Garra jordanica, a new species from the Dead Sea basin with remarks on the relationship of G. ghorensis, G. tibanica and G. rufa (Teleostei: Cyprinidae)

Abstract

Garra jordanica, new species, is described from the northern Dead Sea basin in Jordan and Syria. It is related to G. ghorensis from the southern Dead Sea basin from which it is distinguished by having 8 1/2 branched dorsal-fin rays; 33-35+2 lateral line scales; 5-7 scales between the pelvic-fin base and the anus; a large round, black blotch on the flank at the middle of the posterior extremity of the caudal peduncle; the pelvic fin not overlapping the anus in individuals larger than 70 mm SL; shorter barbels; and details in the arrangement of tubercles on the head. Garra jordanica also differs from G. ghorensis by a nearest neighbor distance of 4.1 % K2P in its COI barcode region. It had previously been postulated that G. ghorensis from southern Jordan has a close relationship to G. tibanica or to G. rufa. Of the two contradicting hypotheses our results support a closer relationship of G. ghorensis to G. rufa.

Full text

Ichthyol. Explor. Freshwaters, Vol. 25, No. 3
223
Copyright © Verlag Dr. Friedrich Pfeil
Ichthyol. Explor. Freshwaters, Vol. 25, No. 3, pp. 223-236, 9 figs., 1 tab., December 2014
© 2014 by Verlag Dr. Friedrich Pfeil, München, Germany – ISSN 0936-9902
Garra jordanica, a new species from the Dead Sea basin
with remarks on the relationship of
G. ghorensis, G. tibanica and G. rufa
(Teleostei: Cyprinidae)
Nashat A. Hamidan*, Matthias F. Geiger** and Jörg Freyhof ***
Garra jordanica, new species, is described from the northern Dead Sea basin in Jordan and Syria. It is related to
G. ghorensis from the southern Dead Sea basin from which it is distinguished by having 8
1
/
2 branched dorsal-fin
rays; 33-35+2 lateral line scales; 5-7 scales between the pelvic-fin base and the anus; a large round, black blotch
on the flank at the middle of the posterior extremity of the caudal peduncle; the pelvic fin not overlapping the
anus in individuals larger than 70 mm SL; shorter barbels; and details in the arrangement of tubercles on the head.
Garra jordanica also differs from G. ghorensis by a nearest neighbor distance of 4.1 % K2P in its COI barcode region.
It had previously been postulated that G. ghorensis from southern Jordan has a close relationship to G. tibanica or
to G. rufa. Of the two contradicting hypotheses our results support a closer relationship of G. ghorensis to G. rufa.
* The Royal Society for the Conservation of Nature – Conservation Division, P.O. Box 1215, Jubaiha 11941,
Jordan and Centre for Conservation Ecology and Environmental Science, School of Applied Sciences, Bour-
nemouth University, Poole, BH12 5BB, U.K. E-mail: nashat.hamidan@rscn.org.jo
** Zoological Research Museum Alexander Koenig, Leibniz Institute for Animal Biodiversity, Foundation under
public law, Adenauerallee 160, 53113 Bonn, Germany. E-mail: m.geiger.zfmk@uni-bonn.de
*** German Centre for Integrative Biodiversity Research (iDiv) Halle-Jena-Leipzig, Deutscher Platz 5a, 04103
Leipzig, Germany (corresponding author). E-mail: joerg.freyhof@idiv.de
Introduction
In the Mediterranean basin, ten species of the
labeonine cyprpinid genus Garra are recognized
by Geiger et al. (2014), three with a mental adhe-
sive disc and seven, previously known as Hemi-
grammocapoeta, lacking such a disc. The species
with a mental adhesive disc are Garra variabilis,
which is distributed in the Asi [Orontes] in Syria
and in the Nahr al Kabir drainages, which makes
the border between Syria and Lebanon on the
Mediterranean coast, G. ghorensis known from the
southern tributaries of the Dead Sea basin in
Jordan (Hamidan & Mir, 2003), and G. rufa from
the Seyhan River in Turkey south to the Jordan
River (Krupp, 1985).
While Garra ghorensis is endemic to the Dead
Sea basin, G. variabilis and G. rufa also occur in
the Persian/Arabian Gulf basin where the former
is widespread in the upper Qweik, Euphrates and
Tigris drainages, and the latter has an even much
wider distribution range occurring all over from
the Qweik and the Euphrates and Tigris drainage
south to the Mond River, which flows into the

224 Copyright © Verlag Dr. Friedrich Pfeil
Hamidan et al.: Garra jordanica
Persian/Arabian Gulf in Iran. Garra ghorensis was
described by Krupp (1982) as a subspecies of
G. tibanica, an Arabian species closely related to,
or even identical with the African G. quadrimacu-
lata (Stiassny & Getahun, 2007). Krupp (1982)
identified the Garra populations from the northern
Dead Sea basin as G. rufa and postulated that the
southern Dead Sea basin was colonised by Garra
from Saudi Arabia and not from the northern
Dead Sea basin (Krupp, 1983). Goren & Ortal
(1999) and Gorshkova et al. (2012) strongly argued
against this hypothesis and postulated that
G. ghorensis has close relationships to the other
Garra species in the Mediterranean and Mesopo-
tamia.
It is the aim of this study to test these two
contradicting hypotheses, i. e. whether G. ghor ensis
has a close relationship to 1) G. tibanica as sug-
gested by Krupp (1982) or to 2) G. rufa as sug-
gested by Goren & Ortal (1999) and Gorshkova
et al. (2011). In addition, data presented by Geiger
et al. (2014) suggest that the Garra populations
from the northern Dead Sea basin represent a
different lineage than G. rufa from Mesopotamia
and might represent an undescribed species.
These fishes are described herein as G. jordanica.
Material and methods
After anaesthesia, all fishes were fixed in 5 %
formaldehyde and stored in 70 % ethanol, or
directly fixed in 99 % molecular grade ethanol.
Measurements were made with dial calliper and
recorded to 1 mm. All measurements are made
point to point, never by projections. Methods for
counts and measurements follow Kottelat &
Freyhof (2007). The terminology of the snout
morphology and the oromandibular structures
follow Stiassny & Getahun (2007) and Nebeshwar
& Vishwanath (2013). Standard length (SL) is
measured from the tip of the snout to the end of
the hypural complex. The length of the caudal
peduncle is measured from behind the base of
the last anal-fin ray to the end of the hypural
complex, at mid-height of the caudal-fin base.
The last two branched rays articulating on a
single pterygiophore in the dorsal and anal fins
are noted as “1 1
/
2
”. The holotype is included in
the calculation of means and SD.
Abbreviations: SL, standard length; HL,
lateral head length; K2P, Kimura 2-parameter.
Collection codes: FSJF, Fischsammlung J. Freyhof,
Berlin; NMW, Naturhistorisches Museum Wien,
Vienna; ZFMK, Zoological Research Museum
Alexander Koenig, Leibniz Institute for Animal
Biodiversity, Bonn; ZIN, Laboratory of Ichthyol-
ogy, Zoological Institute, Russian Academy of
Sciences, St. Petersburg.
DNA extraction and PCR. Genomic DNA was
extracted using Macherey& Nagel NucleoSpin®
Tissue kits following the manufacturer’s protocol
on an EppendorfEpMotion® pipetting-roboter
with vacuum manifold. The standard vertebrate
DNA barcode region of COI (cytochrome c oxi-
dase subunit 1) was amplified using a M13 tailed
primer cocktail including FishF2_t1 (5' TGTAAA-
ACGACGGCCAGTCGACTAATCATAAAGA-
TATCGGCAC), FishR2_t1 (5' CAGGAAACAGC-
TATGACACTTCAGGGTGACCGAAGAATCA-
GAA), VF2_t1 (5' TGTAAAACGACGGCCAGT-
CAACCAACCACAAAGACATTGGCAC) and
FR1d_t1 (5' CAGGAAACAGCTATGACACCT-
CAGGGTGTCCGAARAAYCARAA) (Ivanova et
al., 2007). Sequencing of the ExoSAP-IT (USB)
purified PCR product in both directions was
conducted at Macrogen Europe Laboratories with
forward sequencing primer M13F (5' GTAAAAC-
GACGGCCAGT) and reverse sequencing primer
M13R-pUC (5' CAGGAAACAGCTATGAC). In
order to better understand the phylogenetic posi-
tion of the studied species we include records
from the NCBI genbank for Garra congoensis
(DRC), G. ornata (DRC), and G. waterloti from
Guinea.
Molecular data analysis. Data processing and
sequence assembly was done in Geneious (Bio-
matters, 2013), and the Muscle algorithm (Edgar,
2004) chosen to create a DNA sequence alignment.
Modeltest (Posada & Crandall, 1998), imple-
mented in the MEGA 5 software (Tamura et al.,
2011) determined the most appropriate sequence
evolution model for the given data, treating gaps
Fig. 1. Maximum Likelihood estimation of the phylo-
genetic relationships of 24 Garra species from the
Arabian Peninsula, the Mediterranean basin, Mesopo-
tamia and Africa based on the mitochondrial COI
barcode region. Nucleotide positions with less than
95 % site coverage were eliminated before analysis.
Numbers of nodes indicate bootstrap values (> 75 %)
from the Maximum Likelihood, Neighbour joining, and
Maximum Parsimony method based on 1000 pseudo-
replicates.
/

Ichthyol. Explor. Freshwaters, Vol. 25, No. 3
225
Copyright © Verlag Dr. Friedrich Pfeil
Garra ghorensis Dead Sea Jordan 1193 KJ553478
Garra ghorensis Jordan Jordan 1225 KJ553401
Garra ghorensis Dead Sea Jordan 1193 KJ553508
Garra ghorensis Dead Sea Jordan 1193 KJ553520
Garra ghorensis Burbaita Jordan NHJO-004 KM214728
Garra ghorensis Burbaita Jordan NHJO-002 KM214788
Garra ghorensis Ibn-Hammad Jordan NHJO-009 KM214798
Garra ghorensis Fifa Jordan NHJO-027 KM214722
Garra ghorensis Burbaita Jordan NHJO-001 KM214688
Garra jordanica Jordan Syria 1238 KJ553498
Garra jordanica Jordan Syria 1186 KM214750
Garra jordanica Jordan Syria 1186 KM214710
Garra jordanica Dead Sea Jordan NHJO-041 KM214703
Garra jordanica Dead Sea Jordan NHJO-042 KM214753
Garra jordanica Dead Sea Jordan NHJO-043 KM214697
Garra jordanica Dead Sea Jordan NHJO-045 KM214806
Garra jordanica Jordan Syria 1206 KJ553525
Garra barreimiae Wuray UAE NHUAE-002 KM214783
Garra barreimiae Shawkah UAE NHUAE-012 KM214685
Garra barreimiae Shawkah UAE NHUAE-011 KM214758
Garra barreimiae Shawkah UAE NHUAE-013 KM214738
Garra barreimiae Shawkah UAE NHUAE-014 KM214779
Garra barreimiae Wuray UAE NHUAE-001 KM214734
Garra barreimiae Wuray UAE NHUAE-006 KM214767
Garra sp. Orontes Turkey 331 KJ553616
Garra sp. Orontes Turkey 331 KJ553315
Garra sp. Orontes Syria 1140 KM214743
Garra sp. Orontes Syria 1140 KM214681
Garra sp. Orontes Syria 1140 KJ553321
Garra sp. Orontes Turkey 331 KJ553323
Garra widdowsoni Euphrates Iraq 2301 KM214769
Garra widdowsoni Euphrates Iraq 2301 KM214795
Garra rufa Tigris Turkey 918 KM214684
Garra rufa Firat Turkey 923 KM214800
Garra rufa Firat Turkey 923 KM214692
Garra rufa Euphrates Turkey 2414 KM214792
Garra rufa Euphrates Turkey 2414 KM214694
Garra rufa Euphrates Turkey 2414 KM214693
Garra rufa Firat Turkey 923 KM214695
Garra rufa Tigris Iraq 2234 KM214700
Garra rufa Tigris Iraq 2234 KM214772
Garra rufa Shatt al-Arab Iraq 2480 KM214777
Garra rufa Tigris Iraq 2234 KM214715
Garra typhlops KaajeRu Iran 2169 KM214717
Garra typhlops KaajeRu Iran 2169 KM214731
Garra sahilia SA NHKSA-016 KM214718
Garra sahilia SA NHKSA-012 KM214724
Garra sahilia SA NHKSA-026 KM214799
Garra sahilia SA NHKSA-014 KM214786
Garra sahilia SA NHKSA-015 KM214774
Garra sahilia Sanaa Yemen cn872 KM214689
Garra sahilia Sanaa Yemen cn789 KM214707
Garra cf. longipinnis Jabal al Akhdar Oman cn5897a KM214752
Garra cf. longipinnis Jabal al Akhdar Oman cn5897b KM214756
Garra sauvagei Jordan Syria 1187 KJ553531
Garra nana Al Tammasiyyar Syria 1182 KJ553487
Garra nana Al Tammasiyyar Syria 1182 KJ553389
Garra festai Litani Lebanon 2153 KJ553308
Garra festai Litani Lebanon 2153 KJ553354
Garra festai Litani Lebanon 2153 KJ553509
Garra caudomaculata Orontes Syria 1143 KJ553341
Garra culiciphaga Seyhan Turkey 400 KJ553522
Garra culiciphaga Seyhan Turkey 400 KJ553581
Garra culiciphaga Seyhan Turkey 400 KJ553573
Garra waterloti Guinea JX074212
Garra congoensis Congo DRC HM418166
Garra congoensis Congo DRC HM418168
Garra ornata Congo DRC HM418163
Garra congoensis Congo DRC HM418167
Garra ornata Congo DRC HM418164
Garra smarti Hasaq Oman cn773 KM214732
Garra smarti Hasaq Oman cn5874 KM214744
Garra smarti Hasaq Oman cn5893 KM214699
Garra dunserei Dhofar Oman CN7771 KP069476
Garra dunserei Dhofar Oman CN7766 KP069477
Garra dunserei Dhofar Oman CN7769 KP069475
Garra tibanica Wadi damad SA NHKSA-027 KM214686
Garra tibanica Wadi damad SA NHKSA-028 KM214749
Garra tibanica Wadi damad SA NHKSA-031 KM214789
Garra buettikerii SA NHKSA-024 KM214729
Garra buettikerii SA NHKSA-021 KM214704
Garra buettikerii SA NHKSA-020 KM214723
Garra buettikerii SA NHKSA-022 KM214742
Garra variabilis Orontes Syria 1159 KJ553391
Garra variabilis Orontes Syria 1159 KJ553567
Garra variabilis Orontes Syria 1168 KJ553422
Garra variabilis Orontes Syria 1168 KJ553524
Garra kemali Tuz Turkey 1076 KJ553337
Garra kemali Tuz Turkey 1076 KJ553597
Garra klatti Isikli Turkey 1074 KJ553545
Garra klatti KöpruTurkey 1104 KJ553379
99-100-100
99-99-100
99-100-100
82-100-99
99-100-99
93
95
97
99
99
100
80-98--
79-82-97
99-100-100
100-100-99
99-100-100
99-100-99
100-100-100
99-100-100
88-97-98
98-99-99
100-100-100
100
100
100
100-100-100
99-100-100
99-99-99
97-94-98
100-100-100
100
100
100
97
99
99
91
90
95
90---92
99
99
99
-
76
81
0.05
--75--

226 Copyright © Verlag Dr. Friedrich Pfeil
and missing data with the partial deletion option
under 95% site coverage cutoff. The model with
the lowest BIC score (Bayesian Information Cri-
terion) is considered to best describe the substitu-
tion pattern. We generated neighbor-joining
(Saitou & Nei, 1987), maximum parsimony (Swof-
ford, 2002; with PAUP4b) and maximum likeli-
hood phylogenetic trees with 1000 bootstrap
replicates to explore species phylogenetic affini-
ties.
Results
Maximum Likelihood based estimation of the
phylogenetic relationships based on the mito-
chondrial COI barcode region place the sequenced
fishes into 24 groups (Fig. 1), which show between
0.2 % (G. congoensis vs. G. ornata) and 36.2 %
(G. ornata vs. G. rufa) K2P sequence divergence in
their COI barcode region. Species with one pair
of barbels (G. klattii, G. kemali, G. variabilis) are
well separated from the other species analysed.
Garra ghorensis is only distantly related to the
South Arabian Garra species as G. tibanica, G. buet-
tikeri, G. dunsirei and G. smarti. The three African
species included in the analysis (G. congoensis,
G. ornata and G. waterloti) are not related to the
Arabian G. tibanica, G. buettikeri, G. dunsirei and
G. smarti nor to the Anatolian and Mesopotamian
species. Arabian G. barreimiae, G. cf. longipinnis
and G. sahilia seem to belong to the Anatolian and
Mesopotamian species complex, and are not
closely related to the other species of the Arabian
Fig. 2. Garra jordanica, ZFMK 66328, holotype, 69 mm SL; Jordan: Mujib River.
Hamidan et al.: Garra jordanica

Ichthyol. Explor. Freshwaters, Vol. 25, No. 3
227
Copyright © Verlag Dr. Friedrich Pfeil
Peninsula studied (G. tibanica, G. buettikeri, G. dun-
sirei and G. smarti). African G. congoensis and
G. ornata form one group and might be very
closely related. Arabian G. sahilia are split into
two groups.
Garra rufa from the Euphrates and Tigris Riv-
ers form a group well separated from fishes
identified as G. rufa from the Orontes or the Jordan
drainages. The Garra populations of the Jordan
drainage are closely related to G. ghorensis, and
cannot be identified as G. rufa as suggested by
Krupp & Schneider (1989). These fishes are de-
scribed below as G. jordanica, a new species.
Deeper nodes received generally poorer support,
i.e. bootstrap values below 75 %, and are not
given in Figure 1.
Garra jordanica, new species
(Figs. 2-5)
Holotype. ZFMK 66328, 69 mm SL; Jordan: low-
ermost part of Mujib River, 31°27.998' N 35°
34.417' E; N. A. Hamidan, 22 July 2011.
Paratypes. ZFMK 66329-66332, 4, 28-48 mm SL;
same data as holotype. – FSJF 2715, 12, 39-94 mm
SL; Jordan: stream in Wadi Shouaib, 31°56'47" N
35°40'02" E; J. Freyhof, 18 Oct 2008. – FSJF 2722,
10, 44-96 mm SL; Syria: Yarmuk River in Wadi
Jallayn, 32°44'21" N 35°58'56" E; J. Freyhof, 16 Oct
2008.
Fig. 3. Garra jordanica, FSJF 2722, 96 mm SL; Syria: Yarmuk River.
Fig. 4. Garra jordanica, FSJF 2730, 100 mm SL; Syria: Lake Muzarib.

228 Copyright © Verlag Dr. Friedrich Pfeil
Additional material (non types). FSJF 2696, 5, 36-
51 mm SL; Jordan: spring in Suweyma, 31°46'14" N
35°36'10" E. – FSJF 2730, 31, 34-100 mm SL; Syria: Lake
Muzarib, 32°42' 12" N 36°01'20" E.
Material used in the molecular genetic analysis: FSJF
DNA-1186; Jordan: Spring in Suweyma, 31°46'14" N
35°36'10" E (GenBank accession numbers: KM214710,
KM214750). – FSJF DNA-1206; Syria: River Yarmuk in
Wadi Jallayn, 32°44'21" N 35°58'56" E (GenBank acces-
sion number: KJ553525). – FSJF DNA-2498; Jordan:
lowermost part of Mujib River, 31°27.998' N 35°34.417' E
(GenBank accession numbers: KM214697, KM214703,
KM214753, KM214806). – FSJF DNA-1238; Syria: Lake
Muzarib, 32°42'12" N 36°01'20" E (GenBank accession
number: KJ553498).
Diagnosis. Garra jordanica is closely related and
geographically adjacent to G. ghorensis, from
which it is distinguished by having 8 1
/
2 branched
dorsal-fin rays (vs. 7 1
/
2), 33-35+2 lateral line scales
(vs. 31-32+2), a large round, black blotch on the
flank at the middle of the posterior caudal pe-
duncle (vs. absent), 4-7 rows of deeply embedded
scales on the breast between the pectoral-fin
bases (vs. no or one row, or one additional scale
in the middle between the pectoral fin-base in
some individuals), the pelvic fin not overlapping
the anus in individuals larger than 70 mm SL (vs.
overlapping), shorter barbels and details in the
arrangement of tubercles on the head. See Re-
marks for characters distinguishing G. jordanica
from the other Garra species of the Mediterra-
nean basin and adjacent Mesopotamia.
Description. Morphometric data in Table 1. Body
elongated, moderately compressed laterally, more
compressed in region of caudal peduncle. Dorsal
head profile rising gently, slightly convex, more
or less continuous with dorsal body profile to
nape or about middle between nape and dorsal-
fin origin, almost straight until dorsal-fin origin.
Ventral profile more or less straight to anal-fin
origin. Head moderately large and depressed,
with slightly convex or flat interorbital distance;
height at nape less than head length; width at
nape greater or about equal to depth at nape.
Snout slightly pointed with transverse lobe, with
10-18 small- or medium sized tubercles, demar-
cated posteriorly by a shallow transverse groove
in some individuals, no transverse groove in
others. Proboscis covered with small or medium
Table 1. Morphometric data of Garra jordanica (holotype ZFMK 66328; paratypes: ZFMK 66329-66330, FSJF 2715,
FSJF 2722, n = 17).
holotype range mean SD
Standard length (mm) 68.6 47.3-96.4
In percent of standard length
Head length 25.3 22.8-28.1 24.5 1.2
Body depth at dorsal-fin origin 20.9 19.6-24.8 22.7 1.5
Predorsal length 51.4 45.5-53.3 49.3 1.9
Postdorsal length 38.1 35.1-42.1 38.9 1.7
Preanal length 76.8 73.8-79.1 76.0 1.4
Prepelvic length 53.5 50.3-56.2 52.7 1.8
Distance between pectoral and pelvic-fin origins 31.6 26.7-35.0 30.8 1.6
Distance between pelvic and anal-fin origins 23.8 21.1-24.8 23.6 1.1
Distance between vent and anal-fin origin 6.0 4.5-7.5 5.7 0.8
Depth of caudal peduncle 12.5 11.1-13.8 12.3 0.7
Length of caudal peduncle 15.3 14.3-19.5 17.4 1.4
Dorsal-fin depth 25.9 22.7-25.9 24.3 1.1
Anal-fin base length 19.7 17.2-20.1 18.8 0.8
Pectoral-fin length 23.3 19.7-23.4 21.4 1.0
Pelvic-fin length 21.3 18.0-21.3 19.1 0.9
In percent of head length
Head depth at eye 53 51-58 53.8 1.7
Snout length 51 44-55 50.8 3.1
Eye diameter 18 14-24 18.9 2.0
Postorbital distance 38 35-40 37.2 1.3
Maximum head width 67 64-72 68.9 2.2
Interorbital width 46 42-54 49.9 3.3
Hamidan et al.: Garra jordanica

Ichthyol. Explor. Freshwaters, Vol. 25, No. 3
229
Copyright © Verlag Dr. Friedrich Pfeil
sized tubercles, largest on anterior margin of
proboscis. Proboscis not or only slightly elevated
from depressed rostral surface. Lateral surface of
snout covered by small to medium sized tubercles
reaching to anterior eye margin. Depressed rostral
surface always without tubercles, anterior arm of
depressed rostral surface reaching to base of
rostral barbel, clearly separating transverse lobe
from lateral surface. A shallow groove between
transverse lobe and lateral surface in some indi-
viduals. No tubercles in juveniles and in a few
adults. Eye placed dorso-laterally in posterior half
of head. Barbels in two pairs; rostral barbel antero-
laterally located, shorter than eye diameter;
maxillary barbel at corner of mouth, shorter than
rostral barbel. Rostral cap well-developed, fimbri-
ate, papillate on ventral surface. Upper lip present
as a thin band of papillae arranged in two ridges.
Upper jaw almost or completely covered by ros-
tral cap. Disc elliptical, shorter than wide and
narrower than head width through base of max-
illary barbel; papillae on anterior fold of same
size, regularly arranged; groove between antero-
median fold and central callous-pad narrow and
deep, papillae on inner half of whole length of
latero-posterior flap coarsely arranged; anterior
marginal surface of central callous pad without
or with sparsely arranged small papillae; poste-
rior margin of latero-posterior flap extending
vertical to middle of eye or posterior margin of
eye.
Dorsal fin with 3 simple and 8
1
/
2 branched
rays, last simple ray slightly shorter or equally
long than head length; distal margin concave;
origin closer to snout tip than to caudal-fin base;
inserted anterior to vertical from pelvic-fin origin;
first branched ray longest, tip of last branched
ray reaching vertical of anus. Pectoral fin with 1
simple and 14 branched rays, reaching to a point
4-7 scales anterior to pelvic-fin origin, length
shorter than head length. Pelvic fin with 1 simple
and 8 branched rays, reaching to, or slightly be-
yond anus, not reaching anal-fin base, origin
closer to anal-fin origin than to pectoral-fin origin,
inserted below third or fourth branched dorsal-fin
ray. Anal fin short, with 3 simple and 5 1
/
2 branched
rays; first branched ray longest, reaching to dark
grey or black blotch on posterior caudal peduncle
or slightly anterior to it; distal margin concave;
origin closer to caudal-fin base than to pelvic-fin
origin. Anus 2-3 scales in front of anal-fin origin.
Caudal fin forked; tip of lobes pointed; upper
lobe longer than lower lobe.
Usually 16 gill rakers on ceratobranchial of
first branchial arch. [Krupp (1985) reported 12 (1),
13 (1), 14 (3), 15 (2), 16 (91) and 17 (2) gill rakers
on ceratobranchial in his dataset of 100 individu-
als of G. jordanica]. Lateral line complete, usually
with 33-35 scales on body and 2 scales on caudal
fin. [Krupp (1985) reported 31 (2), 32 (4), 33 (24),
34 (46), 35 (21) and 36 (3) scales on body in his
dataset of 100 individuals of G. jordanica]. Trans-
verse scale rows above lateral line 4
1
/
2; between
lateral line and pelvic-fin origin 4 1
/
2 and between
lateral line and anal-fin origin 3 1
/
2. Circumpedun-
cular scale rows 16. Predorsal scales 11-12; scales
regularly arranged, same size as flank scales.
Chest and belly scaled, scales deeply embedded.
One long axillary scale at base of pelvic fin, and
5-7, usually 6, scales between the posteriormost
pelvic-fin base and anus.
Fig. 5. Garra jordanica, FSJF 2722, 96 mm SL; Syria:
Yarmuk River.

230 Copyright © Verlag Dr. Friedrich Pfeil
flank and belly. Some populations almost com-
pletely grey or silvery. Iris orange. A blue dot at
anterior most lateral line reaching down to upper
pectoral-fin base in some individuals. A faint
irregularly shaped midlateral stripe in most in-
dividuals.
Distribution. Garra jordanica is distributed in the
northern part of the Dead Sea basin. It is wide-
spread in the Jordan drainage, in the Jordanian
Mujib River which flows from the east into the
Central Dead Sea, and also occurred in a spring
in the village Suweyma, which flowed directly
into the northern Dead Sea (but has dried out
recently). Goren & Ortal (1999) reported G. rufa
to occur in the Levantine coastal rivers Qishon,
Daliyya and Taninnim; these populations might
in fact be G. jordanica.
Etymology. The species is named after the Hash-
emite Kingdom of Jordan and for the Jordan
River.
Remarks. Garra jordanica and G. ghorensis are
separated by 4.1 % K2P distance in the studied
COI gene region. We follow Hebert et al. (2003)
who proposed such values as an indicator that
two species might be involved. Beside the char-
acters given in the diagnosis, they are distin-
guished by details in the snout ornamentation
and in the size of the barbels. In both species,
many small tubercles are present on the lateral
surface, the transverse lobe and the proboscis on
the snout. In both species, the size of the tubercles
is quite variable, especially in G. ghorensis, where
individuals with large snout tubercles are found
together with individuals of the same size with
Colouration. In ethanol: Head, dorsum and
flank dark or pale brown. Single or groups of dark
brown scales on flank. A faint or bold, irregu-
larly shaped midlateral stripe restricted to poste-
rior flank in some individuals, usually inter-
rupted and only visible in fishes from clear water
habitats, absent in fishes from murky water
habitats. Mouth, chest and abdomen yellowish
white. A roundish, large black blotch at posteri-
ormost caudal peduncle, very distinct in juveniles,
faded in adults. A black blotch at anterior most
lateral line. Lateral line pores cream whitish. Fins
dusky grey or hyaline. Base of last 4-6 branched
dorsal-fin rays with a black spot or black in indi-
viduals larger than 50 mm SL, hyaline in others.
Caudal fin dusky grey or hyaline; 1-2 rays above
and 2-4 rays below fork dusty grey or black. An
irregularly shaped black caudal-fin margin in
some individuals.
In life: Fins with an orange, yellow- or pink
hue. Head yellowish brown. Flank scales yellow-
ish brown, brown or black; whitish on ventral
Fig. 6. Garra ghorensis, FSJF 2694, 101 mm SL; Jordan: spring at Ghor al Hadithah.
Fig. 7. Garra ghorensis, FSJF 2670, 62 mm SL; Jordan:
stream below Afra hot spring.
Hamidan et al.: Garra jordanica

Ichthyol. Explor. Freshwaters, Vol. 25, No. 3
231
Copyright © Verlag Dr. Friedrich Pfeil
small, or almost no tubercles. Individuals with
well-developed snout ornamentation also have
long pectoral and pelvic fins; these individuals
have been identified as males by the examination
of the gonads. The fields of tubercles reach to the
anterior eye margin in G. jordanica, but in G. ghor-
ensis, there is also a field of tubercles behind the
upper posterior eye margin (Fig. 7). There is a
single tubercle, or a field of tubercles behind the
eye in G. ghorensis, which is absent in G. jordanica
or in any of the other species discussed below.
Furthermore, the rostral and maxillary barbels
are shorter in G. jordanica compared to G. ghoren-
sis (rostral barbel length 13-19 % HL vs. 19-22,
maxillary barbel length 10-16 % HL vs. 16-22).
Garra jordanica was previously identified as
G. rufa (Krupp, 1985; Krupp & Schneider, 1989;
Goren & Ortal, 1999), but the two species show
differences in several details. In our molecular
dataset, fishes identified as G. rufa by Krupp (1985)
are grouped into three well-distinguished clusters.
We describe one of these groups as G. jordanica.
Originally, G. rufa was described as Discognathus
rufus by Heckel (1843) from Aleppo, which is
situated on the Qweik River. Unfortunately, we
were not able to collect fresh materials of G. rufa
from the Qweik, an endorheic basin with head-
waters in Turkey and ending south of Aleppo in
the desert. One of the authors (JF) visited Aleppo
and the Qweik basin in 2008, but there was no
water in the entire Syrian part of the catchment.
In Turkey, there are two very small streams, the
Sünnep, and the Balıksuyu, which belong to the
Qweik catchment. JF visited the Sünnep and
Dagli & Erdemli (2009) published about the
fishes of the Balıksuyu without record of G. rufa.
Furthermore, Davut Turan (pers. comm.) in-
formed us that he never found G. rufa in these
streams. Heckel (1843) described a second species
of Garra (G. obtusa) from the Qweik and the Tigris
at Mossul. Menon (1964) treated G. obtusa as a
subspecies of G. rufa, and identified the fishes of
the Euphrates and Tigris as G. r. obtusa and those
of the Qweik as G. r. rufa. Krupp (1985) synony-
mized G. obtusa with G. rufa. Both authors exam-
ined the types of G. rufa and G. obtusa in NMW.
The freshwater fishes of the Qweik have been
described by early authors as Heckel (1843). This
river is inhabited by a fish fauna mostly made up
of species also occurring in the Euphrates. But
there is one endemic species (Oxynoemacheilus
tigris) and two species (Pseudophoxinus zeregi,
Garra variabilis) that are shared with the Orontes,
which is adjacent to the Qweik in the west. While
G. rufa seems to be extirpated in the Qweik, it is
very likely that it still exists in the Euphrates or
in the Orontes. Until now it is unclear which
population can be identified as G. rufa.
Menon (1964: 206) distinguished G. r. rufa from
the Qweik, the Orontes and some other places in
Fig. 8. Garra rufa, FSJF 2999, 91 and 85 mm SL; Turkey: Merziman stream.

232 Copyright © Verlag Dr. Friedrich Pfeil
the Mediterraean basin from G. r. obtusa from
Mesopotamia by the position of the anal-fin origin,
which he found to be in a more anterior position
in G. r. rufa. Menon (1964: 206) measured this
character state as the ratio of the distance between
the pelvic-fin origin and the anal-fin origin in the
distance between the pelvic-fin origin and the
caudal-fin origin (in front of middle in G. r. rufa
vs. equidistant in G. r. obtusa). We calculated this
ratio in our material from the Orontes and the
Euphrates but found no difference. Fishes of both
rivers have an almost equal ratio (Orontes: 0.8-1.2;
Euphrates and Tigris: 0.9-1.0). Arthur Pichler
(NMW) measured the syntypes of Disco gnathus
rufus and D. obtusus from Aleppo for this study.
The ratio between the above mentioned measure-
ments in these types is largely within the range
of the two other populations (Qweik: 0.7-1.0) and
there is also no difference between the types of
D. rufus (NMW 53240: 0.9-1.0) and the types of
D. obtusus (NMW 53238: 0.7-1.0). Menon (1964:
206, Graph 1) presented the position of the anal-
fin origin by another measurement. He calcu-
lated the distance between the the anal-fin origin
and the anus in % of the distance between the
pelvic- and anal-fin origins. We also measured
these distances and the fishes from the Orontes
can be well distinguished from those from the
Euphrates and Tigris (18-25 % vs. 26-32). The
measurements of the syntypes of D. rufus and
D. obtusus from Aleppo fall within the range of
the fishes from the Euphrates and Tigris (26-36).
These measurements make it likely that the
fishes from the Qweik are conspecific with those
from the Euphrates and Tigris and that these
should be identified as G. rufa.
Nina Bogutskaya and Alexander Naseka (ZIN)
examined the syntypes of Discognathus rufus and
D. obtusus at NMW for us. The eight syntypes of
D. rufus from Aleppo (NMW 53240) have 4 (2),
5 (5) and 6 (1) scales between the posteriormost
pelvic-fin base and the anus. Two syntypes of
D. obtusus from Aleppo (NMW 53238) have both 5,
and six syntypes of D. obtusus from Mosul (NMW
53257) have 5 (4) and 6 (2) scales between the
posteriormost pelvic-fin base and the anus. The
range of scales between the posteriormost pelvic-
fin base and the anus in these syntypes is 4-6 with
a mode of 5. The 40 individuals of Garra from the
Orontes that we examined have 5 (9), 6 (25) and
7 (6) scales between the posteriormost pelvic-fin
base and the anus (vs. 4 (9), 5 (26), 6 (5) in indi-
viduals from the Euphrates and Tigris). While
there is a considerable overlap between both
counts, it is likely that the fishes from the Euphra-
tes and Tigris could be identified as G. rufa.
Furthermore, the snout in the syntypes ex-
amined is blunt (vs. pointed in fishes from the
Orontes). In our molecular dataset, G. rufa (from
the Euphrates and Tigris) and G. rufa from the
Orontes are separated by 2.7 % K2P distance in the
studied COI gene region and they might represent
two different species; this will be addressed in a
Fig. 9. Garra rufa, FSJF 3368, 102 mm SL; Iraq: Nalparez
River.
Hamidan et al.: Garra jordanica

Ichthyol. Explor. Freshwaters, Vol. 25, No. 3
233
Copyright © Verlag Dr. Friedrich Pfeil
later study. For the purpose of this study, we re-
strict G. rufa to the Euphrates and Tigris drainage
and some adjacent rivers in the Persian/Arabian
Gulf basin in Iran. We found no morphological
differences between G. rufa from the Euphrates
and from the Tigris and therefore treat them as
a single species. The final identity of these has no
influence on the results discussed here since both
are well separated from G. jordanica.
Krupp (1985) distinguished G. jordanica (as
G. rufa from the Jordan drainage) from G. rufa by
the number of gill rakers on the lower part of the
first gill arch (12-17 in G. jordanica vs. 17-21 in
G. rufa). This result is confirmed by our study,
and in addition, G. jordanica and G. rufa are sepa-
rated by 5.5 % K2P distance in the studied COI
gene region. Besides, G. jordanica is distinguished
from G. rufa by details in the snout morphology.
In G. jordanica, the depressed rostral surface of
the snout has an anterior extension that is almost
reaching to the base of the anterior barbel and is
separated by a transverse groove from the trans-
verse lobe. This structure forms a clear and wide
gap between the fields of tubercles on the lateral
surface and those on the transverse lobe. The
anterior extension of the depressed rostral surface,
as well as the transverse groove between the
transverse lobe are poorly developed or lacking
in G. rufa and the lateral surface and the transverse
lobe form one continuous band of tubercles.
Furthermore, G. jordanica has 5-7, usually 6 scales,
between the posteriormost pelvic-fin base and
the anus (vs. 4-6, usually 5), and 4-7 rows of
deeply embedded scales on the breast between
the pectoral-fin bases (vs. completely naked or
with few isolated scales in G. rufa). Also, the eye
of G. jordanica is remarkably smaller than the eye
of G. rufa (diameter 14-19 % HL in individuals
larger than 56 mm SL vs. 19-25), the head is
elongated (vs. obtuse), and the snout pointed in
G. jordanica (vs. blunt). Furthermore, in G. jor-
danica, the head is conical and when seen from
above, the widest point of the head is at the eyes
while in G. rufa, the head is trapezoid and the
widest point are the cheeks below the eye.
Garra jordanica is distinguished from Garra
variabilis by having two pairs of barbels (vs. one)
and from all other Garra species in the Mediter-
ranean basin (G. caudomaculata, G. culiciphaga,
G. festai, G. kemali, G. klattii, G. nana, G. sauvagei)
by having a well-developed mental adhesive disc
(vs. absent).
Discussion
The molecular data presented here clearly rejects
the hypothesis of Krupp (1982), that G. ghorensis
is related to G. tibanica, but support the hypoth-
esis of Goren & Ortal (1999) and Gorshkova et al.
(2011) that G. ghorensis is related to the other
Garra species from the Mediterranean and Per-
sian/Arabian Gulf basins, such as G. rufa, G. bar-
reimiae, G. widdowsoni and G. jordanica.
Krupp (1985) and Krupp & Schneider (1989)
already pointed to the high rate of endemic fresh-
water fishes in the Dead Sea and Jordan basin,
and postulated that the Jordan had been colonised
directly, or through the Damascus basin, by
fishes from the Euphrates. We have no doubt that
the population ancestral to G. ghorensis and G. jor-
danica has invaded the Dead Sea basin from the
Euphrates. This connection was already closed
during the Pliocene (Horowitz, 1979), which is in
good agreement with our finding since G. ghoren-
sis and G. jordanica are only distantly related to
G. rufa from the Euphrates. Krupp (1985) also
pointed that fishes might have reached the Oron-
tes from the Jordan through the Litani, which
flows in Lebanon, as the upper Litani has lost one
of its headwater streams to the Orontes (Vaumas,
1957). Krupp (1985) gave one record of G. rufa for
the Litani, we assume that this is erroneous. The
species was not found in this river despite inten-
sive field work in recent years, and is believed to
have never occurred in the Litani (M. Bariche,
pers. comm.). Also our molecular data do not
suggest an invasion of G. jordanica to the Orontes.
Most likely the Orontes has been colonised by
Garra directly from the Euphrates at a later stage
than the colonization of the Jordan from the Eu-
phrates.
Recently Zheng et al. (2012) postulated that the
mental disc in labeonine cyprinids has evolved,
and also been reduced independently in several
lineages. This view gains additional support by
checking the position of the respective character
states in the phylogenetic tree reconstructions
presented by Geiger et al. (2014) and Yang et
al. (2012). All species found to be nested within
Garra in Zheng et al. (2012), Geiger et al. (2014)
and Yang et al. (2012), but lacking a mental disc,
had been described in different genera because
the presence of the mental disc was considered as
diagnostic for the genus Garra (Menon, 1964). This
is also the case of all the species previously placed

234 Copyright © Verlag Dr. Friedrich Pfeil
in the genus Hemigrammocapoeta. The position of
the respective character states in the phylogenetic
tree reconstructions presented by Geiger et al.
(2014) suggests, that Hemigrammocapoeta is not
monophyletic but all species are nested within
Garra. We speculate that the mental disc had been
reduced in these fishes and follow Geiger et al.
(2014), who placed them into Garra.
Comparative material. Garra ghorensis: FSJF 2670, 20,
34-73 mm SL; Jordan: stream below Afra hot spring,
30°57'56" N 35°40'56" E. – FSJF 2694, 6, 65-101 mm SL;
Jordan: spring at Ghor al Hadithah, 31°17'47" N 35°32'
33" E.
Garra rufa: Qweik drainage: NMW 53240, lectotype
(101 mm SL) and 7 paralectotypes of D. rufus, 59-
101 mm SL; Syria: Aleppo; T. Kotschy, 1842. – NMW
53238, syntypes of D. obtusus, 2, 43-134 mm SL; Syria:
Aleppo; T. Kotschy, 1842. Euphrates and Tigris drain-
age: NMW 53257, 6 syntypes of D. obtusus, 31-104 mm
SL; Iraq: Mossul; T. Kotschy, 1842. – FSJF 2549, 8, 43-
82 mm SL; Turkey: Adıyaman prov.: stream Egri south
of Adıyaman, a tributary to Atatürk reservoir, 37°
44.500' N 38°20.108' E. – FSJF 2588, 5, 58-65 mm SL;
Turkey: Adıyaman prov.: steam Çakal, 13 km west of
Adıyaman, tributary to Atatürk reservoir, 37°43.342' N
38°09.920' E. – FSJF 2621, 2, 60-67 mm SL; Turkey:
Diyabakır prov.: Tigris south of Diyabakır, 37°53.230' N
40°13.788' E. – FSJF 2849, 7, 71-105 mm SL; Turkey:
Diyarbakır prov.: stream Ambar at road to Silvan, 25
km east of Diyarbakır, 37.9902° N 40.3824° E. – FSJF 2864,
3, 98-129 mm SL; Turkey: Batman prov.: Tigris 5 km
west of Hasankeyf, 37.7238° N 41.3605° E. – FSJF 2909,
1, 91 mm SL; Turkey: Sivas prov.: stream Kangal under
railway bridge at Çetinkaya, 39.2516° N 37.6189° E. –
FSJF 2955, 1, 62 mm SL; Turkey: Diyarbakır prov.: stream
Savur between Bayındır and Ahmetli east of Tepe,
37.7637° N 40.8839° E. – FSJF 2999, 5, 60-94 mm SL;
Turkey: Gaziantep prov.: stream Merziman south of
Yavuzeli, 37.2924° N 37.7231° E. – FSJF 3371, 2, 92-
100 mm SL; Iraq: stream Suraw near Suraw village, 35°
45.76' N 45°59.09' E. – FSJF 3368, 18, 52-103 mm SL; Iraq:
Nalparez River, 35°34.24' N 45°51.78' E.
Garra sp.: Orontes drainage: FSJF 2302, 10, 38-
78 mm SL; Turkey: Hatay prov: stream Büyük Karaçay
at Karaçay, 36°08.127' N 36°02.533' E. – FSJF 2335, 18,
31-83 mm SL; Turkey: Gaziantep prov.: stream Karasu
below Tahtaköprü dam, 36°51.119' N 36°41.165' E. – FSJF
2414, 2, 55-117 mm SL; Turkey: Hatay prov.: Orontes
at Sinanlı, 36°05.846' N 36°04.712' E. – FSJF 2415, 11,
41-83 mm SL; Turkey: Hatay prov.: stream Yıldırım at
Serinyol, 36°21.971' N 36°10.868' E. – FSJF 2449, 3, 71-
90 mm SL; Turkey: Hatay prov.: stream Karasu at
Kumlu, 36°27.916' N 36°22.816' E. – FSJF 2663, 5, 56-
94 mm SL; Syria: spring south of Qala’at al Jarras,
35°19'49" N 36°18'38" E. – FSJF 2667, 10, 61-103 mm SL;
Syria: Lake Shadha, 35°31'31" N 36°15'13" E. – FSJF 2671,
7, 31-102 mm SL; Syria: Orontes north of Ain al Zarqa,
35°56'40" N 36°24'09" E. – FSJF 2684, 5, 59-74 mm SL;
Syria: Orontes at Mashr’a al Bouz, 35°57'03" N 36°
23'45" E. – FSJF 2695, 18, 58-106 mm SL; Syria: Orontes
at Jinan, 35°04'35" N 36°50'35" E. – FSJF 2699, 4, 104-
117 mm SL; Syria: Lake Qattinah south east of Homs,
34°39'43" N 36°37'06" E.
Garra variabilis: FSJF 2737, 13, 67-105 mm SL;
Syria: Nahr al Barid at Nahr al Barid, 35°18'08" N 36°
20'43" E.
Material used in the molecular genetic analysis: Garra
barreimiae: FSJF DNA-2488; UAE: Wadi Shawkah, in
Emirate of Ras Al-Khaimah, 25°05'54" N 56°06'33" E
(GenBank accession numbers: KM214685, KM214738 ,
KM214758 , KM214779). – FSJF DNA-2489; UAE: Wadi
Wurayah in Emirate of Al-Fujaira, 25°23'54" N 56°16'10" E
(GenBank accession numbers: KM214734, KM214767 ,
KM214783).
Garra buettikerii: FSJF DNA-2490; Saudi Arabia:
Wadi Turabah, south east of Al-Taif city, 20°35'21" N
41°17'20" E (GenBank accession number: KM214742).
– FSJF DNA-2491; Saudi Arabia: Wadi Turabah, south
east of Al-Taif city, 20°32'25" N 41°17'10" E (GenBank
accession numbers: KM214704, KM214723). – FSJF
DNA-2492; Saudi Arabia: Wadi Buwah, south east of
Al-Taif city, 20°45'44" N 41°13'53" E (GenBank accession
number: KM214729).
Garra caudomaculata: FSJF DNA-1143; Syria: Orontes
at Mashr’a al Bouz, 35°57'03" N 36°23'45" E (GenBank
accession number: KJ553341).
Garra cf. longipinnis: FSJF DNA-2493; Oman: Al-Saiq
Platue at Jabal al Akhdar, 23°02'00" N 57°28'00" E (Gen-
Bank accession numbers: KM214752, KM214756).
Garra culiciphaga: FSJF DNA-400; Turkey: Seyhan
River below water regulation doors at Yüreyir, south
of Adana, 36°58.541' N 35°20.125' E (GenBank accession
numbers: KJ553522, KJ553573, KJ553581).
Garra dunserei: FSJF DNA-2494; Oman: Tawi Atair
(sink hole) at Jabal Qara mountain, 17°06'47" N 54°
33'37" E (GenBank accession numbers: KP069475-
KP069477).
Garra festai: FSJF DNA-2153; Lebanon: Spring canal
at western margin of Ammik marshes north of Ammik,
33°43'57" N 35°47'04" E (GenBank accession numbers:
KJ553308, KJ553509 , KJ553354).
Garra ghorensis: FSJF DNA-1193; Jordan: Spring at
Ghor al Hadithah, 31°17'47" N 35°32'33" E (GenBank
accession numbers: KJ553478, KJ553508, KJ553520). –
FSJF DNA-1225; Jordan: stream below Afra hot spring,
30°57'56" N 35°40'56" E (GenBank accession number:
KJ553401). – FSJF DNA-2495; Jordan: Wadi Burbaita at
the upper part of Wadi Al-Hassa, 30°59'01" N 35°40'11" E
(GenBank accession numbers: KM214688, KM214728,
KM214788). – FSJF DNA-2496; Jordan: Wadi Fifa in
Southern Ghor, 30°55'52" N 35° 28'52" E (GenBank ac-
cession number: KM214722). – FSJF DNA-2497; Jordan:
Wadi Ibn-Hammad in Al-Karak Provience, 31°18'05" N
35°37'47" E (GenBank accession number: KM214798).
Garra jordanica: FSJF DNA-1186; Jordan: Spring in
Hamidan et al.: Garra jordanica

Ichthyol. Explor. Freshwaters, Vol. 25, No. 3
235
Copyright © Verlag Dr. Friedrich Pfeil
Suweyma, 31°46'14" N 35°36'10" E (GenBank accession
numbers: KM214710, KM214750). – FSJF DNA-1206;
Syria: River Yarmuk at in Wadi Jallayn, 32°44'21" N
35°58'56" E (GenBank accession number: KJ553525). –
FSJF DNA-2498; Jordan: lower most Mujib River,
31°27'22" N 35°35'08" E (GenBank accession numbers:
KM214697, KM214703, KM214753, KM214806).
Garra kemali: FSJF DNA-1076; Turkey: Lake Meyil
between Yenikent and Esentepe, an isolated lake south
of Lake Tuz and north-east of Karapınar, 37°59.17' N
33°21' E (GenBank accession numbers: KJ553337,
KJ553597).
Garra klatti: FSJF DNA-1074; Turkey: Stream west
of Kızıllı northwest of Dinar, 38°07.37' N 30°05.72' E
(GenBank accession number: KJ553545). – FSJF DNA-
1104; Turkey: Stream Aksu at Bagıllı, 37°45.82' N
31°02.01' E (GenBank accession number: KJ553379).
Garra nana: FSJF DNA-1182; Syria: Spring Al Faw-
war, 33°17'37" N 35°55'29" E (GenBank accession num-
bers: KJ553487, KJ553389).
Garra rufa: FSJF DNA-2414; Turkey: Balıklı kaplıca
10 km northeast of Kangal, 39°18'49.07" N 37°28'10.06" E
(GenBank accession numbers: KM214792-KM214794).
– FSJF DNA-923; Turkey: stream Çakal, 13 km west of
Adıyaman, tributary to Atatürk reservoir, 37°43.34' N
38°09.92' E (GenBank accession numbers: KM214692,
KM214695, KM214800). – FSJF DNA-2234; Iraq: Tabin
river south of Zarbi, 35°48.32' N 45°01.20' E. – FSJF DNA-
2480; Iraq: Shatt al-Arab at Basrah, 30°32'22" N 47°49" E
(GenBank accession number: KM214777). – FSJF DNA-
918; Turkey: River Tigris south of Diyabakır, 37°53.23' N
40°13.79' E (GenBank accession number: KM214684).
Garra sahilia: FSJF DNA-2499; Saudi Arabia: Wadi Al-
Bagarah in Asir area, 18°46'33" N 41°59'15" E (GenBank
accession numbers: KM214718, KM214724 , KM214799).
– FSJF DNA-2500; Saudi Arabia: Ein Al-Hammah in
Khaibar city, 25°44'50" N 39°15'37" E (GenBank accession
numbers: KM214774, KM214786). – FSJF DNA-2501;
Yemen: Sanaa (GenBank accession numbers: KM214689,
KM214707).
Garra sauvagei: FSJF DNA-1187: Syria: Canal drain-
ing from spring at Al Asha’ari, 32°44'20" N 36°00'33" E
(GenBank accession number: KJ553531).
Garra smarti: FSJF DNA-2502; Oman: Wadi Hasik
2 km west of Hasik village, 17°26'05" N 55°13'40" E
(GenBank accession numbers: KM214699, KM214732,
KM214744).
Garra sp.: FSJF DNA-1140; Syria: Orontes at Mashr’a
al Bouz, 35°57'03" N 36°23'45" E (GenBank accession
numbers: KJ553321, KM214681, KM214743). – FSJF
DNA-331; Turkey: Karasu River below Tahtaköprü
dam, 36°51.119' N 36°41.165' E (GenBank accession
numbers: KJ553315, KJ553323, KJ553616).
Garra tibanica: FSJF DNA-2503; Saudi Arabia: Wadi
Damad in Jizan, 25°44'50" N 39°15'37" E (GenBank ac-
cession numbers: KM214686, KM214749, KM214789).
Garra typhlops: FSJF DNA-2169; Iran: Well at Kaaje-
Ru, 33°04'39" N, 48°35'33" E (GenBank accession num-
bers: KM214717, KM214731).
Garra variabilis: FSJF DNA-1159; Syria: Nahr al
Barid at Nahr al Barid, 35°18'08" N 36°20'43" E (GenBank
accession numbers: KJ553391, KJ553567) – FSJF DNA-
1168; Syria: Orontes at Shayzar, 35°16'18" N 36°33'46" E
(GenBank accession numbers: KJ553422, KJ553524).
Garra widdowsoni: FSJF DNA-2301; Iraq: cavern 25
feet below ground, 6 miles north of Haditha, 34°04' N
42°24' E (GenBank accession numbers: KM214769,
KM214795).
Acknowledgments
We are pleased to thank Arthur Pichler (MNW), Nina
Bogutskaya and Alexander Naseka (ZIN) who examined
for us material in NMW, and E. Mikschi, L. Krucken-
hauser, H. Wellendorf and A. Palandacic (all NMW)
for allowing access to material. Many thanks to Davut
Turan (Rize) and Michel Bariche (Beirut) for unpub-
lished information, to Müfit Özulug (Istanbul), Nisreen
Alvan (Beirut), Florian Wicker (Frankfurt), Kai Borken-
hagen (Kiel), Hana A. Raza and Mariwan Qadir (Nature
Iraq, Sulaymaniyah) for help in the field, to Atheer Ali
(Basrah) for sending a fin clip of G. rufa from Iraq and
to Anas Sabbarini (Amman) for assistance in the labora-
tory. Many thanks to the Mujib nature reserve staff,
especially Owdeh Al-Ma’aqbeh, Amer Al-Oqbi and
Hisham Al-Dhaisat. We are indebt to the Arabia’s
Wildlife Centre in Sharjah and Johannes Els for speci-
mens from their collection. Fieldwork of NAH was only
possible due to the generous help of the Fujaira Mu-
nicipality especially Maral Al-Shurqi (UAE) and Mo-
hammed Shobrak from Taif University (Saudi Arabia).
Rajeev Raghavan (Cochin) read and helped improve
the English text. This study is a result of the FREDIE
project, supported by the Leibniz Association Joint
Initiative for Research and Innovation (SAW) and was
supported by the Royal Society for the Conservation of
Nature, Fujaira Municipality in UAE, and Taif Univer-
sity in Saudi Arabia.
Literature cited
Biomatters. 2013. Geneious Pro. Available: http://www.
geneious.com
Dagli, M. & A. U. Erdemli. 2009. An investigation on
the fish fauna of Balıksuyu stream (Kilis, Turkey).
International Journal of Natural and Engineering
Sciences, 3: 19-24.
Edgar, R. C. 2004. MUSCLE: multiple sequence align-
ment with high accuracy and high throughput.
Nucleic Acids Research, 32: 1792-1797.
El-Absy, A. & S. Mir. 1986. New localities for the cypri-
nid fish Garra tibanica ghorensis in Jordan. Zoology
in the Middle East, 1: 111-114.
Geiger, M. F., F. Herder, M. T. Monaghan, V. Almada,
R. Barbieri, M. Bariche, P. Berrebi, J. Bohlen, M.

236 Copyright © Verlag Dr. Friedrich Pfeil
Casal-Lopez, G. B. Delmastro, G. P. J. Denys, A.
Dettai, I. Doadrio, E. Kalogianni, H. Kärst, M. Kot-
telat, M. Kovacib, M. Laporte, M. Lorenzoni, Z.
Marcib, M. Özulug, A. Perdices, S. Perea, H. Persat,
S. Porcellotti, C. Puzzi, J. Robalo, R. Šanda, M.
Schneider, V. Šlechtová, M. Stoumboudi, S. Walter
& J. Freyhof. 2014. Spatial heterogeneity in the
Mediterranean Biodiversity Hotspot affects barcod-
ing accuracy of its freshwater fishes. Molecular
Ecology Resources, doi: 10.1111/1755-0998.12257.
Goren, M. & R. Ortal. 1999. Biogeography, diversity
and conservation of the inland water fish commu-
nities in Israel. Biological Conservation, 89: 1-9.
Gorshkova, G., S. Gorshkova, A. Abu-Ras & D. Golani.
2012. Karyotypes of Garra rufa and G. ghorensis
(Pisces, Cyprinidae) inhabiting the inland water
systems of the Jordan basin. Italian Journal of Zool-
ogy, 79: 1-4.
Hamidan, N. & S. Mir. 2003. The status of Garra ghoren-
sis in Jordan: distribution, ecology and threats.
Zoology in the Middle East 30: 49-55.
Hebert, P. D. N., A. Cywinska, S. L. Ball & J. R. de
Waard. 2003. Biological identifications through
DNA barcodes. Proceedings Biological Sciences B,
Biological Sciences, 270: 313-321.
Horowitz, A. 1979. The quarternary of Israel. Aca-
demic Press, New York, London, 394 pp.
Ivanova, N. V., T. S. Zemlak, R. H. Hanner & P. D. N.
Hebert. 2007. Universal primer cocktails for fish
DNA barcoding. Molecular Ecology Notes, 7: 544-
548.
Kottelat, M. & J. Freyhof. 2007. Handbook of European
freshwater fishes. Kottelat, Cornol and Freyhof,
Berlin, xiv + 646 pp.
Krupp, F. 1982. Garra tibanica ghorensis subsp. nov.
(Pisces: Cyprinidae), an African element in the
cypri nid fauna of the Levant. Hydrobiologia, 88:
319-324.
— 1985. Systematik und Zoogeographie der Süsswas-
serfische des levantinischen Grabenbruchsystems
und der Ostküste des Mittelmeers. Dissertation,
Johannes Gutenberg Universität, Mainz, 215 pp.
Krupp, F. & W. Schneider. 1989. The fishes oft he Jordan
river drainage basin and Azraq oasis. Fauna of
Saudi Arabia, 10: 347-416.
Meier, R., K. Shiyang, G. Vaidya & P. K. L. Ng. 2006.
DNA barcoding and taxonomy in Diptera: a tale of
high intraspecific variability and low identification
success. Systematic Biology, 55: 715-728.
Menon, A. G. K. 1964. Monograph of the cyprinid
fishes of the genus Garra Hamilton. Memoirs of the
Indian Museum, 14: 173-260.
Nebeshwar, K. & W. Vishwanath. 2013. Three new spe-
cies of Garra (Pisces: Cyprinidae) from north-eastern
India and redescription of G. gotyla. Ichthyological
Exploration of Freshwaters, 24: 97-120.
Posada, D. & K. A. Crandall. 1998. MODELTEST: test-
ing the model of DNA substitution. Bioinformatics,
14: 817-818.
Saitou, N. & M. Nei. 1987. The Neighbor-Joining
Method – a new method for reconstructing phylo-
genetic trees. Molecular Biology and Evolution, 4:
406-425.
Srivathsan, A. & R. Meier. 2012. On the inappropriate
use of Kimura-2-parameter (K2P) divergences in
the DNA-barcoding literature. Cladistics, 28: 190-
194.
Stiassny, M. L. J. & A. Getahun. 2007. An overview of
labeonin relationships and the phylogenetic place-
ment of the Afro-Asian genus Garra Hamilton, 1822
(Teleostei: Cyprinidae), with the description of five
new species of Garra from Ethiopia, and a key to
all African species. Zoological Journal of the Lin-
nean Society, 150: 41-83.
Swofford, D. L. 2002. PAUP*. Phylogenetic Analysis
Using Parsimony (*and Other Methods). Version 4.
Sinauer Associates, Sunderland.
Tamura, K., D. Peterson, N. Peterson, G. Stecher, M.
Nei & S. Kumar. 2011. MEGA5: Molecular Evolu-
tionary Genetics Analysis using maximum likeli-
hood, evolutionary distance, and maximum parsi-
mony methods. Molecular Biology and Evolution,
28: 2731-2739.
Vaumas, E. de 1957. Plateaux, plaines et dépressions de
la Syrie intérieure septentrionale du parallèle d’Alep
au parallèle de Homs; étude morphologique. Bul-
letin de la Société de Géographie d’Egypte, 30:
97-235.
Yang, L., M. Arunachalam, T. Sado, B. A. Levin, A. S.
Golubtsov, J. Freyhof, J. P. Friel, W.-J. Chen, M. V.
Hirt, R. Manickam, M. K. Agnew, A. M. Simons, K.
Saitoh, M. Miya, R. L. Mayden, & S. He. 2012. Mo-
lecular phylogeny of the cyprinid tribe Labeonini
(Teleostei: Cypriniformes). Molecular Phylogenetics
and Evolution, 65: 362-379.
Zheng, L.-P., J.-X. Yang & X.-Y. Chen. 2012. Phylogeny
of the Labeoninae (Teleostei, Cypriniformes) based
on nuclear DNA sequences and implications on
character evolution and biogeography. Current
Zoology, 58: 837-850.
Received 10 June 2014
Revised 8 November 2014
Accepted 9 November 2014
Hamidan et al.: Garra jordanica