioned PCR conditions. The software Multiplex Manager v1.2 was used to check
for markers compatibility and to avoid problems like hairpins and primer-dimers. All the
laboratorial procedures described above were conducted at GenoScreen-France (www.
genoscreen.com).
Conditions and characteristics of the polymorphic loci are provided in Table 1. The
number of alleles, expected (He)and observed (Ho)heterozygosity (computed using
Levene’s correction), and inbreeding coecients (FIS)were calculated with GENEPOP on
the web (http://genepop.curtin.edu.au) and based on a sample of 85 individuals from the
Tagus estuary. Allele sequences are provided in Table S1.
This study was approved by the scientific committee of the Portuguese Foundation for
Science and Technology (FCT) which evaluated the project “Role of acoustic signals in
mate choice and male–male assessment in a strongly-vocal fish, Halobatrachus didactylus
(ref. PTDC/MAR/118767/2010) and the ethical forms filled by the research team. MCP
Amorim and PJ Fonseca are also credited by the “Direcc¸˜
ao Geral de Alimentac¸ ˜
ao e
Veterin ´
aria” (General Directorate of Food and Veterinary) as Coordinator-researcher
(C category) by FELASA.
RESULTS AND DISCUSSION
The average number of alleles per locus was of 2.6 (Table 1). GENEPOP results showed that
there was no heterozygote deficiency (p-values between 0.23 and 1.00) and no significant
deviation from Hardy–Weinberg equilibrium was found (X2=2.95, df =10, p=0.98;
Fisher’s method). The average observed heterozygosity over all loci (Ho) and the level of
expected heterozygosity (He) were 0.325 and 0.317, respectively (Table 1). We also tested
for the presence of linkage disequilibrium (LD) between pairs of loci using GENEPOP but
no evidence for LD was detected (p-values ranged from 0.18 to 1.00, mean =0.62).
Only five of the 12 tested loci were considered polymorphic for this population
(polymorphism rate of 41.7%), which is in agreement with the extremely low levels of
genetic diversity obtained for this species by other authors (e.g., Marques et al., 2006;
Robalo et al., 2013). The fact that our study was focused on a single population of the target
species might have also contributed for the low number of polymorphic loci. Nevertheless,
the five polymorphic loci were sucient to address the paternity of eggs (M Amorim,
2014, unpublished data) and so to estimate the impact of sneaking in this population.
Moreover, it seems that testing more loci does not necessarily imply a higher detection of
polymorphic loci.
To compare the present results with the ones of other studies, we did a brief keyword
search for “454 sequencing,” “microsatellite development,” “fish” and “polymorphic.
For the first 15 papers retrieved, we compiled the number of microsatellites detected,
Sousa-Santos et al. (2015), PeerJ, DOI 10.7717/peerj.731 3/9
Table 1 Characterization of 5 polymorphic microsatellite loci for H. didactylus.
Marker Forward primer sequence (5’–3’) Reverse primer sequence (5’–3’) Fluorescent
dye
Repeat
motif
Expected
size (bp)
Size range
(bp)
NaHeHoFIS
Loc11 TCACCTGTGAGAGCGAGAAA TGCACCTGATCCTAAATCCA VIC (GA)16 135 121–135 2 0.101 0.106 0.050
Loc16 ACTCGAACCACAATTCTGCC CGAACAGGGAAGGAAATCAC NED (AC)18 110 107–114 4 0.628 0.600 0.045
Loc26 ATGTCTCTTTGTACATTTGTATCTCTG AAAACTACCAACTGGTCCTCACA 6FAM (TG)11 148 157–159 2 0.322 0.353 0.097
Loc27 AACATCAGAACATCTGTCAATTCAA GTCTGGTGCACATGGTGAGT VIC (AC)12 290 295–297 2 0.079 0.082 0.038
Loc36 GAAAGGGTCACCATGACAGG TGCCAACAGTGAAGCAGTTT PET (AC)14 139 145–167 3 0.452 0.482 0.067
Notes.
Size range of fragments (bp), number of alleles (Na), expected (He)and observed (Ho)heterozygosity, and inbreeding coecient (FIS), based on a sample of 85 individuals.
Sousa-Santos et al. (2015), PeerJ, DOI 10.7717/peerj.731 4/9
Table 2 Overview of a brief search on polymorphic microsatellites developed by 454 sequencing for fish species: number of identified, tested
and polymorphic loci and their comparison with the values obtain for the present study.
Authors Target species Identified
loci (IL)
Tested
loci (TL)
Polymorphic
loci (PL)
TL/IL PL/TL
Halobatrachus didactylus 10,442 12 5 0% 42%
Cardoso et al., 2013 Salaria pavo 4,190 28 26 1% 93%
Carvalho & Beheregaray, 2010 Conorhynchus conirostris 3,796 20 13 1% 65%
Quintela et al., 2014 Labrus bergylta 92 43 22 47% 51%
Kang, Park & Jo, 2012 Raja pulchra 17,033 20 14 0% 70%
Wang et al., 2012 Megalobrama pellegrini 24,522 33 26 0% 79%
An et al., 2013 Stephanolepis cirrhifer 5,350 74 24 1% 32%a
Zeng et al., 2013 Acipenser dabryanus 17,609 80 8 0% 10%a
Carvalho, Hammer & Beheregaray, 2011 Nannoperca obscura 9,476 21 15 0% 71%
Umbers et al., 2012 Gambusia holbrooki 1,187 40 25 3% 63%
Muths & Bourjea, 2011 Lutjanus kasmira 3,022 16 13 1% 81%
Dubut et al., 2010 Zingel asper 241 105 55 44% 52%
Dubut et al., 2010 Sander lucioperca 241 47 18 20% 38%a
Dubut et al., 2010 Perca fluviatilis 241 35 14 15% 40%a
L¨
u et al., 2013 Pseudosciaena crocea 2,535 32 27 1% 84%
Teixeira et al., 2013 Lepadogaster lepadogaster 10,258 25 15 0% 60%
MEAN VALUES 6214.2 41.3 21.0 9% 59%
Notes.
aStudies for which the PL/TL ratio was lower than that obtained in the present study.
the number of tested microsatellites and, from those, the number of polymorphic loci
detected. The results, described in Table 2 show that the number of loci tested in our study
was below the average (0% vs. 9%) and that the ratio between the number of polymorphic
loci (PL) and the number of tested loci (TL) was lower in our study (42%) than the
mean for the considered studies (59%). However, a higher number of tested loci did not
necessarily imply a higher polymorphism detection (as depicted by the marked (a) PL/TL
ratios in Table 2). In addition, although we have detected a low number of polymorphic
loci, Ne, Repka & Gross (2000) points out that eorts should only concentrate on
increasing the number of loci when the male probable paternity is low. In the studied
population the probability of paternity by the nest-holder is high since a preliminary study
using these five polymorphic loci shows that nest-holders sire a high percentage of the eggs
found in their nests (M Amorim, 2014, unpublished data). These microsatellite markers
will allows us to estimate the proportion of eggs sired by the nest-holder and by other
males, the number of contributing females to the batch of eggs defended by nest-holders,
and the existence of filial cannibalism. They will also contribute to assessing the fitness
of dierent ART in Lusitanian toadfish populations with contrasting incidence of type II
males.
Sousa-Santos et al. (2015), PeerJ, DOI 10.7717/peerj.731 5/9
ADDITIONAL INFORMATION AND DECLARATIONS
Funding
This study was funded by the European Fund for Economic and Regional Development
(FEDER) through the Program Operational Factors of Competitiveness (COMPETE) and
National Funds through the FCT—Portuguese Foundation of Science and Technology,
under the Eco-Ethology Research Unit Strategic Plan (PEst-OE/MAR/UI0331/2011) and
the project PTDC/MAR/118767/2010. CSS was supported by a Post-doctoral grant from
FCT (SFRH/BPD/29774/2006). The funders had no role in study design, data collection
and analysis, decision to publish, or preparation of the manuscript.
Grant Disclosures
The following grant information was disclosed by the authors:
Economic and Regional Development (FEDER).
Eco-Ethology Research Unit Strategic Plan: PEst-OE/MAR/UI0331/2011,
PTDC/MAR/118767/2010.
FCT: SFRH/BPD/29774/2006.
Competing Interests
The authors declare there are no competing interests.
Author Contributions
Carla Sousa-Santos conceived and designed the experiments, performed the experi-
ments, analyzed the data, contributed reagents/materials/analysis tools, wrote the paper,
prepared figures and/or tables, reviewed drafts of the paper.
Paulo J. Fonseca and Maria Clara P. Amorim conceived and designed the experiments,
performed the experiments, wrote the paper, reviewed drafts of the paper.
Animal Ethics
The following information was supplied relating to ethical approvals (i.e., approving body
and any reference numbers):
This study was approved by the scientific committee of the Portuguese Foundation for
Science and Technology (FCT) which evaluated the project “Role of acoustic signals in
mate choice and male–male assessment in a strongly-vocal fish, Halobatrachus didactylus
(ref. PTDC/MAR/118767/2010) and the ethical forms filled by the team. Maria Clara P.
Amorim is also credited by the “Direcc¸ ˜
ao Geral de Alimentac¸ ˜
ao e Veterin ´
aria” (General
Directorate of Food and Veterinary) as Coordinator-researcher (C category) by FELASA.
Data Deposition
The following information was supplied regarding the deposition of related data:
GenBank (accession numbers KP250581KP250585).
Sousa-Santos et al. (2015), PeerJ, DOI 10.7717/peerj.731 6/9
Supplemental Information
Supplemental information for this article can be found online at http://dx.doi.org/
10.7717/peerj.731#supplemental-information.
REFERENCES
Amorim MCP, Sim˜
oes JM, Fonseca PJ, Almada VC. 2010. Patterns of shelter usage and
social aggregation by the vocal Lusitanian toadfish. Marine Biology 157:495–503
DOI 10.1007/s00227-009-1335-6.
An C-M, An HS, Lee JW, Hong SW. 2013. New polymorphic microsatellite loci for threadsail
filefish, Stephanolepis cirrhifer (Teleostei, Monacanthidae), from Korean waters. Genetics and
Molecular Research 12:1679–1690 DOI 10.4238/2013.May.14.8.
Bauchot ML. 1987. Poissons osseux. In: Fischer W, Schneider M, Bauchot ML, eds. FAO
d’Identification des Esp`
eces pour les Besoins de la Pˆ
eche. M´
editerran´
ee et Mer Noire (Zone de Pˆ
eche
37),R´
evision 1. Vol. II - Vert´
ebr´
es. Rome: FAO, 891–1421.
Cardoso SD, Gonc¸alves D, Robalo JI, Almada VC, Can ´
ario AVM, Oliveira RF. 2013. Ecient
isolation of polymorphic microsatellites from high-throughput sequence data based on number
of repeats. Marine Genomics 11:11–16 DOI 10.1016/j.margen.2013.04.002.
Carvalho DC, Beheregaray LB. 2010. Rapid development of microsatellites for the endangered
Neotropical catfish Conorhynchus conirostris using a modest amount of 454 shot-gun
pyrosequencing. Conservation Genetics Resources 3:373–375 DOI 10.1007/s12686-010-9365-4.
Carvalho DC, Hammer MP, Beheregaray LB. 2011. Isolation and PCR multiplex genotyping of 18
novel microsatellite markers for the threatened southern pygmy perch (Nannoperca australis).
Conservation Genetics Resources 4:15–17 DOI 10.1007/s12686-011-9462-z.
Costa JL, Almeida PR, Costa MJ. 2003. A morphometric and meristic investigation of Lusitanian
toadfish Halobatrachus didactylus (Bloch & Schneider, 1801): evidence of population
fragmentation on Portuguese coast. Scientia Marina 67:219–231.
Dubut V, Grenier R, Megl´
ecz E, Chappaz R, Costedoat C, Danancher D, Descloux S, Malausa T,
Martin J-F, Pech N, Gilles A. 2010. Development of 55 novel polymorphic microsatellite
loci for the critically endangered Zingel asper L. (Actinopterygii: Perciformes: Percidae)
and cross-species amplification in five other percids. European Journal of Wildlife Research
56:931–938 DOI 10.1007/s10344-010-0421-x.
Fauvelot C, Borsa P. 2011. Patterns of genetic isolation in narrow-barred Spanish mackerel
(Scomberomorus commerson) across the Indo-West Pacific. Biological Journal of the Linnean
Society 104:886–902 DOI 10.1111/j.1095-8312.2011.01754.x.
Gardner MG, Fitch AJ, Bertozzi T, Lowe AJ. 2011. Rise of the machines—recommendations for
ecologists when using next generation sequencing for microsatellite development. Molecular
Ecology Resources 11:1093–1101 DOI 10.1111/j.1755-0998.2011.03037.x.
Jones AG, Small CM, Paczol KA, Ratterman NL. 2010. A practical guide to methods of parentage
analysis. Molecular Ecology Resources 10:6–30 DOI 10.1111/j.1755-0998.2009.02778.x.
Kang J-H, Park J-Y, Jo H-S. 2012. Rapid development of microsatellite markers with 454
pyrosequencing in a vulnerable fish, the mottled skate, Raja pulchra.International Journal of
Molecular Sciences 13:7199–7211 DOI 10.3390/ijms13067199.
L¨
u Z, Li H, Liu L, Cui W, Hu X, Wang C. 2013. Rapid development of microsatelitte markers
from the large yellow croaker (Pseudosciaena crocea) using next generation DNA sequencing
technology. Biochemical Systematics and Ecology 51:314–319 DOI 10.1016/j.bse.2013.09.019.
Sousa-Santos et al. (2015), PeerJ, DOI 10.7717/peerj.731 7/9
Malausa T, Gilles A, Megl´
ecz E, Blanquart H, Duthoy S, Costedoat C, Dubut V, Pech N,
Castagnone-Sereno P, D´
elye C, Feau N, Frey P, Gauthier P, Guillemaud T, Hazard L,
Le Corre V, Lung-Escarmant B, Mal´
e PJ, Ferreira S, Martin JF. 2011. High-throughput
microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA
libraries. Molecular Ecology Resources 11:638–644 DOI 10.1111/j.1755-0998.2011.02992.x.
Marques JF, Rego AL, Costa JL, Costa MJ, Cabral H. 2006. Genetic and morphological
dierentiation of the Lusitanian roadfish (Halobatrachus didactylus) between estuarine and
coastal areas in Portugal. Scientia Marina 70:749–758 DOI 10.3989/scimar.2006.70n4749.
Megl´
ecz E, Costedoat C, Dubut V, Gilles A, Malausa T, Pech N, Martin JF. 2010. QDD: a
user-friendly program to select microsatellite markers and design primers from large sequencing
projects. Bioinformatics 26:403–404 DOI 10.1093/bioinformatics/btp670.
Modesto T, Can´
ario AVM. 2003. Morphometric changes and sex steroid levels during the
annual reproductive cycle of the Lusitanian toadfish, Halobatrachus didactylus.General and
Comparative Endocrinology 131:220–231 DOI 10.1016/S0016-6480(03)00027-3.
Muths D, Bourjea J. 2011. Isolation and characterization of thirteen polymorphic microsatellite
markers from the bluestriped snappers Lutjanus kasmira and L. bengalensis.Molecular Ecology
Resources 11:935–936 DOI 10.1111/j.1755-0998.2011.03046.x.
NeBD, Repka J, Gross MR. 2000. Statistical confidence in parentage analysis with incomplete
sampling: how many loci and ospring are needed? Molecular Ecology 9:529–539
DOI 10.1046/j.1365-294x.2000.00888.x.
Pereira TJ, Silva G, Costa MJ, Costa JL. 2011. Life strategies of Halobatrachus didactylus (Bloch
and Schneider, 1801) in the Tagus estuary: comparison among morphotypes. Estuarine, Coastal
and Shelf Science 93:328–335 DOI 10.1016/j.ecss.2011.04.013.
Quintela M, Danielsen EA, Svasand T, Knutsen H, Skiftesvik AB, Glover KA. 2014. Isolation and
characterization of twenty microsatellite loci for the ballan wrasse, Labrus bergylta.Conservation
Genetics Resources 6:425–428 DOI 10.1007/s12686-013-0114-3.
Robalo JI, Crespo AM, Castilho R, Francisco SM, Amorim MCP, Almada VC. 2013. Are
local extinctions and recolonizations continuing at the colder limits of marine
fish distributions? Halobatrachus didactylus (Bloch & Schneider, 1801) a possible candidate.
Marine Biology 160:2461–2467 DOI 10.1007/s00227-013-2241-5.
Roux C. 1986. Batrachoididae. In: Whitehead PJP, Bauchot ML, Hureau JC, Nielsen J, Tortonese E,
eds. Fishes of the North-eastern Atlantic and Mediterranean, vol. III. Paris: UNESCO, 1360–1361.
Tautz D. 1989. Hypervariability of simple sequences as a general source for polymorphic DNA
markers. Nucleic Acids Research 17:6463–6471 DOI 10.1093/nar/17.16.6463.
Teixeira S, Candeias R, Klein M, Serr˜
ao EA, Borges R. 2013. Characterization of 15 polymorphic
microsatellite loci in the temperate reef fish Lepadogaster lepadogaster, developed using
454-sequencing. Conservation Genetics Resources 5:55–57 DOI 10.1007/s12686-012-9732-4.
Umbers KDL, Jennions MD, Gardner MG, Keogh JS. 2012. Twenty-five new polymorphic
microsatellites for the eastern mosquitofish, Gambusia holbrooki (Actionopterygii:
Poecillidae), an invasive species in Australia. Australian Journal of Zoology 60:235–237
DOI 10.1071/ZO12095.
Vasconcelos RO, Carric¸o R, Ramos A, Modesto T, Fonseca PJ, Amorim MCP. 2012. Vocal
behavior predicts reproductive success in a teleost fish. Behavioral Ecology 23:375–383
DOI 10.1093/beheco/arr199.
Sousa-Santos et al. (2015), PeerJ, DOI 10.7717/peerj.731 8/9
Wang J, Yu X, Zhao K, Zhang Y, Tong J, Peng Z. 2012. Microsatellite development for an
endangered bream Megalobrama pellegrini (Teleostei, Cyprinidae) using 454 sequencing.
International Journal of Molecular Sciences 13:3009–3021 DOI 10.3390/ijms13033009.
Zeng Q, Ye H, Ludwig A, Wang Z, Peng Z. 2013. Microsatellite development for the endangered
Yangtze sturgeon (Acipenser dabryanus Dum´
eril, 1869) using 454 sequencing. Journal of Applied
Ichthyology 29:1219–1221 DOI 10.1111/jai.12278.
Sousa-Santos et al. (2015), PeerJ, DOI 10.7717/peerj.731 9/9
... Total genomic DNA from fin clips of nesting males and respective embryos was isolated using NucleoSpin tissue 96 kit (Macherey-Nagel) following the manufacturer's protocol. Five polymorphic markers (Table 1 in Sousa-Santos et al., 2015) were amplified in 25 mL reactions containing 20 ng of template DNA, 1× reaction buffer, 37.5 pmol MgCl 2 , 6 pmol dNTP, 10 pmol of each primer, and 1 U Taq polymerase (FastStart -Roche Diagnostics). PCR conditions were the following: 958C for 10 min [958C for 30 s, 558C for 30 s, 728C for 1 ′ ] × 40 cycles and 728C for 10 min. ...
... These microsatellites were developed through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries and subsequently tested for polymorphism by GenoScreen-France (www.genoscreen.com). Details on the laboratorial procedures involved are described in Sousa-Santos et al. (2015). Alleles were scored using GeneMapper v5.0 software (Applied Biosystems). ...
... curtin.edu.au) based on a sample of 85 sequenced individuals from the Tagus estuary (Sousa-Santos et al., 2015), and a second data file, which was built for each putative father and included the male's genotype for the five polymorphic loci and the genotypes of all sampled eggs in the considered nest. As outputs, the software provides the number of eggs sired by the male, the most likely paternity estimate, the expected paternity estimate and its respective lower and upper bounds of the 95% confidence interval. ...
Article
Full-text available
The Lusitanian toadfish, Halobatrachus didactylus , like other batrachoidids, is a benthic fish species with nesting behaviour during the breeding season. During this prolonged period it engages in mating activities and remains in the nest providing parental care. It is not known whether males feed while providing parental care but it is likely that their limited mobility may restrict their diet and influence their fitness. As a consequence, egg cannibalism could occur as a life-history strategy. The aim of the present study is to ascertain the feeding behaviour of nesting males, in comparison to mature non-nesting males, and to identify potential life-history traits related to egg cannibalism. Nest-holders were sampled from artificial nests placed in an intertidal area of the Tagus estuary, only exposed during spring low tides. The diet of nest-holders was compared with that of non-nesting mature males from the same area, captured by otter trawl. The present study demonstrates that despite their constrained mobility nest-holders feed during the breeding season, although in a more opportunistic fashion than non-nesting males. Nest-holders showed a generalist feeding behaviour, with a more heterogeneous diet. Egg cannibalism was not related to male condition, paternity or brood size but showed a higher incidence early in the season when water temperatures were lower. The results suggest a possible seasonal trade-off strategy between care and energy recovery, triggered by environmental factors, where under unfavourable conditions to sustain viable eggs the male may recover energy by eating eggs, thus benefiting future reproductive success, later in the season.
... Nevertheless, microsatellites have proved their utility in identifying genetic stocks in marine penaeoid shrimps around the world (Benzie, 2000;Brooker et al., 2000;Supungul, Sootanan & Klinbunga, 2000;Ball & Chapman, 2003;Maggioni, Rogers & Maclean, 2003;Waqairatu et al., 2012;Abdul-Aziz et al., 2015) and it is possible that a greater number of these might provide higher resolution in other Mediterranean and Mozambique populations. Next-generation sequencing (NGS) based on 454 pyrosequencing has enabled a high-throughput approach and has demonstrated its usefulness in the development of SSRs in non-model organisms (Schoebel et al., 2013;Sousa-Santos, Fonseca & Amorim, 2015). Long reads generated by 454 sequencing are expected to contain SSRs and their flanking regions that are needed to develop methods for SSR screening among populations. ...
... Sequences of the contigs including these polymorphic markers were submitted to GenBank (Accession Numbers: KU195267-KU195299) ( Table 1 and Table S1). The proportion of success (36%) in detecting polymorphic loci for putative microsatellite markers was consistent to that achieved in decapods (15%-68%) (Meehan et al., 2003;Dao, Todd & Jerry, 2013;Dambach et al., 2013;Miller et al., 2013), in other marine species (e.g., 29% in a mollusk (Pardo et al., 2011) and also in fishes (∼40%; Sousa-Santos, Fonseca & Amorim, 2015;Williams et al., 2015)). ...
Article
Full-text available
The blue and red shrimp, Aristeus antennatus , is a commercially important crustacean, in the Mediterranean Sea, which has been listed as a priority species for fishery management. Hypervariable microsatellite markers could be a useful tool to identify genetic stocks among geographically close fishing grounds. Potential microsatellite markers (97) identified from next-generation sequencing of an individual shrimp using a 454 GS Junior Pyrosequencer were tested on a preliminary panel of 15 individuals representing the four worldwide genetic stocks of the species from which 35 polymorphic loci were identified and used to characterize an additional 20 individuals from the Western Mediterranean Sea. In the Western Mediterranean sample, 32 out of 35 were polymorphic loci and the number of alleles per locus ranged from 2 to 14 and expected heterozygosity ranged from 0.050 to 0.968. No linkage disequilibrium was detected, indicating the independence of the loci. These novel microsatellites provide additional tools to address questions relating to genetic diversity, parentage studies and connectivity patterns of A. antennatus populations and help develop effective strategies to ensure long-term sustainability of this resource.
... maruadsi individuals showed that 85 of 132 loci were polymorphic (polymorphism rate of 64.39%). The percentage of polymorphic loci was a little higher in present study (64.39%) than the mean for several previous studies (59%, Sousa-Santos et al., 2015). In order to save costs, a set of 70 fl uorescently labeled primers were synthesized and amplifi ed by three primers PCR (TP-PCR). ...
Article
Full-text available
Decapterus maruadsi is a commercially important species in China, but has been heavily exploited in some areas. There is a growing need to develop microsatellites promoting its genetic research for the adequate management of this fishery resources. The recently developed specific-locus amplified fragment sequencing (SLAF-seq) is an efficient and high-resolution method for genome-wide microsatellite markers discovery. In this study, 28 905 microsatellites (mono- to hexa-nucleotide repeats) were identified using SLAF-seq technology, of which di-nucleotide was the most frequent (13 590, 47.02%), followed by mono-nucleotide (8 138, 28.15%), tri-nucleotide (5 727, 19.81%), tetra-nucleotide (1 104, 3.82%), pentanucleotide (234, 0.81%), and hexa-nucleotide (112, 0.39%). One hundred and thirty-two microsatellite loci (di- and tri-nucleotide) were randomly selected for amplification and polymorphism, of which 49 were highly polymorphic and well-resolved. The average number of alleles per locus was 13.63, ranging from 4 to 25, and allele sizes varied between 110 bp and 309 bp. The observed heterozygosity ( Ho ) and expected heterozygosity ( He ) ranged from 0.233 to 1.000 and from 0.374 to 0.959, with mean values of 0.738 and 0.836, respectively. The polymorphism information content (PIC) ranged from 0.341 to 0.941 (mean=0.806). However, 12 loci deviated from Hardy-Weinberg equilibrium. Furthermore, transferability tests were also successful in validating the utility of the developed markers in five phylogenetically related species of family Carangidae. A total of 48 microsatellite markers were successfully cross-amplified in Decapterus macarellus, Decapterus macrosoma, Decapterus kurroides, Trachurus japonicus, and Selaroides leptolepis. The present microsatellites provided the first known set of microsatellite DNA markers for D. maruadsi, D. macarellus, D. kurroides, and D. macrosoma, and would be useful for further population genetic and molecular phylogeny studies as well as help with the fisheries management formulation and implementation of the understudied species.
... As outputs, the software provides 307 the number of eggs sired by the male, the most likely paternity estimate, 308 the expected paternity estimate and its respective lower and upper 309 bounds of the 95% confidence interval. Note, however, that as the num-310 ber of microsatellites and population genetic diversity are low[47] pa-311 ternity results should be considered with caution. ...
Article
Full-text available
Simple sequence repeats (SSRs) are becoming a choice of markers in fish genetic research due to their abundance in the genome, co-dominant nature, high polymorphism and ability to reproduce. Thus, in this review, we have discussed regarding SSRs markers developed in fishes using different techniques. These markers have been used for revealing genetic variability, strain and species identification, genetic linkage map construction and parentage assignment in fish genetic research. Recently, high-throughput sequencing platform has been widely used in non-model fishes for genome/transcriptome sequencing to understand genomic information. The rapid progress in fish genomic research has been made due to sequencing platform along with their low cost for sequencing and use of the advanced computational tools for generated data analysis. We have shown that different next-generation sequencing platforms have been applied in the genomic studies for SSRs markers identification in fishes with evidence. We have depicted the use of various computational tools/algorithms for the SSRs identification from genome/transcriptome data. However, we also highlighted existing challenges in high-throughput sequencing data analysis as well as the current need of computationally deep analysis software/tools/expertise. The purpose of this review is to get envisage on the various possibilities, which can be harnessed via these new technologies and advanced computational tools for SSRs marker development via genome/transcriptome sequencing of aquaculture species.
Article
Full-text available
The relation between acoustic signaling and reproductive success is important to understand the evolution of vocal communi-cation systems and has been well studied in several taxa but never clearly shown in fish. This study aims to investigate whether vocal behavior affects the reproductive success in the Lusitanian toadfish (Halobatrachus didactylus) that relies on acoustic communication to attract mates. We recorded 56 nest-holding (type I) males during the breeding season and analyzed the calling performance and acoustic features of the mate advertising sounds (boatwhistles) exhibited over circa 2 weeks. Hormonal levels of the subjects and the number of eggs (reproductive success) present in the respective nests were quantified. Nesting males attracted both females and other males, namely smaller type I males with significantly lower total length (TL), body condition, sonic muscle mass, gonad mass, and accessory glands mass. Calling rate (CR), calling effort (CE) (% time spent calling), and sound dominant frequency were significantly higher in nesting males with clutches than in those without clutches. Sex steroids (11-ketotestosterone and testosterone) were not correlated with vocal parameters or number of eggs. Maximum CR and CE were the best predictors of the number of eggs. In addition, these vocal variables were best explained by male's TL, condition, and sonic muscle mass. We provide first evidence that vocal behavior significantly determines reproductive success in a vocal fish and show that acoustic signaling at higher and constant rates can operate as an indicator of the male's size and body condition and probably of elevated motivation for reproduction. Key words: acoustic communication, Batrachoididae, mate attraction, reproductive success, toadfish. [Behav Ecol 23:375–383 (2012)] INTRODUCTION
Article
Full-text available
We developed 20 nuclear microsatellite DNA markers from tri- and tetra-nucleotide enriched libraries in the ballan wrasse. In our dataset (N = 241), the detected number of alleles per locus ranged from 2 to 12, and the observed and expected heterozygosity varied from 0.251 to 0.778 and from 0.286 to 0.804, respectively. Cross amplification with the goldsinny wrasse resulted in two usable loci whereas the corkwing wrasse amplified in one locus. The ballan wrasse is an important resource for aquaculture as it delouses farmed salmon efficiently and removes organic matter from farming facilities. In order to obtain individuals for this industry, the wrasse are translocated along the Norwegian coastline, in spite of no knowledge of the population structure. This paper enables such studies, which might be important for the long term management of the species.
Article
Full-text available
The clingfish, Lepadogaster lepadogaster is a reef fish species, abundant in temperate nearshore rocky reefs of the Eastern Atlantic and central and Eastern Mediterranean. To study genetic variability and population connectivity of this species, we developed fifteen polymorphic microsatellite markers. These were tested in one population and all but one, showed no departure from Hardy–Weinberg equilibrium. Average overall observed heterozygosity was 0.66 and allelic richness was 8.9. Two primer pairs revealed possible linkage disequilibrium. These markers open perspectives for population genetic studies of this species to unravel connectivity and population biology, vital information for future conservation studies.
Article
Full-text available
The Lusitanian toadfish, Halobatrachus didactylus (Bloch and Schneider, 1801), is distributed from the Ghana coast to the Iberian Peninsula, being particularly abundant on the south coast of Portugal. The differentiation of this species along the Portuguese coast was assessed through the analysis of 10 samples, considering morphological characters (20 morphometric and 16 meristic) and genetic markers (10 allozymes, 11 loci). Southern samples included estuaries and their adjacent coastal areas, given that this species inhabits both environments, whereas western samples only comprised estuaries. Morphometric and meristic data discriminant analysis evidenced some differentiation between estuarine and coastal populations. This was not entirely corroborated by the genetic analysis, which showed an overall pattern of low FST (0.042) and Nei’s genetic distance, even between geographically distant areas. However, higher values of these parameters were found between estuaries of the south coast and their adjacent coastal areas, suggesting that estuarine systems play a major role in such differentiation. Results are discussed regarding toadfish life-history pattern and Portuguese coast geomorphology, giving an insight into the biological and environmental factors influencing population sub-structuring.
Article
A total of 207 specimens of Lusitanian toadfish Halobatrachus didactylus from six different localities were analysed in terms of morphometric and meristic characters in order to investigate the hypothesis of population fragmentation on the Portuguese coast. This study confirmed the relative isolation between the Algarve populations and those from the western estuaries, which also showed a high degree of discrimination among them. Morphometric characteristics were much more adequate than meristic characters for a good separation of these populations. The most relevant morphometric characteristics for separation between H. didactylus populations were head width, interorbital width and pelvic fin length. These three variables were very useful for separation between western populations and seem to play an important role in species feeding activity. The caudal peduncle development is mainly related to the specimen' swimming ability and was particularly relevant for discrimination between northern and southern populations and between estuarine and adjacent marine populations, apparently due to differences in hydrodynamic conditions. Meristic variation is mostly of a latitudinal nature (mainly nasal tentacles and pores on the lower jaw) but some differences between estuarine and marine populations (principally fin rays counts) related to water temperature were also observed.
Article
We have identified a large number of microsatellites from Pseudosciaena crocea, an economically important fish species in China, by taking advantage of the Roche 454 sequencing technology. A total of 2535 simple sequence repeats (SSR) motifs were identified among which dinucleotides were the most frequent (59.61%), followed by tetra- (29.94%) and trinucleotides (7.06%). Among dinucleotide repeats, the most frequent repeats were AC motifs, accounting for 79.15% of the total. AAT (36.31%) and TCTA (39.66%) motifs were the most frequent of the tri- and tetranucleotide motifs, respectively. A total of 1068 microsatellite loci had flanking sequences suitable for setting primers for polymerase chain reactions (PCR). To verify the identified SSRs, 40 primer pairs were randomly selected for PCR. In total, 32 primer sets (80.00%) produced strong PCR products matching their expected sizes, and 27 (67.50%) were polymorphic. In an analysis of 34 wild individuals from the Zhangzhou Sea area (Fujian Province, China) with the 27 primer sets, the number of alleles per locus ranged from 5 to 11 and the mean allelic richness was 6.74. Linkage disequilibrium was not observed between any pair of loci, indicating that the markers were independent. A Hardy-Weinberg equilibrium test revealed significant deviation in 6 of the 27 microsatellite loci after sequential Bonferroni corrections. This microsatellite isolation method is cost- and time-effective in comparison to traditional approaches.
Data
The Yangtze sturgeon (Acipenser dabryanus) is an endemic species in China. Using 454 sequencing, eight polymorphic tri-, tetra-, penta-, and hexanucleotide microsatellite loci were isolated in this study. The raw sequence data from a one-eighth run of 454 sequencings were 38.0 Mbp containing 94 222 reads/sequences. Of 80 microsatellite loci, only eight loci were polymorphic in a population of 30 individuals. The number of alleles per locus ranged from 4 to 14 (mean 7.62), and the observed heterozygosities varied between 0.46 and 0.88 (mean 0.74). Cross amplification was tested in conge-neric species Acipenser sturio and Acipenser sinensis. These new microsatellite markers will be useful for further studies on genetic variation, parentage analysis, and conservation management for this critically endangered species.
Article
The Lusitanian toadfish, Halobatrachus didactylus (Bloch and Schneider, 1801), is distributed from the Ghana coast to the Iberian Peninsula, being particularly abundant on the south coast of Portugal. The differentiation of this species along the Portuguese coast was assessed through the analysis of 10 samples, considering morphological characters (20 mor- phometric and 16 meristic) and genetic markers (10 allozymes, 11 loci). Southern samples included estuaries and their adja- cent coastal areas, given that this species inhabits both environments, whereas western samples only comprised estuaries. Morphometric and meristic data discriminant analysis evidenced some differentiation between estuarine and coastal popula- tions. This was not entirely corroborated by the genetic analysis, which showed an overall pattern of low FST (0.042) and Nei's genetic distance, even between geographically distant areas. However, higher values of these parameters were found between estuaries of the south coast and their adjacent coastal areas, suggesting that estuarine systems play a major role in such differentiation. Results are discussed regarding toadfish life-history pattern and Portuguese coast geomorphology, giv- ing an insight into the biological and environmental factors influencing population sub-structuring.