Article
To read the full-text of this research, you can request a copy directly from the authors.

Abstract

Background: The adult mammalian heart is incapable of meaningful regeneration after substantial cardiomyocyte loss, primarily due to the inability of adult cardiomyocytes to divide. Our group recently showed that mitochondria-mediated oxidative DNA damage is an important regulator of postnatal cardiomyocyte cell cycle arrest. However, it is not known whether mechanical load also plays a role in this process. We reasoned that the postnatal physiological increase in mechanical load contributes to the increase in mitochondrial content, with subsequent activation of DNA damage response (DDR) and permanent cell cycle arrest of cardiomyocytes. Objectives: The purpose of this study was to test the effect of mechanical unloading on mitochondrial mass, DDR, and cardiomyocyte proliferation. Methods: We examined the effect of human ventricular unloading after implantation of left ventricular assist devices (LVADs) on mitochondrial content, DDR, and cardiomyocyte proliferation in 10 matched left ventricular samples collected at the time of LVAD implantation (pre-LVAD) and at the time of explantation (post-LVAD). Results: We found that post-LVAD hearts showed up to a 60% decrease in mitochondrial content and up to a 45% decrease in cardiomyocyte size compared with pre-LVAD hearts. Moreover, we quantified cardiomyocyte nuclear foci of phosphorylated ataxia telangiectasia mutated protein, an upstream regulator of the DDR pathway, and we found a significant decrease in the number of nuclear phosphorylated ataxia telangiectasia mutated foci in the post-LVAD hearts. Finally, we examined cardiomyocyte mitosis and cytokinesis and found a statistically significant increase in both phosphorylated histone H3-positive, and Aurora B-positive cardiomyocytes in the post-LVAD hearts. Importantly, these results were driven by statistical significance in hearts exposed to longer durations of mechanical unloading. Conclusions: Prolonged mechanical unloading induces adult human cardiomyocyte proliferation, possibly through prevention of mitochondria-mediated activation of DDR.

No full-text available

Request Full-text Paper PDF

To read the full-text of this research,
you can request a copy directly from the authors.

... Mechanical unloading with LVAD leads to a reduction in cardiomyocyte mitochondrial content determined by mtDNA copy number normalized to nDNA. 50 The reduction in mitochondrial number is, however, accompanied by favorable changes in the mitochondrial ultrastructure including size uniformity, organized cristae structure, and reduction in abnormally small and fragmented mitochondria following LVAD support. 51 Frequency of deletion mutations in the mitochondrial DNA was reduced in patients supported with LVAD. ...
... 53 Altered energetics is believed to be central to the development and progression of HF, exhibiting a fetal pattern of substrate use characterized by enhanced glycolysis and a reduction in fatty acid oxidation. Transcriptional analysis of unloaded human hearts has suggested LVAD-induced upregulation of genes involved in LV assist device (LVAD) support is associated with regression of cardiomyocyte hypertrophy, 29 improved calcium handling, 134 improved mitochondrial ultrastructure, 55 improved cytoskeletal organization, 45 no change in cardiomyocyte apoptosis, 63 improved cardiomyocyte regeneration, 50 no change or increase in myocardial fibrosis, macrophage phenotype switch, 94 endothelial cell activation, 24 increased microvascular density, 135 and increased fibrosis of the coronary adventitia. 84 CCR2 indicates C-C motif chemokine receptor 2; CD68, cluster of differentiation 68; DAPI, 4′,6-diamidino-2-phenylindole; TUNEL, terminal deoxynucleotidyl transferase dUTP nick-end labeling. ...
... 67 In addition, markers of cell cycle reentry including phosphorylated histone H3 and aurora B kinase were shown to be upregulated in cardiomyocytes following LVAD support. 50 While the signaling mechanisms responsible for cell cycle reentry remain largely unknown, these early observations suggest that at least a proportion of cardiomyocytes are not terminally differentiated and could potentially regenerate with mechanical unloading. ...
Article
This review provides a comprehensive overview of the past 25+ years of research into the development of left ventricular assist device (LVAD) to improve clinical outcomes in patients with severe end-stage heart failure and basic insights gained into the biology of heart failure gleaned from studies of hearts and myocardium of patients undergoing LVAD support. Clinical aspects of contemporary LVAD therapy, including evolving device technology, overall mortality, and complications, are reviewed. We explain the hemodynamic effects of LVAD support and how these lead to ventricular unloading. This includes a detailed review of the structural, cellular, and molecular aspects of LVAD-associated reverse remodeling. Synergisms between LVAD support and medical therapies for heart failure related to reverse remodeling, remission, and recovery are discussed within the context of both clinical outcomes and fundamental effects on myocardial biology. The incidence, clinical implications and factors most likely to be associated with improved ventricular function and remission of the heart failure are reviewed. Finally, we discuss recognized impediments to achieving myocardial recovery in the vast majority of LVAD-supported hearts and their implications for future research aimed at improving the overall rates of recovery.
... LVADs decrease mechanical and metabolic demands, which may promote myocardial regeneration. 1 Recent studies 2,3 demonstrate appreciable functional recovery resulting in successful ventricular assist device explantation in a number of patients; typically, however, only a small percentage of patients with LVADs can fully recover. 4 Therefore, it is important to define the fundamental mechanisms of myocardial recovery in response to LVAD. ...
... Although a recent, elegantly done study found no improvement in myocardial viability after a median 2.1 months of LVAD support, 5 the present study is differentiated by a longer duration on LVAD which was previously shown to impact cardiomyocyte cell cycle reentry. 1 In conclusion, this prospective FDG-PET imaging study of 4 end-stage heart failure patients demonstrates that long-term mechanical unloading of the left ventricle is associated with bidirectional metabolic changes in the myocardium and a heterogenous, yet measurable, increase in viability of previously quiescent myocardial regions. However, a major limitation of this study is the small number of patients, and thus further studies are needed to determine the effect of mechanical unloading on myocardial viability. ...
... Mitochondrial DNA Quantitation. For mitochondrial DNA (mtDNA) quantification, we used a primer set that detects a relatively stable site in mitochondrial DNA minimal arc: mtDNA F: CTAAATAGCCCACACGTTCCC; R: AGA GCTCCCGTGAGTGGTTA; single-copy nuclear DNA was quantified with the beta-2M gene: nuclear DNA F: GCTGG GTAGCTCTAAACAATGTATTCA; R: CCATGTACTAA CAAATGTCTAAAATGGT [26]. Relative mitochondrial DNA copy number was calculated as the difference in threshold amplification between mtDNA and nuclear DNA [26]. ...
... For mitochondrial DNA (mtDNA) quantification, we used a primer set that detects a relatively stable site in mitochondrial DNA minimal arc: mtDNA F: CTAAATAGCCCACACGTTCCC; R: AGA GCTCCCGTGAGTGGTTA; single-copy nuclear DNA was quantified with the beta-2M gene: nuclear DNA F: GCTGG GTAGCTCTAAACAATGTATTCA; R: CCATGTACTAA CAAATGTCTAAAATGGT [26]. Relative mitochondrial DNA copy number was calculated as the difference in threshold amplification between mtDNA and nuclear DNA [26]. ...
Article
Full-text available
Much evidence demonstrates that mitochondrial dysfunction plays a crucial role in the pathogenesis of vascular complications of diabetes. However, the signaling pathways through which hyperglycemia leads to mitochondrial dysfunction of endothelial cells are not fully understood. Here, we treated human umbilical vein endothelial cells (HUVECs) with high glucose and examined the role of translocase of mitochondrial outer membrane (Tom) 22 on mitochondrial dynamics and cellular function. Impaired Tom22 expression and protein expression of oxidative phosphorylation (OXPHOS) as well as decreased mitochondrial fusion were observed in HUVECs treated with high glucose. The deletion of Tom22 resulted in reduced mitochondrial fusion and ATP production and increased apoptosis in HUVECs. The overexpression of Tom22 restored the balance of mitochondrial dynamics and OXPHOS disrupted by high glucose. Importantly, we found that Tom22 modulates mitochondrial dynamics and OXPHOS by interacting with mitofusin (Mfn) 1. Taken together, our findings demonstrate for the first time that Tom22 is a novel regulator of both mitochondrial dynamics and bioenergetic function and contributes to cell survival following high-glucose exposure.
... Since the accumulation of DNA damage induced by oxidative stress promotes heart failure progression [33][34][35] , we hypothesized that the oxidative stress response might be activated at the hypertrophy stage and be associated with morphological hypertrophy. GO analysis showed that M1 and M5 were specifically enriched for genes involved in the oxidative stress response (Supplementary Fig. 13d). ...
... Sustained stimuli induce the accumulation of oxidative DNA damage, leading to p53 signaling activation during hypertrophy. Single-cell analysis of cardiomyocyte-specific knockout mice ARTICLE provided strong evidence indicating that p53 in cardiomyocytes increases cell-to-cell transcriptional heterogeneity, induces morphological elongation, and drives pathogenic gene programs by disrupting the adaptive hypertrophy modules and activating the heart failure module, thereby elucidating how DNA damage accumulation leads to heart failure 33,34 . Heterogeneous p53 activation in vivo may be related to recent live-cell imaging results showing stochastic p53 signaling activation for cell fate determination in vitro 48 . ...
Article
Full-text available
Pressure overload induces a transition from cardiac hypertrophy to heart failure, but its underlying mechanisms remain elusive. Here we reconstruct a trajectory of cardiomyocyte remodeling and clarify distinct cardiomyocyte gene programs encoding morphological and functional signatures in cardiac hypertrophy and failure, by integrating single-cardiomyocyte transcriptome with cell morphology, epigenomic state and heart function. During early hypertrophy, cardiomyocytes activate mitochondrial translation/metabolism genes, whose expression is correlated with cell size and linked to ERK1/2 and NRF1/2 transcriptional networks. Persistent overload leads to a bifurcation into adaptive and failing cardiomyocytes, and p53 signaling is specifically activated in late hypertrophy. Cardiomyocyte-specific p53 deletion shows that cardiomyocyte remodeling is initiated by p53-independent mitochondrial activation and morphological hypertrophy, followed by p53-dependent mitochondrial inhibition, morphological elongation, and heart failure gene program activation. Human single-cardiomyocyte analysis validates the conservation of the pathogenic transcriptional signatures. Collectively, cardiomyocyte identity is encoded in transcriptional programs that orchestrate morphological and functional phenotypes. The mechanisms underlying the transition from cardiac hypertrophy to heart failure following pressure overload are incompletely understood. Here the authors identify the gene programs encoding the morphological and functional characteristics of cardiomyocytes during the transition from early hypertrophy to heart failure via single-cell transcriptomics, establishing a key role for p53 signalling.
... Cardiomyocyte proliferation was accompanied with a decrease of mitochondrial DNA (Canseco, Kimura et al. 2015). It has been shown that the depletion of mitochondrial DNA reduces oxidative DNA damage, resulting in an increase of the chances for cardiomyocyte survival and proliferation as we have described before (Chen, Wang et al. 2016). ...
Thesis
In humans, most cardiovascular disorders lead to the destruction of cardiac tissue which will be replaced by fibrosis, leading to arrhythmia and reduced contractile function, resulting in an increase in ventricular load. In order to maintain an overall cardiac output, cardiomyocytes undergo hypertrophic response, leading to pathological hypertrophy and heart failure. This increase in ventricular load, have to be sensed by mechanosensors such as the mechanosensitive ion channels such as TREK-1. Unlike mammals, adult zebrafish (zf) can fully regenerate their heart after an extensive insult through cardiomyocyte dedifferentiation followed by proliferation. We believe that in adult mammals, cardiomyocyte proliferation has been blocked/inhibited. Therefore it’s likely that genes which respond to increased ventricular load in mammals and trigger pathological hypertrophy will trigger cardiomyocyte proliferation during heart regeneration in zf. In this study we show that zTREK1a and zTREK1b have similar biophysical and pharmacological properties to mammalian TREK1 and they are important for successful zebrafish heart regeneration.
... Although it has been much debated on the source of this proliferation and whether it is restricted to a subset of ACMs, the magnitude, an annual renewal rate of~0.5-1% has now been accepted by most investigators 6,[8][9][10][11] . Given the low rate of overall ACM renewal, detecting CM cell cycle progression especially cell division is challenging but crucial for future studies targeting endogenous CM regeneration. ...
Article
Full-text available
While it is recognized that there are low levels of new cardiomyocyte (CM) formation throughout life, the source of these new CM generates much debate. One hypothesis is that these new CMs arise from the proliferation of existing CMs potentially after dedifferentiation although direct evidence for this is lacking. Here we explore the mechanisms responsible for CM renewal in vivo using multi-reporter transgenic mouse models featuring efficient adult CM (ACM) genetic cell fate mapping and real-time cardiomyocyte lineage and dedifferentiation reporting. Our results demonstrate that non-myocytes (e.g., cardiac progenitor cells) contribute negligibly to new ACM formation at baseline or after cardiac injury. In contrast, we found a significant increase in dedifferentiated, cycling CMs in post-infarct hearts. ACM cell cycling was enhanced within the dedifferentiated CM population. Single-nucleus transcriptomic analysis demonstrated that CMs identified with dedifferentiation reporters had significant down-regulation in gene networks for cardiac hypertrophy, contractile, and electrical function, with shifts in metabolic pathways, but up-regulation in signaling pathways and gene sets for active cell cycle, proliferation, and cell survival. The results demonstrate that dedifferentiation may be an important prerequisite for CM proliferation and explain the limited but measurable cardiac myogenesis seen after myocardial infarction (MI).
... Globally,17.5 million people die each year from cardiovascular diseases [1] . Compensation for myocytes loss is very difficult as cardiomyocytes are static cells, having a limited proliferative capacity, and only 1% of these cells can proliferate [2] . ...
... It is of interest to observe that the area composita is not found in lower vertebrates, such as amphibians and fish [189], which suggests that this structure might have evolved to sustain the augmented mechanical load of the mammalian ventricles. Since increased load is considered to be a main reason for withdrawal of CMs from the cell cycle immediately after birth [190], the molecular connection between the ICD and the regulation of CM proliferation definitely needs more systematic, molecular analysis. ...
Article
Adult mammals are unable to regenerate their hearts after cardiac injury; largely due to the incapacity of cardiomyocytes to undergo cell division. However, mammalian embryonic and foetal cardiomyocytes, similar to cardiomyocytes from fish and amphibians during their entire life, exhibit robust replicative activity, which stops abruptly after birth and never significantly resumes. Converging evidence indicates that formation of the highly ordered and stable cytoarchitecture of mammalian mature cardiomyocytes is coupled with loss of their proliferative potential. Here, we review the available information on the role of the cardiac cytoskeleton and sarcomere in the regulation of cardiomyocyte proliferation. The actin cytoskeleton, the intercalated disc, the microtubular network and the dystrophin glycoprotein complex each sense mechanical cues from the surrounding environment. Furthermore, they participate in the regulation of cardiomyocyte proliferation by impinging on the YAP/TAZ, β‐catenin and MRTF transcriptional co‐activators. Mastering the molecular mechanisms regulating cardiomyocyte proliferation would permit the development of innovative strategies to stimulate cardiac regeneration in adult individuals, a hitherto unachieved yet fundamental therapeutic goal.
... In the cancer cells, Hesperadin targets Aurora B kinase to inhibit tumor growth and induce cell death. However, adult mammalian cardiomyocytes are terminally differentiated cells and only a very small percentage of them expresses Aurora B kinase 62,63 . Therefore, in cardiomyocytes, Hesperadin treatment targets mainly CaMKII that is a central mediator of cardiomyocyte death, which avoids the death-inducing functions caused by the inhibition of Aurora B kinase and protects against cardiac injury and cardiovascular diseases. ...
Article
Background: Cardiac ischemia/reperfusion (I/R) injury has emerged as an important therapeutic target for ischemic heart disease, the leading cause of morbidity and mortality worldwide. At present, there is no effective therapy for reducing cardiac I/R injury. CaMKII (Ca2+/calmodulin-dependent kinase II) plays a pivotal role in the pathogenesis of severe heart conditions, including I/R injury. Pharmacological inhibition of CaMKII is an important strategy in the protection against myocardial damage and cardiac diseases. To date, there is no drug targeting CaMKII for the clinical therapy of heart disease. Furthermore, at present, there is no selective inhibitor of CaMKII-δ, the major CaMKII isoform in the heart. Methods: A small-molecule kinase inhibitor library and a high-throughput screening system for the kinase activity assay of CaMKII-δ9 (the most abundant CaMKII-δ splice variant in human heart) were used to screen for CaMKII-δ inhibitors. Using cultured neonatal rat ventricular myocytes, human embryonic stem cell-derived cardiomyocytes, and in vivo mouse models, in conjunction with myocardial injury induced by I/R (or hypoxia/reoxygenation) and CaMKII-δ9 overexpression, we sought to investigate the protection of hesperadin against cardiomyocyte death and cardiac diseases. BALB/c nude mice with xenografted tumors of human cancer cells were used to evaluate the in vivo antitumor effect of hesperadin. Results: Based on the small-molecule kinase inhibitor library and screening system, we found that hesperadin, an Aurora B kinase inhibitor with antitumor activity in vitro, directly bound to CaMKII-δ and specifically blocked its activation in an ATP-competitive manner. Hesperadin functionally ameliorated both I/R- and overexpressed CaMKII-δ9-induced cardiomyocyte death, myocardial damage, and heart failure in both rodents and human embryonic stem cell-derived cardiomyocytes. In addition, in an in vivo BALB/c nude mouse model with xenografted tumors of human cancer cells, hesperadin delayed tumor growth without inducing cardiomyocyte death or cardiac injury. Conclusions: Here, we identified hesperadin as a specific small-molecule inhibitor of CaMKII-δ with dual functions of cardioprotective and antitumor effects. These findings not only suggest that hesperadin is a promising leading compound for clinical therapy of cardiac I/R injury and heart failure, but also provide a strategy for the joint therapy of cancer and cardiovascular disease caused by anticancer treatment.
... 52 Similarly, in the failing human heart unloaded with a ventricular assist device, cell cycle reentry has been observed. 53 The ECM is a multicompartment structure that provides both microscopic and macroscopic cues for cell behavior. We propose that the balance between different ECM components differentiates regenerative ECM, where cells incorporate and function, from scarring ECM, where collagen fibers predominate. ...
Article
The myocardium consists of numerous cell types embedded in organized layers of ECM (extracellular matrix) and requires an intricate network of blood and lymphatic vessels and nerves to provide nutrients and electrical coupling to the cells. Although much of the focus has been on cardiomyocytes, these cells make up <40% of cells within a healthy adult heart. Therefore, repairing or regenerating cardiac tissue by merely reconstituting cardiomyocytes is a simplistic and ineffective approach. In fact, when an injury occurs, cardiac tissue organization is disrupted at the level of the cells, the tissue architecture, and the coordinated interaction among the cells. Thus, reconstitution of a functional tissue must reestablish electrical and mechanical communication between cardiomyocytes and restore their surrounding environment. It is also essential to restore distinctive myocardial features, such as vascular patency and pump function. In this article, we review the current status, challenges, and future priorities in cardiac regenerative or reparative medicine. In the first part, we provide an overview of our current understanding of heart repair and comment on the main contributors and mechanisms involved in innate regeneration. A brief section is dedicated to the novel concept of rejuvenation or regeneration, which we think may impact future development in the field. The last section describes regenerative therapies, where the most advanced and disruptive strategies used for myocardial repair are discussed. Our recommendations for priority areas in studies of cardiac regeneration or repair are summarized in Tables 1 and 2 .
... 59 In contrast, 2 later studies have showed a decrease in the average nuclear ploidy in cardiomyocytes after mechanical unloading of human hearts with a left ventricular assist device. 12,20 Although nuclear ploidy was reported to be reduced in mechanical unloaded hearts, the number of multinucleated cardiomyocytes increased at the same time, 63 which is counterintuitive and would suggest a differential regulation of multinucleation and polyploidy in unloaded hearts. If unloading indeed leads to ploidy reversal, either newly formed diploid cells are added to the pool of preexisting cardiomyocytes or polyploid cardiomyocytes preferentially die off in mechanically unloaded hearts. ...
Article
The hallmark of most cardiac diseases is the progressive loss of cardiomyocytes. In the perinatal period, cardiomyocytes still proliferate, and the heart shows the capacity to regenerate upon injury. In the adult heart, however, the actual rate of cardiomyocyte renewal is too low to efficiently counteract substantial cell loss caused by cardiac injury. In mammals, cardiac growth by cell number expansion changes to growth by cardiomyocyte enlargement soon after birth, coinciding with a period in which most cardiomyocytes increase their DNA content by multinucleation and nuclear polyploidization. Although cardiomyocyte hypertrophy is often associated with these processes, whether polyploidy is a prerequisite or a consequence of hypertrophic growth is unclear. Both the benefits of cardiomyocyte enlargement over proliferative growth of the heart and the physiological role of polyploidy in cardiomyocytes are enigmatic. Interestingly, hearts in animal species with substantial cardiac regenerative capacity dominantly comprise diploid cardiomyocytes, raising the hypothesis that cardiomyocyte polyploidy poses a barrier for cardiomyocyte proliferation and subsequent heart regeneration. On the contrary, there is also evidence for self-duplication of multinucleated myocytes, suggesting a more complex picture of polyploidy in heart regeneration. Polyploidy is not restricted to the heart but also occurs in other cell types in the body. In this review, we explore the biological relevance of polyploidy in different species and tissues to acquire insight into its specific role in cardiomyocytes. Furthermore, we speculate about the physiological role of polyploidy in cardiomyocytes and how this might relate to renewal and regeneration.
... The reason why CM replication irreversibly stops after birth in mammals while it remains possible throughout life in lower vertebrates still escapes our full understanding. Birth coincides with sudden oxidative stress to the myocardium, 16 increased ventricular load, 17 metabolic switch from glycolysis to oxidative phosphorylation, 18 lack of exposure to maternal factors, 19 and sudden change in hormone stimulation. 20 One of these reasons, or most likely a combination of them, is responsible for blocking the CM cell cycle and initiating a gene programme leading to hypertrophy. ...
Article
Full-text available
A growing body of evidence indicates that cardiac regeneration after myocardial infarction can be achieved by stimulating the endogenous capacity of cardiomyocytes to replicate. This process is controlled, both positively and negatively, by a large set of non-coding RNAs. Some of the microRNAs (miRNAs) that can stimulate cardiomyocyte proliferation are expressed in embryonic stem cells and are required to maintain pluripotency (e.g. the miR-302∼367 cluster). Others also govern the proliferation of different cell types, including cancer cells (e.g. the miR-17∼92 cluster). Additional miRNAs were discovered through systematic screenings (e.g. miR-199a-3p and miR-590-3p). Several miRNAs instead suppress cardiomyocyte proliferation and are involved in the withdrawal of cardiomyocytes from the cell cycle after birth (e.g. the let-7 and miR-15 families). Similar regulatory roles on cardiomyocytes proliferation are also exerted by a few long non-coding RNAs. This body of information has obvious therapeutic implications, as miRNAs with activator function or short antisense oligonucleotides against inhibitory miRNAs or lncRNAs can be administered to stimulate cardiac regeneration. Expression of miRNAs can be achieved by gene therapy using adeno-associated vectors, which transduce cardiomyocytes with high efficiency. More effective and safer for therapeutic purposes, small nucleic acid therapeutics can be obtained as chemically modified, synthetic molecules, which can be administered through lipofection or inclusion in lipid or polymer nanoparticles for efficient cardiac delivery. The notion that it is possible to reprogramme cardiomyocytes into a regenerative state and that this property can be enhanced by non-coding RNA therapeutics remains exciting, however extensive experimentation in large mammals and rigorous assessment of safety are required to advance towards clinical application.
... Cardiomyocyte proliferation contributes to heart growth prenatally and postnatally both in human and other animals [1][2][3][4]. It is now well recognized that endogenous cardiomyocyte proliferation may be the more promising form of treatment of heart failure since there are no cardiac stem cells [5,6]. ...
Article
Full-text available
Background: Hypoxia has been suggested to be both beneficial and harmful to the proliferation of cardiomyocytes. This controversy remains unresolved, and the underlying mechanism by which hypoxia exerts its effects remains unclear. We here hypothesize that cardiomyocyte developmental stage may play a role. Methods and results: The embryonic ventricular myocyte cell line H9C2, primary isolated fetal cardiomyocytes, and neonatal cardiomyocytes were cultured with normal O2 (21% O2) or under hypoxic conditions (10% O2) for 7 days, and then harvested for Western blotting, qRT-PCR, and immunostaining. When cultured under hypoxic conditions, proliferating marker-Ki67, mRNA level, and the percentage of Ki67-positive cardiomyocytes were significantly lower in H9C2 and fetal cardiomyocytes but higher in neonatal cardiomyocytes. Consistently, the mRNA and protein levels and induced nuclear localization of yes associated protein 1(YAP1), one of the most important regulators of cardiomyocyte proliferation, were significantly lower in H9C2 and fetal cardiomyocytes but up-regulated in neonatal cardiomyocytes when treated with hypoxia. Compared to neonatal cardiomyocytes, there was a lower level of troponin T mRNA and protein expression in H9C2 and fetal cardiomyocytes. When H9C2 or fetal cardiomyocytes overexpressing troponin T in were cultured under hypoxic condition, their ability to proliferate increased. Conclusions: The effect of hypoxia on the proliferation of cardiomyocyte is associated with their developmental stage. YAP1 expression is positively correlated with the change in cardiomyocyte proliferation in response to hypoxia. Developmental stage- specific sarcomere component troponin T may partly account for the underlying mechanism.
... This phenomenon facilitates increased free radical production, causing increased DNA damage (14,15 (16,17). Current evidence suggests that DNA damage is a critical factor in the suppression of CM proliferation (12,18). We speculated that dramatic increases or decreases in postnatal O 2 contribute to an increase in mitochondrial content, thereby activating the DNA damage response and causing permanent cell cycle arrest in CMs. ...
Article
Full-text available
Blood oxygen saturation (SaO2) is one of the most important environmental factors in clinical heart protection. This study used human heart samples and human induced pluripotent stem cell−cardiomyocytes (iPSC-CMs) to assess how SaO2 affects human CM cell cycle activities. The results showed that there were significantly more cell cycle markers in the moderate hypoxia group (SaO2: 75% to 85%) than in the other 2 groups (SaO2 <75% or >85%). In iPSC-CMs 15% and 10% oxygen (O2) treatment increased cell cycle markers, whereas 5% and rapid change of O2 decreased the markers. Moderate hypoxia is beneficial to the cell cycle activities of post-natal human CMs.
... In favour of the possibility that targeting cardiac cells mechanosensation is a possible strategy to protect the heart from failure, is the evidence emerging from studies with LV assist devices, which showed an effect of ventricular mechanical unloading on the possible re-activation of adult cardiomyocyte cycle. 149 Although mechanistically it is still undetermined how mitotic reactivation may occur, recent investigations showed that overriding the block of Hippo signalling in adult myocytes using Hippo-insensitive YAP variants, determined partial cell cycle reactivation and reversion to a more immature phenotype. 150 Since YAP is sequestered by components of the cytoskeleton in the cytoplasm of the adult myocytes, 116 mechanical unloading of the cells may lead to partial release of the mechanicaldependent transcription factor from the cytoskeleton, enabling its nuclear translocation. ...
Article
Advanced age is a major predisposing risk factor for the incidence of coronary syndromes and co-morbid conditions which impact the heart response to cardioprotective interventions. Advanced age also significantly increases the risk of developing post-ischemic adverse remodeling and heart failure after ischemia/reperfusion (IR) injury. Some of the signaling pathways become defective or attenuated during ageing, whereas others with well-known detrimental consequences, like glycoxidation or proinflammatory pathways, are exacerbated. The causative mechanisms responsible for all these changes are yet to be elucidated and are a matter of active research. Here, we review the current knowledge about the pathophysiology of cardiac ageing that eventually impacts on the increased susceptibility of cells to IR injury and can affect the efficiency of cardioprotective strategies.
... With regard to cardiac regeneration in mammals, it is limited to their neonatal period. The myocardial regeneration is observed within 7 days of life in mice (Porrello et al. 2011), but after which the majority of the cardiomyocytes exit cell cycle permanently (Lin et al. 2014;Canseco et al. 2015) and a few new myocytes are generated after cardiac injury (Senyo et al. 2013). It has been known that mammalian hearts respond with hypertrophy of cardiomyocytes and hyperplasia of noncardiomyocytes including fibroblasts (for review, Santini et al. 2016;Talman and Ruskoaho 2016). ...
Article
Full-text available
In mammalian hearts, cardiomyocytes retain a transient capacity to proliferate and regenerate following injury before birth, whereas they lose proliferative capacity immediately after birth. It has also been known that cardiac progenitor cells including islet1-positive cells do not contribute to the cardiac repair and regeneration in mammals. In contrast, hearts of zebrafish, amphibians and reptiles maintain a regenerative ability throughout life. Here, we analyzed proliferative capacity of cardiac cells during cardiac development and post-ventricular resection using Xenopus laevis, especially focusing on islet1. Immunohistochemical examination showed that islet1-positive cells were present in a wide range of the ventricle and maintained high dividing ability after metamorphosis. Interestingly, the islet1-positive cells were preserved even at 1 year after metamorphosis, some of which showed tropomyosin expression. To assess the possibility of islet1-positive cells as a cellular resource, islet1 response to cardiac resection was analyzed, using adult hearts of 3 months after metamorphosis. Transient gene activation of islet1 in apical region was detected within 1 day after amputation. Histological analyses revealed that islet1-positive cells appeared in the vicinity of resection plane at 1 day post-amputation (dpa) and increased at 3 dpa in both tropomyosin-positive and tropomyosin-negative regions. Vascular labeling analysis by biotinylated dextran amine (BDA) indicated that the islet1-positive cells in a tropomyosin-negative region were closely associated with cardiac vessels. Moreover, dividing ability at this time point was peaked. The resected region was healed with tropomyosin-positive cardiomyocytes until 3 months post-amputation. These results suggest a role of islet1-positive cells as a cellular resource for vascularization and cardiogenesis in Xenopus laevis.
... Increased mechanical stress induced in volume overload models activates mitochondrial biogenesis, which increases ROS production; thus, similar to hyperoxemia it results in the activation of DNA damage responses [109]. Canseco et al. [19] examined the effects of human ventricular unloading after implantation of left ventricular assist devices (LVADs) by comparing left ventricular samples collected at the time of LVAD implantation (pre-LVAD) and at the time of explantation (post-LVAD). Their findings demonstrated that post-LVAD hearts had increased cardiomyocyte proliferation, suggesting that mechanical unloading promotes the cell cycle progression. ...
Article
Full-text available
Soon after birth, the regenerative capacity of the mammalian heart is lost, cardiomyocytes withdraw from the cell cycle and demonstrate a minimal proliferation rate. Despite improved treatment and reperfusion strategies, the uncompensated cardiomyocyte loss during injury and disease results in cardiac remodeling and subsequent heart failure. The promising field of regenerative medicine aims to restore both the structure and function of damaged tissue through modulation of cellular processes and regulatory mechanisms involved in cardiac cell cycle arrest to boost cardiomyocyte proliferation. Non-coding RNAs (ncRNAs), such as microRNAs (miRNAs), long non-coding RNAs (lncRNAs), and circular RNAs (circRNAs) are functional RNA molecules with no protein-coding function that have been reported to engage in cardiac regeneration and repair. In this review, we summarize the current understanding of both the biological functions and molecular mechanisms of ncRNAs involved in cardiomyocyte proliferation. Furthermore, we discuss their impact on the structure and contractile function of the heart in health and disease and their application for therapeutic interventions.
... A prevalent view is that this is linked to sudden biochemical and mechanical events occurring immediately after birth. Pressure overload [23], sudden increase in oxygen tension and oxidative stress [24], lack of maternal factors [25], changes in hormonal stimulation [26], and switch from glycolytic to oxidative metabolism [27] are all factors that have been associated with the rapid loss of regenerative capacity. Most reasonably, it appears likely that the withdrawal of CMs from the cell cycle and the activation of a hypertrophic gene programme is the consequence of a combination of all these factors. ...
Article
Full-text available
Purpose of review: Until recently, cardiac regeneration after myocardial infarction has remained a holy grail in cardiology. Failure of clinical trials using adult stem cells and scepticism about the actual existence of such cells has reinforced the notion that the heart is an irreversibly post-mitotic organ. Recent evidence has drastically challenged this conclusion. Recent findings: Cardiac regeneration can successfully be obtained by at least two strategies. First, new cardiomyocytes can be generated from embryonic stem cells or induced pluripotent stem cells and administered to the heart either as cell suspensions or upon ex vivo generation of contractile myocardial tissue. Alternatively, the endogenous capacity of cardiomyocytes to proliferate can be stimulated by the delivery of individual genes or, more successfully, of selected microRNAs. Recent experimental success in large animals by both strategies now fuels the notion that cardiac regeneration is indeed possible. Several technical hurdles, however, still need to be addressed and solved before broad and successful clinical application is achieved.
... Recently, alternative strategies have been developed, instead of implanting stem cells, the turnover of native cardiomyocytes is enhanced by transferring nucleic acids that act intracellularly, 50,51 or growth factors that act through cell surface receptors 52,53 or redox regulators. [54][55][56] The inhibition of the glycogen synthase kinase (GSK)-3 57 and modulation of the Hippo pathways 58 as well as other molecular mechanisms that induce cardiomyocyte proliferation are also under investigation. 59 Unfortunately, the strategies that aim to induce endogenous myocyte turnover, although promising, do not guarantee that the resulting contractile cells will be able to counteract heart failure in humans or that a cell neoplastic transformation will not occur. ...
Article
Full-text available
Regenerative therapies including stem cell treatments hold promise to allow curing patients affected by severe cardiac muscle diseases. However, the clinical efficacy of stem cell therapy remains elusive, so far. The two key roadblocks that still need to be overcome are the poor cell engraftment into the injured myocardium and the limited knowledge of the ideal mixture of bioactive factors to be locally delivered for restoring heart function. Thus, therapeutic strategies for cardiac repair are directed to increase the retention and functional integration of transplanted cells in the damaged myocardium or to enhance the endogenous repair mechanisms through cell‐free therapies. In this context, biomaterial‐based technologies and tissue engineering approaches have the potential to dramatically impact cardiac translational medicine. This review intends to offer some consideration on the cell‐based and cell‐free cardiac therapies, their limitations and the possible future developments.
... AurKB is one of the central protein kinases that ensure the proper execution and delity of mitosis and is expressed only for a short time during the cytokinesis process, localizing to the central spindle during anaphase and in the midbody during cytokinesis 18 . It has been considered as a putative marker for mitosis in several cell types, including cardiomyocytes [19][20][21] . A recent study demonstrated that AurKB correct positioning to the midbody in cardiomyocytes during mitosis is positively correlated with cytokinesis and that 70% of the neonatal cardiomyocytes that express AurKB undergo complete cytokinesis with correct midbody positioning 20 . ...
Preprint
Full-text available
The regenerative capacity of the heart after myocardial infarction (MI) is limited. Our previous study showed that ectopic introduction of Cdk1/CyclinB1 and Cdk4/CyclinD1 complexes (4F) promotes cardiomyocyte proliferation in 15-20% of infected cardiomyocytes in vitro and in vivo and improves cardiac function after MI. Here, we aim to identify the necessary reprogramming stages during the forced cardiomyocyte proliferation with 4F on a single cell basis. Also, we aim to start the first preclinical testing to introduce 4F gene therapy as a candidate for the treatment of ischemia-induced heart failure. Temporal bulk and single-cell RNAseq and further biochemical validations of mature hiPS-CMs treated with either LacZ or 4F adenoviruses revealed full cell cycle reprogramming in 15% of the cardiomyocyte population after 48 h post-infection with 4F, which was associated with sarcomere disassembly and metabolic reprogramming. Transient overexpression of 4F, specifically in cardiomyocytes, was achieved using a polycistronic non-integrating lentivirus (NIL) encoding the 4F; each is driven by a TNNT2 promoter (TNNT2-4F-NIL). TNNT2-4F-NIL or control virus was injected intramyocardially one week after MI in rats or pigs. TNNT2-4F-NIL treated animals showed significant improvement in left ventricular ejection fraction and scar size compared with the control virus treated animals four weeks post-injection. In conclusion, the present study provides a mechanistic demonstration of the process of forced cardiomyocyte proliferation and advances the clinical feasibility of this approach by minimizing the oncogenic potential of the cell cycle factors using a novel transient and cardiomyocyte-specific viral construct.
... A small cohort of patients with advanced heart failure who received left ventricular assist devices showed significant increases in myocytes positive for histological markers of cell cycle activation and cytokinesis. 70 Clinical presentations in newborns with severe cardiac damage, perinatal MI, or genetic cardiomyopathies have also demonstrated evidence for myocyte cell cycle reentry 71 and in some cases complete ...
Article
Death of adult cardiac myocytes and supportive tissues resulting from cardiovascular diseases such as myocardial infarction is the proximal driver of pathological ventricular remodeling that often culminates in heart failure. Unfortunately, no currently available therapeutic barring heart transplantation can directly replenish myocytes lost from the injured heart. For decades, the field has struggled to define the intrinsic capacity and cellular sources for endogenous myocyte turnover in pursuing more innovative therapeutic strategies aimed at regenerating the injured heart. Although controversy persists to this day as to the best therapeutic regenerative strategy to use, a growing consensus has been reached that the very limited capacity for new myocyte formation in the adult mammalian heart is because of proliferation of existing cardiac myocytes but not because of the activity of an endogenous progenitor cell source of some sort. Hence, future therapeutic approaches should take into consideration the fundamental biology of myocyte renewal in designing strategies to potentially replenish these cells in the injured heart.
... Notably, cardiac regenerative capacity can be restored in mice by pharmacologically reducing stiffness on P3 (Notari et al., 2018), and the composition and stiffness of the ECM may also influence the myogenic differentiation of stem and bone-marrow-derived cells (Engler et al., 2006;Zhang et al., 2009;Hastings et al., 2015). Increases in cardiomyocyte cell-cycle activity have also been observed in patients after implantation of a left-ventricular assist device, which can mimic increases in myocardial compliance by reducing the hemodynamic load (i.e., mechanical unloading) (Canseco et al., 2015). ...
Article
Full-text available
The billions of cardiomyocytes lost to acute myocardial infarction (MI) cannot be replaced by the limited regenerative capacity of adult mammalian hearts, and despite decades of research, there are still no clinically effective therapies for remuscularizing and restoring damaged myocardial tissue. Although the majority of the cardiac mass is composed of cardiomyocytes, cardiac fibroblasts (CFs) are one type of most numerous cells in the heart and the primary drivers of fibrosis, which prevents ventricular rupture immediately after MI but the fibrotic scar expansion and LV dilatation can eventually lead to heart failure. However, embryonic CFs produce cytokines that can activate proliferation in cultured cardiomyocytes, and the structural proteins produced by CFs may regulate cardiomyocyte cell-cycle activity by modulating the stiffness of the extracellular matrix (ECM). CFs can also be used to generate induced-pluripotent stem cells and induced cardiac progenitor cells, both of which can differentiate into cardiomyocytes and vascular cells, but cardiomyocytes appear to be more readily differentiated from iPSCs that have been reprogrammed from CFs than from other cell types. Furthermore, the results from recent studies suggest that cultured CFs, as well as the CFs present in infarcted hearts, can be reprogrammed directly into cardiomyocytes. This finding is very exciting as should we be able to successfully increase the efficiency of this reprogramming, we could remuscularize the injured ventricle and restore the LV function without need the transplantation of cells or cell products. This review summarizes the role of CFs in the innate response to MI and how their phenotypic plasticity and involvement in ECM production might be manipulated to improve cardiac performance in injured hearts.
... Moreover, evidence has pointed to mechanical load as a key limiting factor on cardiomyocyte proliferative ability. Interestingly, mechanical unloading in human patients with an LVAD allowed for cardiomyocyte proliferation [21]. These studies point to the potential for cardiomyocyte renewal that is lost during development, and the mechanisms for limiting this potential possibly involve mechanical pressures placed on the maturing heart. ...
Article
Full-text available
Purpose of review: Current pharmacologic treatments for cardiovascular disease do not correct the underlying cellular defect, the loss of cardiomyocytes. With recent advancements in cardiac regenerative approaches, the induction of endogenous mature cardiomyocyte proliferation has emerged as a new possibility. Here, we review progress made toward the regeneration of cardiac tissue in the mammalian heart through the stimulation of mature cardiomyocyte renewal. Recent findings: The targeting of several developmental and signaling pathways has been shown to stimulate cell cycle re-entry in mature cardiomyocytes. In animal models of cardiac regeneration, various strategies have been used to target these pathways to stimulate cardiomyocyte renewal and have relied on the delivery of signaling factors via systemic delivery, epicardial patches, or direct intramyocardial injection. Gene therapy techniques involving the viral delivery of transgenes by using adenoviral or adeno-associated viral vectors have been used to successfully target cardiac gene expression. The delivery of nucleic acids in the form of anti-microRNAs and microRNA mimetics has also been shown to be effective in stimulating cardiomyocyte renewal. As the field of cardiac regeneration continues to progress, an important ongoing challenge in developing clinically translatable therapies is limiting the stimulation of growth pathways in non-cardiomyocytes.
... DNA damage and subsequent activation of the DNA damage response (DDR) occurs in cardiomyocytes of heart failure (HF) patients [13][14][15] . Moreover, recent studies suggest that DNA damage is induced in cardiomyocytes during transverse aortic constriction (TAC)-induced heart failure development 16,17 . ...
Article
Full-text available
In the past decade, many long noncoding RNAs (lncRNAs) have been identified and their in vitro functions defined, although in some cases their functions in vivo remain less clear. Moreover, unlike nuclear lncRNAs, the roles of cytoplasmic lncRNAs are less defined. Here, using a gene trapping approach in mouse embryonic stem cells, we identify Caren (short for cardiomyocyte-enriched noncoding transcript), a cytoplasmic lncRNA abundantly expressed in cardiomyocytes. Caren maintains cardiac function under pathological stress by inactivating the ataxia telangiectasia mutated (ATM)-DNA damage response (DDR) pathway and activating mitochondrial bioenergetics. The presence of Caren transcripts does not alter expression of nearby (cis) genes but rather decreases translation of an mRNA transcribed from a distant gene encoding histidine triad nucleotide-binding protein 1 (Hint1), which activates the ATM-DDR pathway and reduces mitochondrial respiratory capacity in cardiomyocytes. Therefore, the cytoplasmic lncRNA Caren functions in cardioprotection by regulating translation of a distant gene and maintaining cardiomyocyte homeostasis.
... Contrary to this, the functional cardiomyocytes die and are replaced by fibrotic tissue which causes the problem related to cardiac function. Although the mammalian heart has been known as a non-regenerative organ for decades, there is growing evidence that it retains the capability to renew cardiomyocytes during adulthood [10][11][12][13]. However, this is not enough to cause a significant functional recovery after injury. ...
Article
Full-text available
Neonatal mammalian heart has been shown to possess the capacity to regenerate substantially after an injury. This remarkable regenerative capacity is lost in a week. This transition has been marked with cardiomyocyte cell cycle arrest and induction of fibrotic response similar to what occurs after myocardial infarction in adult hearts. Recent studies outlined the function of several cardiogenic factors that play a pivotal role in neonatal cardiac regeneration. However, underlying molecular mechanisms of neonatal cardiac regeneration and other cardiogenic factors remained elusive. Here, we investigated the involvement of novel putative cardiogenic factors in neonatal cardiac regeneration and cardiomyocyte cell cycle withdrawal. We have shown that Cbl, Dnmt3a, and Itch are significantly downregulated during neonatal cardiac regeneration process after cardiac injury in vivo. Intriguingly, several of studied factors are upregulated in non-regenerative period of 7-day-old mice after cardiac injury. Knockdown of Cbl, Dnmt3a and Itch in rat neonatal cardiomyocytes lead to the induction of cardiomyocyte proliferation. Cardiomyocyte proliferation accompanies upregulation of positive regulators of cardiomyocyte division and downregulation of CDKIs. Taken together, our findings suggest that Cbl, Dnmt3a, and Itch may be involved in the regulation of cardiomyocyte cell cycle withdrawal and may represent new targets for the induction of cardiac regeneration. Graphic Abstract
... In addition, an increase in cardiac mechanical load after birth has been proposed to activate cardiac mitochondrial biogenesis, thereby adapting the heart to the increase in energetic demand 169 . Remarkably, mechanical unloading after implantation of LVADs in the failing human heart caused a decrease in mitochondrial content and a reduction of the DDR, with signs of cardiomyocyte proliferation 170 . These findings suggest a novel therapeutic approach for heart regeneration whereby the proliferative capacity of cardiomyocytes that is silenced in the adult mammalian heart can be reawakened by environmental adjustments rather than by directly manipulating specific signalling pathways in cardiomyocytes. ...
Article
Ischaemic heart disease is a leading cause of death worldwide. Injury to the heart is followed by loss of the damaged cardiomyocytes, which are replaced with fibrotic scar tissue. Depletion of cardiomyocytes results in decreased cardiac contraction, which leads to pathological cardiac dilatation, additional cardiomyocyte loss, and mechanical dysfunction, culminating in heart failure. This sequential reaction is defined as cardiac remodelling. Many therapies have focused on preventing the progressive process of cardiac remodelling to heart failure. However, after patients have developed end-stage heart failure, intervention is limited to heart transplantation. One of the main reasons for the dramatic injurious effect of cardiomyocyte loss is that the adult human heart has minimal regenerative capacity. In the past 2 decades, several strategies to repair the injured heart and improve heart function have been pursued, including cellular and noncellular therapies. In this Review, we discuss current therapeutic approaches for cardiac repair and regeneration, describing outcomes, limitations, and future prospects of preclinical and clinical trials of heart regeneration. Substantial progress has been made towards understanding the cellular and molecular mechanisms regulating heart regeneration, offering the potential to control cardiac remodelling and redirect the adult heart to a regenerative state.
... Contrary to this, the functional cardiomyocytes die and are replaced by fibrotic tissue which causes the problem related to cardiac function. Although the mammalian heart has been known as a non-regenerative organ for decades, there is growing evidence that it retains the capability to renew cardiomyocytes during adulthood [10][11][12][13]. However, this is not enough to cause a significant functional recovery after injury. ...
... 52 Similarly, in the failing human heart unloaded with a ventricular assist device, cell cycle reentry has been observed. 53 The ECM is a multicompartment structure that provides both microscopic and macroscopic cues for cell behavior. We propose that the balance between different ECM components differentiates regenerative ECM, where cells incorporate and function, from scarring ECM, where collagen fibers predominate. ...
Article
Full-text available
High-mobility group box 1 (HMGB1) is a deoxyribonucleic acid (DNA)–binding protein associated with DNA repair. Decreased nuclear HMGB1 expression and increased DNA damage response (DDR) were observed in human failing hearts. DNA damage and DDR as well as cardiac remodeling were suppressed in cardiac-specific HMGB1 overexpression transgenic mice after angiotensin II stimulation as compared with wild-type mice. In vitro, inhibition of HMGB1 increased phosphorylation of extracellular signal-related kinase 1/2 and nuclear factor kappa B, which was rescued by DDR inhibitor treatment. DDR inhibitor treatment provided a cardioprotective effect on angiotensin II–induced cardiac remodeling in mice.
Article
Over 5 million people in the United States suffer from heart failure, due to the limited ability to regenerate functional cardiac tissue. One potential therapeutic strategy is to enhance proliferation of resident cardiomyocytes. However, phenotypic screening for therapeutic agents is challenged by the limited ability of conventional markers to discriminate between cardiomyocyte proliferation and endoreplication (e.g. polyploidy and multinucleation). Here, we developed a novel assay that combines automated live-cell microscopy and image processing algorithms to discriminate between proliferation and endoreplication by quantifying changes in the number of nuclei, changes in the number of cells, binucleation, and nuclear DNA content. We applied this assay to further prioritize hits from a primary screen for DNA synthesis, identifying 30 compounds that enhance proliferation of human induced pluripotent stem cell-derived cardiomyocytes. Among the most active compounds from the phenotypic screen are clinically approved L-type calcium channel blockers from multiple chemical classes whose activities were confirmed across different sources of human induced pluripotent stem cell-derived cardiomyocytes. Identification of compounds that stimulate human cardiomyocyte proliferation may provide new therapeutic strategies for heart failure.
Chapter
The heart changes its size and shape in response to different pathological stimuli or insults. In this chapter we describe the different patterns of cardiac remodeling, how they relate to cardiac disease and how they develop as a result of differential activation of signaling circuits within and between myocardial cells. We also address the regulation of cardiac contractility and cardiac metabolism and the way it changes in heart failure. We demonstrate with multiple current examples how basic science and the identification of molecular mechanisms of disease lead the way to novel therapeutic strategies, but also that, in turn, clinical practice keeps posing new questions to be addressed by translational research as new facets of heart failure continue to emerge.
Chapter
The adult mammalian heart, once viewed as a postmitotic organ, is now considered a regenerative organ. The human heart’s regenerative capacity peaks during childhood and decreases exponentially with age. While this innate regenerative capacity is limited, the study of the cellular sources of innate regeneration and the molecular pathways that govern it is certainly merited; elucidation of the endogenous regenerative mechanisms of the mammalian heart could enable their therapeutic exploitation. With regard to the cellular sources of myocyte turnover, cardiomyocyte proliferation has emerged as the dominant mechanism of myocyte replenishment in the injured neonatal heart and in the healthy adult heart during normal aging. Following myocardial injury of the adult heart, myocyte proliferation increases. Endogenous progenitors may also contribute to cardiomyogenesis in the injured mammalian heart, although this is not universally accepted and remains a subject of intense debate. Regarding therapeutic ways to stimulate cardiac regeneration, several strategies have yielded promising results in animal testing, including genetic manipulation of the cell cycle, regulation of miRNA expression, modulation of the Hippo and neuregulin/ERBB signaling pathways, administration of mitogenic factors, exposure to hypoxia, exercise, cell therapy, and mechanical unloading with left ventricular assist devices. Clinical translation of such therapeutic strategies is of utmost importance, as safe and reliable exogenous stimulation of endogenous regenerative processes will undoubtedly enable development of more effective treatments for a wide spectrum of cardiac diseases.
Article
The pathological processes leading to heart failure are characterized by the formation of fibrosis and scar, yet the dynamics of scar production and removal are incompletely understood. Spontaneous disappearance of myocardial collagen is reported in infancy but doubted in adulthood where scar volume constitutes a better prognostic indicator than the conventional parameters of ventricular function. Whilst certain drugs are known to attenuate myocardial fibrosis evidence is emerging that stem cell therapy also has the potential to reduce scar size and improve myocardial viability. Both animal studies and clinical trials support the concept that, as in infancy, cellular processes can be triggered to remove collagen and regenerate injured myocardium. The molecular mechanisms likely involve anti-fibrotic cytokines growth factors and matrix-metalloproteinases. Autologous cardiac, bone-marrow and adipose tissue derived stem cells have each shown efficacy. Specific immune privileged mesenchymal stem cells and genetically modified immunomodulatory progenitor cells may in turn provide an allogenic source for the paracrine effects. Thus autologous and allogenic cells both have the potential through paracrine action to reduce scar volume, boost angiogenesis and improve ventricular morphology. The potential benefit of myocardial cell therapy for routine treatment of heart failure is an area that requires further study.
Article
Full-text available
Loss of functional cardiomyocytes is a major determinant of heart failure after myocardial infarction. Previous high throughput screening studies have identified a few microRNAs (miRNAs) that can induce cardiomyocyte proliferation and stimulate cardiac regeneration in mice. Here, we show that all of the most effective of these miRNAs activate nuclear localization of the master transcriptional cofactor Yes-associated protein (YAP) and induce expression of YAP-responsive genes. In particular, miR-199a-3p directly targets two mRNAs coding for proteins impinging on the Hippo pathway, the upstream YAP inhibitory kinase TAOK1, and the E3 ubiquitin ligase β-TrCP, which leads to YAP degradation. Several of the pro-proliferative miRNAs (including miR-199a-3p) also inhibit filamentous actin depolymerization by targeting Cofilin2, a process that by itself activates YAP nuclear translocation. Thus, activation of YAP and modulation of the actin cytoskeleton are major components of the pro-proliferative action of miR-199a-3p and other miRNAs that induce cardiomyocyte proliferation.
Article
The mammalian heart undergoes complex structural and functional remodeling to compensate for stresses such as pressure overload. While studies suggest that, at best, the adult mammalian heart is capable of very limited regeneration arising from the proliferation of existing cardiomyocytes, how myocardial stress affects endogenous cardiac regeneration or repair is unknown. To define the relationship between left ventricular afterload and cardiac repair, we induced left ventricle pressure overload in adult mice by constriction of the ascending aorta (AAC). One week following AAC, we normalized ventricular afterload in a subset of animals through removal of the aortic constriction (de-AAC). Subsequent monitoring of cardiomyocyte cell cycle activity via thymidine analog labeling revealed that an acute increase in ventricular afterload induced cardiomyocyte proliferation. Intriguingly, a release in ventricular overload (de-AAC) further increases cardiomyocyte proliferation. Following both AAC and de-AAC, thymidine analog-positive cardiomyocytes exhibited characteristics of newly generated cardiomyocytes, including single diploid nuclei and reduced cell size as compared to age-matched, sham-operated adult mouse myocytes. Notably, those smaller cardiomyocytes frequently resided alongside one another, consistent with local stimulation of cellular proliferation. Collectively, our data demonstrate that adult cardiomyocyte proliferation can be locally stimulated by an acute increase or decrease of ventricular pressure, and this mode of stimulation can be harnessed to promote cardiac repair.
Article
Full-text available
Introduction: Cardiocyte myofibrillolysis and interstitial fibrosis belong to histopathological changes in cardiomyopathies, leading to heart failure. Aim: To evaluate these changes in apical resection during left ventricular assist device (LVAD) implantation. Material and methods: The studied group consisted of 40 patients with cardiomyopathy, and apical samples excised during left ventricular assist device implantation were studied (CM/VAD group, mean: 48.1 ±10 y/o). A control group consisted of 6 apical samples from healthy heart graft donors (mean: 29 ±2.3 years old). Area fraction (AF) was calculated for: fibrosis, cardiocytes with myofibrillolysis (MFL), non-myofibrillolytic cardiocytes (non-MFL). Results: Single lymphocytes were seen in 18 (45%) cases in the CM/VAD group. Cardiomyopathy grade evaluated semiquantitatively in CM/VAD was: slight (25% of a group), moderate (35.5%), advanced (35.5%). CM/VAD cases showed nearly ten times higher fibrosis than the control group. The MFL cells occupied nearly a five times larger area in CM/VAD than in the control group, whereas non-MFL cells were found in the control group, as a predominant pattern. The linear regression calculated between fibrosis AF and types of cardiocytes indicated the depletion of cardiomyocytes with fibrosis increase. The control group presented insignificant dependency between fibrosis and MFL cells, suggesting the lack of replacement fibrosis. Significant negative dependence between fibrosis and non-MFL cardiocytes suggested remodeling in controls. Correlation analysis showed a strong relation between depletion of normal cardiocytes and progression of fibrosis. Conclusions: Progression of cardiomyopathy and fibrosis depends on the loss of cardiocytes rather than degeneration of these cells.
Article
Full-text available
This study evaluated myocardial nuclear staining for the DNA damage markers poly(ADP-ribose) (PAR) and γ-H2A.X in 58 patients with dilated cardiomyopathy. Patients with left ventricular reverse remodeling (LVRR) showed a significantly smaller proportion of PAR-positive nuclei and γ-H2A.X–positive nuclei in biopsy specimens compared with those without LVRR. Propensity analysis showed that the proportion of both PAR-positive and γ-H2A.X–positive nuclei were independent prognostic factors for LVRR. In conclusion, we showed the utility of DNA damage-marker staining to predict the probability of LVRR, thus revealing a novel prognostic predictor of medical therapy for dilated cardiomyopathy. Key Words: dilated cardiomyopathy, DNA damage, left ventricular reverse remodeling, poly ADP-ribose
Article
The investment of nearly 2 decades of clinical investigation into cardiac cell therapy has yet to change cardiovascular practice. Recent insights into the mechanism of cardiac regeneration help explain these results and provide important context in which we can develop next-generation therapies. Non-contractile cells such as bone marrow or adult heart derivatives neither engraft long-term nor induce new muscle formation. Correspondingly, these cells offer little functional benefit to infarct patients. In contrast, preclinical data indicate that transplantation of bona fide cardiomyocytes derived from pluripotent stem cells induces direct remuscularization. This new myocardium beats synchronously with the host heart and induces substantial contractile benefits in macaque monkeys, suggesting that regeneration of contractile myocardium is required to fully recover function. Through a review of the preclinical and clinical trials of cardiac cell therapy, distinguishing the primary mechanism of benefit as either contractile or non-contractile helps appreciate the barriers to cardiac repair and establishes a rational path to optimizing therapeutic benefit.
Article
Heart regeneration, a relatively new field of biology, is one of the most active and controversial areas of biomedical research. The potential impact of successful human heart regeneration therapeutics cannot be overstated, given the magnitude and prognosis of heart failure. However, the regenerative process is highly complex, and premature claims of successful heart regeneration have both fueled interest and created controversy. The field as a whole is now in the process of course correction, and a clearer picture is beginning to emerge. Despite the challenges, fundamental principles in developmental biology have provided a framework for hypothesis-driven approaches toward the ultimate goal of adult heart regeneration and repair. In this review, we discuss the current state of the field and outline the potential paths forward toward regenerating the human myocardium.
Article
Background Left ventricular (LV) assist devices (LVADs) are known to elicit reverse remodeling by mechanically unloading the left ventricle. Current guidelines target a reduction in LV end-diastolic diameter (LVEDD) of 15% compared with pre-LVAD dimensions; however, there is significant heterogeneity in the degree of unloading achieved. We sought to investigate factors associated with mechanical unloading at 6 months of LVAD support. Methods Data were retrospectively collected for 75 LVAD recipients at five time points: pre-LVAD, within 14 days post-LVAD, and at 1, 3, and 6 months post-LVAD. The percentage change in LVEDD between the pre-LVAD and 6 months post-LVAD time points was termed ΔLVEDD. Optimal LV unloading was defined as ΔLVEDD of ≥15% at 6 months. Patients who achieved optimal unloading (group A, n = 30) were compared with patients who did not (group B, n = 45). Results At 6 months, optimally unloaded patients (group A) demonstrated higher fractional shortening (15% ± 10% vs 10% ± 7%, P = .007), lower rates of moderate or severe mitral regurgitation (10% vs 33%, P = .02), and lower pulmonary capillary wedge pressure (9 ± 4 vs 16 ± 7 mm Hg, P = .02). Right ventricular dysfunction was more prevalent at 6 months in poorly unloaded (group B) patients (73% vs 43%, P = .008). Between hospital discharge and 6 months, the percentage increase in pump speed (Δ revolutions per minute) was higher in group A patients (4.4% ± 3.7% vs 0.1% ± 2.6%, P < .001). In a multivariate analysis, Δ revolutions per minute and tricuspid annular systolic velocity (S') at 6 months were independently associated with 6-month ΔLVEDD. Conclusions Recipients of LVADs who undergo progressive pump speed up-titration during outpatient follow-up are more likely to sustain optimal LV unloading. Progressive LVAD-related right ventricular failure is prevalent in suboptimally unloaded patients.
Article
Full-text available
The spectrum of ischemic heart diseases, encompassing acute myocardial infarction to heart failure, represents the leading cause of death worldwide. Although extensive progress in cardiovascular diagnoses and therapy has been made, the prevalence of the disease continues to increase. Cardiac regeneration has a promising perspective for the therapy of heart failure. Recently, extracellular matrix (ECM) has been shown to play an important role in cardiac regeneration and repair after cardiac injury. There is also evidence that the ECM could be directly used as a drug to promote cardiomyocyte proliferation and cardiac regeneration. Increasing evidence supports that applying ECM biomaterials to maintain heart function recovery is an important approach to apply the concept of cardiac regenerative medicine to clinical practice in the future. Here, we will introduce the essential role of cardiac ECM in cardiac regeneration and summarize the approaches of delivering ECM biomaterials to promote cardiac repair in this review.
Article
GSK3 are involved in different physical and pathological conditions and inflammatory regulated by macrophages contribute to significant mechanism. Infection stimuli may modulate GSK3 activity and influence host cell adaption, immune cells infiltration or cytokine expressions. To further address the role of GSK3 modulation in macrophages, the signal transduction of three major organs challenged by endotoxin, virus and genetic inherited factors are briefly introduced (lung injury, myocarditis and autosomal dominant polycystic kidney disease). As a result of pro-inflammatory and anti-inflammatory functions of GSK3 in different microenvironments and stages of macrophages (M1/M2), the rational resolution should be considered by adequately GSK3.
Article
Cardiac disease is the main cause of death worldwide. Insufficient regeneration of the adult mammalian heart is a major driver of cardiac morbidity and mortality. Cardiac regeneration occurs in early postnatal mice, thus understanding mechanisms of mammalian cardiac regeneration could facilitate the development of novel therapeutic strategies. Here, we provide a detailed description of a neonatal mouse model of pressure overload by transverse aortic constriction (nTAC) that can be applied at postnatal days 1 and 7. We have previously used this model to demonstrate that mice are able to fully adapt to pressure overload following nTAC on postnatal day 1. In contrast, when nTAC is applied in the non-regenerative phase (at postnatal day 7), it is associated with a maladaptive response similar to that seen when transverse aortic constriction (TAC) is applied to adult mice. Once a user is experienced in nTAC surgery, the procedure can be completed in less than 10 min per mouse. We anticipate that this model will facilitate the discovery of therapeutic targets to treat patients or prevent pressure overload-induced cardiac failure in the future.
Preprint
Full-text available
Background Cardiomyocytes increase DNA content in response to stress in humans. Proliferation has been reported in cardiomyocytes in failing hearts and following LVAD unloading which may represent a resolution of this process through cell division. However, cardiac recovery from LVAD is rare. Methods We quantified cardiomyocyte nuclear number, cell size, DNA content and the frequency of cell cycling markers by imaging flow cytometry from human subjects undergoing LVAD implantation or primary transplantation. Results Cardiomyocyte size was 15 percent smaller in unloaded versus loaded samples without differences in the percentage of mono-, bi, or multi-nuclear cells. DNA content per nucleus was significantly decreased in unloaded hearts versus loaded controls. Cell cycle markers, Ki67 and phosphohistone H3 (H3P) were not increased in unloaded versus failing samples. Conclusions Unloading of failing hearts is associated with decreased DNA content of nuclei independent of nucleation state within the cell. As these changes were associated with a trend to decreased cell size but not increased cell cycle markers, they may represent a regression of hypertrophic nuclear remodeling and not proliferation.
Article
Full-text available
Purpose of Review The replenishment of lost or damaged myocardium has the potential to reverse heart failure, making heart regeneration a goal for cardiovascular medicine. Unlike adult mammals, injury to the zebrafish or neonatal mouse heart induces a robust regenerative program with minimal scarring. Recent insights into the cellular and molecular mechanisms of heart regeneration suggest that the machinery for regeneration is conserved from zebrafish to mammals. Here, we will review conserved mechanisms of heart regeneration and their translational implications. Recent Findings Based on studies in zebrafish and neonatal mice, cardiomyocyte proliferation has emerged as a primary strategy for effecting regeneration in the adult mammalian heart. Recent work has revealed pathways for stimulating cardiomyocyte cell cycle reentry; potential developmental barriers for cardiomyocyte proliferation; and the critical role of additional cell types to support heart regeneration. Summary Studies in zebrafish and neonatal mice have established a template for heart regeneration. Continued comparative work has the potential to inform the translation of regenerative biology into therapeutics.
Article
Full-text available
Adult mammalian hearts are not regenerative. However, recent studies have evidenced that hypoxia enhances their regeneration. Islet1 (isl1) is known as a cardiac progenitor marker, which is quiescent in adult mammal hearts. In Xenopus hearts, transcriptional activation of isl1 was shown during cardiac regeneration of froglets at 3 months after metamorphosis. In this study, we examined transcriptional regulation of isl1 focusing on hypoxia-inducible factor 1α (hif1α) in Xenopus heart. We found that hif1α expression was increased in response to cardiac injury and overexpression of hif1α upregulated mRNA expression of isl1. Multiple conservation analysis including 9 species revealed that 8 multiple conserved regions (MCRs) were present upstream of isl1. DNA sequence analysis using JASPAR showed hif1α binding motifs in MCRs. By luciferase reporter assay and chromatin immunoprecipitation analysis, we found that hif1α directly bound to hif1α motifs in the most distant MCR8 and showed a specific transcriptional activity on the MCR8. In the luciferase assay using constructs carrying MCR8 without a responsive motif of hif1α, the reporter activity was lost. Pharmacologically inhibition of hif1α affected isl1 transcription and downstream events including cardiac phenotypes, suggesting functional defects of islet1. Contrarily in murine hearts, transcription of isl1 was unresponsive even after cryoinjury to adult hearts while hif1α mRNA was induced. In comparative analysis of multiple alignment, hif1α elements present in MCR8 of Xenopus or zebrafish were found to be disrupted as species are evolutionarily distant from Xenopus and zebrafish. Our results suggested an altered switch of isl1 transcription between mammals and Xenopus laevis.
Article
Objective Patients with profound cardiogenic shock may require veno-arterial (VA) extracorporeal membrane oxygenation (ECMO) for circulatory support most commonly via the femoral vessels. The rate of cardiac recovery in this population remains low, possibly because peripheral VA-ECMO increases ventricular afterload. Whether direct ventricular unloading in peripheral VA-ECMO enhances cardiac recovery is unknown, but is being more frequently utilized. A randomized trial is warranted to evaluate the clinical effectiveness of percutaneous LV venting to enhance cardiac recovery in the setting of VA-ECMO. Methods We here describe the rationale, design and initial testing of a randomized controlled trial of VA-ECMO with and without percutaneous LV venting using a percutaneous micro-axial ventricular assist device. Results This is an ongoing prospective randomized controlled trial in adult patients with primary cardiac failure presenting in cardiogenic shock requiring peripheral VA-ECMO, designed to test the safety and effectiveness of percutaneous LV venting in improving the rate of cardiac recovery. Conclusion The results of this non-industry sponsored trial will provide critical information on whether LV unloading in peripheral VA-ECMO is safe and effective.
Article
Background: The regenerative capacity of the heart after myocardial infarction (MI) is limited. Our previous study showed that ectopic introduction of Cdk1/CyclinB1 and Cdk4/CyclinD1 complexes (4F) promotes cardiomyocyte proliferation in 15-20% of infected cardiomyocytes in vitro and in vivo and improves cardiac function after MI in mice. Methods: Here, using temporal single-cell RNAseq we aimed to identify the necessary reprogramming stages during the forced cardiomyocyte proliferation with 4F on a single cell basis. Also, using rat and pig models of ischemic heart failure, we aimed to start the first preclinical testing to introduce 4F gene therapy as a candidate for the treatment of ischemia-induced heart failure. Results: Temporal bulk and single-cell RNAseq and further biochemical validations of mature hiPS-CMs treated with either LacZ or 4F adenoviruses revealed full cell cycle reprogramming in 15% of the cardiomyocyte population at 48 h post-infection with 4F, which was mainly associated with sarcomere disassembly and metabolic reprogramming (n=3/timepoint/group). Transient overexpression of 4F, specifically in cardiomyocytes, was achieved using a polycistronic non-integrating lentivirus (NIL) encoding the 4F; each is driven by a TNNT2 promoter (TNNT2-4Fpolycistronic-NIL). TNNT2-4Fpolycistronic-NIL or control virus was injected intramyocardially one week after MI in rats (n=10/group) or pigs (n=6-7/group). Four weeks post-injection, TNNT2-4Fpolycistronic-NIL treated animals showed significant improvement in left ventricular ejection fraction and scar size compared with the control virus treated animals. At four months after treatment, rats that received TNNT2-4Fpolycistronic-NIL still showed a sustained improvement in cardiac function and no obvious development of cardiac arrhythmias or systemic tumorigenesis (n=10/group). Conclusions: This study provides mechanistic insights into the process of forced cardiomyocyte proliferation and advances the clinical feasibility of this approach by minimizing the oncogenic potential of the cell cycle factors thanks to the use of a novel transient and cardiomyocyte-specific viral construct.
Article
Heart failure is a devastating disease that affects more than 26 million individuals worldwide and has a 5-year survival rate of less than 50%, with its development in part reflecting the inability of the adult mammalian heart to regenerate damaged myocardium. In contrast, certain vertebrate species including fish and amphibians, as well as neonatal mammals, are capable of complete cardiac regeneration after various types of myocardial injury such as resection of the ventricular apex or myocardial infarction, with this regeneration being mediated by the proliferation of cardiomyocytes, dissolution of temporary fibrosis, and revascularization of damaged tissue. In an effort to identify regulators of cardiac regeneration and to develop novel therapeutic strategies for induction of myocardial regeneration in the adult human heart, recent studies have adopted an approach based on comparative biology. These studies have pointed to cellular or tissue responses to environmental cues-including activation of the immune system, the reaction to mechanical stress, and the adoption of oxidative metabolism-as key determinants of whether the heart undergoes regeneration or nonregenerative scar formation after injury. We here summarize recent insight into the molecular mechanisms as well as environmental and systemic factors underlying cardiac regeneration based on the findings of inter- or intraspecific comparisons between regenerative and nonregenerative responses to heart injury. We also discuss how recent progress in understanding the molecular, systemic, and environmental basis of cardiac regeneration in a variety of organisms may relate to multiple scientific fields including ecology, evolutionary as well as developmental biology.
Article
Full-text available
Background: Impaired bioenergetics is a prominent feature of the failing heart, but the underlying metabolic perturbations are poorly understood. Methods and Results: We compared metabolomic, gene transcript, and protein data from six paired failing human left ventricular (LV) tissue samples obtained during left ventricular assist device (LVAD) insertion (heart failure (HF) samples) and at heart transplant (post-LVAD samples). Non-failing left ventricular (NFLV) wall samples procured from explanted hearts of patients with right heart failure served as novel comparison samples. Metabolomic analyses uncovered a distinct pattern in HF tissue: increased pyruvate concentrations coupled with reduced Krebs cycle intermediates and short-chain acylcarnitines, suggesting a global reduction in substrate oxidation. These findings were associated with decreased transcript levels for enzymes that catalyze fatty acid oxidation and pyruvate metabolism and for key transcriptional regulators of mitochondrial metabolism and biogenesis, peroxisome proliferator-activated receptor gamma co-activator1α (PGC1α) and estrogen-related receptor α (ERRα) and γ (ERRγ). Thus, parallel decreases in key transcription factors and their target metabolic enzyme genes can explain the decreases in associated metabolic intermediates. Mechanical support with LVAD improved all of these metabolic and transcriptional defects. Conclusions: These observations underscore an important pathophysiologic role for severely defective metabolism in HF, while the reversibility of these defects by LVAD suggests metabolic resilience of the human heart.
Article
Full-text available
Mitochondrial dysfunction is implicated in a vast array of diseases and conditions, such as Alzheimer's disease, cancer, and aging. Alterations in mitochondrial DNA (mtDNA) may provide insight into the processes that either initiate or propagate this dysfunction. Here, we describe a unique multiplex assay which simultaneously provides assessments of mtDNA copy number and the proportion of genomes with common large deletions by targeting two mitochondrial sites and one nuclear locus. This probe-based, single-tube multiplex provides high specificity while eliminating well-to-well variability that results from assaying nuclear and mitochondrial targets individually.
Article
Full-text available
The adult mammalian heart has limited potential for regeneration. Thus, after injury, cardiomyocytes are permanently lost, and contractility is diminished. In contrast, the neonatal heart can regenerate owing to sustained cardiomyocyte proliferation. Identification of critical regulators of cardiomyocyte proliferation and quiescence represents an important step toward potential regenerative therapies. Yes-associated protein (Yap), a transcriptional cofactor in the Hippo signaling pathway, promotes proliferation of embryonic cardiomyocytes by activating the insulin-like growth factor and Wnt signaling pathways. Here we report that mice bearing mutant alleles of Yap and its paralog WW domain containing transcription regulator 1 (Taz) exhibit gene dosage-dependent cardiac phenotypes, suggesting redundant roles of these Hippo pathway effectors in establishing proper myocyte number and maintaining cardiac function. Cardiac-specific deletion of Yap impedes neonatal heart regeneration, resulting in a default fibrotic response. Conversely, forced expression of a constitutively active form of Yap in the adult heart stimulates cardiac regeneration and improves contractility after myocardial infarction. The regenerative activity of Yap is correlated with its activation of embryonic and proliferative gene programs in cardiomyocytes. These findings identify Yap as an important regulator of cardiac regeneration and provide an experimental entry point to enhance this process.
Article
Full-text available
Mitochondrial dynamics is a recent topic of research in the field of cardiac physiology. The study of mechanisms involved in the morphological changes and in the mobility of mitochondria is legitimate since the adult cardiomyocytes possess numerous mitochondria which occupy at least 30% of cell volume. However, architectural constraints exist in the cardiomyocyte that limit mitochondrial movements and communication between adjacent mitochondria. Still, the proteins involved in mitochondrial fusion and fission are highly expressed in these cells and could be involved in different processes important for the cardiac function. For example, they are required for mitochondrial biogenesis to synthesize new mitochondria and for the quality-control of the organelles. They are also involved in inner membrane organization and may play a role in apoptosis. More generally, change in mitochondrial morphology can have consequences in the functioning of the respiratory chain, in the regulation of the mitochondrial permeability transition pore (MPTP), and in the interactions with other organelles. Furthermore, the proteins involved in fusion and fission of mitochondria are altered in cardiac pathologies such as ischemia/reperfusion or heart failure (HF), and appear to be valuable targets for pharmacological therapies. Thus, mitochondrial dynamics deserves particular attention in cardiac research. The present review draws up a report of our knowledge on these phenomena.
Article
Full-text available
The neonatal mammalian heart is capable of substantial regeneration following injury through cardiomyocyte proliferation. However, this regenerative capacity is lost by postnatal day 7 and the mechanisms of cardiomyocyte cell cycle arrest remain unclear. The homeodomain transcription factor Meis1 is required for normal cardiac development but its role in cardiomyocytes is unknown. Here we identify Meis1 as a critical regulator of the cardiomyocyte cell cycle. Meis1 deletion in mouse cardiomyocytes was sufficient for extension of the postnatal proliferative window of cardiomyocytes, and for re-activation of cardiomyocyte mitosis in the adult heart with no deleterious effect on cardiac function. In contrast, overexpression of Meis1 in cardiomyocytes decreased neonatal myocyte proliferation and inhibited neonatal heart regeneration. Finally, we show that Meis1 is required for transcriptional activation of the synergistic CDK inhibitors p15, p16 and p21. These results identify Meis1 as a critical transcriptional regulator of cardiomyocyte proliferation and a potential therapeutic target for heart regeneration.
Article
Full-text available
The mammalian heart loses its regenerative potential soon after birth. Adult cardiac myocytes (ACMs) permanently exit the cell cycle, and E2F-dependent genes are stably silenced, although the underlying mechanism is unclear. Heterochromatin, which silences genes in many biological contexts, accumulates with cardiac differentiation. H3K9me3, a histone methylation characteristic of heterochromatin, also increases in ACMs and at E2F-dependent promoters. We hypothesize that genes relevant for cardiac proliferation are targeted to heterochromatin by retinoblastoma (Rb) family members interacting with E2F transcription factors and recruiting heterochromatin protein 1 (HP1) proteins. To test this hypothesis, we created cardiac-specific Rb and p130 inducible double knockout (IDKO) mice. IDKO ACMs showed a decrease in total heterochromatin, and cell cycle genes were derepressed, leading to proliferation of ACMs. Although Rb/p130 deficiency had no effect on total H3K9me3 levels, recruitment of HP1-γ to promoters was lost. Depleting HP1-γ up-regulated proliferation-promoting genes in ACMs. Thus, Rb and p130 have overlapping roles in maintaining the postmitotic state of ACMs through their interaction with HP1-γ to direct heterochromatin formation and silencing of proliferation-promoting genes.
Article
Full-text available
It has been difficult to establish whether we are limited to the heart muscle cells we are born with or if cardiomyocytes are generated also later in life. We have taken advantage of the integration of carbon-14, generated by nuclear bomb tests during the Cold War, into DNA to establish the age of cardiomyocytes in humans. We report that cardiomyocytes renew, with a gradual decrease from 1% turning over annually at the age of 25 to 0.45% at the age of 75. Fewer than 50% of cardiomyocytes are exchanged during a normal life span. The capacity to generate cardiomyocytes in the adult human heart suggests that it may be rational to work toward the development of therapeutic strategies aimed at stimulating this process in cardiac pathologies.
Article
Full-text available
Aurora-B is an evolutionally conserved protein kinase that regulates several mitotic events including cytokinesis. We previously demonstrated the possible existence of a protein kinase that phosphorylates at least Ser-72 on vimentin, the most widely expressed intermediate filament protein, in the cleavage furrow-specific manner. Here we showed that vimentin-Ser-72 phosphorylation occurred specifically at the border of the Aurora-B-localized area from anaphase to telophase. Expression of a dominant-negative mutant of Aurora-B led to a reduction of this vimentin-Ser-72 phosphorylation. In vitro analyses revealed that Aurora-B phosphorylates vimentin at ∼2 mol phosphate/mol of substrate for 30 min and that this phosphorylation dramatically inhibits vimentin filament formation. We further identified eight Aurora-B phosphorylation sites, including Ser-72 on vimentin, and then constructed the mutant vimentin in which these identified sites are changed into Ala. Cells expressing this mutant formed an unusually long bridge-like intermediate filament structure between unseparated daughter cells. We then identified important phosphorylation sites for the bridge phenotype. Our findings indicate that Aurora-B regulates the cleavage furrow-specific vimentin phosphorylation and controls vimentin filament segregation in cytokinetic process.
Article
Full-text available
The use of left ventricular assist devices is an accepted therapy for patients with refractory heart failure, but current pulsatile volume-displacement devices have limitations (including large pump size and limited long-term mechanical durability) that have reduced widespread adoption of this technology. Continuous-flow pumps are newer types of left ventricular assist devices developed to overcome some of these limitations. In a prospective, multicenter study without a concurrent control group, 133 patients with end-stage heart failure who were on a waiting list for heart transplantation underwent implantation of a continuous-flow pump. The principal outcomes were the proportions of patients who, at 180 days, had undergone transplantation, had cardiac recovery, or had ongoing mechanical support while remaining eligible for transplantation. We also assessed functional status and quality of life. The principal outcomes occurred in 100 patients (75%). The median duration of support was 126 days (range, 1 to 600). The survival rate during support was 75% at 6 months and 68% at 12 months. At 3 months, therapy was associated with significant improvement in functional status (according to the New York Heart Association class and results of a 6-minute walk test) and in quality of life (according to the Minnesota Living with Heart Failure and Kansas City Cardiomyopathy questionnaires). Major adverse events included postoperative bleeding, stroke, right heart failure, and percutaneous lead infection. Pump thrombosis occurred in two patients. A continuous-flow left ventricular assist device can provide effective hemodynamic support for a period of at least 6 months in patients awaiting heart transplantation, with improved functional status and quality of life. (ClinicalTrials.gov number, NCT00121472 [ClinicalTrials.gov].).
Article
-Impaired bioenergetics is a prominent feature of the failing heart, but the underlying metabolic perturbations are poorly understood. -We compared metabolomic, gene transcript, and protein data from six paired failing human left ventricular (LV) tissue samples obtained during left ventricular assist device (LVAD) insertion (heart failure (HF) samples) and at heart transplant (post-LVAD samples). Non-failing left ventricular (NFLV) wall samples procured from explanted hearts of patients with right HF served as novel comparison samples. Metabolomic analyses uncovered a distinct pattern in HF tissue: 2.6 fold increased pyruvate concentrations coupled with reduced Krebs cycle intermediates and short-chain acylcarnitines, suggesting a global reduction in substrate oxidation. These findings were associated with decreased transcript levels for enzymes that catalyze fatty acid oxidation and pyruvate metabolism and for key transcriptional regulators of mitochondrial metabolism and biogenesis, peroxisome proliferator-activated receptor gamma co-activator1α (PGC1A, 1.3 fold) and estrogen-related receptor α (ERRA, 1.2 fold) and γ (ERRG, 2.2 fold). Thus, parallel decreases in key transcription factors and their target metabolic enzyme genes can explain the decreases in associated metabolic intermediates. Mechanical support with LVAD improved all of these metabolic and transcriptional defects. -These observations underscore an important pathophysiologic role for severely defective metabolism in HF, while the reversibility of these defects by LVAD suggests metabolic resilience of the human heart.
Article
The mammalian heart has a remarkable regenerative capacity for a short period of time after birth, after which the majority of cardiomyocytes permanently exit cell cycle. We sought to determine the primary postnatal event that results in cardiomyocyte cell-cycle arrest. We hypothesized that transition to the oxygen-rich postnatal environment is the upstream signal that results in cell-cycle arrest of cardiomyocytes. Here, we show that reactive oxygen species (ROS), oxidative DNA damage, and DNA damage response (DDR) markers significantly increase in the heart during the first postnatal week. Intriguingly, postnatal hypoxemia, ROS scavenging, or inhibition of DDR all prolong the postnatal proliferative window of cardiomyocytes, whereas hyperoxemia and ROS generators shorten it. These findings uncover a protective mechanism that mediates cardiomyocyte cell-cycle arrest in exchange for utilization of oxygen-dependent aerobic metabolism. Reduction of mitochondrial-dependent oxidative stress should be an important component of cardiomyocyte proliferation-based therapeutic approaches.
Article
The Sixth Annual Report of the Interagency Registry for Mechanically Assisted Circulatory Support (Intermacs) summarizes the first 8 years of patient enrollment. This analysis is based on data from more than 10,000 patients and updates demographics, survival, adverse events, and risk factors. Among patients with continuous flow pumps, actuarial survival continues to be 80% at 1 year and 70% at 2 years. This report features a comparison of two eras of continuous flow durable devices in the U.S. in terms of device strategy, patient profiles, adverse event burden, survival, and quality of life.
Article
Chronically supported left ventricular assist device (LVAD) patients may be candidates for novel therapies aimed at promoting reverse remodeling and myocardial recovery. However, the effect of hemodynamic unloading with a LVAD on myocardial viability and LV function in chronically supported LVAD patients has not been fully characterized. We aimed to develop a non-invasive imaging protocol to serially quantify native cardiac structure, function, and myocardial viability while at reduced LVAD support. Clinically stable (n = 18) ambulatory patients (83% men, median age, 61 years) supported by a HeartMate II (Thoratec, Pleasanton, CA) LVAD (median durations of heart failure 4.6 years and LVAD support 7 months) were evaluated by echocardiography and technetium-99m ((99m)Tc)-sestamibi single photon emission computed tomography (SPECT) imaging at baseline and after an interval of 2 to 3 months. Echocardiographic measures of LV size and function, including speckle tracking-derived circumferential strain, were compared between ambulatory and reduced LVAD support at baseline and between baseline and follow-up at reduced LVAD support. The extent of myocardial viability by SPECT was compared between baseline and follow-up at reduced LVAD support. With reduction in LVAD speeds (6,600 rpm; interquartile range: 6,200, 7,400 rpm), LV size increased, LV systolic function remained stable, and filling pressures nominally worsened. After a median 2.1 months, cardiac structure, function, and the extent of viable myocardium, globally and regionally, was unchanged on repeat imaging while at reduced LVAD speed. In clinically stable chronically supported LVAD patients, intrinsic cardiac structure, function, and myocardial viability did not significantly change over the pre-specified time frame. Echocardiographic circumferential strain and (99m)Tc-sestamibi SPECT myocardial viability imaging may provide useful non-invasive end points for the assessment of cardiac structure and function, particularly for phase II studies of novel therapies aimed at promoting reverse remodeling and myocardial recovery in LVAD patients.
Article
Our insights into different system levels of mechanisms by left ventricular assist device support are increasing and suggest a complex regulatory system of overlapping biological processes. To develop novel decision-making strategies and patient selection criteria, heart failure and reverse cardiac remodeling should be conceptualized and explored by a multifaceted research strategy of transcriptomics, metabolomics, proteomics, molecular biology, and bioinformatics. Knowledge of the molecular mechanisms of reverse cardiac remodeling is in its early stages, and comprehensive reconstruction of the underlying networks is necessary.
Article
Heart failure resulting in hospitalization represents a significant and growing health care burden. Heterogeneity characterizes this group in terms of mode of presentation, pathophysiology, and prognosis. The vast majority of patients symptomatically improve during hospitalization; however, their early post-discharge rehospitalization and mortality rates continue to be high. Worsening signs and symptoms, neurohormonal, and renal abnormalities occurring soon after discharge may contribute to these high post-discharge event rates. Currently available assessment modalities combined with recent advances in cardiovascular therapies provide present-day opportunities to improve post-discharge outcomes. Further investigation into pathophysiologic targets and novel approaches to clinical trial design are needed. Improving post-discharge outcomes is the single most important goal in the management of acute heart failure syndromes.
Article
Heart failure is associated with remodeling that consists of adverse cellular, structural, and functional changes in the myocardium. Until recently, this was thought to be unidirectional, progressive, and irreversible. However, irreversibility has been shown to be incorrect because complete or partial reversal can occur that can be marked after myocardial unloading with a left ventricular assist device (LVAD). Patients with chronic advanced heart failure can show near-normalization of nearly all structural abnormalities of the myocardium or reverse remodeling after LVAD support. However, reverse remodeling does not always equate with clinical recovery. The molecular changes occurring after LVAD support are reviewed, both those demonstrated with LVAD unloading alone in patients bridged to transplantation and those occurring in the myocardium of patients who have recovered enough myocardial function to have the device removed. Reverse remodeling may be attributable to a reversal of the pathological mechanisms that occur in remodeling or the generation of new pathways. A reduction in cell size occurs after LVAD unloading, which does not necessarily correlate with improved cardiac function. However, some of the changes in both the cardiac myocyte and the matrix after LVAD support are specific to myocardial recovery. In the myocyte, increases in the cytoskeletal proteins and improvements in the Ca(2+) handling pathway seem to be specifically associated with myocardial recovery. Changes in the matrix are complex, but excessive scarring appears to limit the ability for recovery, and the degree of fibrosis in the myocardium at the time of implantation may predict the ability to recover.
Article
Rationale: Cardiomyocytes in adult mammalian hearts are terminally differentiated cells that have exited from the cell cycle and lost most of their proliferative capacity. Death of mature cardiomyocytes in pathological cardiac conditions and the lack of regeneration capacity of adult hearts are primary causes of heart failure and mortality. However, how cardiomyocyte proliferation in postnatal and adult hearts becomes suppressed remains largely unknown. The miR-17-92 cluster was initially identified as a human oncogene that promotes cell proliferation. However, its role in the heart remains unknown. Objective: To test the hypothesis that miR-17-92 participates in the regulation of cardiomyocyte proliferation in postnatal and adult hearts. Methods and results: We deleted miR-17-92 cluster from embryonic and postnatal mouse hearts and demonstrated that miR-17-92 is required for cardiomyocyte proliferation in the heart. Transgenic overexpression of miR-17-92 in cardiomyocytes is sufficient to induce cardiomyocyte proliferation in embryonic, postnatal, and adult hearts. Moreover, overexpression of miR-17-92 in adult cardiomyocytes protects the heart from myocardial infarction-induced injury. Similarly, we found that members of miR-17-92 cluster, miR-19 in particular, are required for and sufficient to induce cardiomyocyte proliferation in vitro. We identified phosphatase and tensin homolog, a tumor suppressor, as an miR-17-92 target to mediate the function of miR-17-92 in cardiomyocyte proliferation. Conclusions: Our studies therefore identify miR-17-92 as a critical regulator of cardiomyocyte proliferation, and suggest this cluster of microRNAs could become therapeutic targets for cardiac repair and heart regeneration.
Article
• 1.The INTERMACS database now includes more than 6,800 patients and 145 participating hospitals. • 2.The Heartware HVAD and Berlin Heart Excor Pediatric VAD have recently received FDA approval. • 3.Greater than 95% of implants are currently continuous-flow devices. • 4.Current survival is approximately 80% at 1 year and 70% at 2 years. • 5.Elderly patients have generally favorable outcomes but have less tolerance for additional risk factors. • 6.Patients in INTERMACS Levels 1 and 2 have about a 5–8% decrease in 1-year survival compared with other INTERMACS levels. • 7.Worsening degrees of right ventricular failure and renal dysfunction are associated with an incremental likelihood of early mortality. • 8.Adverse event burden will play an important role in driving therapeutic choices for INTERMACS Levels 4 to 7. • 9.Quality of life indicators are generally positive after device implant for at least the first year. • 10.Major knowledge gaps will be addressed by the addition of dedicated pediatric (PEDIMACS) and medical (MEDAMACS) components within INTERMACS.
Article
In mammals, enlargement of the heart during embryonic development is primarily dependent on the increase in cardiomyocyte numbers. Shortly after birth, however, cardiomyocytes stop proliferating and further growth of the myocardium occurs through hypertrophic enlargement of the existing myocytes. As a consequence of the minimal renewal of cardiomyocytes during adult life, repair of cardiac damage through myocardial regeneration is very limited. Here we show that the exogenous administration of selected microRNAs (miRNAs) markedly stimulates cardiomyocyte proliferation and promotes cardiac repair. We performed a high-content microscopy, high-throughput functional screening for human miRNAs that promoted neonatal cardiomyocyte proliferation using a whole-genome miRNA library. Forty miRNAs strongly increased both DNA synthesis and cytokinesis in neonatal mouse and rat cardiomyocytes. Two of these miRNAs (hsa-miR-590 and hsa-miR-199a) were further selected for testing and were shown to promote cell cycle re-entry of adult cardiomyocytes ex vivo and to promote cardiomyocyte proliferation in both neonatal and adult animals. After myocardial infarction in mice, these miRNAs stimulated marked cardiac regeneration and almost complete recovery of cardiac functional parameters. The miRNAs identified hold great promise for the treatment of cardiac pathologies consequent to cardiomyocyte loss.
Article
Over the last 2 decades, numerous advancements in medical therapies have improved patient outcomes in heart failure (HF). However, a significant number of patients still progress to end-stage HF, in which treatment options are largely limited to cardiac transplantation. As patient demands for transplant continue to exceed the supply of available organs, mechanical assist devices—specifically, the left ventricular assist device (LVAD)—were initially introduced as a bridge to cardiac transplantation. LVADs have 2 important beneficial effects. First, LVADs are placed in parallel to the native left ventricle (LV), causing pressure and volume unloading of the LV. Second, LVADs restore cardiac output and subsequent perfusion to the organs. As a result of these 2 effects, it became evident that some patients had actual improvement in LV function after LVAD placement. The term reverse remodeling was used to describe the improvement in myocardial function that was observed in patients with a seemingly end-stage disease. With reverse remodeling, a new hope for the treatment of HF was born—using LVADs as a bridge to recovery; however, to date, this promise has largely been unrealized. This probably is reflective of the fact that the sequela of mechanical ventricular unloading are quite complex and appear to involve the engagement of competing biological pathways including regression of cardiomyocyte hypertrophy as well as progressive cell atrophy. Although the promise of ventricular recovery still persists, its actualization will await a more comprehensive dissection of these competing biological processes. This review will discuss the beneficial clinical effects of LVAD support as well as review what is known about the cellular and molecular response to mechanical unloading and mechanisms of reverse remodeling. Key research findings have been summarized in the Table. View this table: Table. Summary of Research of LVAD Support on Clinical Effects and the Cellular and Molecular Changes That May Contribute to Reverse …
Article
We have previously shown that a specific combination of drug therapy and left ventricular assist device unloading results in significant myocardial recovery, sufficient to allow pump removal, in two thirds of patients with dilated cardiomyopathy receiving a Heartmate I pulsatile device. However, this protocol has not been used with nonpulsatile devices. We report the results of a prospective study of 20 patients who received a combination of angiotensin-converting enzymes, β-blockers, angiotensin II inhibitors, and aldosterone antagonists followed by the β₂-agonist clenbuterol and were regularly tested (echocardiograms, exercise tests, catheterizations) with the pump at low speed. Before left ventricular assist device insertion, patient age was 35.2 ± 12.6 years (16 male patients), patients were on 2.0 ± 0.9 inotropes, 7 (35) had an intra-aortic balloon pump, 2 were hemofiltered, 2 were ventilated, 3 had a prior Levitronix device, and 1 had extracorporeal membrane oxygenation. Cardiac index was 1.39 ± 0.43 L · min⁻¹ · m⁻², pulmonary capillary wedge pressure was 31.5 ± 5.7 mm Hg, and heart failure history was 3.4 ± 3.5 years. One patient was lost to follow-up and died after 240 days of support. Of the remaining 19 patients, 12 (63.2) were explanted after 286 ± 97 days. Eight had symptomatic heart failure for ≤6 months and 4 for >6 months (48 to 132 months). Before explantation, at low flow for 15 minutes, ejection fraction was 70 ± 7, left ventricular end-diastolic diameter was 48.6 ± 5.7 mm, left ventricular end-systolic diameter was 32.3 ± 5.7 mm, mV(O₂) was 21.6 ± 4 mL · kg⁻¹ · min⁻¹, pulmonary capillary wedge pressure was 5.9 ± 4.6 mm Hg, and cardiac index was 3.6 ± 0.6 L · min⁻¹ · m⁻². Estimated survival without heart failure recurrence was 83.3 at 1 and 3 years. After a 430.7 ± 337.1-day follow-up, surviving explants had an ejection fraction of 58.1 ± 13.8, left ventricular end-diastolic diameter of 59.0 ± 9.3 mm, left ventricular end-systolic diameter of 42.0 ± 10.7 mm, and mV(O₂) of 22.6 ± 5.3 mL · kg⁻¹ · min⁻¹. Reversal of end-stage heart failure secondary to nonischemic cardiomyopathy can be achieved in a substantial proportion of patients with nonpulsatile flow through the use of a combination of mechanical and pharmacological therapy.
Article
This study investigates alterations in myocardial microvasculature, fibrosis, and hypertrophy before and after mechanical unloading of the failing human heart. Recent studies demonstrated the pathophysiologic importance and significant mechanistic links among microvasculature, fibrosis, and hypertrophy during the cardiac remodeling process. The effect of left ventricular assist device (LVAD) unloading on cardiac endothelium and microvasculature is unknown, and its influence on fibrosis and hypertrophy regression to the point of atrophy is controversial. Hemodynamic data and left ventricular tissue were collected from patients with chronic heart failure at LVAD implant and explant (n = 15) and from normal donors (n = 8). New advances in digital microscopy provided a unique opportunity for comprehensive whole-field, endocardium-to-epicardium evaluation for microvascular density, fibrosis, cardiomyocyte size, and glycogen content. Ultrastructural assessment was done with electron microscopy. Hemodynamic data revealed significant pressure unloading with LVAD. This was accompanied by a 33% increase in microvascular density (p = 0.001) and a 36% decrease in microvascular lumen area (p = 0.028). We also identified, in agreement with these findings, ultrastructural and immunohistochemical evidence of endothelial cell activation. In addition, LVAD unloading significantly increased interstitial and total collagen content without any associated structural, ultrastructural, or metabolic cardiomyocyte changes suggestive of hypertrophy regression to the point of atrophy and degeneration. The LVAD unloading resulted in increased microvascular density accompanied by increased fibrosis and no evidence of cardiomyocyte atrophy. These new insights into the effects of LVAD unloading on microvasculature and associated key remodeling features might guide future studies of unloading-induced reverse remodeling of the failing human heart.
Article
The ability of the human heart to regenerate large quantities of myocytes remains controversial, and the extent of myocyte renewal claimed by different laboratories varies from none to nearly 20% per year. To address this issue, we examined the percentage of myocytes, endothelial cells, and fibroblasts labeled by iododeoxyuridine in postmortem samples obtained from cancer patients who received the thymidine analog for therapeutic purposes. Additionally, the potential contribution of DNA repair, polyploidy, and cell fusion to the measurement of myocyte regeneration was determined. The fraction of myocytes labeled by iododeoxyuridine ranged from 2.5% to 46%, and similar values were found in fibroblasts and endothelial cells. An average 22%, 20%, and 13% new myocytes, fibroblasts, and endothelial cells were generated per year, suggesting that the lifespan of these cells was approximately 4.5, 5, and 8 years, respectively. The newly formed cardiac cells showed a fully differentiated adult phenotype and did not express the senescence-associated protein p16(INK4a). Moreover, measurements by confocal microscopy and flow cytometry documented that the human heart is composed predominantly of myocytes with 2n diploid DNA content and that tetraploid and octaploid nuclei constitute only a small fraction of the parenchymal cell pool. Importantly, DNA repair, ploidy formation, and cell fusion were not implicated in the assessment of myocyte regeneration. Our findings indicate that the human heart has a significant growth reserve and replaces its myocyte and nonmyocyte compartment several times during the course of life.
Article
Whether adult cardiomyocytes have the capacity to regenerate in response to injury and, if so, to what extent are still issues of intense debate. In human heart failure, cardiomyocytes harbor a polyploid genome. A unique opportunity to study the mechanism of polyploidization is provided through the setting of hemodynamic support by left ventricular assist devices. Hence, the cardiomyocyte DNA content, nuclear morphology, and number of nuclei per cell were assessed before and after left ventricular assist device support. In 23 paired myocardial samples, cardiomyocyte ploidy was investigated by DNA image cytometry, flow cytometry, and in situ hybridization. Nuclear cross-sectional area and perimeters were measured morphometrically, and the binucleated cardiomyocytes were counted. The median of the cardiomyocyte DNA content and the number of polyploid cardiomyocytes both declined significantly from 6.79 c to 4.7 c and 40.2% to 23%, whereas a significant increase in diploid cardiomyocytes from 33.4% to 50.3% and in binucleated cardiomyocytes from 4.5% to 10% after unloading was observed. The decrease in polyploidy and increase in diploidy after left ventricular assist device suggest a numeric increase in diploid cardiomyocytes (eg, through cell cycle progression with completion of mitosis or by increased stem cells). The cardiac regeneration that follows may serve as a morphological correlate of the recovery observed in some patients after unloading.
Article
The prime objective for every life form is to deliver its genetic material, intact and unchanged, to the next generation. This must be achieved despite constant assaults by endogenous and environmental agents on the DNA. To counter this threat, life has evolved several systems to detect DNA damage, signal its presence and mediate its repair. Such responses, which have an impact on a wide range of cellular events, are biologically significant because they prevent diverse human diseases. Our improving understanding of DNA-damage responses is providing new avenues for disease management.
Article
Many organs rely on undifferentiated stem and progenitor cells for tissue regeneration. Whether differentiated cells themselves can contribute to cell replacement and tissue regeneration is a controversial question. Here, we show that differentiated heart muscle cells, cardiomyocytes, can be induced to proliferate and regenerate. We identify an underlying molecular mechanism for controlling this process that involves the growth factor neuregulin1 (NRG1) and its tyrosine kinase receptor, ErbB4. NRG1 induces mononucleated, but not binucleated, cardiomyocytes to divide. In vivo, genetic inactivation of ErbB4 reduces cardiomyocyte proliferation, whereas increasing ErbB4 expression enhances it. Injecting NRG1 in adult mice induces cardiomyocyte cell-cycle activity and promotes myocardial regeneration, leading to improved function after myocardial infarction. Undifferentiated progenitor cells did not contribute to NRG1-induced cardiomyocyte proliferation. Thus, increasing the activity of the NRG1/ErbB4 signaling pathway may provide a molecular strategy to promote myocardial regeneration.
Article
Although multiple studies have shown that the left ventricular assist device (LVAD) improves distorted cardiac geometry, the pathological mechanisms of the "reverse remodeling" of the heart are unknown. Our goal was to determine the effects of LVAD support on cardiac myocyte size and shape. Isolated myocytes were obtained at cardiac transplantation from 30 failing hearts (12 ischemic, 18 nonischemic) without LVAD support, 10 failing hearts that received LVAD support for 75+/-15 days, and 6 nonfailing hearts. Cardiac myocyte volume, length, width, and thickness were determined by use of previously validated techniques. Isolated myocytes from myopathic hearts exhibited increased volume, length, width, and length-to-thickness ratio compared with normal myocytes (P<0.05). However, there were no differences in any parameter between myocytes from ischemic and nonischemic cardiomyopathic hearts. Long-term LVAD support resulted in a 28% reduction in myocyte volume, 20% reduction in cell length, 20% reduction in cell width, and 32% reduction in cell length-to-thickness ratio (P<0.05). In contrast, LVAD support was associated with no change in cell thickness. These cellular changes were associated with reductions in left ventricular dilation and left ventricular mass measured echocardiographically in 6 of 10 LVAD-supported patients. These studies suggest that the regression of cellular hypertrophy is a major contributor to the "reverse remodeling" of the heart after LVAD implantation. The favorable alterations in geometry that occur in parallel fashion at both the organ and cellular levels may contribute to reduced wall stress and improved mechanical performance after LVAD support.
Article
With improved technology and expanding indications for use, left ventricular assist devices (LVADs) are assuming a greater role in the care of patients with end-stage heart failure. Following LVAD implantation with the intention of bridge to transplant, it became evident that some patients exhibit substantial recovery of ventricular function. This prompted explantation of some devices in lieu of transplantation, the so-called bridge-to-recovery (BTR) therapy. However, clinical outcomes following these experiences are not always successful. Patients treated in this fashion have often progressed rapidly back to heart failure. Special knowledge has emerged from studies of hearts supported by LVADs that provides insights into the basic mechanisms of ventricular remodeling and possible limits of ventricular recovery. In general, it was these studies that spawned the concept of reverse remodeling now recognized as an important goal of many heart failure treatments. Important examples of myocardial and/or ventricular properties that do not regress towards normal during LVAD support include abnormal extracellular matrix metabolism, increased tissue angiotensin levels, myocardial stiffening and partial recovery of gene expression involved with metabolism. Nevertheless, studies of LVAD-heart interactions have led to the understanding that although we once considered the end-stage failing heart of patients near death to be irreversibly diseased, an unprecedented degree of myocardial recovery is possible, when given sufficient mechanical unloading and restoration of more normal neurohormonal milieu. Evidence supporting and unsupporting the notion of reverse remodeling and clinical implications of this process will be reviewed.
Division of Cardiology/Department of Internal Medicine
  • U T Mammen
  • Southwestern Medical
  • Center
Mammen, UT Southwestern Medical Center, Division of Cardiology/Department of Internal Medicine, Heart Failure, VAD, & Heart Transplant Program, 5323
Use of a continuous-flow device in patients awaiting heart transplantation
  • Heartmate
  • Investigators
HeartMate II Clinical Investigators. Use of a continuous-flow device in patients awaiting heart transplantation. N Engl J Med 2007;357:885-96.