Content uploaded by Julie Schwartz
Author content
All content in this area was uploaded by Julie Schwartz on Feb 16, 2015
Content may be subject to copyright.
FISH Labeling Reveals a Horizontally Transferred
Algal (Vaucheria litorea) Nuclear Gene on a Sea Slug
(Elysia chlorotica) Chromosome
JULIE A. SCHWARTZ
1
, NICHOLAS E. CURTIS
2
, AND SIDNEY K. PIERCE
1,3
*
1
Department of Integrative Biology, University of South Florida, Tampa, Florida 33620;
2
Department of
Biology and Chemistry, Ave Maria University, Ave Maria, Florida 34142; and
3
Department of Biology,
University of Maryland, College Park, Maryland 20742
Abstract. The horizontal transfer of functional nuclear
genes, coding for both chloroplast proteins and chlorophyll
synthesis, from the food alga Vaucheria litorea to the sea
slug Elysia chlorotica has been demonstrated by pharma-
cological, polymerase chain reaction (PCR), real time PCR
(qRT-PCR), and transcriptome sequencing experiments.
However, partial genomic sequencing of E. chlorotica lar-
vae failed to find evidence for gene transfer. Here, we have
used fluorescent in situ hybridization to localize an algal
nuclear gene, prk, found in both larval and adult slug DNA
by PCR and in adult RNA by transcriptome sequencing and
RT-PCR. The prk probe hybridized with a metaphase chro-
mosome in slug larvae, confirming gene transfer between
alga and slug.
Introduction
Kleptoplasty, the process of phagocytosis, sequestration,
and utilization of algal chloroplasts by certain digestive
cells in some species of herbivorous sea slugs (Sacoglossa),
is a well-known phenomenon that has been studied by many
investigators for 50 years or more (reviewed by Pierce and
Curtis, 2012). The symbiotic plastids, kleptoplasts, can pho-
tosynthesize inside the slug cell for varying periods, from
hours to months, depending upon the slug species, provid-
ing at least some source of energy for the animal. The
longer-lived associations between the captured plastids and
the slug involve various behavioral, morphological, and
biochemical adaptations to maintain the chloroplasts in the
absence of the mechanisms of organelle renewal that are
present in the algal cell (Pierce and Curtis, 2012).
Of particular interest is the growing evidence that Elysia
chlorotica (Gould 1870), a slug species with one of the
longest (9 mon or more) maintained associations with chlo-
roplasts from its algal food, Vaucheria litorea (C. Agardh
1823), has somehow acquired functional algal nuclear
genes. The products of these transferred genes help with the
long-term maintenance of plastid function within the slug
cell. Chloroplast reproduction has never been found in E.
chlorotica (or any other sacoglossan) (Pierce and Curtis,
2012), and the larval stages feed on unicellular algae (West
et al., 1984). So, once metamorphosis to the adult form
occurs, each generation of adult slugs must take up chloro-
plasts anew. Inside the adult E. chlorotica digestive cells,
chloroplast proteins are synthesized for months after plastid
uptake (Mujer et al., 1996; Pierce et al., 1996; Green et al.,
2000), and many of those are nuclear-encoded in the slug
cell (Hanten and Pierce, 2001; Rumpho et al., 2009). Evi-
dence for the presence of algal nuclear genes coding for
chloroplast proteins in DNA from both E. chlorotica adults
and larvae has been reported from polymerase chain reac-
tion (PCR) experiments (Pierce et al., 2007; Rumpho et al.,
2008, 2009; Schwartz et al., 2010) as well as real time PCR
(qRT-PCR) and transcriptome sequencing of RNA from E.
chlorotica adults (Soule and Rumpho, 2009; Pierce et al.,
2012). Therefore, all of these data agree that several dozen
algal nuclear genes have been transferred from the alga to
slug cells, have been integrated into the slug cell biology,
are transmitted to the next generation of slugs, and then are
actively transcribed and translated in the animals. However,
genome sequencing of E. chlorotica “egg ribbons,” which
* To whom correspondence should be addressed. E-mail: pierce
@usf.edu
Received 21 April 2014; accepted 21 October 2014.
Reference: Biol. Bull. 227: 300 –312. (December 2014)
© 2014 Marine Biological Laboratory
300
are actually unhatched larvae, failed to find any algal se-
quences (Bhattacharya et al., 2013). This negative result
was used to dismiss all of the previous positive results,
including those with larvae, that demonstrated horizontal
gene transfer between V. litorea and E. chlorotica, although
Bhattacharya et al. (2013) “stress[ed]” that their results did
not “prove” the absence of algal genes in the slug genome.
Instead, alternative hypotheses were proposed to explain the
mechanism of long-term chloroplast maintenance in E.
chlorotica without a gene transfer event incorporated into
the germ line, including the possibility of extrachromo-
somal DNA fragments taken up during feeding and missed
in the adult sequencing efforts (Bhattacharya et al., 2013).
However, the unhatched embryos do not have chloroplasts
and have not fed, so the source of the PCR-identified algal
sequences in the larval DNA found in earlier studies cannot
be from feeding. Furthermore, if extrachromosomal DNA
were the source of the transferred algal genes in the adults,
it would require the uptake of the correct DNA fragments by
every cell in every slug in every generation.
Since a negative result from genomic data will always be
subject at least to “not enough data” and “not in the data-
base” criticisms, we have used a different approach to test
the E. chlorotica genome for the presence of algal genes.
Instead of just more genome sequencing, we used fluores-
cence in situ hybridization (FISH) and fluorescent micros-
copy to test chromosomes from pre-hatched E. chlorotica
larvae (which have never been exposed to any algae) for the
presence of algal sequences. We found that a gene probe
made with the coding sequence of a V. litorea nuclear gene,
prk, bound to one of the chromosomes in the unhatched
larva of E. chlorotica, confirming the positive gene transfer
results found by most of the previous studies.
Materials and Methods
Sources and culture of slugs and algae
Specimens of Elysia chlorotica were collected from a salt
marsh near Menemsha on Martha’s Vineyard, Massachu-
setts, and shipped overnight to our laboratory in Tampa,
Florida. The sea slugs were kept at 10 °C in aerated aquaria
containing sterilized, 1000 mosm, artificial seawater (ASW;
Instant Ocean) on a 14:10-h light/dark cycle. The slugs were
starved for at least one month before use under these con-
ditions. Sterile laboratory cultures of Vaucheria litorea
were maintained in 250 mosm ASW containing a modified
F/2 medium (Bidwell and Spotte, 1985) and transferred into
fresh medium bi-monthly. The algal culture was grown in
an incubator at 20 °C on a 14:10-h light/dark cycle.
Localization of transferred algal nuclear genes on Elysia
chlorotica chromosomes
Metaphase chromosomes in cells of developing E. chlo-
rotica embryos were examined for the presence of algal
genes by using FISH labeling and microscopy. Gastrula-
stage embryos were tested since many more dividing cells
are present in them than in later developmental stages or
adults. The slugs were induced to produce egg masses by
moving them into aquaria at room temperature (RT), still
under the 14:10 light/dark cycle (Harrigan and Alkon,
1978). The aquaria were monitored daily for egg masses,
which were collected, rinsed with ASW, and placed into
small culture dishes containing ASW. After the embryos
had developed to the gastrula stage at RT, the egg masses
were gently passed through a 22-ga needle several times to
remove the jelly coat and free the egg capsules. The capsule
suspension was centrifuged at 1500 ⫻gfor 5 min at RT, the
supernatant was decanted, and the dissociated jelly coat
layer was removed from the top of the pellet using a pipet
tip. The egg capsules were transferred to ASW containing
1.0 mmol l
⫺1
colchicine (Sigma-Aldrich, St. Louis, MO)
and incubated for1hatRTinthedark, with slight agitation,
to arrest all cell division at metaphase. The suspension was
then centrifuged at 1500 ⫻gfor 5 min and the supernatant
was decanted. The egg capsules were resuspended in 250
mosm ASW and incubated for 20 min at RT to swell the
chromosomes, then centrifuged again at 1500 ⫻g; the pellet
containing the egg capsules was fixed with methanol/acetic
acid (3:1) (fixation solution) and incubated for 20 min at
RT. This fixation step was repeated two additional times.
Finally, the fixed gastrulae were stored in the fixation solu-
tion overnight at ⫺20 °C prior to microscope slide prepa-
ration (modified from Rønne, 1989).
Chromosome preparation for karyotype analysis and
FISH labeling
The microscope slide preparations of chromosomes used
for karyotyping or FISH analysis required about 100 –150
fixed gastrulae per slide to obtain at least 10 isolated meta-
phase chromosome spreads for analysis. The gastrula-con-
taining E. chlorotica egg capsules described above were
resuspended in fresh fixation solution, incubated at RT for 5
min, and then centrifuged at 12,000 ⫻gfor 5 min at RT.
The egg capsules were broken open, releasing the meta-
phase chromosomes, by resuspending them in acetic acid/
water (1:1), incubated for 5 min at RT, then, using a pipet
tip that was angled ⬃45° to the slide surface, the suspension
was spread onto pre-warmed (42 °C) glass microscope
slides and dried for1hat42°C.Slides were brought to RT
and used immediately for karyotyping or aged for 24 h prior
to their use for FISH analysis.
Karyotype analysis: Elysia chlorotica
Elysia chlorotica chromosome number and morphology
were determined using fluorescence microscopy. The chro-
mosomes were visualized by staining their DNA with 4⬘,6-
diamidino-2-phenylindole (DAPI) antifade mounting buffer
301
ALGAL GENES ON SEA SLUG CHROMOSOMES
(Invitrogen, Carlsbad, CA) and viewed using an inverted
fluorescent microscope (Axiovert 200, Zeiss, Oberkochen,
Germany) equipped with a DAPI optical filter and an 100⫻/
1.40 Plan-Apochromat oil objective. Chromosomes were
counted, classified, and paired, based on their size and
morphology, from about 50 well-isolated, metaphase chro-
mosome spreads acquired from images of five different
chromosome preparations captured using a digital camera
(Hamamatsu IEEE1394 Orca-Era) and Velocity 6.1.1 soft-
ware. Images shown in the Results section were cropped
and sharpened using Photoshop Elements (ver. 9).
FISH localization of transferred algal genes
Elysia chlorotica metaphase chromosomes were tested
with FISH labeling utilizing a gene probe designed to label
the V. litorea nuclear gene prk, which encodes the Calvin
cycle enzyme phosphoribulokinase. Prk was chosen from
among the variety of possible genes because several previ-
ous studies have found evidence for its horizontal transfer
between V. litorea and E. chlorotica using both polymerase
chain reaction (PCR) experiments in adult and larval slug
DNA (Rumpho et al., 2009; Schwartz et al., 2010) and adult
slug transcriptome sequence data analysis (Pierce et al.,
2012). Also, prk encodes a protein used exclusively in the
Calvin cycle and has no known homolog in non-photosyn-
thetic organisms.
A 1218-bp, V. litorea prk-targeting probe was synthe-
sized using native sequence (GENBANK accession
#AF3366986) (Schwartz et al., 2010) and labeled with the
hapten digoxigenin (DIG) so that it could be detected with,
and amplified by, FISH labeling and fluorescent micros-
copy. Genomic DNA (gDNA) and RNA were purified from
V. litorea, and cDNA was synthesized using previously
described techniques (Schwartz et al., 2010). Amplicons of
prk (1.2 kb using V. litorea cDNA) were obtained by using
PCR, which used a reaction mixture containg 100 ng of
gDNA or cDNA, 12.5 pmol of primer, 200
mol l
⫺1
dNTP
mix (Roche Applied Science, Indianapolis, IN), and 1.25
units of IDProof DNA polymerase (ID Labs, London, On-
tario, Canada). The reactions were initially denatured for 2
min at 94 °C, then underwent 35 cycles of 30-s denaturation
at 94 °C, 30-s annealing at a temperature 5 °C below the
melting temperature of the primers, and then a 1-min ex-
tension at 72 °C. The reaction products were electropho-
resed on a 1% agarose gel; the amplicons were extracted
from the gel and then purified (QIAquick Gel Extraction
Kit, Qiagen, Valencia, CA). The purified amplicons were
cloned (TOPO TA cloning kit, Invitrogen, Grand Island,
NY) as per manufacturer’s instructions. Individual clones
were sequenced (Eurofins MWG Operon, Huntsville, AL)
to verify sequence integrity. The bacterial colonies were
grown at 37 °C overnight in LB media containing 50
g/ml
kanamycin. The insert-containing plasmid vectors were pu-
rified (Wizard Plus SV Minipreps DNA Purification Kit,
Promega, Madison, WI) and used as the templates for FISH
probe synthesis. FISH probes were synthesized and simul-
taneously labeled with digoxigenin (DIG) (PCR DIG Probe
Synthesis Kit, Roche Applied Science, Indianapolis, IN) as
per manufacturer’s instructions.
prk primers:
Forward: 5⬘ATGCTCGTACATAGTCTAATTC 3⬘
Reverse: 5⬘TTATGCAGCCTCGGCTTGG 3⬘
Hybridization of prk probe with slug chromosomes
The chromosome spreads described above were pre-
treated to increase assay sensitivity and specificity using
methods modified from Henegariu et al. (2001) and Vitturi
et al. (2000), determined in preliminary experiments. The
dried chromosomes on the microscope slides were rehy-
drated in phosphate-buffered saline (PBS) (pH 7.4) for 30
min at 37 °C. Then the slides were incubated for 7 min in
0.005% pepsin/0.01N HCl (pH 2.0) that was pre-warmed to
37 °C to digest any cytoplasmic proteins that could cause
non-specific probe binding. The pepsin digestion was
stopped by immediately raising the pH back to 7.4 by
immersing the samples in PBS and incubating them for 5
min at RT. The slides were incubated for 10 min in PBS/50
mmol l
⫺1
MgCl
2
at RT, then post-fixed in PBS containing
50 mmol l
⫺1
MgCl
2
and 1% formaldehyde to maintain
chromosome morphology. They were then washed in PBS
for 5 min with gentle agitation, dehydrated through an
ethanol series (70%, 95%, 100%, 5 min each concentration),
then dried for 15 min at RT. The DNA in the chromosomes
was denatured by incubation with 200
lof2⫻saline-
sodium citrate buffer (300 mmol l
⫺1
NaCl and 30 mmol l
⫺1
Na
3
C
6
H
5
O
7
, pH 7.0; 2⫻SSC) containing 70% deionized
formamide for 5 min at 70 °C. The slides were briefly rinsed
in 2⫻SSC and then dehydrated through an ethanol series.
The DIG-labeled prk probe was then bound to the chro-
mosomes and viewed with a fluorescent microscope. A
hybridization solution containing the prk probe was pre-
pared (2⫻SSC, 45% deionized formamide, 5% dextran
sulfate, 1.75
g of mouse cot-1 DNA [Invitrogen, Grand
Island, NY] and 1.7⫻Denhardt’s solution containing ⬃20
ng of DIG-labeled prk probe), denatured for 7 min at 76 °C
in a thermocycler, then snap-cooled in an ice bath for 2 min.
Then a 15-
l drop was pipetted onto the denatured chro-
mosomes on the microscope slide, covered by a 20 mm ⫻
20 mm cover slip, and the edges sealed with rubber cement
(modified from Vitturi et al., 2000). Probe hybridization
with the chromosomes was achieved by incubation in a
humidified chamber for 17–20 h at 35 °C. This temperature
was chosen as the result of preliminary experiments per-
formed to determine an incubation temperature that mini-
mized non-specific probe binding. Then the coverslips were
removed and unbound prk probe was removed from the
302 J. A. SCHWARTZ ET AL.
slides by washing for 5 min with agitation: once in 2⫻SSC
(37 °C), three times in 2⫻SCC containing 45% formamide
(37 °C) and then two times in 0.5⫻SCC (65 °C). All wash
steps in the series were performed in a Coplin jar containing
40 ml of each washing solution.
The chromosomes were prepared for probe detection by a
series of RT equilibration washes performed once each in
the following: 2⫻SSC, PBS, and finally in PBS/0.1%
Tween 20. DNA-free areas on the slide preparation were
blocked in blocking solution (Roche Applied Science, In-
dianapolis, IN) for1hat37°C,then rinsed in PBS/0.1%
Tween 20. Finally, the prk probe was labeled for fluores-
cence detection by first incubating the chromosomes with
blocking solution containing 250 ng/ml mouse monoclonal
anti-DIG (Roche Applied Science, Indianapolis, IN) for 1 h
at 37 °C, then washing three times for 5 min at RT in
PBS/0.1% Tween 20 with agitation. Next, the slides were
incubated with blocking solution containing 2.5
g/ml anti-
mouse AlexaFluor488 or AlexaFluor594 (Invitrogen, Grand
Island, NY) for 45 min at 37 °C and washed three times in
a foil-wrapped Coplin jar for 5 min at RT in PBS/0.1%
Tween 20 with agitation. The slides were dehydrated
through an ethanol series and allowed to dry for 20 min in
the dark. DAPI antifade mounting buffer (Invitrogen, Grand
Island, NY) was pipetted onto each slide to counterstain the
chromosomes (blue) and provide contrast to the probe
(green or red) and covered with a 30 mm ⫻30 mm cover-
slip. The chromosomes were then viewed with a confocal
microscope (UltraVIEW ERS Spinning Disk, PerkinElmer,
Waltham, MA) or an inverted fluorescent microscope
equipped with standard optical DAPI, FITC, and rhodamine
filters, using a 100⫻/1.40 Plan-Apochromat oil objective.
Once the labeled probe was detected, the chromosomes
were viewed using gas lasers (Krypton 561 and/or Argon
488/515) using the following parameters: DAPI— excita-
tion 405-nm, laser emission 485 nm (W60), 705 nm filter
(W90); Alexa Fluor488 — excitation 488 nm, laser emission
527 nm filter (W55); and Alexa Fluor594 — excitation 640
nm, laser emission 485 nm (W60), 705 nm filter (W90).
Images were acquired, analyzed, and processed using the
same camera and software used for E. chlorotica karyotype
analysis described above. This procedure was repeated on
preparations from 13 different groups of larvae from differ-
ent egg masses (See Table 1).
Controls to verify prk chromosome labeling specificity
Several control procedures were performed to confirm
reagent and chromosome quality as well as the specificity of
prk labeling of the E. chlorotica chromosome.
Reagent and chromosome quality in the various chromo-
some slide preparations was verified by using the FISH
procedures described above and substituting a 960-bp probe
designed to target the actin gene. The actin probe was
synthesized from E. chlorotica gDNA, as described above
for the prk probe, using the following primers:
actin primers:
Forward: 5⬘AGGGTGTCATGGTTGGTA 3⬘
Reverse: 5⬘GATCCACATCTGCTGGAA 3⬘
Actin was chosen because of its ubiquity, sequence con-
servation, and presence in multiple, similar isoforms in most
species (Zappula et al., 2005).
Prk binding specificity was tested in several ways. First,
the FISH procedure was performed on chromosome slide
preparations with all components except the prk probe to
ensure that the antibody labeling system was not non-
specifically binding to the chromosomes. Second, a gene
probe for an algal sequence that should not bind to the slug
DNA was tested. The gene for the large subunit of ribulose-
1,5-bisphosphate carboxylase/oxygenase (RuBisCo) was
used for this experiment as it is a chloroplast-encoded gene
in V. litorea (Curtis et al., 2006, 2007). A 631-bp rbcL
probe was synthesized from V. litorea gDNA, using the
methods described above and the following primers, and
substituted for the prk probe in the FISH procedure de-
scribed above. Both of these controls were tested a mini-
mum of seven times on seven different metaphase chromo-
some preparations and along with each prk labeling run (See
Table 1).
rbcL primers: Forward: 5⬘AATGGATAAATTTGGACG 3⬘
Reverse: 5⬘ACGTAATGCTGCCCAATCC 3⬘
Prk binding specificity for E. chlorotica chromosomes
was also tested using chromosomes from Aplysia califor-
nica (Cooper 1863), a non-kleptoplastic, herbivorous slug,
relatively phylogenetically close to Elysia. Although the
chromosome number has been reported as n⫽17 for
several aplysiidaean species including Aplysia benedicti
(Elliot 1899) (⫽Aplysia dactylomela Rang 1828) (Patter-
son, 1969), we were unable to locate a karyotype for A.
californica in the literature, so to be sure all chromosomes
were accounted for in our experiments, a karyotype analysis
was done before the prk binding tests.
Karyotype: Aplysia
Aplysia californica egg strands were kindly provided by
Thomas Capo from the National Aplysia Resource Facility
at the Rosenstiel School of Marine and Atmospheric Sci-
ence, University of Miami, Miami, Florida. Freshly depos-
ited egg strands were shipped to Tampa overnight and, upon
arrival, were rinsed in 1000 mosm ASW; embryos were
allowed to develop to the gastrula phase. The egg strands
were transferred to 1000 mosm ASW containing 1.0 mmol
l
⫺1
colchicine and incubated for6hatRTinthedark with
slight agitation. After the incubation, gastrulae were liber-
ated from the jelly coat and egg capsules by finely mincing
the egg strands with a razor blade. The liberated gastrulae
303
ALGAL GENES ON SEA SLUG CHROMOSOMES
were centrifuged at 1500 ⫻gfor 5 min at RT. Chromo-
somes were swelled by resuspending the gastrulae in 500
mosm ASW and incubating them at RT for 20 min. The A.
californica gastrulae were collected by centrifugation, then
fixed, stored, and karyotyped using the same procedures
described above for the E. chlorotica preparations. Once the
karyotype was established, the chromosomes were tested
for prk binding as described below.
Nuclear prk binding: Vaucheria
A final control experiment was to ensure that the prk
probe would label V. litorea DNA. There is almost no
information in the literature about Vaucheria chromosomes
in general, and V. litorea in particular. The filaments of V.
litorea are coenocytic with nuclei scattered along the length,
but nuclear division occurs at the growing tip, usually in the
dark. The nuclei are small, and the chromosomes are tiny
and may not condense during nuclear division. The older
literature indicates possibly 5 chromosomes in some of the
freshwater Vaucheria species, but other chromosome num-
bers have been reported also (Gross, 1937). Electron mi-
croscopy of nuclear division in V. litorea found spindles but
no recognizable chromosomes (Ott and Brown, 1972). As a
result, we tested prk labeling using V. litorea nuclei as
described below.
Preparation of Vaucheria litorea nuclei
Vaucheria litorea filaments were rinsed in algal culture
medium and blotted to remove excess liquid. The filaments
were placed in cold (4 °C) homogenization buffer (250
mosm ASW containing 250 mmol l
⫺1
sucrose, 10 mmol l
⫺1
MgCl
2
and 1 mmol l
⫺1
DTT), minced with a razor blade,
then homogenized in a glass homogenizer. The algal sus-
pension was filtered through six layers of cheesecloth to
remove large clumps, then the filtrate was centrifuged at
500 ⫻gfor 5 min at RT to pellet the nuclei but leave other
cellular components in the supernatant. The supernatant was
discarded and the pellet was resuspended in 250 mmol l
⫺1
sucrose containing 10 mmol l
⫺1
MgCl
2
. The suspension
was applied to a two-step sucrose gradient (equal volumes
of 1 mol l
⫺1
and 0.5 mol l
⫺1
sucrose) and centrifuged at
1000 ⫻gfor 5 min at RT to concentrate the nuclei (mod-
ified from Luthe and Quatrano, 1980). The upper, slightly
green layer at the top of the 0.5 mol l
⫺1
sucrose gradient
step was collected, washed two times in 250 mosm ASW,
then resuspended in fixation solution and incubated for 20
min at RT. This fixation step was repeated two additional
times and the nuclei stored in the fixation solution overnight
at ⫺20 °C prior to slide preparation.
Prk binding on Vaucheria litorea nuclei and Aplysia
californica metaphase chromosomes
One hundred V. litorea nuclei or 100 –150 fixed A. cali-
fornica gastrulae per slide were needed to obtain at least 10
single nuclei not associated with any cellular debris or at
least 10 well-spaced metaphase chromosome spreads. V.
litorea nuclei and liberated A. californica gastrulae were
resuspended in fresh fixation solution and incubated at RT
for 5 min. The suspensions were transferred to microfuge
tubes and centrifuged at 12,000 ⫻gfor 5 min at RT. The
pellets were resuspended in fixation solution and dropped
onto a RT glass microscope slide by using a pipet tip; the
fixation solution was allowed to evaporate. The A. califor-
nica chromosomes were spread by adding 20
lof1:1
acetic acid/water. Then both the nuclei and chromosome
slides were transferred to a 42 °C incubator and dried for
1 h. They were brought to RT and aged for 24 h prior to
their use for FISH analysis.
The A. californica chromosome pre-treatment, in situ
hybridization, detection, and microscopy experiments were
performed using the same procedures as described above,
except that an actin probe synthesized using A. californica
gDNA was substituted for the E. chlorotica actin probe to
verify chromosome and reagent quality.
Results
An ideal result from these experiments would be for the
various gene probes to bind at a similar location on each
sister chromatid of two morphologically similar—therefore,
homologous— chromosomes in the middle of a well-iso-
lated chromosome spread that accounted for all of the
diploid number of chromosomes, all of which were easily
photographed. In practice, that almost never happened in a
single preparation, as the result of degree of chromosome
coiling, physical position of the chromosome, intermingling
of chromosomes from neighboring nuclei, loss of chromo-
somes, length of probe sequence, working distance, and
field of view, among other reasons. Many preliminary ex-
periments were performed to maximize the encounters with
the fluorescent signal, but an ideal result was rare. Instead,
the results described below are a compilation of hundreds of
examinations of many dozens of preparations from many
egg masses on multiple occasions (Table 1).
Although there are a few large, easily recognized chro-
mosomes in the E. chlorotica cell nucleus, more than half of
them are quite small (less than 2 or 3
m), metacentric, and
have arms of very similar length (Fig. 1). These smaller
chromosomes are very difficult to distinguish from each
other. The chromosomes in Figure 1 were assembled show-
ing potential homologous pairs, but possibly members of
the smaller pairs should be interchanged. Nevertheless,
counts of chromosome numbers from 50 isolated metaphase
smears on slides from 10 different preparations routinely
304 J. A. SCHWARTZ ET AL.
produced a haploid number of 15 (2n⫽30). In comparison,
among a variety of opisthobranch species, chromosome
numbers range from 13 to 17 (Burch and Natarajan, 1967;
Thiriot-Quievreux, 2003). Two other species of Elysia (E.
amakusana [Inaba, 1959] and E. viridis [Mancino and
Sordi, 1964]) each had n⫽17.
The FISH actin probe was always localized on the arms
of two, probably homologous, intermediate-sized E. chlo-
rotica chromosomes in the metaphase spreads (Fig. 2). It
was unusual for all probe binding sites on the chromosomes
to be labeled in every preparation (Fig. 2), but the actin label
was not found anywhere else among the chromosomes. In
all our experiments, the prk probe labeled only the arms of
two of the tiny E. chlorotica chromosomes in the metaphase
spreads (Table 1, Fig. 3). Because there are so many of these
tiny chromosomes that are not distinguishable from each
other with the techniques used here, we cannot say for sure
that the same chromosome was labeled in every preparation,
but the label never appeared on more than two chromo-
somes in each nuclear group. So, importantly, a FISH probe
for an algal nuclear gene binds to a slug chromosome.
The reagent control experiments were always negative in
preparations from all species (Table 1). No chromosome in
any preparation was ever labeled without a gene probe
present. Similarly, the rbcL probe was never observed
bound to an E. chlorotica chromosome (Table 1). So neither
the reagents nor the probes caused non-specific signals
under the conditions we used.
The A. californica karyotype analysis consistently found
17 chromosomes (2n⫽34) in metaphase smears from
seven different egg masses (Fig. 4). As was the case with E.
chlorotica, several of the larger chromosomes were easily
distinguished by size and centromere position, but some of
the smaller chromosomes are quite similar in morphology
and require more than DAPI staining to distinguish them
adequately. The actin probe routinely bound only to two,
likely homologous, intermediate-sized A. californica chro-
mosomes in the metaphase spreads (Fig. 5). As with the E.
chlorotica results, it was unusual for all the actin sites to be
labeled in every A. californica preparation, but no more than
two chromosomes were ever labeled. These control exper-
iments ensure that we were looking at all the chromosomes
present in A. californica, and that the chromosomal DNA
was capable of binding the FISH probes. Binding of the prk
probe was never observed in any of the A. californica
preparations.
Finally, as expected, the V. litorea nuclei were small, 3– 4
m in diameter, with a prominent nucleolus (Fig. 6a).
Although we failed to visualize V. litorea chromosomes, the
prk probe labeled the algal nuclei (Fig 6b), sometimes
showing two probe-binding sites per nucleus.
Discussion
The FISH labeling presented in the results clearly dem-
onstrates that one of the Elysia chlorotica chromosomes has
a site that binds a probe made up of the nucleotide sequence
for the Vaucheria litorea nuclear gene, prk. This is the third
line of evidence that genes from the slug’s algal food
species have not only been transferred into the slug cell but
have been incorporated into the chromosomes and are now
vertically transmitted in the slug germ line. This result is
supported by earlier work that located prk, and other V.
litorea nuclear genes as well, in the genomic DNA of both
Table 1
Summary of the results of prk FISH labeling of Elysia chlorotica chromosome preparations
Date of egg mass
1
Reagent Control Negative Control rbcL probe Positive Control actin probe prk Probe
5/14/13 Negative Negative
2
Positive
2
Positive, 100%
2
5/25/13 Negative Negative Positive Positive
3
, 100%
5/18/13 Negative Negative Positive Positive, 100%
4/7/13 Negative Negative Positive Positive, 100%
5/30/13 Negative Negative Positive Positive, 100%
6/11/13 Negative Negative Positive Positive, 100%
6/12/13 Negative Negative Positive Positive, 100%
3/4/13 Negative Negative Positive Positive, 100%
6/13/13 Negative Negative Positive Positive, 100%
2/16/13 Negative Negative Negative Negative
4
2/16/13 Negative Negative Negative Negative
4
3/8/13 Negative Negative Positive Positive
5
, 100%
3/4/13 Negative Negative Positive Positive, 100%
1
Each egg mass was treated separately on a different microscope slide.
2
Result (positive labeling/negative), % of labeled chromosomes that were the same morphology.
3
Fig. 3A.
4
The positive control (actin column) failed in these experiments also, indicating a protocol issue. These were not included in the results.
5
Fig. 3B.
305ALGAL GENES ON SEA SLUG CHROMOSOMES
E. chlorotica larvae and adults using PCR (Pierce et al.,
2007; Rumpho et al., 2009), in RNA from adult slugs by
qRT-PCR (Soule and Rumpho, 2009), as well as in the
E. chlorotica adult transcriptome (Pierce et al., 2012). Two
other sequencing efforts failed to find algal sequences in the
E. chlorotica transcriptome (Pelletreau et al., 2011) or the
larval (“egg”) genome (Battacharya et al., 2013). However,
those sequencing studies either did not produce a complete
genome and used an incomplete V. litorea genomic data set
(Battacharya et al., 2013), or used no V. litorea data at all
(Pelletreau et al., 2011) for sequence matching purposes.
Further, the larval sequencing study (Battacharya et al.,
2013) pooled DNA from hundreds of individuals, which
could have produced assembly issues resulting from
Figure 1. DAPI-stained karyotype of metaphase chromosomes of Elysia chlorotica. The chromosomes in
top row are readily recognized individually by their size and position of the centromere. The intermediate-sized
chromosomes (second row, first four from the left) are recognizable as a group, but not from each other, as is
the case with the smallest group (bottom row and right-hand middle row). The round object in the field is a
nucleus. This image was taken at 1000⫻under oil. Scale bar ⫽20
m.
306 J. A. SCHWARTZ ET AL.
Figure 2. FISH-labeled micrograph of Elysia chlorotica chromosomes labeled with the probe for actin
counter-stained with DAPI. This view contains chromosomes from more than one cell, but does not have a
complete set of chromosomes. The probe has labeled both arms of sister chromatids on an intermediate-sized
chromosome and one arm of another (arrows), morphologically similar, chromosome. No other chromosome
morph was ever labeled with the actin probe. The three round objects are intact nuclei. Probes occasionally
bound to the microscope slide surface, which is sticky to hold the chromosomes and nuclei in place, and a few
are visible here. This image was taken at 1000⫻under oil. Scale bar ⫽20
m.
307ALGAL GENES ON SEA SLUG CHROMOSOMES
heterozygocity, and analyzed only the unassembled raw
reads. Clearly, the FISH technique and the control experi-
ments have produced unambiguous evidence of a trans-
ferred algal sequence in the E. chlorotica genome.
The mechanism of gene transfer is of interest, but un-
known. The phagosomal-based feeding mechanism utilized
by gastropods (Owen, 1966) could take up nuclei and other
algal cell inclusions, as well as the chloroplasts (Taylor,
1968; Martin et al., 2013). Transcriptome sequencing sug-
gests that several dozen algal nuclear genes are expressed in
the E. chlorotica cell, perhaps indicating that relatively
large pieces of algal DNA rather than individual genes were
transferred. However, the E. chlorotica transcriptome anno-
tation found genes only in the slug RNA associated with
photosynthesis proteins and their processing (Pierce et al.,
2012). A wider variety of algal proteins might be expected
to be present if large pieces of algal DNA were involved.
Furthermore, although protistan kleptoplasty often involves
the presence of algal nuclei or nuclear remnants in addition
to the chloroplast within the host cell (Gast et al., 2007;
Johnson et al., 2007; Nowack et al., 2011), all attempts to
locate algal nuclei or their remnants with molecular or
microscopical experiments in several species of Elysia have
been negative (reviewed in Pierce and Curtis, 2012). So the
results so far suggest that pieces of DNA rather than entire
chromosomes or individual genes may constitute the trans-
ferome. It will require a great deal more FISH testing to
learn the chromosomal positions of other algal genes.
The location of algal nuclear genes on the host cell
chromosomes further demonstrates the high amount of in-
tegration of the chloroplast and the photosynthesis mainte-
nance mechanisms into the E. chlorotica cell biology. Al-
though chloroplast reproduction has never been reported in
any species of kleptoplastic sacoglossan, a wide array of
adaptations for maintaining the chloroplasts are present in
the various species, ranging from essentially nothing—
chloroplasts are taken up into phagosomes and rapidly di-
gested—to the high level of integration in E. chlorotica
Figure 3. FISH-labeled micrographs of Elysia chlorotica chromosomes from two different egg mass
preparations (A, B) done on different dates (Table 1), labeled with the prk probe counter-stained with DAPI.
Several of both the larger and smaller chromosomes are not present in these fields of view. The prk probe has
labeled the arms of both sister chromatids of one of the smallest chromosomes in both A and B. No other
chromosome morph was ever labeled with the prk probe. This image was taken at 1000⫻under oil. Scale bar ⫽
20
m.
308 J. A. SCHWARTZ ET AL.
(reviewed in Pierce and Curtis, 2012). Not only do the V.
litorea chloroplasts persist for 7– 8 mon or longer in starved
E. chlorotica, but they continue to photosynthesize, fix
carbon, produce oxygen, synthesize chlorophyll, and be
translationally active. Both chloroplast- and nuclear-en-
coded chloroplast proteins are synthesized, nuclear-encoded
transcripts for chloroplast genes are present in the slug cell
RNA, and the genes for some of them have been located in
genomic DNA of both larvae and adults by PCR (reviewed
by Pierce and Curtis, 2012). In addition, while many other
species of sacoglossans—including some that are able to
keep the chloroplasts for several months, such as E. timida
(Risso 1818)—are rarely found away from the algal chlo-
roplast source and continually turn over the algal organelles,
individual E. chlorotica are often found in our field site
during seasons-long absences of V. litorea. Unlike E. chlo-
rotica,E. timida seems to have little capacity to sustain
photosynthesis for more than a few weeks (Casalduero and
Muniain, 2008) although the chloroplasts are present for
2–3 mon, and it also may not have any cellular biochemical
support for them. Indeed, transcriptome sequencing of E.
timida did not find any algal transcripts, although the data
set was small and donor algal (Acetabularia) genome se-
quences were only partially available (Wa¨gele et al., 2011),
so matches might have easily been missed. Other sacoglos-
Figure 4. DAPI-stained karyotype of the metaphase chromosomes of Aplysia californica. There is less
morphological variation between the chromosomes than in Elysia chlorotica, but the top two rows are readily
identifiable by arm length and centromere position. The smallest chromosome (bottom right) is also easily
resolved. Of the remaining, two groups of intermediate-sized chromosomes are evident, which are all morpho-
logically similar by DAPI staining, except for one (fourth row left), which has an acentric centromere. This
image was taken at 1000⫻under oil. Scale bar ⫽20
m.
Figure 5. FISH-labeled micrograph of Aplysia californica metaphase
chromosomes labeled with the actin probe and counter-stained with DAPI.
Two chromosomes in the field are labeled, one has 3 probes bound to it,
perhaps indicating some non-specific binding or binding to another actin
gene copy. This image was taken at 1000⫻under oil. Scale bar ⫽20
m.
309ALGAL GENES ON SEA SLUG CHROMOSOMES
san species with similar lengths of plastid function longev-
ity as E. timida (2– 4 mon; namely E. viridis, E. clarki) show
a variety of specific adaptations in their cell biology to
sustain the function of the algal organelle. In some cases,
such as E. clarki, plastid maintenance mechanisms are suf-
ficient to enable enough photosynthesis to occur for long
enough to permit some independence from a food source
(Middlebrooks et al., 2011, 2012, 2014). Although a few
recent accounts based on E. timida have discounted the
importance of photosynthetic function as well as the lon-
gevity and integration of symbiotic plastid function among
the sacoglossans as a group (Wa¨gele et al., 2011; Christa et
al., 2013), it is clear that the broad differences in the
adaptations among species makes generalizations based on
one slug species unwarranted.
All of the research on gene transfer in E. chlorotica so far
has been descriptive, and another aspect of major signifi-
cance, about which nothing is presently known, is the un-
derlying cell biology that permits the phenomenon. The
transfer of genes between species has been demonstrated in
groups other than sea slugs (for example, International
Aphid Genomics Consortium, 2010; Nowack et al., 2011;
Kent et al., 2011), and the integration of foreign organelles
into host cells and subsequent gene transfer is the basis of
the endosymbiotic theory of the origin of eukaryotic cells.
However, the underlying adaptations that permit long-term
survival of a foreign organelle and the integration of a
functional gene and gene product, as well as its transmission
to future generations, are mostly unknown. The foreign
gene must not only get to the host nucleus and find its way
into the expression process, but the gene product must be
appropriately synthesized, folded, transported, targeted, in-
serted, and unfolded, all in a cytoplasm that should not be
biochemically equipped to do all that. Still, those kinds of
biochemical adaptations have occurred many times before,
most obviously in the cases of the integrations of mitochon-
dria and chloroplasts into the eukaryotic cell complex. The
transcriptome analysis of E. chlorotica found not only the
presence of transcripts for proteins that must be turned over
for photosynthesis to persist, but also transcripts for algal
cellular enzymes that are involved in targeting and traffick-
ing chloroplast proteins (Pierce et al., 2012). In addition, the
chloroplast genome is translationally active in E. chlorotica
(Hanten and Pierce, 2001; Pierce et al., 2012) and E. clarki
(Pierce et al., 2003). Possibly, at least some of the chloro-
plast protein synthesis, trafficking, and modification could
be done by hijacking host cell native proteins, but some
presence of algal-specific, protein-trafficking molecules
would seem to be necessary, and indeed, some of them are
present in the E. chlorotica transcriptome. A FISH search
for these kinds of genes using V. litorea gene sequences
might be informative.
Acknowledgments
We thank Tom Capo for kindly providing us with A.
californica egg masses. We are also grateful to a private
donor, who wishes to remain anonymous, for providing
funds to SKP to support this research. The experimental
work was done by JAS as part of the requirements for the
Ph.D degree.
Literature Cited
Bhattacharya, D., K. N. Pelletreau, D. C. Price, K. E. Sarver, and M. E.
Rumpho. 2013. Genome analysis of Elysia chlorotica egg DNA
provides no evidence for horizontal gene transfer into the germ line of
this kleptoplastic mollusc. Mol. Biol. Evol. 30: 1843–1853.
Figure 6. (A, top) DAPI-stained, isolated Vaucheria litorea nuclei.
The round dark structure, slightly off center in both, is the nucleolus. (B,
bottom) FISH-labeled micrograph of an isolated V. litorea nucleus stained
with prk probe. Both images were taken at 1000⫻under oil and enlarged
with the computer. Scale bars ⫽7
m.
310 J. A. SCHWARTZ ET AL.
Bidwell, J. P., and S. Spotte. 1985. Artificial Seawaters: Formulas and
Methods. Jones and Bartlett, Boston.
Burch, J. B., and R. Natarajan. 1967. Chromosomes of some opistho-
branchiate mollusks from Eniwetok Atoll, Western Pacific. Pac. Sci.
21: 252–259.
Casalduero, F. G., and C. Muniain. 2008. The role of kleptoplasts in
the survival rates of Elysia timida (Risso, 1818) (Sacoglossa: Opistho-
branchia) during periods of food shortage. J. Exp. Mar. Biol. Ecol. 357:
181–197.
Christa, G., V. Zimorski, C. Woehle, A. G. M. Tielens, H. Wa¨ gele,
W. F. Martin, and S. V. Gould. 2013. Plastid-bearing sea slugs fix
CO
2
in the light but do not require photosynthesis to survive. Proc. R.
Soc. Lond. B 281: 20132493. doi:10.1098/rspb.2013.2493.
Curtis, N. E., S. E. Massey, and S. K. Pierce. 2006. The symbiotic
chloroplasts in the sacoglossan Elysia clarki are from several algal
species. J. Invertebr. Biol. 125: 336 –345.
Curtis, N. E., S. K. Pierce, S. E. Massey, J. A. Schwartz, and T. K.
Maugel. 2007. The intracellular, functional chloroplasts in adult sea
slugs (Elysia clarki) come from several algal species, and are also
different from those in juvenile slugs. Mar. Biol. 150: 797– 806.
Gast, R. J., D. M. Moran, M. R. Dennett, and D. A. Caron. 2007.
Kleptoplasty in an Antarctic dinoflagellate: caught in evolutionary
transition. Environ. Microbiol. 9: 39 – 45.
Green, B. J., W-Y. Li, J. R. Manhart, T. C. Fox, E. J. Summer, R. A.
Kennedy, S. K. Pierce, and M. E. Rumpho. 2000. Mollusc-
chloroplast endosymbiosis. Photosynthesis, thylakoid protein mainte-
nance and chloroplast gene expression continue for many months in the
absence of the algal nucleus. Plant Physiol. 124: 331–342.
Gross, C. 1937. The cytology of Vaucheria. Bull. Torrey Bot. Club 64:
1–15.
Hanten, J. J., and S. K. Pierce. 2001. Synthesis of several light-
harvesting complex I polypeptides is blocked by cycloheximide in
symbiotic chloroplasts in the sea slug, Elysia chlorotica (Gould): a case
for horizontal gene transfer between alga and animal? Biol. Bull. 201:
34-44.
Harrigan, J. F., and D. L. Alkon. 1978. Laboratory cultivation of
Haminoea solitaria (Say, 1822) and Elysia chlorotica (Gould, 1870).
Veliger 12: 299 –302.
Henegariu, O., P. Bray-Ward, S. Artan, G. H. Vance, M. Qumsyieh,
and D. C. Ward. 2001. Small marker chromosome identification in
metaphase and interphase using centromeric multiplex FISH (CM-
FISH). Lab. Invest. 81: 475– 481.
Inaba, A. 1959. Cytological studies in molluscs. III. A chromosome
survey in the opisthobranchiate Gastropoda. Annot. Zool. Jpn. 32:
81– 88.
International Aphid Genomics Consortium. 2010. Genome sequence
of the Pea Aphid Acyrthosiphon pisum. PLoS Biol. doi: 10.1371/
journal.pbio.1000313.
Johnson, M. D., D. Oldach, C. Delwiche, and D. K. Stoecker. 2007.
Retention of transcriptionally active cryptophyte nuclei by the ciliate
Myrionecta rubra. Nature 445: 426 – 428.
Kent, B. N., L. Salichos, J. G. Gibbons, A. Rokas, I. L. G. Newton,
M. E. Clark, and S. R. Bordenstein. 2011. Complete bacteriophage
transfer in a bacterial endosymbiont (Wolbachia) determined by tar-
geted genome capture. Genome Biol. Evol. 3: 209 –218.
Luthe, D. S., and R. S. Quatrano. 1980. Transcription in isolated wheat
nuclei. I. Isolation of nuclei and elimination of endogenous ribonu-
clease activity. Plant Physiol. 65: 305–308.
Mancino, G., and M. Sordi. 1964. Il corredo cromosomico di alcuni
Opisthobranchi Sacoglossi del mar Tirreno. Atti Soc. Toscana Sci. Nat.
Mem. Ser. B 71: 1–12.
Martin, R., P. Walther, and K.-H. Tomaschko. 2013. Phagocytosis of
algal chloroplasts by digestive gland cells in the photosynthesis-capa-
ble slug Elysia timida (Mollusca, Opisthobranchia, Sacoglossa). Zoo-
morphology 132: 253–259.
Middlebrooks, M. L., S. K. Pierce, and S. S. Bell. 2011. Foraging
behavior under starvation conditions is altered via photosynthesis by
the marine gastropod, Elysia clarki. PLoS One 6: e22162.
Middlebrooks, M. L., S. S. Bell, and S. K. Pierce. 2012. The klepto-
plastic sea slug Elysia clarki prolongs photosynthesis by synthesizing
chlorophyll a and b. Symbiosis 57: 127–132.
Middlebrooks, M. L., S. S. Bell, N. E. Curtis, and S. K. Pierce.
2014. Atypical plant– herbivore association of algal food and a
kleptoplastic sea slug (Elysia clarki) revealed by DNA barcoding
and field surveys. Mar. Biol. 161: 1429 –1440. 10.1007/s00227-014-
2431-9.
Mujer, C. V., D. L. Andrews, J. R. Manhart, S. K. Pierce, and
M. E. Rumpho. 1996. Chloroplast genes are expressed during intra-
cellular symbiotic association of Vaucheria litorea plastids with the
sea slug Elysia chlorotica. Proc. Natl. Acad. Sci. USA 93: 12333–
12338.
Nowack, E. C. M., H. Vogel, M. Groth, E. R. Grossman, M. Melko-
nian, and G. Glockner. 2011. Endosymbiotic gene transfer and
transcriptome regulation of transferred genes in Paulinella chromato-
phora. Mol. Biol. Evol. 28: 407– 422.
Ott, D. W., and R. M. Brown. 1972. Light and electron microscopical
observations on mitosis on Vaucheria litorea Hofman ex C. Agardh.
Br. Phycol. J. 7: 361–374.
Owen, G. 1966. Digestion. Pp. 53–96 in Physiology of Mollusca, Vol. 2,
K. M. Wilbur and C. M. Yonge, eds. Academic Press, New York.
Patterson, C. M. 1969. Chromosomes of the molluscs. Pp. 635– 686 in
Proceedings of the Symposium on the Mollusca, Part II, K. Virabhadra
Rao, ed. Marine Biological Association of India, Fisheries P. O.,
Mandapam Camp, India.
Pelletreau, K. M., D. Bhattacharya, D. C. Price, J. M. Worful, A.
Moustafa, and M. E. Rumpho. 2011. Sea slug kleptoplasty and
plastid maintenance in a metazoan. Plant Physiol. 155: 1561–1565.
Pierce, S. K., and N. E. Curtis. 2012. The cell biology of the chloroplast
symbiosis in sacoglossan sea slugs. Int. Rev. Cell Mol. Biol. 293:
123–148.
Pierce, S. K., R. W. Biron, and M. E. Rumpho. 1996. Endosymbiotic
chloroplasts in molluscan cells contain proteins synthesized after plas-
tid capture. J. Exp. Biol. 199: 2323–2330.
Pierce, S. K., S. E. Massey, J. J. Hanten, and N. E. Curtis. 2003.
Horizontal transfer of functional nuclear genes between multicellular
organisms. Biol. Bull. 204: 237–240.
Pierce, S. K., N. E. Curtis, J. J. Hanten, S. L. Boerner, and J. A.
Schwartz. 2007. Transfer, integration and expression of functional
nuclear genes between multicellular species. Symbiosis 43: 57– 64.
Pierce, S. K., X. Fang, J. A. Schwartz, X. Jiang, W. Zhao, N. E. Curtis,
K. Kocot, B. Yang, and J. Wang. 2012. Transcriptomic evidence for
the expression of horizontally transferred algal nuclear genes in the
photosynthetic sea slug, Elysia chlorotica. Mol. Biol. Evol. 29: 1549 –
1556.
Rønne, M. 1989. Chromosome preparation and high resolution R- and
G-banding techniques. Pp. 11–40 in Cytogenetics of Animals, C. Hal-
nan, ed., C.A.B. International.
Rumpho, M. E., J. M. Worful, J. Lee, K. Kannan, M. S. Tyler, D.
Bhattacharya, A. Moustafa, and J. R. Manhart. 2008. Horizontal
gene transfer of the algal nuclear gene psbO to the photosynthetic sea
slug Elysia chlorotica. Proc. Natl. Acad. Sci. USA 105: 17867–17871.
Rumpho, M. E., S. Pochareddy, J. M. Worful, E. J. Summer, D.
Bhattacharya, K. N. Pelletreau, M. S. Tyler, J. Lee, J. M. Manhart,
and K. M. Soule. 2009. Molecular characterization of the Calvin
cycle enzyme phosphoribulokinase in the stramenopile alga Vaucheria
litorea and the plastid hosting mollusc, Elysia chlorotica. Mol. Plant 2:
1384 –1396.
311ALGAL GENES ON SEA SLUG CHROMOSOMES
Schwartz, J. A., N. E. Curtis, and S. K. Pierce. 2010. Using algal
transcriptome sequences to identify transferred genes in the sea slug,
Elysia chlorotica. Evol. Biol. 37: 29 –37.
Soule, K. M., and M. E. Rumpho. 2009. Light-regulated photosynthetic
gene expression and phosphoribulokinase enzyme activity in the het-
erokont alga Vaucheria litorea (xanthophyceae) and its symbiotic
molluskan partner Elysia chlorotica (Gastropoda). J. Phycol. 48: 373–
383.
Taylor, D. L. 1968. Chloroplasts as symbiotic organelles in the digestive
gland of Elysia viridis (Gastropoda: Opisthobranchia). J. Mar. Biol.
Assoc. UK 48: 1–15.
Thiriot-Quievreux, C. 2003. Advances in chromosomal studies of gas-
tropod molluscs. J. Molluscan Stud. 69: 187–201.
Vitturi, R., P. Gianguzza, M. S. Colomba, and S. Riggio. 2000. Cy-
togenetic characterization of Brachidontes pharaonis (Fisher P.,1870):
karyotype, banding and fluorescent in situ hybridization (FISH) (Mol-
lusca: Bivalvia: Mytilidae). Ophelia 52: 213–220.
Wa¨ gele, H., O. Deusch, K. Ha¨ndeler, R. Martin, V. Schmitt, G.
Christa, B. Pinzger, S. B. Gould, T. Dagan, A. Klussman-Kolb, and
W. Martin. 2011. Transcriptome evidence that longevity of acquired
plastids in the photosynthetic slugs Elysia timida and Plakobranchus
ocellatus does not entail lateral transfer of algal nuclear genes. Mol.
Biol. Evol. 28: 699 –706.
West, H. H., J. Harrigan, and S. K. Pierce. 1984. Hybridization of two
populations of a marine opisthobranch with different developmental
patterns. Veliger 26: 199 –206.
Zappulla, J. P., A. Angers, D. Barbas, V. F. Castellucci, and L.
DesGroseillers. 2005. A novel actin isoform is expressed in the
ovotestis of Aplysia californica. Comp. Biochem. Physiol. B 140:
403– 409.
312 J. A. SCHWARTZ ET AL.
