ArticlePDF Available

STAT2/IRF9 directs a prolonged ISGF3-like transcriptional response and antiviral activity in the absence of STAT1

Authors:

Abstract and Figures

Evidence is accumulating for the existence of a STAT2/IRF9-dependent, STAT1-independent IFNα signaling pathway. However, no detailed insight exists in the genome-wide transcriptional regulation and the biological implications of STAT2/IRF9 dependent IFNα signaling as compared to ISGF3. In hST2-U3C and mST2-MS1KO cells we observed that the IFNα-induced expression of OAS2 and Ifit1 correlated with the kinetics of STAT2 phosphorylation, and the presence of a STAT2/IRF9 complex requiring STAT2 phosphorylation and the STAT2 transactivation domain. Subsequent microarray analysis of IFNα treated WT and STAT1 KO cells over-expressing STAT2 extended our observations and identified around 120 known antiviral ISRE-containing ISGs commonly up-regulated by STAT2/IRF9 and ISGF3. The STAT2/IRF9 directed expression profile of these ISGs was prolonged as compared to the early and transient response mediated by ISGF3. In addition, we identified a group of "STAT2/IRF9-specific" ISGs, whose response to IFNα was ISGF3-independent. Finally, STAT2/IRF9 was able to trigger an antiviral response upon EMCV and VSV. Our results further prove that IFNα-activated STAT2/IRF9 induces a prolonged ISGF3-like transcriptome and generates an antiviral response in the absence of STAT1.Moreover, the existence of "STAT2/IRF9-specific" target genes predicts a novel role of STAT2 in IFNα signaling.
Content may be subject to copyright.
STAT2/IRF9 directs an ISGF3-like response without STAT1
1
STAT2/IRF9 directs a prolonged ISGF3-like transcriptional response and antiviral activity in the
absence of STAT1**
Katarzyna Blaszczyk*1, Adam Olejnik*1, Hanna Nowicka*, Lilla Ozgyin±, Yi-Ling Chen, Stefan
Chmielewski*, Kaja Kostyrko*, Joanna Wesoly, Balint Laszlo Balint±, Chien-Kuo Lee and
Hans A.R. Bluyssen
* Department of Human Molecular Genetics and Laboratory of High Throughput Technologies,
Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz
University,Poznan, Poland,
Graduate Institute of Immunology, National Taiwan University College of Medicine, Taipei, Taiwan
±University of Debrecen/ Medical Faculty, Department of Biochemistry and Molecular Biology
Centre for Clinical Genomics and Personalized Medicine, Debrecen, Hungary
1 These authors contributed equally
§Corresponding author: h.bluyss@amu.edu.pl
**Page heading title: STAT2/IRF9 directs an ISGF3-like transcriptome without STAT1
Keywords: STAT transcription factor, cytokines/interferon, signal transduction, host-pathogen
interactions, microarray, alternative interferon response pathway.
Abbreviations: IFN- interferon; STAT-signal transducer and activator of transcription; IRF-interferon
regulatory factor; 2fTGH-human sarcoma cells; U3C- STAT1 deficient human sarcoma cells; hST2-
U3C- U3C stably overexpressing human STAT2; IRF9-U3C- U3C stably overexpressing human
IRF9; Migr1-U3C- U3C stably overexpressing Migr1; MEF-murine embryonic fibroblast cells;
MS1KO- STAT1 deficient murine embryonic fibroblast cells; mSTAT2-MS1KO- MS1KO stably
overexpressing mouse STAT2; ΔmSTAT2-MS1KO- MS1KO stably overexpressing mouse
ΔmSTAT2; Migr1-MS1KO- MS1KO stably overexpressing Migr1; ISGF3- Interferon-stimulated
gene factor 3; ISRE- IFN-stimulated response element;GAS- Interferon-Gamma Activated Sequence;
;;;VSV- Vesicular stomatitis Indiana virus; EMCV- Encephalomyocarditisvirus; MOI- multiplicity of
infection; NLS- nuclear localization signal; OAS2-2'-5'-Oligoadenylate Synthase 2; Ifit1- Interferon-
Induced Protein With Tetratricopeptide Repeats 1; ISG15- ISG15 Ubiquitin-Like Modifier; MX1-
Myxovirus (Influenza Virus) Resistance 1, Interferon-Inducible Protein; Rsad2- Radical S-Adenosyl
Methionine Domain Containing 2, IFI27- Interferon, Alpha-Inducible Protein 27; HERC5- HECT And
RLD Domain Containing E3 Ubiquitin Protein Ligase 5; Ddx60- DEAD (Asp-Glu-Ala-Asp) Box
Polypeptide 60; PKR- Protein Kinase, Interferon-Inducible Double Stranded RNA Dependent
Activator; CCL8- Chemokine (C-C Motif) Ligand 8; CX3CL1- Chemokine (C-X3-C Motif) Ligand 1;
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
2
ABSTRACT
Evidence is accumulating for the existence of a STAT2/IRF9-dependent, STAT1-
independent IFNα signaling pathway. However, no detailed insight exists in the genome-wide
transcriptional regulation and the biological implications of STAT2/IRF9 dependent IFNα
signaling as compared to ISGF3. In hST2-U3C and mST2-MS1KO cells we observed that the
IFNα-induced expression of OAS2 and Ifit1 correlated with the kinetics of STAT2
phosphorylation, and the presence of a STAT2/IRF9 complex requiring STAT2 phosphorylation
and the STAT2 transactivation domain. Subsequent microarray analysis of IFNα treated WT
and STAT1 KO cells over-expressing STAT2 extended our observations and identified around
120 known antiviral ISRE-containing ISGs commonly up-regulated by STAT2/IRF9 and ISGF3.
The STAT2/IRF9 directed expression profile of these ISGs was prolonged as compared to the
early and transient response mediated by ISGF3. In addition, we identified a group of
“STAT2/IRF9-specific” ISGs, whose response to IFNα was ISGF3-independent. Finally,
STAT2/IRF9 was able to trigger an antiviral response upon EMCV and VSV. Our results
further prove that IFNα-activated STAT2/IRF9 induces a prolonged ISGF3-like transcriptome
and generates an antiviral response in the absence of STAT1. Moreover, the existence of
“STAT2/IRF9-specific” target genes predicts a novel role of STAT2 in IFNα signaling.
INTRODUCTION
Interferons (IFNs) are a subset of cytokines that mediate cellular homeostatic responses to
virus infection. IFNs represent a family of molecules which can be divided into three main sub
families: Type I, Type II and Type III [1] [2]. Type I IFNs predominantly consist of IFNα and IFNβ
subtypes, Type II of the single IFN type, while Type III comprises of IFNλ1, IFNλ2 and IFNλ3 [3].
All IFN types induce IFN stimulated gene (ISG) expression by phosphorylating STAT1 and STAT2,
members of the signal transducer and activator of transcription (STAT) family, mediated by Janus
kinases (JAKs). STAT1 homodimers facilitate transcriptional responses to all types of IFN by directly
activating genes containing the IFNγ activated site (GAS) DNA element [4]. Responses to type I and
type III IFN also depend on STAT2 and the DNA-binding protein interferon regulatory factor (IRF)9.
They form a heterotrimeric transcription complex with STAT1 termed ISGF3 that binds to the
interferon-stimulated response element (ISRE) in ISG promoters [5] [2] [6]. In ISGF3, STAT2
contributes a potent transactivation domain but is unable to directly contact DNA, while STAT1
stabilizes the complex by providing additional DNA contacts [7].
As a component of ISGF3 it is clear that STAT2 plays an essential role in the transcriptional
responses to IFN with a strong dependence on STAT1. Previously, we showed that STAT2 is also
capable of forming homodimers when phosphorylated in response to IFNα [7]. These STAT2
homodimers were shown to interact with IRF9 and form the ISGF3-like complex STAT2/IRF9 that
activates transcription of ISRE containing genes in response to IFNα [7]. This provides evidence for
the existence of STAT1-independent IFNα signaling pathways. In agreement with this, Hahm et al
showed that viruses (like measles virus and lymphocytic choriomeningitis) evade the immune system
through a type I IFN-mediated STAT2-dependent, but STAT1-independent, mechanism [8].
Additionally, STAT2 dependency, but not STAT1, was shown of IRF7 expression during viral
infection [9]. On the contrary, IRF9 expression in response to IFNα required both STAT1 and STAT2.
Similarly, IFNα induction of the antiviral protein apolipoprotein B mRNA editing enzyme, catalytic
polypeptide-like 3G (A3G) and other ISGs (PKR, ISG15, and MX1) was STAT1 independent, but
STAT2 dependent in mouse liver cells. However, STAT1 signaling was functional and required for
IFNγ-induction of A3G in these cells [10]. As was suggested by the authors, a potential mechanism
responsible for IFNα-induction of A3G could involve STAT2/IRF9 containing complexes. In line with
this, chromatin immunoprecipitation analysis using primers specific to ISRE sites confirmed the
association of STAT2 with the promoter of antiviral genes induced in response to Dengue virus in
STAT1-deficient mice [11]. Lou et al. [12] [13] and Fink et al. provided additional important proof for
the biological significance of STAT2/IRF9 complexes in the transcriptional regulation of Retinoic
acid-induced gene G (RIG-G) and Dual Oxidase (DUOX(2), respectively. Lou et al. showed that the
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
3
STAT2/IRF9 complex effectively drives transcription of the RIG-G gene in NB4 cells upon signaling
cross-talk between retinoic acid and IFNα, in a STAT1-independent manner [12]. On the other hand, it
was shown that the late anti-viral gene DUOX2 was induced by an autocrine/ paracrine pathway
specifically triggered in airway epithelial cells by synergistic action of IFN and tumor necrosis factor
alpha (TNFα), and depending on STAT2/IRF9 but not on STAT1 [13]. Therefore, evidence continues
to accumulate that IFNα induction of ISGs and biological outcomes can occur in a STAT2/IRF9-
dependent, ISGF3-independent manner [14-16]. However, no detailed insight exists in the genome-
wide transcriptional regulation and the biological implications of STAT2/IRF9 dependent IFNα
signaling as compared to ISGF3.
Our results further prove that an IFNα-mediated, STAT2/IRF9 dependent signaling pathway
can induce a prolonged ISGF3-like transcriptional response and generate an antiviral response
analogous to ISGF3 in the absence of STAT1. Moreover, we provide evidence for the existence of
“STAT2/IRF9-specific” target genes, uncovering a novel role of STAT2 in IFNα signaling, and
providing further evidence that IFNα signaling can occur in a STAT2-dependent, STAT1-independent
manner.
EXPERIMENTAL PROCEDURES
Cell culture and reagents
Human fibrosarcoma 2fTGH [17] and STAT1-deficient U3C [18] cells were kind gifts from dr Sandra
Pellegrini (Institute Pasteur, Paris, France). U3A cells are the standard model for STAT1 null cells
[17], derived from a high-frequency mutagenesis screen. U3C cells were selected from the same
screen and belong to the same complementation group as U3A, designated U3 (S. Pellegrini, personal
communication). Murine embryonic fibroblasts (MEF) and STAT1 deficient murine embryonic
fibroblast (MS1KO) were described previously [19]. Stable cell lines U3C stably overexpressing
human STAT2 (hST2-U3C),U3C stably overexpressing Migr1 (Migr1-U3C) and U3C stably
overexpressing human IRF9 (IRF9-U3C) were established in our laboratory by co-transfecting (using
the calcium phosphate method [20] U3C cells with the pcDNA6/TR (blasticidin-resistance) plasmid
together with the hSTAT2-3xHA-Migr1, empty Migr1 or hIRF9-Migr1 plasmids respectively. After,
the cells were put on blasticidin (5ug/ml) (InvivoGen) selection medium specific clones were selected
based on GFP fluorescence (derived from Migr1 plasmid). MS1KO cells stably overexpressing mouse
STAT2 (mSTAT2-MS1KO) or mouse ΔmSTAT2 (ΔmSTAT2-MS1KO) or Migr1 (Migr1-MS1KO)
were established as follows: first the calcium phosphate method was used to transfect 293T cells with
mST2-Migr1 or ΔmSTAT2-Migr1 plasmids respectively together with GAG-POL and ENV vectors in
ratio 3:1:1. After 48h supernatant containing retrovirus was collected and used for transduction of
MS1KO cells as described before[21]. After an additional 24h cells were transfected with
pcDNA6/TR plasmid using TurboFect transfection reagent (Fermentas). Next, the cells were put on
blasticidin (4ug/ml) selection medium and GFP positive clones were chosen for further
characterization.
All the cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM, IITD PAN Wrocław)
supplemented with 10% fetal bovine serum - FBS (PAA Laboratories) and 1% L-Glutamine,
penicillin/streptomycin (PAA Laboratories).
The cells were stimulated with or without 200U/ml of recombinant IFNα (Millipore), human cells with
human IFNα – IF007 and mouse cells with mouse IFNα – IF009.
Plasmids and Transfection
Human STAT2-3xHA-Migr1, mouse STAT2-Migr1, human IRF9-Migr1 and mouse ΔmSTAT2-
3xHA-Migr1 plasmids were constructed in the following way: The full-length cDNA sequence of
IRF9 was cloned into the XhoI and EcoRI restriction sites of the MigR1 plasmid [22]. The STAT2 and
STAT2-ΔTAD coding sequences (2769bpand 2199bp, respectively) combined with the human
influenza virus hemagglutinin epitope (3xHA, 116bp) were sequentially cloned into the BglII and
EcoRI restriction sites of Migr1. The STAT2-Y690F plasmid was constructed using the Quick Change
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
4
site directed mutagenesis kit (Agilent). Human STAT2-3xHA-Migr1 plasmid was used as a template
and the following primers were designed to introduce the point mutation:
For_hSTAT2_Y690F:CAGGAACGGAGGAAATTCCTGAAACACAGGCTC;
Rev_hSTAT2_Y690F:GAGCCTGTGTTTCAGGAATTTCCTCCGTTCCTG.
Two transfection methods were used: calcium phosphate method was used as described before [20],
TurboFect transfection reagent was used according to the manufacture’s descriptions (Fermentas).
Immunoprecipitation and Western blotting
Total cell lysates were prepared by lysing cells in lysis buffer (300 mM NaCl, 50 mM HEPES [pH
7.6], 1.5 mM MgCl2, 10% glycerol, 1% Triton X-100, 10 mM NaPyrPO4, 20 mM NaF, 1 mM EGTA,
0.1 mM EDTA, 1 mM DTT, 1 mM PMSF, and 1 mM Na4VO3) at 4°C for 20 min. Lysates were
quantified by the BCA method (Thermo Scientific) and equal amounts of samples were resolved by
8% SDS-PAGE, followed by transfer to PVDF membrane (Santa Cruz) and Western analysis with
indicated antibodies. For immunoprecipitation of HA tagged human STAT2 total cell lysates were
subjected to overnight incubationwith 5μg of anti-HA antibody (05-904; Millipore) and 30μL of
protein G-Sepharose beads (BioVision). The immunoprecipitates were washed according to the
manufacturer's instructions and processed for Western blotting. To control for specificity, we
additionally performed IP with an unrelated antibody (IgG) (not shown).
Proteins were immunodetected using α-tubulin (04-1117; Millipore), phosphorylated STAT2
(pSTAT1) (07-224; Millipore), ISGF-3γ p48 (sc-10793; Santa Cruz), human total Stat2 (tSTAT2) (sc-
839; Santa Cruz), total Stat1 (tSTAT1) (sc-346; Santa Cruz), phosphorylated STAT1 (pSTAT1) (sc-
7988-R; Santa Cruz), mouse total Stat2 (tSTAT2) [23] diluted in TBS-T containing either 0.125%
non-fat milk or 1% BSA (BioShop). Next, the horseradish peroxidase (HRP)-conjugated goat anti-
rabbit IgG secondary antibody (12-348; Millipore) was applied and immunoreactive bands were
visualized by enhanced chemiluminescence using the Luminata Forte HRP Substrate (Millipore) and
detected with the G:Box System (Syngene).
Quantitative RT-PCR analysis
Total RNA was prepared using the GeneMATRIX purification Kit (EURx) following the
manufacture’s instruction. Total RNA (500ng) was subjected to reverse transcription and PCR
amplification was performed in Maxima SYBR Green/ROX qRT-PCR Master Mix (Fermentas) on the
Eco qRT-PCR System (Illumina). Sequences of oligonucleotides (Genomed) are available on request.
The amount of target gene in each sample was normalized to endogenous control ACT-β (ΔCT). Data
were transformed as described [24].
Microarray and data analysis
First, human 2fTGH and hST2-U3C and mouse MEF WT and mSTAT2-MS1KO cells were treated
with or without IFNα for different time points: oh, 4h, 8h, 24h. RNA from each sample was isolated
and labeled via the Illumina® TotalPrep™ RNA Amplification Kit (LifeTechnologies, CA). Standard
Illumina Expression BeadChip HumanHT-12v4 or MouseRef-8v2 (Illumina, SA) hybridization
protocols were used to obtain the raw data. Chips were scanned using the HiScanSQ system
(Illumina). The complete data of the Illumina Expresion BeadChip analysis is available at NCBI GEO,
with the accession number GSE50007. The average gene expression signals from 3 (for human cells)
or 2 (for the mouse cells) independent biological experiments were taken for statistical testing.
Background subtraction and quantile normalization were applied and genes, significantly (p-value
0.05) up-regulated at least 2-fold in any of the IFNα-treated samples, were selected for further
analysis. Statistically significant up-regulated genes in different cell-line data sets were compared by
Venn diagram analysis(http://bioinfogp.cnb.csic.es/tools/venny/index.html) [25]. Identification of
overlapping genes between human and mouse data sets was based on “Gene ID and name”. Cluster
analysis was performed using Genesis software
(http://genome.tugraz.at/genesisclient/genesisclient_description.shtml) [26]. For hierarchical clustering
the average linkage method was applied. Thus, induction ratio of common up-regulated genes between
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
5
human 2fTGH vs. hST2-U3C or mouse MEF WT vs. MST2-MS1KOwas log2 transformed and
subjected to cluster analysis. The automatic gene cluster assignment method was used to create gene
clusters. For the common up-regulated genes listed in table 2, promoter regions from -450 bp to +50
bp (in relation to the transcriptional start site) were searched for the presence of an ISRE sequence
according to the Transfac database (PSCAN software (http://www.beaconlab.it/pscan) [27].
Enrichment in gene ontology categories was performed using Gorilla software (http://cbl-
gorilla.cs.technion.ac.il/) [28]. P-value of 10-3 was used as a threshold and Illumina gene lists from
HumanHT-12 v4 or MouseRef-8 v2 were taken as a background model. Next, all the statistically
significant and enriched gene ontology categories were analyzed by Revigo software
(http://revigo.irb.hr/) [29]. To remove redundant GO terms the allowed similarity value of 0.5 was
used.
Chromatin immunoprecipitation (ChIP)
ChIP was performed as previously described [30] with minor modifications. Briefly, cells were
treated with IFNα for 0 and 24h, followed by crosslinking with DSG (Sigma) for 30 minutes and then
with formaldehyde (Sigma) for 10 minutes. After fixation chromatin was sonicated with a Diagenode
Bioraptor to generate 200-1000 bp fragments. Chromatin was immunoprecipitated with a pre-immune
IgG (Millipore, 12–371B) or a polyclonal antibody against STAT2 (Santa Cruz, sc-476X). Chromatin-
antibody complexes were precipitated with anti-IgA and anti-IgG paramagnetic beads (Life
Technologies). After 6 washing steps, complexes were eluted and the crosslinks reversed. DNA
fragments were column purified (Qiagen, MinElute). DNA was quantified with a Qubit fluorometer
(Invitrogen). Immunoprecipitated DNA was quantified by qPCR and normalized to values obtained
after amplification of unprecipitated (input) DNA. Sequences of oligonucleotides (Genomed) are
available on request.
Antiviral assay
Antiviral assay was performed as described before [21, 31] with modifications. 2fTGH, U3C, hST2-
U3C and Migr1-U3C cells were seeded onto 96-well plates at 7x103cells/well. Next day, cells were
pretreated with or without 2-fold serial dilutions of IFN-α, starting from 250 U/ml for 24 h.
Subsequently, EMCV or VSV virus at a multiplicity of infection (MOI) of 0.3 or 3 was added to the
cells using serum-free DMEM. 20h post-infection, the medium was removed and cells were fixed with
10% formaldehyde solution for 20 min at room temperature. After fixation, cells were visualized by
crystal violet staining. Excessive dye was removed by immersing the plate in water.
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
6
RESULTS
The abrogated IFNα response in STAT1 KO cells correlates with diminished STAT2
phosphorylation
First, we characterized IFNα responses of the human 2fTGH (WT) and U3C (STAT1 deficient) cell
lines, and the mouse MEF fibroblasts (MEF WT) and MS1KO cells. Both human and mouse wild type
cells were treated with IFNα for increasing time points, which resulted in a similar phosphorylation
pattern of STAT1 and STAT2. Phosphorylation of both proteins increased after 4h of treatment and
diminished to near basal levels after 8 and 24h (Figure 1A and 1B). Expression of STAT1 and STAT2
clearly increased in time in 2fTGH and MEF WT in response to IFNα. The expression of IRF9, on the
other hand, only increased in 2fTGH. The IFNα response in both U3C and MS1KO cells exhibited
diminished STAT2 phosphorylation, despite the normal expression of STAT2 and IRF9 proteins
(Figure 1A and 1B). STAT2 phosphorylation in IFNα-treated human U3C cells was not detectable
(Figure 1A), even after 1 and 2h of treatment (not shown). In mouse MS1KO cells diminished
phosphorylation of STAT2 could be detected with a more prolonged kinetics as compared to MEF WT
cells (Figure 1B). Expression of STAT2 and IRF9 did not increase in time in response to IFNα (Figure
1A and Figure 1B). However, the IFNα-induced expression of the classical ISGs human OAS2 and
mouse Ifit1 still slowly increased over time, but at a much lower level as compared to the wild type
cells (Figure 1C and 1D). Together these results show that the decrease of STAT2 phosphorylation
correlated with the diminution of OAS2 and Ifit1 gene expression, suggesting the involvement of
STAT2 in IFN-induction of the latter genes.
STAT1 KO cells over-expressing STAT2 recapitulate IFNα response
To study the role of STAT2 and IRF9 in the residual IFN-induced gene expression in the STAT1 KO
cells, we next generated human and mouse STAT1 KO cells overexpressing STAT2 (hST2-U3C and
mST2-MS1KO, respectively) or empty vector (Migr1-U3C and Migr1-MS1KO, respectively). IFNα
treatment of hST2-U3C and MST2-MS1KO for increasing time points resulted in high levels of
STAT2 phosphorylation, still being present after 24hr (Figure 2A and 1B). This correlated with the
increased expression of IRF9 in hST2-U3C, but not in MST2-MS1KO cells (Figure 2A and 1B).
Interestingly, under these conditions, the IFNα-induced expression of OAS2 (in hST2-U3C) and Ifit1
(in mST2-MS1KO) dramatically increased as compared to the control cells (Migr1-U3C and Migr1-
MS1KO, respectively) (Figure 2C and 1D), with a maximum expression after 24h of IFNα treatment.
In contrast to the WT cells (Figure 1A and 1B) the expression of these genes in the human and mouse
STAT1 KO cells overexpressing STAT2 was prolonged, which correlated with the continued presence
of phosphorylated STAT2. Interestingly, knocking down STAT1 expression in MEF WT, resulted in a
similar prolonged IFN-induced expression pattern for Ifit1 and Oas2 as compared to control cells
(data not shown). This implies that by increasing levels of STAT2 in STAT1 KO the IFN response
can be restored.
STAT2 and IRF9 interact and mediate an IFNα response in the absence of STAT1
To prove that a STAT2/IRF9-containing complex is responsible for the IFNα response in the STAT1
KO cells overexpressing STAT2 we performed additional experiments. First, by using protein extracts
from hST2-U3C cells treated with IFNα for increasing time points in combination with HA antibodies
to immunoprecipitate STAT2, we were able to observe specific STAT2-IRF9 complex formation even
after 24h of IFN treatment (Figure 3A; input control is shown in Figure 2A). Interestingly, the
STAT2/IRF9 complex could already be detected in the absence of IFNα treatment (lane 1, Figure 3A),
and was not affected by increased STAT2 phosphorylation. On the other hand, the phosphorylation
kinetics of STAT2 correlated with the prolonged expression pattern of OAS2 (Figure 2A and 1C). We
also checked the level of ISG expression in response to IFNα in two different clones of hST2-U3C
with varying STAT2 mRNA levels. In hST2-U3C the STAT2 mRNA level was 75 fold higher than in
Migr1-U3C control, whereas in hST2-U3Ca there was a 30 fold difference (Figure 3B). This
correlated with the difference in expression of OAS2 in these two cell lines in response to IFNα, being
9 fold higher in hST2-U3C (46 fold) as opposed to hST2-U3Ca (5 fold), when compared to untreated
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
7
cells (Figure 3B). In addition to mST2-MS1KO cells, we generated a MS1KO stable cell line
overexpressing a C-terminally truncated form of mSTAT2 (ΔmST2-MS1KO), which lacks the trans-
activation domain of STAT2 and acts as a dominant negative. As shown in Figure 3C, the levels of
STAT2 in mST2-MS1KO cells correlated with the high induction of mouse Ifit1. ΔmST2-MS1KO
facilitated no significant induction of the mouse Ifit1 gene in response to IFNα. Subsequently, we
investigated in more detail the role of IRF9 in the IFNα response in the absence of STAT1. We
generated a U3C cell line stably overexpressing IRF9 (IRF9-U3C). Interestingly, OAS2 expression
increased only 3 fold as compared to Migr1-U3C cells after 8h of IFNα treatment (Figure 3D).
However, hST2-U3C cells transiently transfected with IRF9 showed a 10 fold increase in OAS2 gene
expression in comparison to the hST2-U3C IFNα treated cells and a 57 fold increase in contrast to
Migr1-U3C cells (Figure 3E). Finally, we compared expression of IFIT2 and OAS2 in U3C cells
transiently transfected with STAT2 or the tyrosine mutant STAT2Y690F (mutant form of STAT2 that
cannot be phosphorylated on tyrosine). U3C-ST2 showed a 10 fold increase upon IFN treatment, while
U3C-ST2Y690F exhibited no response, implying that the STAT2/IRF9-mediated IFN-response is
dependent on STAT2 phosphorylation. Together, these results point to the importance of the
STAT2/IRF9 complex in the prolonged IFNα response in the absence of STAT1 and suggest an
ISGF3-like function.
STAT2/IRF9 and ISGF3 regulate expression of a common set of ISGs with different kinetics
To characterize IFNα-mediated transcriptional responses and identify the genes being regulated by
STAT2/IRF9 in relation to ISGF3 we performed microarray experiments comparing human and
mouse STAT1 KO cells overexpressing STAT2 with their wild type counterparts treated with IFNα
for 4, 8 and 24h. After quality check and data analysis we only focused on the up-regulated genes. By
comparing the expression profiles of hST2-U3C with 2fTGH, we identified 303 up-regulated genes in
hST2-U3C of which 117 were in common with 2fTGH (Figure 4A). Similarly, by comparing the
expression profiles of mST2-MS1KO with MEF-WT, we identified 295 up-regulated genes with 126
genes commonly induced between the two cell-lines (Figure 4B). To characterize these commonly up-
regulated genes in more detail, first we performed hierarchical cluster analysis (based on average
linkage clustering of ratio’s) comparing human 2fTGH vs. hST2-U3C and mouse MEF-WT vs. mST2-
MS1KO (Figure 5A and 5B, respectively). Strikingly, among the commonly induced genes in both
human and mouse cell lines many known ISGs could be recognized, including IFITs, IFIs, ISGs,
OASs, MX, Rsad2 and Herc5. In general, the induction level of these genes was lower in the
STAT1KO cells overexpressing STAT2 as opposed to wild type cells. The centroid view, representing
the average gene expression pattern in human (Figure 4C) and mouse cells (Figure 4D) unveiled a
prolonged profile in hST2-U3C and MST2-MS1KO cells in response to IFNα. In contrast, in the WT
cells this was early and transient. In order to validate the microarray data, qRT-PCR was performed
for a selection of these genes. Indeed, IFIT1, IFIT2, IFIT3, ISG15 and MX1 exhibited a prolonged
IFNα-induced expression profile in hST2-U3C as compared to the 2fTGH cells (not shown). The same
was true for the expression of Mx2, Ifit3, Isg15, Oas1b, and Rsad2 when compared in MST2-MS1KO
vs. MEF-WT (not shown). Collectively, our results reveal that STAT2/IRF9 and ISGF3 regulate
expression of a common set of ISGs, however with a different kinetics.
STAT2/IRF9 and ISGF3 mediated transcriptional responses predict functional overlap
Next, gene ontology (GO) enrichment was performed on the commonly up-regulated genes in human
and mouse WT and STAT1KO cells overexpressing STAT2 (Table 1). Interestingly, based on the
log10 p-value parameter the categories that were highly overrepresented in both species displayed its
main involvement in three groups: (1) “Response to virus” (white) including GO categories such as
defense response or regulation of viral reproduction; (2) “Response to stimulus” (light grey) including
response to cytokine or biotic stimulus categories and (3) “Multi-organism processes” (dark grey)
including response to stress and organic substance. We subsequently examined the top-20 commonly
up-regulated genes in 2fTGH vs. hST2-U3C derived from the “Response to the virus” category based
on the 24h expression profile of hST2-U3C. Indeed, these genes included well known ISGs with
antiviral functions such as IFIT1, IFIT2, IFIT3, IFI27, IFI44, IFI44L, OAS1, OAS2, OASL, ISG15,
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
8
MX1, RSAD2 (Table 2). Using Pscan we confirmed the presence of a classical ISRE in the promoter
of all of these genes (Table 2). BioMart from Ensemble successively allowed us to identify mouse
homologs for these 20 human genes. For 6 of these genes we found more than one mouse homolog,
including OASL and IFI27 (Table 2, indicated by **), while no mouse homolog was identified for
HERC5. Ifit27l1, Ifi44l, Ddx60 mouse gene probes were not present on the mouse beadchip array
(Table 2, indicated by *). On the other hand, the probe for mouse Ifit1 failed on the array (Table 2,
indicated by ***) although our q-PCR experiments showed comparable results to human IFIT1 (data
not shown). All the identified mouse homologs also contained a classical ISRE sequence in their
promoter, which correlated with a similar expression pattern as compared to their human equivalents
(Table 2). Performing chromatin-immunoprecipitation (ChIP)-qPCR on hST2-U3C treated with or
without IFN and using antibodies against STAT2 or IgG, clearly showed enhanced binding of
STAT2 to the ISRE of the IFI27, MX1, OAS2, IFIT1, IFIT3 and ISG15 genes, in an IFN-dependent
manner (Figure 6). Together with the cluster analysis this strongly implied functional overlap between
STAT2/IRF9 and ISGF3 in human and mouse cells, especially for the potential of generating an IFNα-
induced antiviral response.
STAT2/IRF9 regulates expression of ISRE-independent ISGs
Comparing the expression profiles of hST2-U3C with 2fTGH also identified 186 genes specifically
up-regulated in hST2-U3C cells (Figure 4A). Table 3 illustrates the top-10 of these genes, of which the
expression of CCL8 and CX3CL1 was confirmed by qRT-PCR in hST2-U3C and 2fTGH after IFNα
treatment (Figure 7). As shown in Figure 7A, the expression of CCL8 and CX3CL1 depended on both
STAT2 and IRF9, but was absent in WT cells. Indeed, their IFNα-induced expression correlated with
the STAT2 levels in hST2-U3C and hST2-U3Ca. Moreover, hST2-U3C cells transiently transfected
with IRF9 showed increased expression of CCL8 and CX3CL1 in comparison to the hST2-U3C in
response to IFNα (Figure 7B). Detailed promoter analysis of these genes did not identify a classical
ISRE motif, implying a different mode of regulation. This suggests that STAT2/IRF9 also regulates
expression of ISRE-independent ISGs.
STAT2/IRF9 mediates a similar antiviral response against EMCV and VSV virus as ISGF3
To provide further evidence for the functional overlap between STAT2/IRF9 and ISGF3 in the
antiviral response we performed a series of antiviral assays on 2fTGH, U3C, hST2-U3C and Migr1-
U3C cells (Figure 7). The cells where first pretreated with 2 fold serial dilutions of IFNα for 24h and
subsequently infected with either EMCV or VSV virus with MOI=0.3 (Figure 8A and 8B) or 3 (Figure
8C and 8D) for each virus. Indeed, we could observe a restored antiviral response in hST2-U3C cells,
as compared to 2fTGH, due to the overexpression of STAT2. U3C cells showed no antiviral protection
as well as the Migr1-U3C control cells even when treated with the lower virus concentration of
MOI=0.3. In conclusion, STAT2/IRF9 mediates a similar antiviral response against EMCV and VSV
virus as ISGF3.
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
9
DISCUSSION
Previously, we showed that STAT2 homodimers interact with IRF9 (STAT2/IRF9) to activate
transcription of ISRE containing ISGs in response to IFNα [7]. Indeed, evidence is accumulating for
the existence of a STAT1-independent IFNα signaling pathway, where STAT2/IRF9 can substitute the
role of ISGF3 [14-16]. Here, we provide further insight in the genome-wide transcriptional regulation
and the biological implications of STAT2/IRF9 dependent IFNα signaling as compared to ISGF3.
By comparing the timely IFNα response of human and mouse WT cells, we observed an early
and transient character that correlated with the phosphorylation kinetics of the ISGF3 components
STAT1 and STAT2 and the presence of IRF9 (Figure 1). The expression of the classical ISGs OAS2
and Ifit1 followed this pattern, confirming the transient ISGF3-dependent IFNα-response displayed in
many different cell types [6]. As expected, in STAT1 KO cells this ISGF3-dependent IFNα-response
was severely abrogated, highlighting the importance of STAT1 [32]. However, IFNα-induced STAT2
phosphorylation was also diminished in these cells, which associated with decreased but still
detectable expression levels of OAS2 and Ifit1.
Interestingly, increasing the levels of STAT2 in the human and mouse STAT1 KO cells
recapitulated the IFNα response. In contrast to the WT cells (Figure 1) the IFNα-induced expression of
OAS2 and IFIT1 in the human and mouse STAT1 KO cells overexpressing STAT2 was prolonged,
which correlated with the kinetics of STAT2 phosphorylation, and the presence of a STAT2/IRF9
complex requiring STAT2 phosphorylation and the STAT2 transactivation domain (Figure 2 and 3).
This response also depended on the levels of IRF9, as transient overexpression of IRF9 in hST2-U3C
cells further increased the response of OAS2 to IFNα (Figure 3). On the other hand, U3C cells
overexpressing IRF9 only weakly responded to IFNα, in agreement with the lack of intrinsic
transcriptional capacity of IRF9 [33] and limited amount of phosphorylated STAT2 in these cells after
treatment (not shown). A similar prolonged IFN-induced expression pattern for Ifit1 and Oas2 could
be detected after knocking down STAT1 expression in MEF WT (data not shown), suggesting that
activation of STAT2/IRF9-dependent transcription depends on the level of STAT1 in WT cells.
Our findings are in agreement with Lou et al., [12], who observed that the STAT2/IRF9 complex
effectively drives transcription of the RIG-G gene in U3A cells upon IFNα treatment, in a STAT1-
independent manner. U3A and U3C cells belong to the same complementation group of IFN and
IFN unresponsive mutants [17]. However, in U3A cells RIG-G expression required over-expression
of both STAT2 and IRF9 [12], while in our study in U3C cells over-expression of STAT2 was
sufficient. Lou et al. also showed IFN-independent interaction of STAT2 and IRF9, but
transcriptional regulation of RIG-G required STAT2 phosphorylation (not shown). Further comparison
of U3A and U3C learned that IFNα-induced STAT2 phosphorylation in U3A cells is also severely
diminished (although still visible) as compared to 2fTGH WT cells (not shown). However, IFNα-
induced expression of OAS2 is not detectable (not shown). IRF9 levels, on the other hand were lower
in U3A as compared to U3C (not shown), and only upregulated by IFN in U3C and not in U3A (not
shown). Together this implies that in the absence of STAT1, a certain threshold amount of STAT2 and
IRF9 must be reached to allow STAT2 phosphorylation and STAT2/IRF9 mediated transcription.
Subtle differences between U3C and U3A in these threshold levels could potentially explain for the
differences in their response to IFN. Our experiments in MS1KO fibroblasts, in which the presence
of IFN-induced STAT2 phosphorylation and IRF9 correlate with significant induction of ISG
transcription, are in agreement with this.
Likewise, Bowick et al. [34], showed a prolonged IFNα response of STAT1 KO mice to viral
infection, resulting in prolonged expression of classical ISGs. Perry et al. on the other hand, confirmed
the association of STAT2 with the promoter of antiviral genes induced in response to Dengue virus in
STAT1-deficient mice [11]. Similarly, Kraus et al. [33] and Poat et al. [35], observed that a hybrid of
IRF9-STAT2 recapitulates interferon-stimulated gene expression in the absence of STAT1. We extend
these observations by showing that abundance of phosphorylated STAT2 and IRF9 allows a
STAT2/IRF9 complex to regulate transcription of ISGs, resulting in a prolonged expression pattern, in
both human and mouse cells independent of STAT1.
Remarkably, the STAT2/IRF9 complex formed in the STAT1 KO cells overexpressing
STAT2 could already be detected in the absence of IFNα treatment (Figure 3), suggesting that the
interaction was independent of STAT2 phosphorylation. This could also suggest that STAT2
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
10
phosphorylation takes place while complexed with IRF9. Our results are in disagreement with the
model proposed by Tang et al.[36], in which STAT2-IRF9 complex formation depends on IFNa-
induced acetylation. However, this model is not compatible with the frequently made observations that
Histone deacytelase inhibitors (HDACi) block IFN signaling[37]. On the other hand, others have
shown that STAT2 and IRF9 interact independent of phosphorylation [12] and that nucleo-
cytoplasmic shuttling of STAT2 has been attributed to the constitutive binding of STAT2 to the NLS-
containing IRF9, independent of phosphorylation, to transport STAT2 into the nucleus [38]. In
agreement with Testoni et al. who used ChIP-chip with anti-STAT2 antibodies, a substantial
percentage of ISG promoters have shown to be occupied by un-phosphorylated STAT2 before IFNα
treatment [39]. On the other hand, IFNα treatment of hST2-U3C cells stimulated the interaction of
phosphorylated STAT2 with IRF9, even after 24h, which closely correlated with the prolonged
expression pattern of OAS2 (Figure 2 and 3). This was again in accordance with Testoni et al., who
observed that the majority of promoters that gained STAT2 in response to IFNα was positive for
phosphorylated STAT2 [39] and, therefore predicted that the STAT2/IRF9 complex functioned similar
to the classical ISGF3-directed pathway.
Subsequent microarray analysis of IFNα treated human and mouse WT and STAT1 KO cells
overexpressing STAT2 extended our initial observations and identified around 120 known ISRE-
containing ISGs commonly up-regulated by STAT2/IRF9 and ISGF3 (Figure 4A and 4B). The
STAT2/IRF9 directed expression profile of these ISGs was prolonged as compared to the early and
transient response mediated by ISGF3, implying that STAT2/IRF9 and ISGF3 regulate expression of a
common set of ISGs with different kinetics. In general, in WT cells the transient nature of the IFNα
response is tightly regulated by up-regulation of suppressor of cytokine signaling 1 (SOCS1) [40]. In
contrast, IFNα treatment of hST2-U3C and mSTAT2-MS1KO cells did not result in increased
expression of SOCS1 (data not show), which could explain the prolonged phosphorylation kinetics of
STAT2 and expression pattern of ISGs.
Among the commonly induced genes in both human and mouse cell lines were many known
ISGs (Figure 5) and functional analysis revealed significant enrichment in biological functions
categorized in “Response to virus” (defense response, regulation of viral reproduction), “Response to
stimulus” (response to cytokine or biotic stimulus) and “Multi-organism processes” (response to stress
and organic substance) (Table 1). Interestingly, the top-20 commonly up-regulated human genes from
the “Response to virus” category, with their mouse homologs, predominantly consisted of well
characterized ISG’s with known antiviral functions (Table 1). Within the promoter of all of these
genes we confirmed the presence of a classical ISGF3-binding ISRE. Indeed, ChIP-qPCR confirmed
binding of STAT2 to a selection of these genes, in an IFN-dependent manner in the absence of
STAT1 (Figure 6). This strongly implies functional overlap between STAT2/IRF9 and ISGF3 in
human and mouse cells, especially for the potential of generating an IFNα-induced antiviral response.
Indeed, Human ST2-U3C cells were able to trigger the antiviral response upon EMCV and VSV
infection, protecting better against VSV as compared to EMCV (Figure 7), offering additional proof
for the functional overlap between STAT2/IRF9 and ISGF3. Thus, STAT2/IRF9 not only activates
expression of known antiviral ISGs, but also has a biological function in the reconstitution of the
antiviral response in cells lacking STAT1. This is in agreement with findings of Kraus et al.[33] and
Poat et al. [35], who observed that expression of the IRF9-STAT2 fusion can recapitulate the type I
IFN biological response, producing a cellular antiviral state that protects cells from RNA and DNA
virus-induced cytopathic effects and inhibits virus replication.
Previously, Sarkis et al. [10], proposed a novel STAT1-independent IFNα signalling pathway
in human liver cells that depended on STAT2 and IRF9. IFNα induction of the antiviral protein A3G
and other ISGs (PKR, ISG15, and MX1) was STAT1 independent, but STAT2 dependent in these
cells. Similarly, Lou et al. [12], showed that the STAT2/IRF9 complex effectively drives transcription
of the RIG-G (IFIT-3) gene in NB4 cells upon signaling cross-talk between retinoic acid and IFNα, in
a STAT1-independent manner. Moreover, it was shown that the late anti-viral gene DUOX2 was
induced by an autocrine/paracrine pathway specifically triggered in airway epithelial cells by
synergistic action of IFNβ and TNFα, and depending on STAT2/IRF9 but entirely independent of
STAT1 [13]. Of these genes, IFIT3, PKR, ISG15, and MX1 were both regulated by STAT2/IRF9 and
ISGF3 in our human and mouse cell lines. However, A3G was only regulated by ISGF3 and not by
STAT2/IRF9. The expression of DUOX2 could not be detected in our WT and STAT2 overexpressing
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
11
STAT1 KO cells, in response to IFNα, which could point to a cell-type specific mechanism.
Interestingly, Cheon et al. [41] recently identified another alternative, unphosphorylated(U)-ISGF3-
mediated, IFN response pathway, which was shown to regulate a group of classical antiviral ISRE-
containing ISGs but to act independent of STAT phosphorylation. This is in contrast to our results, in
which un-phosphorylated STAT2 formed a complex with IRF9, but did not induce ISG expression in
human and mouse cell lines (Fig. 3B-E), while STAT2 mutation (Y690F) impaired the ability to
induce gene expression (Fig. 3F). Therefore, STAT/IRF9 directed gene expression is clearly
dependent on STAT2 phosphorylation.
The ISGF3 complex, consisting of STAT1-STAT2 heterodimers and IRF9, binds a composite
DNA sequence (AGTTTCNNTTTCN) in which IRF9 contributes most of the DNA binding specificity
by recognizing the core sequence of the ISRE [42]. STAT1 contributes necessary contacts with DNA
which raise the affinity of ISGF3 for DNA above a minimal threshold provided by IRF9 alone.
STAT2 contains a transactivation domain that is essential for transcriptional activity of ISGF3 [43]. In
the Stat2/IRF9 complex, STAT2 homodimers in conjunction with IRF9 recognize only a core ISRE
sequence, resulting in a lower DNA-binding affinity as compared to ISGF3[7]. The presence of
classical ISGF3-binding ISRE sequences, also bound by STAT2/IRF9, in the promoters of the
commonly induced ISGs in both human and mouse cell lines, thus could explain the functional overlap
of STAT2/IRF9 with ISGF3. The lower DNA-affinity of the STAT2/IRF9 complex as compared to
ISGF3, on the other hand, requires abundance of STAT2 and IRF9 protein and correlates with the
delayed and prolonged nature of its IFN-mediated activity. In addition, in the hST2-U3C cells we
identified a group of ISGs, including CCL8 and CX3CL1, whose response to IFNα was absent in
2fTHG cells (Table 3). Moreover, the IFNα-induced expressions of these genes depended on both
STAT2 and IRF9 and were therefore classified as “STAT2/IRF9-specific” (Figure 6). Detailed
promoter analysis of the top-10 “STAT2/IRF9-specific” genes did not identify a classical ISGF3-
binding ISRE, predicting that a DNA sequence distinct from the ISRE is involved in the regulation of
these “STAT2/IRF9-specific” genes. Future ChIP-seq experiments will hopefully reveal the identity of
this mechanism.
Collectively our results strongly suggest that the alternative IFNα-mediated, STAT2/IRF9
dependent signaling pathway can induce a prolonged ISGF3-like transcriptome and generate an
antiviral response analogous to ISGF3, independent of STAT1. Moreover, the existence of
“STAT2/IRF9-specific” target genes predicts a novel role of STAT2 in IFNα signaling. In analogy to
the previously identified role of STAT2/IRF9 in the delayed transcriptional regulation of the RIG-G
and DUOX2 genes, which correlated with prolonged STAT2 phosphorylation and STAT2 and IRF9
expression in a cell-type specific manner, we hypothesize that STAT2/IRF9 can co-exist together with
the classical ISGF3 complex only in cells with elevated levels of STAT2 and prolonged STAT2
phosphorylation. In contrast, in cell types with a transient STAT1 and STAT2 phosphorylation pattern,
like 2fTGH, ISGF3 is the pre-dominant mediator of IFN signaling. This situation is very likely to be
cell-type specific, where both complexes may be involved in different stages of the antiviral response;
ISGF3 stimulating a rapid and transient antiviral response whereas STAT2/IRF9 being responsible for
a more prolonged antiviral response. It also becomes clear that equal to phosphorylation, IFN
signaling is regulated by acetylation. In particular, inhibition of STAT1 (but not STAT2) by
acetylation has been observed in many systems[37] leading to termination of IFN signaling. Therefore,
the presence of acetylated STAT1 in the ISGF3 complex (which can be achieved by HDACi or IFN
pre-stimulation) seems incompatible with prolonged IFN-dependent transcription. As STAT1
acetylation does not affect STAT2, it could be that under certain conditions STAT2/IRF9 may allow
continuation of the IFN response and prolonged transcription. This could provide a level of
redundancy to certain cells to ensure effective induction of an antiviral state and help to overcome
countermeasures that many viruses have evolved against IFN-dependent signaling, for example
blocking STAT1 to impair the formation of ISGF3. Identifying these cell types and the role of
STAT2/IRF9 in the regulation of specific transcriptional programs and anti-viral activity, as compared
to ISGF3, is amongst our next challenge.
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
12
ACKNOWLEDGMENTS
We would like to acknowledge Ting-Ting Chen and Chien-Hui Lao for their help in cell sorting and
antiviral assays.
FUNDING
This publication was supported by grants NN301 073140 (to HB); 2012/07/B/NZ1/02710 (to HB);
UMO-2013/11/B/NZ2/02569 (to HB), from Polish Ministry of Science and Higher Education
(http://www.ncn.gov.pl/) and by KNOW RNA Research Centre in Poznań (No. 01/KNOW2/2014).
The microarray and Real-Time experiments were performed in the Genome Analysis Laboratory,
funded by National Multidisciplinary Laboratory of Functional Nanomaterials NanoFun project,
POIG.02.02.00-00-025/09 (http://www.nanofun.edu.pl/). The PhD fellowship of K.B. is part of the
International PhD Program ‘From genome to phenotype: A multidisciplinary approach to functional
genomics' (MPD/2010/3) funded by the Foundation for Polish Science (FNP).
COMPETING INTERESTS
The authors have declared that no competing interests exist.
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
13
REFERENCES
1Pestka,S.,Krause,C.D.andWalter,M.R.(2004)Interferons,interferonlike
cytokines,andtheirreceptors.Immunologicalreviews.202,832
2Schindler,C.,Levy,D.E.andDecker,T.(2007)JAKSTATsignaling:frominterferonsto
cytokines.TheJournalofbiologicalchemistry.282,2005920063
3Donnelly,R.P.andKotenko,S.V.(2010)Interferonlambda:anewadditiontoanold
family.Journalofinterferon&cytokineresearch:theofficialjournaloftheInternational
SocietyforInterferonandCytokineResearch.30,555564
4Bluyssen,H.A.,Rastmanesh,M.M.,Tilburgs,C.,Jie,K.,Wesseling,S.,Goumans,M.J.,
Boer,P.,Joles,J.A.andBraam,B.(2010)IFNgammadependentSOCS3expressioninhibits
IL6inducedSTAT3phosphorylationanddifferentiallyaffectsIL6mediatedtranscriptional
responsesinendothelialcells.Americanjournalofphysiology.Cellphysiology.299,C354
362
5Wesoly,J.,SzweykowskaKulinska,Z.andBluyssen,H.A.(2007)STATactivationand
differentialcomplexformationdictateselectivityofinterferonresponses.Actabiochimica
Polonica.54,2738
6Darnell,J.E.,Jr.,Kerr,I.M.andStark,G.R.(1994)JakSTATpathwaysand
transcriptionalactivationinresponsetoIFNsandotherextracellularsignalingproteins.
Science.264,14151421
7Bluyssen,H.A.andLevy,D.E.(1997)Stat2isatranscriptionalactivatorthatrequires
sequencespecificcontactsprovidedbystat1andp48forstableinteractionwithDNA.The
Journalofbiologicalchemistry.272,46004605
8Hahm,B.,Trifilo,M.J.,Zuniga,E.I.andOldstone,M.B.(2005)Virusesevadethe
immunesystemthroughtypeIinterferonmediatedSTAT2dependent,butSTAT1
independent,signaling.Immunity.22,247257
9Ousman,S.S.,Wang,J.andCampbell,I.L.(2005)Differentialregulationofinterferon
regulatoryfactor(IRF)7andIRF9geneexpressioninthecentralnervoussystemduringviral
infection.Journalofvirology.79,75147527
10Sarkis,P.T.,Ying,S.,Xu,R.andYu,X.F.(2006)STAT1independentcelltypespecific
regulationofantiviralAPOBEC3GbyIFNalpha.Journalofimmunology.177,45304540
11Perry,S.T.,Buck,M.D.,Lada,S.M.,Schindler,C.andShresta,S.(2011)STAT2
mediatesinnateimmunitytoDenguevirusintheabsenceofSTAT1viathetypeIinterferon
receptor.PLoSpathogens.7,e1001297
12Lou,Y.J.,Pan,X.R.,Jia,P.M.,Li,D.,Xiao,S.,Zhang,Z.L.,Chen,S.J.,Chen,Z.and
Tong,J.H.(2009)IRF9/STAT2[corrected]functionalinteractiondrivesretinoicacidinduced
geneGexpressionindependentlyofSTAT1.Cancerresearch.69,36733680
13Fink,K.,Martin,L.,Mukawera,E.,Chartier,S.,DeDeken,X.,Brochiero,E.,Miot,F.
andGrandvaux,N.(2013)IFNbeta/TNFalphasynergisminducesanoncanonicalSTAT2/IRF9
dependentpathwaytriggeringanovelDUOX2NADPHoxidasemediatedairwayantiviral
response.Cellresearch.23,673690
14AuYeung,N.,Mandhana,R.andHorvath,C.M.(2013)Transcriptionalregulationby
STAT1andSTAT2intheinterferonJAKSTATpathway.JakStat.2,e23931
15Fink,K.andGrandvaux,N.(2013)STAT2andIRF9:BeyondISGF3.JakStat.2,e27521
16Steen,H.C.andGamero,A.M.(2013)STAT2phosphorylationandsignaling.JakStat.
2,e25790
17McKendry,R.,John,J.,Flavell,D.,Muller,M.,Kerr,I.M.andStark,G.R.(1991)High
frequencymutagenesisofhumancellsandcharacterizationofamutantunresponsiveto
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
14
bothalphaandgammainterferons.ProceedingsoftheNationalAcademyofSciencesofthe
UnitedStatesofAmerica.88,1145511459
18Bonjardim,C.A.(1998)JAK/STATdeficientcelllines.Brazilianjournalofmedicaland
biologicalresearch=Revistabrasileiradepesquisasmedicasebiologicas/Sociedade
BrasileiradeBiofisica...[etal.].31,13891395
19Lee,C.K.,Smith,E.,Gimeno,R.,Gertner,R.andLevy,D.E.(2000)STAT1affects
lymphocytesurvivalandproliferationpartiallyindependentofitsroledownstreamofIFN
gamma.Journalofimmunology.164,12861292
20Chen,C.andOkayama,H.(1987)Highefficiencytransformationofmammaliancells
byplasmidDNA.Molecularandcellularbiology.7,27452752
21Wang,W.B.,Levy,D.E.andLee,C.K.(2011)STAT3negativelyregulatestypeIIFN
mediatedantiviralresponse.Journalofimmunology.187,25782585
22Pear,W.S.,Miller,J.P.,Xu,L.,Pui,J.C.,Soffer,B.,Quackenbush,R.C.,Pendergast,A.
M.,Bronson,R.,Aster,J.C.,Scott,M.L.andBaltimore,D.(1998)Efficientandrapid
inductionofachronicmyelogenousleukemialikemyeloproliferativediseaseinmice
receivingP210bcr/abltransducedbonemarrow.Blood.92,37803792
23Chen,L.S.,Wei,P.C.,Liu,T.,Kao,C.H.,Pai,L.M.andLee,C.K.(2009)STAT2
hypomorphicmutantmicedisplayimpaireddendriticcelldevelopmentandantiviral
response.Journalofbiomedicalscience.16,22
24Willems,E.,Leyns,L.andVandesompele,J.(2008)StandardizationofrealtimePCR
geneexpressiondatafromindependentbiologicalreplicates.Analyticalbiochemistry.379,
127129
25Chen,H.andBoutros,P.C.(2011)VennDiagram:apackageforthegenerationof
highlycustomizableVennandEulerdiagramsinR.BMCbioinformatics.12,35
26Sturn,A.,Quackenbush,J.andTrajanoski,Z.(2002)Genesis:clusteranalysisof
microarraydata.Bioinformatics.18,207208
27Zambelli,F.,Pesole,G.andPavesi,G.(2009)Pscan:findingoverrepresented
transcriptionfactorbindingsitemotifsinsequencesfromcoregulatedorcoexpressed
genes.Nucleicacidsresearch.37,W247252
28Eden,E.,Navon,R.,Steinfeld,I.,Lipson,D.andYakhini,Z.(2009)GOrilla:atoolfor
discoveryandvisualizationofenrichedGOtermsinrankedgenelists.BMCbioinformatics.
10,48
29Supek,F.,Bosnjak,M.,Skunca,N.andSmuc,T.(2011)REVIGOsummarizesand
visualizeslonglistsofgeneontologyterms.PloSone.6,e21800
30Barish,G.D.,Yu,R.T.,Karunasiri,M.,Ocampo,C.B.,Dixon,J.,Benner,C.,Dent,A.L.,
Tangirala,R.K.andEvans,R.M.(2010)Bcl6andNFkappaBcistromesmediateopposing
regulationoftheinnateimmuneresponse.Genes&development.24,27602765
31CostaPereira,A.P.,Williams,T.M.,Strobl,B.,Watling,D.,Briscoe,J.andKerr,I.M.
(2002)Theantiviralresponsetogammainterferon.Journalofvirology.76,90609068
32Durbin,J.E.,Hackenmiller,R.,Simon,M.C.andLevy,D.E.(1996)Targeteddisruption
ofthemouseStat1generesultsincompromisedinnateimmunitytoviraldisease.Cell.84,
443450
33Kraus,T.A.,Lau,J.F.,Parisien,J.P.andHorvath,C.M.(2003)AhybridIRF9STAT2
proteinrecapitulatesinterferonstimulatedgeneexpressionandantiviralresponse.The
Journalofbiologicalchemistry.278,1303313038
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
15
34Bowick,G.C.,Airo,A.M.andBente,D.A.(2012)Expressionofinterferoninduced
antiviralgenesisdelayedinaSTAT1knockoutmousemodelofCrimeanCongohemorrhagic
fever.Virologyjournal.9,122
35Poat,B.,Hazari,S.,Chandra,P.K.,Gunduz,F.,Alvarez,X.,Balart,L.A.,Garry,R.F.and
Dash,S.(2010)IntracellularexpressionofIRF9Statfusionproteinovercomesthedefective
JakStatsignalingandinhibitsHCVRNAreplication.Virologyjournal.7,265
36Tang,X.,Gao,J.S.,Guan,Y.J.,McLane,K.E.,Yuan,Z.L.,Ramratnam,B.andChin,Y.
E.(2007)AcetylationdependentsignaltransductionfortypeIinterferonreceptor.Cell.131,
93105
37Wieczorek,M.,Ginter,T.,Brand,P.,Heinzel,T.andKramer,O.H.(2012)Acetylation
modulatestheSTATsignalingcode.Cytokine&growthfactorreviews.23,293305
38Banninger,G.andReich,N.C.(2004)STAT2nucleartrafficking.TheJournalof
biologicalchemistry.279,3919939206
39Testoni,B.,Vollenkle,C.,Guerrieri,F.,GerbalChaloin,S.,Blandino,G.andLevrero,
M.(2011)Chromatindynamicsofgeneactivationandrepressioninresponsetointerferon
alpha(IFN(alpha))revealnewrolesforphosphorylatedandunphosphorylatedformsofthe
transcriptionfactorSTAT2.TheJournalofbiologicalchemistry.286,2021720227
40Fenner,J.E.,Starr,R.,Cornish,A.L.,Zhang,J.G.,Metcalf,D.,Schreiber,R.D.,
Sheehan,K.,Hilton,D.J.,Alexander,W.S.andHertzog,P.J.(2006)Suppressorofcytokine
signaling1regulatestheimmuneresponsetoinfectionbyauniqueinhibitionoftypeI
interferonactivity.Natureimmunology.7,3339
41Cheon,H.,HolveyBates,E.G.,Schoggins,J.W.,Forster,S.,Hertzog,P.,Imanaka,N.,
Rice,C.M.,Jackson,M.W.,Junk,D.J.andStark,G.R.(2013)IFNbetadependentincreasesin
STAT1,STAT2,andIRF9mediateresistancetovirusesandDNAdamage.TheEMBOjournal.
32,27512763
42Veals,S.A.,SantaMaria,T.andLevy,D.E.(1993)TwodomainsofISGF3gammathat
mediateproteinDNAandproteinproteininteractionsduringtranscriptionfactorassembly
contributetoDNAbindingspecificity.Molecularandcellularbiology.13,196206
43Hartman,S.E.,Bertone,P.,Nath,A.K.,Royce,T.E.,Gerstein,M.,Weissman,S.and
Snyder,M.(2005)GlobalchangesinSTATtargetselectionandtranscriptionregulationupon
interferontreatments.Genes&development.19,29532968
TABLES AND FIGURES
Figure 1 The IFNα response in STAT1 KO cells is abrogated. (A, C) 2fTGH and U3C; (B, D) MEF
WT and MS1KO were treated with IFNα for indicated times. For (A) and (B) protein lysates were
isolated and analyzed by Western analysis. Total STAT2 (tSTAT2), phosphorylated STAT2
(pSTAT2), total STAT1 (tSTAT1), phosphorylated STAT1 (pSTAT1) and IRF9 were analyzed using
specific antibodies. Equal loading was verified using anti-tubulin. For (C) and (D) total RNA was
extracted and OAS2 and Ifit1 relative fold induction was quantified using qRT-PCR. Statistical
significance is presented as compared to the non-treated control as SEM. Statistical analysis was
conducted using one-way ANOVA with Tukey post-test. *p0.05, ***p0.01.
Figure 2 The IFNα response in STAT1 KO cells is recapitulated by increasing STAT2 levels. (A, C)
hSTAT2-U3C and Migr1-U3C; (B, D) mST2-MS1KO and Migr1-MS1KO, were treated with IFNα
for indicated times. For (A) and (B) protein lysates were isolated and analyzed by Western analysis for
expression of tSTAT2), pSTAT2, tSTAT1, pSTAT1 and IRF9. Equal loading was verified using anti-
tubulin. In (C-D) total RNA was extracted and OAS2 and Ifit1 relative fold induction was quantified
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
16
using qRT-PCR. Statistical significance is presented as compared to the non-treated control and
presented as SEM. Statistical analysis was conducted using one-way ANOVA with Tukey post-test.
*p0.05, **p0.01.
Figure 3 STAT2 and IRF9 complex and mediate an IFNα response in the absence of STAT1. (A) The
interaction between STAT2 and IRF9 was analyzed by immunoprecipitation. hSTAT2-U3C were
treated with IFNα for indicated times. Cell lysates were immunoprecipitated with anti-HA antibody
followed by Western blotting with IRF9, tSTAT2 and pSTAT2 antibodies. (B) Two different clones of
hST2-U3C (hST2-U3Ca and hST2-U3C) varying in hSTAT2 expression level and their control Migr1-
U3C; (C) ΔmST2-MS1KO, mST2-MS1KO and their control Migr1-MS1KO; . (D) Migr1-U3C, IRF9-
U3C and hST2-U3C; (E) hST2-U3C transiently transfected with Migr1-IRF9 (500ng); (F) U3C cells
transiently transfected with STAT2-Y690F or STAT2 plasmid (2.5ug)were all treated with or without
200 units/mL IFNα for 8h (B-E) or 24h (F). Total RNA was extracted and OAS2, Ifit1, STAT2 or
IRF9 relative fold inductions were quantified using qRT-PCR. Statistical significance is presented as
compared to the non-treated control as SEM. Statistical analysis was conducted using one-way
ANOVA with Tukey post-test except in E where t-test, two-tailed was used. *p0.05, **p0.01
Figure 4 STAT2/IRF9 and ISGF3 regulate expression of a common set of ISGs with different
kinetics. (A) 2fTGH and hST2-U3C or (B) MEF WT and mST2-MS1KO were treated with IFNα for
0h, 4h, 8h and 24h and subjected to microarray analysis. Common up-regulated genes were selected
by comparing transcriptomes of individual cell lines. Statistically significant up-regulated genes in
human (A) and mouse (B) cell-line data sets were compared by Venn diagram analysis (. Average
expression profiles of common up-regulated genes between (C) 2fTGH and hST2-U3C and (D) MEF
WT and mST2-MS1KO are displayed in Centroid view. Expression values are shown as log2 ratio;
error bars equal standard deviation
Figure 5 STAT2/IRF9 and ISGF3 mediated transcriptional responses predict functional overlap.
Cluster analysis of common up-regulated genes between (A) 2fTGH and hST2-U3Cor (B) MEF WT
and mST2-MS1KO. Total RNA from IFNα treated cell lines was analyzed using Illumina Human HT-
12 v4 (A) or MouseRef 8v2 (B) microarrays. For microarray analysis background subtraction and
quantile normalization were used, genes with ratio 2 and p0.05 were considered as up-regulated.
Log2 ratios from up-regulated genes were clustered using average linkage method.
Figure 6 ChIP-qPCR analysis show enhanced binding of STAT2 to the ISRE of the IFI27, MX1,
OAS2, IFIT1, IFIT3 and ISG15 genes in an IFNα-dependent manner in the hST2-U3C cells.
Immunoprecipitated DNA was quantified by qPCR and normalized to values obtained after
amplification of unprecipitated (input) DNA.
Figure 7 STAT2/IRF9 regulates expression of ISGF3-independent genes. (A) 2fTGH and hST2-U3C
were treated with IFNα for indicated times. (B) Two different clones of hST2-U3C (hST2-U3Ca and
hST2-U3C) varying in hSTAT2 expression levels were treated with IFNα for 8h. Subsequently hST2-
U3Ca was transfected with Migr1-IRF9 (500 ng) and treated with IFNα for 8h. In (A-B) total RNA
was extracted. CCL8 and CX3CL1 relative fold induction was quantified using qRT-PCR. All data are
presented as SEM. Statistical significance is presented using t-test, two tailed, *p0.05.
Figure 8 STAT2/IRF9 mediates a similar antiviral response against EMCV and VSV virus as ISGF3
2fTGH, U3C, hST2-U3C and Migr1-U3C cell lines, pre-treated for 24h with 2-fold serial dilutions of
IFNα from 250 U/ml, were infected with (A) EMCV or (B) VSV at a MOI of 0.3 for 20 h, or at a MOI
of 3 for 20 h (C and D, respectively) followed by visualizing live cells by crystal violet staining.
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
17
TABLES
Table 1. Gene Ontology enrichment. Common up-regulated genes from human and mouse microarray
experiments were taken for gene ontology enrichment analysis using Gorilla and Revigo software.
Gene ontology terms were grouped as follow: top 8 terms classified as “Response to virus” (white
background), next 5 were categorized as “Response to stimulus” (light grey background) and last 6 as
“Multi-organism processes” (dark-grey background) based on the log10 p-values. Frequency scores
were the percentage of proteins in UniProt which were annotated with a GO term in the GOA
database, i.e. a higher frequency denotes a more general term (Publication: Fran Supek et al.,Plos One
2011, REVIGO Summarizes and Visualizes Long Lists of Gene Ontology Terms)
Table 2. The top-20 commonly up-regulated antiviral genes in 2fTGH vs. hST2-U3C. Cells were
untreated or stimulated with IFNα for 4h, 8h and 24h. Expression ratios (of treated vs. untreated
control) were calculated as a mean from three (human) and two (mouse) repeats. Genes were selected
from the „Response to the virus” GO category (Table 1.). Mouse homologs (indicated as % of
homology with the human gene) were identified using Ensemble BioMart.. P: position of the first
nucleotide in the predicted ISRE sequence in relation to the transcriptional start site. S; Consensus
ISRE matching score (from 0-1), with 1 representing 100% identity.
Table 3 The top 10 STAT1/IRF9 specific genes regulated in response to IFNα. hST2-U3C cells were
untreated or stimulated with IFNα for 4, 8 and 24h. Total RNA from each sample was analyzed using
Illumina Human HT-12 v4 microarrays. Expression ratios (of treated vs. untreated control) were
calculated as the average from three repeats.
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
18
Table 1
frequency log10
p-value frequency log10
p-value
GO:0006952 defense response 0.92% -25.3 0.92% -18.0
GO:0035455 response to interf eron-alpha 0.00% -11.2 0.00% -4.8
GO:0050896 response to stimulus 10.88% -10.9 10.88% -4.3
GO:0050792 regulation of viral reproduction 0.01% -9.7 0.01% -7.0
GO:0035456 response to interf eron-beta 0.00% -9.1 0.00% -11.6
GO:0032020 ISG15-protein conjugation 0.00% -6.1 0.00% -8.7
GO:0048002 antigen processing and presentation of peptide antigen 0.04% -5.5 0.04% -7.1
GO:0019884 antigen processing and presentation of exogenous antigen 0.01% -4.6 0.01% -4.0
GO:0034097 response to cy tokine stimulus 0.06% -30.7 0.06% -8.0
GO:0009607 response to biotic stimulus 0.71% -25.3 0.71% -20.4
GO:0002376 immune system process 0.75% -24.6 0.75% -17.3
GO:0002252 immune eff ector process 0.05% -23.1 0.05% -16.8
GO:0042221 response to chemical stimulus 1.88% -11.6 1.88% -3.9
GO:0051704 multi-organism process 4.28% -17.9 4.28% -19.4
GO:0010033 response to organic substance 0.36% -15.0 0.36% -5.2
GO:0006950 response to stress 4.21% -13.9 4.21% -9.4
GO:0043901 negativ e regulation of multi-organism process 0.01% -12.7 0.01% -6.0
GO:0043900 regulation of multi-organism process 0.02% -12.5 0.02% -8.9
GO:2000241 regulation of reproductiv e process 0.03% -7.5 0.03% -4.6
term_ID Description
Human Mouse
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
19
Table 2
Table 3
4h
8h
24h
4h
8h
24h ISRE Sequence P S
4h
8h
24h
4h
8h
24h ISRE Sequence P S
Ifi27l1* 47% ----- -AAGTTTCGATTTCCC290.90
Ifi27l2a* 44% ----- -TAGTTTCCATTTCAT-3190.85
Ifi27l2b* 48% ----- -GAGTCTCTCTTGCTC-300.78
CXCL10
36.5 129.8 3.5 8.7 57.7 96.5
A
GGTTTCACTTTCCA -184 0.88 CXCL10 68%
57.2 22.7 13.1 3.1 7.0 13.4
AAGTTTCACTTTCCA -215 0.92
RSAD2
343.7 364.4 29.4 20.9 48.2 44.0
AGGTTTCAGTTTCCC -35 0.90 Rsad2 83%
109.0 71.6 53.6 33.3 74.8 1801.5
GAGTTTCTGTTTTCT -110 0.90
IFIT2
90.3 32.0 3.5 35.7 39.9 26.6
CAGTTTCACTTTCCT -7 0.96 Ifit2 62%
8.3 4.1 1.9 1.7 1.6 2.3
CAGGATCCTTTTCTG -341 0.74
Ifit1*** 53% ----- -CAGTTTCACTTTCCA-1070.96
2010002M12Rik* 51% ----- -CAGTTTCACTTTCCA-530.96
Gm14446* 55% ----- -AGGTTTCATTTTCTG-260.86
OAS2
24.7 45.0 18.7 7.3 20.6 24.3
CACTTTCACTTTCCT -17 0.88 Oas2 60%
68.3 112.6 147.7 1.0 1.0 88.4
GAGTTTCGATTTCCT -79 0.87
IFI44L*
43.5 245.1 140.6 1.0 7.3 21.1
TAGTTTCACTTTCCC -61 0.98 Ifi44l* 21% ----- -CATTTTCATTTTACT-1950.79
CCL5
2.2 4.2 2.6 1.9 5.5 19.1
CAGTTTCAGTTTCCC -187 0.98 Ccl5 80%
1.3 1.2 1.6 1.0 1.2 2.4
CAGTTTTCTTTTCCA -153 0.83
Ifit3 49%
13.0 11.9 10.7 39.1 70.0 101.2
AAGTTTCACTTTCCT -159 0.93
I830012O16Rik 50% ----- -AAGTTTCACTTTCCT-1910.93
HERC5**
29.4 90.0 14.7 5.0 19.9 16.9
CAGTTTCCTTTTCCT -126 0.91 ----** ---- ----- - - --
IFI44
14.6 38.2 17.4 3.5 8.8 12.8
GAGTTTCAGGTTTCT -63 0.82 Ifi44 54%
1.1 1.0 1.0 1.0 1.0 0.8
GAGTTTCAGTTTTCG -9 0.93
Oasl1 70%
109.7 58.7 44.6 7.4 17.8 40.2
TAGTTTCTCTTTTGT -159 0.90
Oasl2 48%
20.8 20.3 26.1 19.8 47.6 89.9
TGGTTTTGTTTTTGT -247 0.73
ISG15
22.3 34.8 30.8 2.9 6.6 9.4
CAGTTTCATTTCTGT -114 0.90 Isg15 62%
17.3 16.4 17.1 7.9 13.6 24.9
CGGTTTCCTTTTCCT -80 0.87
BST2
3.7 10.0 13.8 1.4 2.6 6.5
CAGTTTCGGTTTCCT -108 0.91 Bst2 36%
3.6 3.6 3.1 5.2 13.8 22.0
CAGTTTCATTTTCCT -167 0.95
DDX58
16.4 16.2 4.8 4.1 6.4 5.7
CAGTTTTCTTTTCCG -118 0.85 Ddx58 77%
6.1 5.4 4.4 6.8 9.9 13.6
CAGTTTCGATTTCCT -1 0.90
DHX58
14.7 44.8 18.6 2.4 4.3 5.6
CAGTTTCAGTTTCCA -1 0.94 Dhx58 79%
14.5 16.6 16.7 13.7 31.3 59.0
CAGTTTCATTTCTAG -1 0.91
ISG20
2.6 4.6 2.5 1.7 3.7 5.2
CAGTTTTGGTTTCCC -183 0.86 Isg20 82%
3.3 2.1 1.8 1.6 2.5 4.9
TAGTTTCAGTTTCTG -311 0.91
DDX60*
7.213.67.4 2.5 5.3 4.8
TAGTTTCGTTTCCCT -78 0.87 Ddx60* 75% ----- -TAGTTTCGGTTTCTC-230.90
Oas1g 60%
5.5 26.4 34.0 2.4 20.7 937.4
CAGTTTCCATTTCCC -35 0.93
Oas1a 59%
131.8 92.4 135.8 1.0 1.0 42.9
CAGTTTCCATTTCCC -22 0.93
Mx2 74%
40.5 31.2 30.5 31.9 127.9 766.7
AAGTTTCAATTCTCC -69 0.89
Mx1 41%
24.5 13.7 9.6 3.4 1.5 47.1
CGGTTTCAATTCTCC -69 0.89
* - No mouse probe on array
** - No mouse homolog gene
Human Mouse
Gene
2fTGH h ST2-U 3C Promoter Mo us e
homologes
%
homolog
MEF WT mST2-MS1KO Promoter
IFI27*
7.6 19.8 38.0 6.2 37.4 179.7
GAGTTTCAGTTTCCT -24 0.92
IFIT1***
50.7 45.1 16.8 24.8 34.3 26.0
TAGTTTCACTTTCCC -1 0.98
IFIT3
100.3 75.1 10.7 19.0 29.0 18.6
CAGTTTCGGTTTCCC -79 0.94
OASL
36.3 45.1 8.2 7.1 15.6 10.5
GAGTTTCGATTTTTC -16 0.88
OAS1
17.7 28.4 11.0 2.6 5.7 4.6
TGGTTTCGTTTCCTC
-32 0.88
***- Mouse probe failure
80.83
MX1
16.0 31.9 19.0 1.5 2.9 4.0
CGGTTTCATTTCTGC
Gene 4h 8h 24h
CCL8 23.32 58.03 73.82
SAA2 0.73 4.24 15.45
DPYSL4 0.34 1.96 7.19
VSIG8 5.25 7.52 6.99
HS.254477 2.41 4.56 6.46
CH25H 5.14 8.19 6.31
CD74 0.70 1.24 5.55
CX3CL1 3.39 7.69 5.39
TXNIP 1.58 2.00 4.41
CCL7 2.62 4.70 3.34
hST2-U3C
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
20
Figure 1
Figure 2
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
21
Figure 3
Figure 4
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
22
Figure 5
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
23
Figure 6
Figure 7
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
STAT2/IRF9 directs an ISGF3-like response without STAT1
24
Figure 8
Biochemical Journal Immediate Publication. Published on 07 Jan 2015 as manuscript BJ20140644
THIS IS NOT THE VERSION OF RECORD - see doi:10.1042/BJ20140644
Accepted Manuscript
Licenced copy. Copying is not permitted, except with prior permission and as allowed by law.
© 2015 The Authors Journal compilation © 2015 Biochemical Society
... Nonetheless, for its particularly important role in type I IFN signaling, STAT2 and its destruction by specific viruses has received substantial attention. First of all, although the IFN response pathway leads to robust induction of the large family IFN-stimulated genes (ISGs), the preformed STAT2-IRF9 complex allows basal low-level expression of roughly a quarter of the ISGs [12,[16][17][18]. Indeed, relatively recent studies have revealed that unphosphorylated STAT2 and STAT1 (U-STAT2, U-STAT1), lacking the IFN-triggered phosphorylation, can combine with IRF9 to form the unphosphorylated version of ISGF3 (U-ISGF3) [17,19,20]. ...
... The cardinal role of STAT2 in ISG induction was further established in several other studies. In one study, STAT1-deficient cells that overexpress STAT2 supported IFNα-induced expression of key antiviral ISGs and inhibited the growth of encephalomyocarditis virus (EMCV) and vesicular stomatitis virus (VSV) [16]. Early studies also showed that in some cases, type I IFN can promote STAT1-independent signaling that is still STAT2-dependent [21]. ...
Article
Full-text available
Virus infection of eukaryotes triggers cellular innate immune response, a major arm of which is the type I interferon (IFN) family of cytokines. Binding of IFN to cell surface receptors triggers a signaling cascade in which the signal transducer and activator of transcription 2 (STAT2) plays a key role, ultimately leading to an antiviral state of the cell. In retaliation, many viruses counteract the immune response, often by the destruction and/or inactivation of STAT2, promoted by specific viral proteins that do not possess protease activities of their own. This review offers a summary of viral mechanisms of STAT2 subversion with emphasis on degradation. Some viruses also destroy STAT1, another major member of the STAT family, but most viruses are selective in targeting either STAT2 or STAT1. Interestingly, degradation of STAT2 by a few viruses requires the presence of both STAT proteins. Available evidence suggests a mechanism in which multiple sites and domains of STAT2 are required for engagement and degradation by a multi-subunit degradative complex, comprising viral and cellular proteins, including the ubiquitin–proteasomal system. However, the exact molecular nature of this complex and the alternative degradation mechanisms remain largely unknown, as critically presented here with prospective directions of future study.
... These activated STAT complexes enter the nucleus and induce the expression of IFN-stimulated genes (ISGs). STAT1:STAT2:IRF9 (ISGF3) and STAT2 2 :IRF9 complexes bind to particular promoter cis-elements conforming to a consensus sequence known as the IFN-stimulated response element (ISRE) [27][28][29]. STAT1 homodimers, activated also (and mainly) by IFNγ, target IFNγ-activated promoter elements (γ-activated sequences, GAS) to stimulate a distinct, but overlapping, set of ISGs [30,31]. In addition to induction by IFN-I, the ISGF3 complex can be induced also by IFNα/β-downstream IFNγ-and IFNλ-activated signaling via IFNGR1/2 and IFNLR1/IL-10Rβ receptors, respectively [32]. ...
Article
Human herpesvirus 8 (HHV-8), also known as Kaposi’s sarcoma (KS)-associated herpesvirus, is involved etiologically in AIDS-associated KS, primary effusion lymphoma (PEL), and multicentric Castleman’s disease, in which both viral latent and lytic functions are important. HHV-8 encodes four viral interferon regulatory factors (vIRFs) that are believed to contribute to viral latency (in PEL cells, at least) and/or to productive replication via suppression of cellular antiviral and stress signaling. Here, we identify vIRF-1 interactions with signal transducer and activator of transcription (STAT) factors 1 and 2, interferon type-I (IFN-I)-stimulated gene factor 3 (ISGF3) cofactor IRF9, and associated signal transducing Janus kinases JAK1 and TYK2. In naturally infected PEL cells and in iSLK epithelial cells infected experimentally with genetically engineered HHV-8, vIRF-1 depletion or ablation, respectively, led to increased STAT1 and STAT2 activation (phosphorylation) in IFNβ-treated, and untreated, cells during lytic replication and to associated cellular-gene induction. In transfected 293T cells, used for mechanistic studies, suppression by vIRF-1 of IFNβ-induced phospho-STAT1 (pSTAT1) was found to be highly dependent on STAT2, indicating vIRF-1-mediated inhibition and/or dissociation of ISGF3-complexing, resulting in susceptibility of pSTAT1 to inactivating dephosphorylation. Indeed, coprecipitation experiments involving targeted precipitation of ISGF3 components identified suppression of mutual interactions by vIRF-1. In contrast, suppression of IFNβ-induced pSTAT2 was effected by inhibition of TYK2 and its interactions with STAT2 and IFN-I receptor (IFNAR). Our identified vIRF-1 interactions with IFN-signaling mediators STATs 1 and 2, co-interacting ISGF3 component IRF9, and STAT-activating TYK2 and the suppression of IFN signaling via ISGF3, TYK2-STAT2 and TYK2-IFNAR disruption and TYK2 inhibition represent novel mechanisms of vIRF function and HHV-8 evasion from host-cell defenses.
... Type I IFNs activate the IFN-stimulated gene factor 3 (ISGF3) complex, which induces genes containing IFN-stimulated response elements (ISREs) [25]. ISGF3 function is dependent on the interaction between STAT2 and IRF9 [25,26]. Consistent with activation of the type I IFN pathway, we found that MUC1 significantly associates with (i) STAT2 and IRF9 expression in TNBC tumors ( Figure 1C) and (ii) IRF9 in a scRNA-seq dataset from TNBC tumor cells ( Figure 1D). ...
Article
Full-text available
The MUC1-C apical transmembrane protein is activated in the acute response of epithelial cells to inflammation. However, chronic MUC1-C activation promotes cancer progression, emphasizing the importance of MUC1-C as a target for treatment. We report here that MUC1-C is necessary for intrinsic expression of the RIG-I, MDA5 and cGAS cytosolic nucleotide pattern recognition receptors (PRRs) and the cGAS-stimulator of IFN genes (STING) in triple-negative breast cancer (TNBC) cells. Consistent with inducing the PRR/STING axis, MUC1-C drives chronic IFN-β production and activation of the type I interferon (IFN) pathway. MUC1-C thereby induces the IFN-related DNA damage resistance gene signature (IRDS), which includes ISG15, in linking chronic inflammation with DNA damage resistance. Targeting MUC1-C in TNBC cells treated with carboplatin or the PARP inhibitor olaparib further demonstrated that MUC1-C is necessary for expression of PRRs, STING and ISG15 and for intrinsic DNA damage resistance. Of translational relevance, MUC1 significantly associates with upregulation of STING and ISG15 in TNBC tumors and is a target for treatment with CAR T cells, antibody–drug conjugates (ADCs) and direct inhibitors that are under preclinical and clinical development.
... While IRF9 is integral in mediating the type I interferon antiviral response and the role of IRF9 in many important non-communicable diseases has just begun to emerge, the regulation of IRF9 during these conditions is not well understood [79]. What is known is that high levels of IRF9 and STAT1/STAT2 drive a prolonged response of the initial anti-viral response and also provide resistance to DNA damage [80,81]. ...
Article
Full-text available
Gene expression plays a key role in health and disease. Estimating the genetic components underlying gene expression can thus help understand disease etiology. Polygenic models termed “transcriptome imputation” are used to estimate the genetic component of gene expression, but these models typically consider only the cis regions of the gene. However, these cis-based models miss large variability in expression for multiple genes. Transcription factors (TFs) that regulate gene expression are natural candidates for looking for additional sources of the missing variability. We developed a hypothesis-driven approach to identify second-tier regulation by variability in TFs. Our approach tested two models representing possible mechanisms by which variations in TFs can affect gene expression: variability in the expression of the TF and genetic variants within the TF that may affect the binding affinity of the TF to the TF-binding site. We tested our TF models in whole blood and skeletal muscle tissues and identified TF variability that can partially explain missing gene expression for 1035 genes, 76% of which explains more than the cis-based models. While the discovered regulation patterns were tissue-specific, they were both enriched for immune system functionality, elucidating complex regulation patterns. Our hypothesis-driven approach is useful for identifying tissue-specific genetic regulation patterns involving variations in TF expression or binding.
... Second, time-course analyses suggest that IRF7 and IRF9 accumulation precedes that of its target genes ( Figure 3C-E). Third, TRRAP specifically represses U-ISGs, which can be induced by the sole overexpression of unphosphorylated IRF9, including in CRCs (Kolosenko et al., 2015;Cheon et al., 2013;Sung et al., 2015;Platanitis et al., 2019;Blaszczyk et al., 2015;Figure 4). Fourth, TRRAP dynamically binds to the promoters of IRF7 and IRF9 and represses their transcription (Figures 5-7). ...
Article
Full-text available
Transcription is essential for cells to respond to signaling cues and involves factors with multiple distinct activities. One such factor, TRRAP, functions as part of two large complexes, SAGA and TIP60, which have crucial roles during transcription activation. Structurally, TRRAP belongs to the PIKK family but is the only member classified as a pseudokinase. Recent studies established that a dedicated HSP90 co-chaperone, the TTT complex, is essential for PIKK stabilization and activity. Here, using endogenous auxin-inducible degron alleles, we show that the TTT subunit TELO2 promotes TRRAP assembly into SAGA and TIP60 in human colorectal cancer cells (CRC). Transcriptomic analysis revealed that TELO2 contributes to TRRAP regulatory roles in CRC cells, most notably of MYC target genes. Surprisingly, TELO2 and TRRAP depletion also induced the expression of type I interferon genes. Using a combination of nascent RNA, antibody-targeted chromatin profiling (CUT&RUN), ChIP, and kinetic analyses, we propose a model by which TRRAP directly represses the transcription of IRF9, which encodes a master regulator of interferon stimulated genes. We have therefore uncovered an unexpected transcriptional repressor role for TRRAP, which we propose contributes to its tumorigenic activity.
... Figure 6 compares percentile rankings of the four cross-species' AIWG-P genes in human and mouse ChIP-Seq consensomes for which at least one of both the human and mouse orthologs is a HCT (the full list of percentile rankings for all four genes is in Supplementary file section 7). This in silico analysis also recapitulates previous in vitro studies identifying transcriptional regulatory connections between Stat2 and Ifit1 [55], Stat1 and Rsad2 [56], and Tal1, Gata1, and Rhd [57]. We observed striking cross-species conservation of the regulatory relationships of the four genes with several of the key immunomodulatory nodes previously identified in the HCT intersection analysis. ...
Article
Full-text available
Although antipsychotics, such as olanzapine, are effective in the management of psychiatric conditions, some patients experience excessive antipsychotic-induced weight gain (AIWG). To illuminate pathways underlying AIWG, we compared baseline blood gene expression profiles in two cohorts of mice that were either prone (AIWG-P) or resistant (AIWG-R) to weight gain in response to olanzapine treatment for two weeks. We found that transcripts elevated in AIWG-P mice relative to AIWG-R are enriched for high-confidence transcriptional targets of numerous inflammatory and immunomodulatory signaling nodes. Moreover, these nodes are themselves enriched for genes whose disruption in mice is associated with reduced body fat mass and slow postnatal weight gain. In addition, we identified gene expression profiles in common between our mouse AIWG-P gene set and an existing human AIWG-P gene set whose regulation by immunomodulatory transcription factors is highly conserved between species. Finally, we identified striking convergence between mouse AIWG-P transcriptional regulatory networks and those associated with body weight and body mass index in humans. We propose that immunomodulatory transcriptional networks drive AIWG, and that these networks have broader conserved roles in whole body-metabolism.
... Testoni et al. characterized STAT2 binding at homeostasis and under IFNa stimulation over a subset of 113 ISG promoters in hepatocytes [20]. Several groups have compared the effects of ISGF3 binding and STAT2: IRF9 dimer binding to ISREs [21][22][23][24]. However, none of these works characterized ISRE binding patterns across the genome or across cell types. ...
Article
Full-text available
The type I interferon (IFN) signaling pathway involves binding of the transcription factor ISGF3 to IFN-stimulated response elements, ISREs. Gene expression under IFN stimulation is known to vary across cell types, but variation in ISGF3 binding to ISRE across cell types has not been characterized. We examined ISRE binding patterns under IFN stimulation across six cell types using existing ChIPseq datasets. We find that ISRE binding is largely cell specific for ISREs distal to transcription start sites (TSS) and largely conserved across cell types for ISREs proximal to TSS. We show that bound ISRE distal to TSS associate with differential expression of ISGs, although at weaker levels than bound ISRE proximal to TSS. Using existing ATACseq and ChIPseq datasets, we show that the chromatin state of ISRE at homeostasis is cell type specific and is predictive of cell specific, ISRE binding under IFN stimulation. Our results support a model in which the chromatin state of ISRE in enhancer elements is modulated in a cell type specific manner at homeostasis, leading to cell type specific differences in ISRE binding patterns under IFN stimulation.
Article
Inflammation is a natural immune defense mechanism of the body's response to injury, infection, and other damaging triggers. Uncontrolled inflammation may become chronic and contribute to a range of chronic inflammatory diseases. Signal transducer and activator of transcription 2 (STAT2) is an essential transcription factor exclusive to type I and type III interferon (IFN) signaling pathways. Both pathways are involved in multiple biological processes, including powering the immune system as a means of controlling infection that must be tightly regulated to offset the development of persistent inflammation. While studies depict STAT2 as protective in promoting host defense, new evidence is accumulating that exposes the deleterious side of STAT2 when inappropriately regulated, thus prompting its reevaluation as a signaling molecule with detrimental effects in human disease. This review aims to provide a comprehensive summary of the findings based on literature regarding the inflammatory behavior of STAT2 in microbial infections, cancer, autoimmune, and inflammatory diseases. In conveying the extent of our knowledge of STAT2 as a proinflammatory mediator, the aim of this review is to stimulate further investigations into the role of STAT2 in diseases characterized by deregulated inflammation and the mechanisms responsible for triggering severe responses.
Preprint
SARS-COV-2 explores every possible vulnerability in human body and uses it against the host. To treat this SARS-COV-2 induced COVID-19, we should target the multiple factors virus is targeting and use the drugs in a strategical way. This approach can save the patients from severe state of illness and damage associated with the disease.
Article
Type I interferons (IFNs), mostly IFNα and IFNβ, and the type I IFN Signature are important in the pathogenesis of Systemic Lupus Erythematosus (SLE), an autoimmune chronic condition linked to inflammation. Both IFNα and IFNβ trigger a signaling cascade that, through the activation of JAK1, TYK2, STAT1 and STAT2, initiates gene transcription of IFN stimulated genes (ISGs). Noteworthy, other STAT family members and IFN Responsive Factors (IRFs) can also contribute to the activation of the IFN response. Aberrant type I IFN signaling, therefore, can exacerbate SLE by deregulated homeostasis leading to unnecessary persistence of the biological effects of type I IFNs. The etiopathogenesis of SLE is partially known and considered multifactorial. Family-based and genome wide association studies (GWAS) have identified genetic and transcriptional abnormalities in key molecules directly involved in the type I IFN signaling pathway, namely TYK2, STAT1 and STAT4, and IRF5. Gain-of-function mutations that heighten IFNα/β production, which in turn maintains type I IFN signaling, are found in other pathologies like the interferonopathies. However, the distinctive characteristics have yet to be determined. Signaling molecules activated in response to type I IFNs are upregulated in immune cell subsets and affected tissues of SLE patients. Moreover, Type I IFNs induce chromatin remodeling leading to a state permissive to transcription, and SLE patients have increased global and gene-specific epigenetic modifications, such as hypomethylation of DNA and histone acetylation. Epigenome wide association studies (EWAS) highlight important differences between SLE patients and healthy controls in Interferon Stimulated Genes (ISGs). The combination of environmental and genetic factors may stimulate type I IFN signaling transiently and produce long-lasting detrimental effects through epigenetic alterations. Substantial evidence for the pathogenic role of type I IFNs in SLE advocates the clinical use of neutralizing anti-type I IFN receptor antibodies as a therapeutic strategy, with clinical studies already showing promising results. Current and future clinical trials will determine whether drugs targeting molecules of the type I IFN signaling pathway, like non-selective JAK inhibitors or specific TYK2 inhibitors, may benefit people living with lupus.
Article
Full-text available
Type I interferon (IFN) signaling induces the heterotrimeric transcription complex, IFN-stimulated gene factor (ISGF) 3, which contains STAT1, STAT2, and the DNA binding subunit, interferon regulatory factor (IRF) 9. Because IRF9 is targeted to the nucleus in the absence of IFN stimulation, the potential of IRF9 protein for gene regulation was examined using a GAL4 DNA binding domain fusion system. GAL4-IRF9 was transcriptionally active in reporter gene assays but not in the absence of cellular STAT1 and STAT2. However, the inert IRF9 protein was readily converted to a constitutively active ISGF3-like activator by fusion with the C-terminal transcriptional activation domain of STAT2 or the acidic activation domain of herpesvirus VP16. The IRF9 hybrids are targeted to endogenous ISGF3 target loci and can activate their transcription. Moreover, expression of the IRF9-STAT2 fusion can recapitulate the type I IFN biological response, producing a cellular antiviral state that protects cells from virus-induced cytopathic effects and inhibits virus replication. The antiviral state generated by regulated IRF9-STAT2 hybrid protein expression is independent of autocrine IFN signaling and inhibits both RNA and DNA viruses.
Article
Full-text available
STAT2 is an essential transcription factor in type I IFN mediated anti-viral and anti-proliferative signaling. STAT2 function is regulated by tyrosine phosphorylation, which is the trigger for STAT-dimerization, subsequent nuclear translocation, and transcriptional activation of IFN stimulated genes. Evidence of additional STAT2 phosphorylation sites has emerged as well as novel roles for STAT2 separate from the classical ISGF3-signaling. This review aims to summarize knowledge of phosphorylation-mediated STAT2-regulation and future avenues of related STAT2 research.
Article
Full-text available
STAT1 and STAT2 proteins are key mediators of type I and type III interferon (IFN) signaling, and are essential components of the cellular antiviral response and adaptive immunity. They associate with IFN regulatory factor 9 (IRF9) to form a heterotrimeric transcription factor complex known as ISGF3. The regulation of IFN-stimulated gene (ISG) expression has served as a model of JAK-STAT signaling and mammalian transcriptional regulation, but to date has primarily been analyzed at the single gene level. While many aspects of ISGF3-mediated gene regulation are thought to be common features applicable to several ISGs, there are also many reports of distinct cases of non-canonical STAT1 or STAT2 signaling events and distinct patterns of co-regulators that contribute to gene-specific transcription. Recent genome-wide studies have begun to uncover a more complete profile of ISG regulation, moving toward a genome-wide understanding of general mechanisms that underlie gene-specific behaviors.
Article
Full-text available
A single high dose of interferon-β (IFNβ) activates powerful cellular responses, in which many anti-viral, pro-apoptotic, and anti-proliferative proteins are highly expressed. Since some of these proteins are deleterious, cells downregulate this initial response rapidly. However, the expression of many anti-viral proteins that do no harm is sustained, prolonging a substantial part of the initial anti-viral response for days and also providing resistance to DNA damage. While the transcription factor ISGF3 (IRF9 and tyrosine-phosphorylated STATs 1 and 2) drives the first rapid response phase, the related factor un-phosphorylated ISGF3 (U-ISGF3), formed by IFNβ-induced high levels of IRF9 and STATs 1 and 2 without tyrosine phosphorylation, drives the second prolonged response. The U-ISGF3-induced anti-viral genes that show prolonged expression are driven by distinct IFN stimulated response elements (ISREs). Continuous exposure of cells to a low level of IFNβ, often seen in cancers, leads to steady-state increased expression of only the U-ISGF3-dependent proteins, with no sustained increase in other IFNβ-induced proteins, and to constitutive resistance to DNA damage.
Article
Full-text available
Airway epithelial cells are key initial innate immune responders in the fight against respiratory viruses, primarily via the secretion of antiviral and proinflammatory cytokines that act in an autocrine/paracrine fashion to trigger the establishment of an antiviral state. It is currently thought that the early antiviral state in airway epithelial cells primarily relies on IFNβ secretion and the subsequent activation of the interferon-stimulated gene factor 3 (ISGF3) transcription factor complex, composed of STAT1, STAT2 and IRF9, which regulates the expression of a panoply of interferon-stimulated genes encoding proteins with antiviral activities. However, the specific pathways engaged by the synergistic action of different cytokines during viral infections, and the resulting physiological outcomes are still ill-defined. Here, we unveil a novel delayed antiviral response in the airways, which is initiated by the synergistic autocrine/paracrine action of IFNβ and TNFα, and signals through a non-canonical STAT2- and IRF9-dependent, but STAT1-independent cascade. This pathway ultimately leads to the late induction of the DUOX2 NADPH oxidase expression. Importantly, our study uncovers that the development of the antiviral state relies on DUOX2-dependent H2O2 production. Key antiviral pathways are often targeted by evasion strategies evolved by various pathogenic viruses. In this regard, the importance of the novel DUOX2-dependent antiviral pathway is further underlined by the observation that the human respiratory syncytial virus is able to subvert DUOX2 induction.Cell Research advance online publication 2 April 2013; doi:10.1038/cr.2013.47.
Article
Expression of the 210-kD bcr/abl fusion oncoprotein can cause a chronic myelogenous leukemia (CML)-like disease in mice receiving bone marrow cells transduced by bcr/abl-encoding retroviruses. However, previous methods failed to yield this disease at a frequency sufficient enough to allow for its use in the study of CML pathogenesis. To overcome this limitation, we have developed an efficient and reproducible method for inducing a CML-like disease in mice receiving P210 bcr/abl-transduced bone marrow cells. All mice receiving P210 bcr/abl-transduced bone marrow cells succumb to a myeloproliferative disease between 3 and 5 weeks after bone marrow transplantation. The myeloproliferative disease recapitulates many of the hallmarks of human CML and is characterized by high white blood cell counts and extensive extramedullary hematopoiesis in the spleen, liver, bone marrow, and lungs. Use of a retroviral vector coexpressing P210 bcr/abl and green fluorescent protein shows that the vast majority of bcr/abl-expressing cells are myeloid. Analysis of the proviral integration pattern shows that, in some mice, the myeloproliferative disease is clonal. In multiple mice, the CML-like disease has been transplantable, inducing a similar myeloproliferative syndrome within 1 month of transfer to sublethally irradiated syngeneic recipients. The disease in many of these mice has progressed to the development of acute lymphoma/leukemia resembling blast crisis. These results demonstrate that murine CML recapitulates important features of human CML. As such, it should be an excellent model for addressing specific issues relating to the pathogenesis and treatment of this disease.
Article
We describe a simple calcium phosphate transfection protocol and neo marker vectors that achieve highly efficient transformation of mammalian cells. In this protocol, the calcium phosphate-DNA complex is formed gradually in the medium during incubation with cells and precipitates on the cells. The crucial factors for obtaining efficient transformation are the pH (6.95) of the buffer used for the calcium phosphate precipitation, the CO2 level (3%) during the incubation of the DNA with the cells, and the amount (20 to 30 micrograms) and the form (circular) of DNA. In sharp contrast to the results with circular DNA, linear DNA is almost inactive. Under these conditions, 50% of mouse L(A9) cells can be stably transformed with pcDneo, a simian virus 40-based neo (neomycin resistance) marker vector. The NIH3T3, C127, CV1, BHK, CHO, and HeLa cell lines were transformed at efficiencies of 10 to 50% with this vector and the neo marker-incorporated pcD vectors that were used for the construction and transduction of cDNA expression libraries as well as for the expression of cloned cDNA in mammalian cells.
Article
Cytokine signaling is mediated by the combinatorial usage of seven STAT proteins that form homo- or heterodimers involved in the regulation of specific transcriptional programs. Among STATs, STAT2 is classically known to dimerize with STAT1 and together with IRF9 forms the ISGF3 transcription factor complex that has long been considered a hallmark of activation by type I and type III interferons. However, accumulating evidence reveal distinct facets of STAT2 and IRF9 activity mediated by the segregation in alternative STAT1-independent complexes/pathways that are thought to trigger different transcriptional programs. The goal of this review is to summarize our current knowledge of the stimuli, regulatory mechanisms, and function of these alternative pathways.