ArticlePDF Available

Distinct Amino Acid Compositional Requirements for Formation and Maintenance of the [ PSI + ] Prion in Yeast

Authors:

Abstract and Figures

Multiple yeast prions have been identified that result from the structural conversion of proteins into a self-propagating amyloid form. Amyloid-based prion activity in yeast requires a series of discrete steps. First, the prion protein must form an amyloid nucleus that can recruit and structurally convert additional soluble proteins. Subsequently, maintenance of the prion during cell division requires fragmentation of these aggregates to create new heritable propagons. For the yeast prion protein Sup35, these different activities are encoded for by different regions of Sup35's prion domain. An N-terminal glutamine/asparagine-rich nucleation domain is required for nucleation and fiber growth, while an adjacent oligopeptide repeat domain is largely dispensable for prion nucleation and fiber growth, but required for chaperone-dependent prion maintenance. Although prion activity of glutamine/asparagine-rich proteins is predominantly determined by amino acid composition, the nucleation and oligopeptide repeat domains of Sup35 have distinct compositional requirements. Here, we quantitatively define these compositional requirements in vivo. We show that aromatic residues strongly promote both prion formation and chaperone-dependent prion maintenance. By contrast, non-aromatic hydrophobic residues strongly promote prion formation, but inhibit prion propagation. These results provide insight into why some aggregation-prone proteins are unable to propagate as prions. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Content may be subject to copyright.
Distinct Amino Acid Compositional Requirements for Formation and
Maintenance of the [PSI
] Prion in Yeast
Kyle S. MacLea,
a
*Kacy R. Paul,
a
Zobaida Ben-Musa,
b
Aubrey Waechter,
a
Jenifer E. Shattuck,
a
Margaret Gruca,
a
Eric D. Ross
a,b
Department of Biochemistry and Molecular Biology, Colorado State University, Fort Collins, Colorado, USA
a
; Graduate Program in Cell and Molecular Biology, Colorado
State University, Fort Collins, Colorado, USA
b
Multiple yeast prions have been identified that result from the structural conversion of proteins into a self-propagating amyloid
form. Amyloid-based prion activity in yeast requires a series of discrete steps. First, the prion protein must form an amyloid nu-
cleus that can recruit and structurally convert additional soluble proteins. Subsequently, maintenance of the prion during cell
division requires fragmentation of these aggregates to create new heritable propagons. For the Saccharomyces cerevisiae prion
protein Sup35, these different activities are encoded by different regions of the Sup35 prion domain. An N-terminal glutamine/
asparagine-rich nucleation domain is required for nucleation and fiber growth, while an adjacent oligopeptide repeat domain is
largely dispensable for prion nucleation and fiber growth but is required for chaperone-dependent prion maintenance. Although
prion activity of glutamine/asparagine-rich proteins is predominantly determined by amino acid composition, the nucleation
and oligopeptide repeat domains of Sup35 have distinct compositional requirements. Here, we quantitatively define these com-
positional requirements in vivo. We show that aromatic residues strongly promote both prion formation and chaperone-depen-
dent prion maintenance. In contrast, nonaromatic hydrophobic residues strongly promote prion formation but inhibit prion
propagation. These results provide insight into why some aggregation-prone proteins are unable to propagate as prions.
Misfolding of a wide range of proteins leads to formation of
amyloid fibrils, which are ordered, -sheet-rich protein ag-
gregates. Many human diseases are associated with the formation
of amyloid fibrils, including Alzheimer’s disease, type II diabetes,
and the transmissible spongiform encephalopathies (TSEs) (1).
However, only a small subset of amyloids are infectious (called
prions), including the causative agents of TSEs in mammals (2–4)
and [URE3], [PSI
], [PIN
], and others in Saccharomyces cerevi-
siae (5–9).
Most of the known yeast prion proteins contain glutamine/
asparagine (Q/N)-rich domains that drive amyloid formation.
Q/N-rich domains are found in 1 to 4% of the proteins in most
eukaryotic proteomes (10), but very few of these proteins have
been shown to undergo amyloid structural conversion. Bioinfor-
matics screens for prions in yeast have had some notable successes
(reviewed in reference 11); however, despite advances in predict-
ing which Q/N-rich domains may turn out to be bona fide prions
(12,13), predictions remain imperfect.
Awell-studied model prion from yeast (S. cerevisiae)is[PSI
],
the prion form of the translational terminator protein Sup35 (5).
Like other yeast prion proteins, Sup35 is modular, as it contains a
distinct prion-forming domain (PFD), middle domain (M), and
C-terminal domain (C) (Fig. 1A)(14–17). The PFD (amino acids
1 to 114) drives the conversion of Sup35 into its amyloid form
(15), the charged M domain has no known function other than its
ability to stabilize [PSI
] fibers, and the C domain is an essential
component responsible for translational termination (14,17).
Prion formation by Sup35 is driven primarily by the amino
acid composition of the PFD (18). We previously used a quanti-
tative mutagenesis method to determine the prion propensity of
each amino acid in the context of Q/N-rich PFDs (13). Briefly, an
8-amino-acid segment in the middle of a scrambled version of the
Sup35 PFD was replaced with a random sequence to generate a
library of mutants. This library was then screened for the subset of
mutants that maintained the ability to form and propagate prions.
We then derived prion-propensity scores for each amino acid by
comparing the frequency of occurrence of each amino acid among
the prion-forming sequences to their frequency of occurrence in
the starting library. These prion propensity values were used to
develop PAPA (prion aggregation prediction algorithm), a pre-
diction algorithm capable of accurately distinguishing between
Q/N-rich domains with and without prion activity (13,19,20).
Although PAPA represents a significant advance in prion pre-
diction, it is far from perfect. One likely problem is that there are
multiple distinct steps required for prion activity. Specifically,
prion formation requires that a protein be able to both form prion
aggregates and add onto these aggregates; additionally, prion
propagation to daughter cells during multiple rounds of cell divi-
sion (also referred to as prion maintenance) requires that the ag-
gregates be fragmented to create new independently segregating
prion seeds to offset dilution by cell division (21). Each of these
steps may have distinct amino acid sequence requirements, yet
PAPA uses only a single prion propensity score for each amino
acid. Making better predictions of prion propensity requires a
Received 7 August 2014 Returned for modification 27 September 2014
Accepted 16 December 2014
Accepted manuscript posted online 29 December 2014
Citation MacLea KS, Paul KR, Ben-Musa Z, Waechter A, Shattuck JE, Gruca M, Ross
ED. 2015. Distinct amino acid compositional requirements for formation and
maintenance of the [PSI
] prion in yeast. Mol Cell Biol 35:899 –911.
doi:10.1128/MCB.01020-14.
Address correspondence to Eric D. Ross, Eric.Ross@ColoState.Edu.
* Present address: Kyle S. MacLea, Biology Program, University of New Hampshire
at Manchester, Manchester, New Hampshire, USA.
Supplemental material for this article may be found at http://dx.doi.org/10.1128
/MCB.01020-14.
Copyright © 2015, American Society for Microbiology. All Rights Reserved.
doi:10.1128/MCB.01020-14
March 2015 Volume 35 Number 5 mcb.asm.org 899Molecular and Cellular Biology
on October 20, 2015 by guesthttp://mcb.asm.org/Downloaded from
better understanding of how amino acid composition separately
affects prion formation and maintenance.
Sup35 is an ideal substrate for examining these compositional
requirements. Unlike the scrambled version of Sup35 used for the
initial library experiments, the wild-type Sup35 PFD has two dis-
tinct subdomains with overlapping but separate functions (Fig.
1A). The N-terminal nucleation domain (ND; amino acids 1 to
39) is highly Q/N rich and is primarily responsible for nucleation
and growth of prion fibers (16,22). The remaining portion of
the PFD (amino acids 40 to 114) has been implicated in prion
maintenance and contains an oligopeptide repeat domain
(ORD) consisting of 5.5 imperfect repeats with the consensus
sequence (P/Q)QGGYQ(Q/S)YN (16,23–25). This separation
of prion formation from prion maintenance potentially allows
for dissection of how amino acid composition separately affects
each activity. Importantly, the ND and the ORD have distinct
compositional requirements for their respective functions
(26).
The functional separation between the ND and ORD is not
absolute (13,22,27). For example, both the ND and the first two
repeats of the ORD are required for efficient de novo aggregation
(22), and tyrosines in the ORD have been implicated in the early
steps of prion nucleation (27). Nevertheless, significant evidence
supports a role for the ORD in prion maintenance (22,26). Re-
moval of all or part of the ORD (14,22,23,25) or replacement of
the ORD with a random sequence (28) destabilizes [PSI
]. Such
mutations appear to reduce prion aggregate fragmentation, re-
sulting in larger aggregates that are frequently lost as a result of
imperfect segregation of aggregates into daughter cells (29). The
chaperone protein Hsp104 is essential for [PSI
] maintenance
(30); Hsp104 cleaves prion fibers into smaller fragments better
suited to segregate into daughter cells (21,31,32). The ORD re-
peats have been hypothesized to facilitate Hsp104-dependent ag-
gregate cleavage; the repeats could act as Hsp104-binding sites
(although recent evidence suggests that a binding site exists in the
M domain [33]), conformationally modify the amyloid core to
allow chaperone access, or modulate fiber fragility (24,34). Inter-
estingly, the mammalian prion protein PrP also contains an ORD,
and PrP repeat expansion is associated with dominantly inherited
prion disease (35,36). This observation, combined with the pres-
ence of repeat elements in the PFDs of Rnq1 and New1 (22,37),
suggest a role for repeats in prion maintenance; however, other
yeast PFDs, such as in Ure2, do not contain repeats, and so repeats
cannot be an absolutely necessary feature for prion maintenance.
Furthermore, scrambling the Sup35 ORD does not prevent prion
formation or maintenance (26), indicating that the activity of the
repeats is largely primary sequence independent.
The amino acid compositional requirements for ORD func-
tion have only been explored to a limited degree, mostly through
targeted mutations. However, several studies have used artificial
polyglutamine fragments to explore the sequence requirements
for aggregate fragmentation. Targeted replacement of Gln with
Tyr residues (38) or other aromatic residues (34) reduced the
average aggregate size, suggesting an increase in fiber fragmenta-
tion. The elevated number and regular spacing of Tyr residues in
both the Sup35 ORD and in the repeats of prion-like protein
New1 likewise suggest that aromatic residues may act as recogni-
tion sites for chaperones such as Hsp104. Indeed, some chaper-
ones are known to use exposed aromatic or hydrophobic residues
as binding sites (39,40).
To perform a more comprehensive analysis of the composi-
tional determinants for prion formation and maintenance, we
quantitatively measured how amino acid composition affects the
respective activities of the Sup35 ND and ORD. We observed dis-
tinct compositional biases in these two domains. To confirm that
these differences were due to distinct compositional requirements
for prion formation and maintenance, we developed a new
method to specifically isolate the effects of amino acid composi-
tion on prion maintenance. These studies confirm that nucleation
and maintenance of prions have overlapping but nonidentical
compositional requirements and highlight a divergent role for al-
iphatic residues in promoting prion formation while inhibiting
prion maintenance.
MATERIALS AND METHODS
Yeast strains and media. Standard yeast media and methods were as pre-
viously described (41), except that yeast extract-peptone-dextrose (YPD)
medium contained 0.5% yeast extract in place of the standard amount
(1%). In all experiments, yeast were grown at 30°C.
A complete strain list can be found in Table 1. To build YER709/
pER589, the HIS3 gene was amplified from pRS313 using primers
EDR1314 and EDR1315 (see Table S1 in the supplemental material for
primer sequences). The resulting product was transformed into YER632/
pJ533 (42); pJ533 expresses SUP35 from aURA3 plasmid as the sole copy
of SUP35 in the cell (43) (see Table S2 in the supplemental material for a
complete plasmid list). Successful knockout of ppq1 was confirmed by
PCR and sequencing. Two rounds of plasmid shuffling were then used to
replace pJ533 with pER589 (a URA3 plasmid expressing Sup35MC from
the SUP35 promoter).
FIG 1 Prion formation library experiment. (A) Schematic of Sup35. The PFD
is enlarged below, showing the ND and ORD. (B) Sequence of Sup35. The
oligopeptide repeats are underlined. The region of the ND and ORD targeted
for mutagenesis are in bold italics. (C) Experimental scheme for prion forma-
tion library experiments. [psi
] cells in which Sup35C was expressed from a
URA3 plasmid as the sole copy of Sup35 were transformed with a randomly
mutated version of Sup35 and then selected for loss of the wild-type plasmid
(step 1). Cells were screened to remove clones in which the mutant Sup35 had
compromised activity, and randomly selected clones were sequenced to gen-
erate the naive library. The library was then screened for clones that could form
and propagate prions (step 2).
MacLea et al.
900 mcb.asm.org March 2015 Volume 35 Number 5Molecular and Cellular Biology
on October 20, 2015 by guesthttp://mcb.asm.org/Downloaded from
Building the libraries. To randomly mutate regions of the SUP35
PFD, first the C-terminal portion of Sup35 was amplified with EDR304
paired with either EDR1388 or EDR1384 for the ND and ORD libraries,
respectively. These products were then reamplified with EDR304 paired
with either EDR1380 [GCAAAACTACCAGCAATACAGCCAGAACGG
T(NNB)
8
TACCAAGGCTACCAGGCTTACAATGC] or EDR1377 [CTG
GGTACCAACAAGGTGGCTATCAACAGTACAAT(NNB)
10
CCTCAA
GGAGGCTACCAGCAATACAAC]. These oligonucleotides, made by
Invitrogen, contain degenerate segments encoding a 25% mix of each
nucleotide at positions 1 and 2 of each mutated codon and a 33.3% mix of
C, G, and T at the third position. In a second PCR, a primer complemen-
tary to the nondegenerate 5=region of EDR1380 or EDR1377 (EDR1389
or EDR1385, respectively) was paired with EDR302 to amplify the N-ter-
minal portion of Sup35. The N- and C-terminal PCR products were com-
bined and reamplified with EDR301 and EDR262. The final PCR products
were cotransformed with BamHI/HindIII-cut pJ526 (cen LEU2; from
Dan Masison, National Institutes of Health [18]) into yeast strain
YER709/pER589 for the prion formation experiments and YER282/
pER1112 for the prion maintenance experiments. Transformants were
selected on synthetic complete (SC)-Leu medium.
Prion formation library experiments. Transformants were spotted
onto 5-fluoroorotic acid (5-FOA)-containing medium to select for loss of
pER589. Library mutants that grew on 5-FOA were stamped onto SC-
Ade, YPD, and yeast extract-peptone-adenine-dextrose (YPAD) and
grown for 3 to 5 days at 30°C. Isolates that grew red colonies on YPD and
did not grow on SC-Ade were pooled into minilibraries containing 80
clones. Random isolates were sequenced to generate the naive data set.
Minilibraries were plated onto SC-Ade at concentrations of 10
6
and 10
5
cells per plate and grown for 5 days at 30°C. To test curability, Ade
colonies were grown on YPD and on YPD plus 4 mM guanidine-HCl
(GdHCl) and then restreaked on YPD to test for loss of the Ade
pheno-
type. Clones in which the Ade
phenotype was stable and curable were
sequenced. The odds ratio (OR) for each amino acid or group of amino
acids was calculated as follows:
OR [fpf ⁄(1fpf)]⁄[fn⁄(1fn)] (1)
where ƒ
pf
is the per-residue frequency of the amino acid in the mutated
region of prion-forming isolates and ƒ
n
is the per-residue frequency of the
amino acid in the mutated region of the naive library (44,45). Prion propen-
sity scores for each amino acid (PP
aa
) are then calculated as follows:
PPaa 1n(OR) (2)
Prion maintenance library experiments. Transformants were replica
plated onto 5-FOA-containing medium to select for loss of pER1112.
Cells were pooled and mated with 780-1D/pJ533 for 24 h on YPAD. Dip-
loids were selected by replica plating on SD-Ade-Trp-Ura medium and
then replica plating onto 5-FOA-containing medium to select for loss of
pJ533. Cells were then plated for single colonies on YPD medium to allow
color selection. Ade
colonies were streaked on YPD and YPD plus 4 mM
GdHCl to test for curability. Clones in which the Ade
phenotype was
stable and curable were defined as propagators and sequenced. Clones
with a strong Ade
phenotype were defined as nonpropagators and se-
quenced.
The prion maintenance odds ratio (OR
m
) for each amino acid or
group of amino acids was calculated as follows:
ORm[fp⁄(1fp)]⁄[fnp ⁄(1fnp)] (3)
where ƒ
p
is the per-residue frequency of the amino acid in the mutated
region of prion-positive clones and ƒ
np
is the per-residue frequency of the
amino acid in the mutated region of nonprion clones. Prion maintenance
propensity scores for each amino acid (PMP
aa
) were then calculated as
follows:
PMPaa 1n(ORm) (4)
To test whether library mutants that failed to maintain [PSI
] could
add onto wild-type aggregates when coexpressed with wild-type Sup35,
plasmids expressing nonpropagating mutants were isolated and trans-
formed into 780-1D/pJ533. Cells were then spread on SD-Trp-Ura me-
dium supplemented with limiting adenine (10 g/ml) to allow color se-
lection. To confirm an inability to propagate [PSI
], cells were spotted on
5-FOA-containing medium to select for loss of pJ533 and then spread on
YPD to test for prion loss.
Prion maintenance library experiments, preselecting for the ability
to add to existing aggregates. To preselect against any mutants that were
unable to add onto wild-type Sup35 aggregates, the library experiments
were performed as described above, except that selection for diploids was
performed on medium lacking adenine (SD-Trp-Ura).
Leave-one-out analysis. To calculate the predicted prion mainte-
nance propensity (PMP) for each isolate in the prion maintenance library
data set, PMP
aa
scores were first calculated based on the other 151 isolates
in the data set (i.e., “leaving out” the one sequence to be scored), as shown
in equation 4. The PMP score for the left-out isolate was then calculated as
the sum of the PMP
aa
scores for the 10 amino acids in the mutagenized
region (the third repeat). This process was iteratively repeated for all 152
isolates in the data set. Four isolates were excluded from the analysis
because they contained amino acids for which PMP
aa
scores could not be
calculated. The three lysine-containing red sequences were excluded be-
cause the absence of lysine among the propagating clones made lysine’s
PMP
aa
score indeterminate; likewise, the only methionine-containing
prion-propagating clone could not be scored, because when it was left out
of the PMP
aa
calculation the methionine PMP
aa
score became indetermi-
nate. The accuracies of the leave-one-out PMP scores were assessed using
a receiver operator characteristic (ROC) plot.
Creation of de novo mutants in the ORD. A random proteome of
65,386 residues was generated using the random number function of the
Microsoft Excel software program, with an equal chance of selecting any
of the 20 natural amino acids at each position. Windows of 10 amino acid
were scored using the calculated PMP values (from the full library data
set). A total of 3,628 sequences did not contain any of the low-abundance
residues (E, K, M, Q, and W) and were chosen for further evaluation.
Sequences with PMP scores at the 95th and 5th percentiles were chosen.
Sequences were constructed using the same protocol as that used to build
the ORD library, except that EDR1471 to EDR1473 and EDR1490 to
EDR1492 were used in place of EDR1377 for the 95th percentile mutants
and EDR1480 to EDR1482 and EDR1493 to EDR1495 were used for the
5th percentile mutants.
Tyrosine substitutions in the ORD. To make the tyrosine substitu-
tion mutations, first the portion of SUP35 immediately after the site of
mutation was PCR amplified with EDR304 and EDR1890. This product
was reamplified with EDR304 paired with EDR1892 to EDR1895 or
EDR2156 to EDR2158. In a separate reaction, the portion of SUP35 im-
mediately before the site of mutation was amplified with EDR302 and
EDR1891. These two reaction products were then combined and ream-
plified with EDR301 and EDR262. The final PCR products were cotrans-
formed with BamHI/HindIII-cut pJ526 into YER632/pJ533. 5-FOA was
TABLE 1 Yeast strains
Strain Genotype Reference
YER709/pER589 MATkar1-1 SUQ5 ade2-1 his3 leu2 trp1
ura3 ppq1::HIS3 sup35::KanMx [psi
]
[PIN
] pER589 (URA3 SUP35MC)
This study
YER632/pJ533 MATkar1-1 SUQ5 ade2-1 his3 leu2 trp1
ura3 sup35::KanMx [psi
][PIN
]
pJ533 (URA3 SUP35)
42
YER282/pER1112 MATakar1-1 SWQ5 ade2-1 his3 leu2 trp1
ura3 arg1::HIS3 sup35::KanMx [psi
]
[PIN
] pER1112 (URA3 SUP35-27)
18
780-1D/pJ533 MATkar1-1 SUQ5 ade2-1 his3 leu2 trp1
ura3 sup35::KanMx [PSI
][PIN
]
pJ533 (URA3 SUP35)
43
Compositional Determinants of Prion Maintenance
March 2015 Volume 35 Number 5 mcb.asm.org 901Molecular and Cellular Biology
on October 20, 2015 by guesthttp://mcb.asm.org/Downloaded from
used to select for loss of pJ526. Plasmids for transient overexpression of
each PFD from the GAL1 promoter were constructed, and prion forma-
tion assays were performed as previously described (42).
Plasmids expressing PFD-green fluorescent protein (GFP) fusions
were constructed as previously described (42). To test for focus forma-
tion, these plasmids were transformed into 780-1D/pJ533 and YER632/
pJ533. Cells were grown for2hingalactose/raffinose dropout medium
and visualized by fluorescence microscopy.
In silico reanalysis of the Alberti et al. data set. Amino acid compo-
sitions were compared by calculating the percentage of each amino acid
out of the total number of amino acids in each predicted PFD (12). The 18
proteins that passed all four tests in the assays of Alberti et al. (12) were the
following: Ure2, Sup35, Rnq1, New1, Puf2, Nrp1, Swi1, Ybr016w, Cbk1,
Lsm1, Ybl081w, Pub1, Ksp1, Asm4, Nsp1, Gln3, Ypr022c, and Rlm1. The
12 proteins that failed only in the Sup35 fusion protein expression assay
were the following: Snf5, Gts1, Scd5, Sgf73, Sok2, Mot3, Ngr1, Jsn1, Pdr1,
Cyc8, Pan1, and Ybr108w.
Statistics. Both a two-sided Student’s ttest and Fisher’s exact test were
performed using the GraphPad QuickCalcs website. Standard errors (SE)
for log odds ratios are estimated as follows:
SE [1⁄np1⁄(tpnp)1⁄nnp 1⁄(tnp nnp)]0.5 (5)
where n
p
and n
np
are the numbers of times that the amino acid is found in
the prion and naive (or nonprion for the prion maintenance experiments)
libraries, respectively, and t
p
and t
np
are the total numbers of amino acids
in the prion and naive (or nonprion) libraries, respectively (44). To de-
termine if the difference between two log odds ratios was statistically sig-
nificant, zscores were calculated, using a two-sample z-test:
z[1n(OR1)1n(OR2)] ⁄ [(SE1)2(SE2)2]0.5 (6)
where OR
1
and OR
2
are the two odds ratios and SE
1
and SE
2
are the
standard errors for the respective log odds ratios.
RESULTS
Prion formation library experiments with the SUP35 ND and
ORD. To define the distinct compositional requirements of the
Sup35 ND and ORD, libraries of Sup35 mutants were created in
which segments of the ND or ORD were replaced with a segment
of random amino acids (Fig. 1B, bold italics). The ND segment
(amino acids 21 to 28) was selected because it overlaps the portion
of the ND that was previously shown to be critical for aggregate
growth (16) and because it contains a mixture of predicted prion-
promoting and -inhibiting residues. In the ORD, the third repeat
(amino acids 65 to 74) was targeted because this repeat is impor-
tant for efficient prion maintenance but dispensable for prion
nucleation or fiber growth (22).
We utilized an oligonucleotide-based mutagenesis method to
build each library (13). Oligonucleotides were designed to anneal
to the regions flanking the site of mutagenesis, but with the target
codons replaced with the sequence (NNB)
n
, where N is any of the
four nucleotides, B is any of the nucleotides except adenine, and n
is the number of targeted codons (8 for the ND library and 10 for
the ORD library). Disallowing adenine at the final position elim-
inated two of the three stop codons while still allowing all 20
amino acids to be incorporated in the mutated region. PCR with
these oligonucleotides was used to create libraries of randomly
mutated versions of SUP35, which were then transformed into
yeast cells in which SUP35C was expressed from a plasmid as the
sole copy of SUP35 in the cell. Through plasmid shuffling, the
SUP35C-expressing plasmid was replaced with the random library
(Fig. 1C). Prion formation by Sup35 is extremely rare without
PFD overexpression, and only a small fraction of library mutants
was expected to form prions. Therefore, to enhance prion detec-
tion, a ppq1 strain was used; this mutation enhances [PSI
] for-
mation by approximately 10-fold (46).
The prion-forming libraries were screened as previously de-
scribed (13). Briefly, to remove any clones that might have com-
promised Sup35 activity, each clone was first screened for Sup35
activity by monitoring nonsense suppression of the ade2-1 allele
(47). ade2-1 mutants are unable to grow in the absence of adenine
and turn red in the presence of limiting adenine. [PSI
] causes
stop codon read-through, allowing for growth without adenine
and white or pink colony formation in the presence of limiting
adenine. Colonies that grew red on limiting adenine and did not
grow without adenine were pooled into minilibraries consisting of
80 mutants. Sup35 was sequenced from randomly selected
clones to generate a naive library data set (see Table S3 in the
supplemental material for the full set of sequences).
The minilibraries were plated onto SC-Ade medium to select
for prion formation. Ade
colonies can result from either DNA
mutation or prion formation. To distinguish between these, Ade
cells were grown on YPD with and without guanidine-HCl and
then restreaked onto YPD to test for loss of the Ade
phenotype.
Guanidine-HCl cures [PSI
](48) by inhibiting Hsp104 activity
(49,50). Cells that lost the Ade
phenotype after growth on gua-
nidine-HCl but that maintained the Ade
phenotype after growth
on YPD were considered prion positive and were sequenced (see
Table S3 in the supplemental material).
Compositional biases among the ND and ORD prion-form-
ing isolates. For each amino acid, an odds ratio was determined,
which represented the degree of over- or underrepresentation of
that amino acid among the [PSI
] isolates (13)(Table 2). In many
cases, the odds ratios for individual amino acids carried large con-
fidence intervals due to limitations of the library sample sizes. This
was particularly true for Met, Trp, Lys, Gln, and Glu; because
adenine was excluded at the third position of each codon, each was
only encoded by a single codon, and thus each was quite rare
among the libraries (Table 2). Nevertheless, there was a strong
correlation (P0.016 by Spearman rank analysis) between the
odds ratios for the ND library and our previously determined odds
ratios based on mutagenesis of Sup35-27 (13), a version of Sup35
with a scrambled PFD (Table 3). Excluding the five single-codon
amino acids further strengthened this correlation (P0.0064).
Grouping similar amino acids can effectively increase sample
sizes, thereby improving statistical significance. Doing so con-
firmed that the same broad trends observed for Sup35-27 were
seen in the ND library, with both aromatic and nonaromatic hy-
drophobic residues promoting prion activity and charged residues
strongly inhibiting prion activity (Fig. 2A).
There was also a statistically significant correlation between
our previous Sup35-27 odds ratios and those for the ORD library
(P0.017). As in the ND and Sup35-27 libraries, there was a
statistically significant bias against charged residues among prion-
forming sequences in the ORD library (P0.0002) (Table 2) and
an overrepresentation of aromatic residues, albeit below the
threshold for statistical significance (P0.084) (Table 2). How-
ever, there was one striking difference. With the exception of leu-
cine (which is known to have a low -sheet propensity [51]), the
nonaromatic hydrophobic residues (Ile, Val, and Met) were highly
enriched among prion-forming sequences in both the Sup35-27
library (P0.0001) and the ND library (P0.017), yet they were
actually modestly underrepresented among prion-forming se-
quences in the ORD library (Table 3). The differences between the
MacLea et al.
902 mcb.asm.org March 2015 Volume 35 Number 5Molecular and Cellular Biology
on October 20, 2015 by guesthttp://mcb.asm.org/Downloaded from
ORD library and both the Sup35-27 and ND libraries were both
statistically significant (P0.0031 and 0.029, respectively) (Table
3), demonstrating that these residues have significantly different
effects in these locations.
Prion maintenance library experiments with the SUP35
ORD. The simplest explanation for the different biases observed
in the ND versus ORD is that these differences reflect the distinct
functions of the two regions (16,23–25) and, thus, that nonaro-
matic hydrophobic residues promote prion formation but not
prion maintenance. However, the functional separation between
the two regions is not absolute, so it is possible that some of the
ORD biases that we observed were due to effects on prion forma-
tion.
Therefore, we adapted our library screening method to specif-
ically isolate the effects of composition on prion maintenance
(Fig. 3A). We constructed a second ORD library as described
above, but this time we assessed the abilities of mutants to main-
tain an existing prion. To accomplish this, we utilized a two-step
process. Because our plasmid libraries were constructed directly in
yeast by using homologous recombination (by cotransforming a
mutagenized PCR product and a linearized vector), the libraries
were inevitably contaminated with products of recombination be-
tween the initial Sup35 maintenance plasmid that was present in
the cell and the linearized vector. Thus, when the libraries were
built directly in a [PSI
] cell, because prion-propagating mutants
are relatively rare, a large fraction of the prion-propagating clones
turned out to contain wild-type Sup35 (data not shown). To avoid
this problem, the libraries were constructed in a [psi
] strain ex-
TABLE 2 Amino acid representation within the libraries
Amino acid(s)
ND prion formation library
a
ORD prion formation library
b
Prion maintenance library
c
Frequency of amino acid in:
Odds
ratio
d
Frequency of amino acid in:
Odds
ratio
d
Frequency of amino acid
in:
Odds
ratio
e
Selected [PSI
]
library
Unselected naive
library
Selected [PSI
]
library
Unselected naive
library
White [PSI
]
colonies
Red [psi
]
colonies
Individual amino acids
Alanine 0.053 0.055 0.96 0.095 0.068 1.40 0.089 0.069 1.32
Arginine 0.024 0.095 0.26*** 0.044 0.107 0.41** 0.054 0.121 0.41****
Asparagine 0.061 0.031 1.95 0.047 0.021 2.24 0.038 0.032 1.20
Aspartic acid 0.028 0.046 0.60 0.033 0.058 0.57 0.054 0.064 0.83
Cysteine 0.065 0.071 0.91 0.084 0.062 1.35 0.072 0.047 1.58*
Glutamic acid 0.003 0.008 0.42 0.006 0.012 0.53 0.015 0.006 2.70
Glutamine 0.007 0.016 0.41 0.003 0.003 0.94 0.008 0.007 1.12
Glycine 0.13 0.213 0.61* 0.144 0.151 0.95 0.114 0.109 1.05
Histidine 0.031 0.029 1.08 0.047 0.038 1.26 0.04 0.043 0.94
Isoleucine 0.088 0.055 1.60 0.04 0.058 0.69 0.025 0.043 0.57
Leucine 0.065 0.071 0.91 0.058 0.06 0.96 0.04 0.063 0.62*
Lysine 0 0 N/A 0.016 0.009 0.31 0 0.003 0.00
Methionine 0.014 0.014 0.96 0.088 0.06 1.89 0.002 0.009 0.17
Phenylalanine 0.121 0.042 2.88*** 0.037 0.053 1.45 0.068 0.049 1.40
Proline 0.017 0.035 0.48 0.123 0.113 0.70 0.048 0.045 1.07
Serine 0.109 0.125 0.87 0.04 0.038 1.09 0.12 0.102 1.20
Threonine 0.061 0.042 1.45 0.016 0.016 1.07 0.037 0.039 0.94
Tryptophan 0.014 0.021 0.67 0.076 0.055 1.04 0.018 0.005 4.07*
Tyrosine 0.069 0.042 1.63 0.076 0.086 1.40 0.074 0.028 2.81****
Valine 0.125 0.078 1.60 0.095 0.068 0.89 0.085 0.116 0.70*
Groups of amino acids
Charged (D, E, K,
R)
0.054 0.139 0.35*** 0.129 0.210 0.43*** 0.123 0.194 0.58***
Nonaromatic
hydrophobic
(I, L, M, V)
0.267 0.206 1.41 0.181 0.200 0.88 0.151 0.231 0.59****
Prion-promoting
nonaromatic
hydrophobic
(I, M, V)
0.206 0.139 1.61* 0.126 0.143 0.86 0.111 0.168 0.62**
Aromatic (F, W, Y) 0.186 0.101 2.04** 0.168 0.124 1.42 0.160 0.082 2.14***
Polar (N, Q, S, T) 0.220 0.198 1.14 0.197 0.162 1.27 0.203 0.180 1.16
a
The ND library consists of 37 selected [PSI
] sequences (296 amino acids) and 62 unselected sequences (496 amino acids).
b
The ORD prion formation library consists of 31 selected [PSI
] sequences (310 amino acids) and 58 unselected sequences (580 amino acids).
c
The prion maintenance library consists of 65 white [PSI
] sequences (650 amino acids) and 87 red [psi
] sequences (870 amino acids).
d
Odds ratios reflect the degree of overrepresentation or underrepresentation of each amino acid among the prion-forming isolates, as calculated according to equation 1. Values
above 1 indicate overrepresentation among prion-forming isolates. Statistical significance of the over- or underrepresentation is indicated: *, P0.05; **, P0.01; ***, P0.001;
****, P0.0001.
e
Odds ratios reflect the degree of overrepresentation or underrepresentation of each amino acid among the white (prion-propagating) isolates, as calculated using equation 3.
Compositional Determinants of Prion Maintenance
March 2015 Volume 35 Number 5 mcb.asm.org 903Molecular and Cellular Biology
on October 20, 2015 by guesthttp://mcb.asm.org/Downloaded from
pressing scrambled Sup35 (Sup35-27) from a URA3 plasmid as
the sole copy of Sup35 in the cell. After transformation, we se-
lected for loss of the URA3 plasmid, so that the library mutants
were the sole copy of Sup35. These cells were then mated with
wild-type [PSI
] cells in which the sole copy of Sup35 was again
expressed from a URA3 plasmid. After selection for diploids and
for loss of the URA3 plasmid, clones were plated for single colonies
and screened for Sup35 activity by using the ade2-1 allele. Because
Sup35-27 is unable to propagate wild-type [PSI
], any spurious
recombination events between the Sup35-27 maintenance plas-
mid and the linearized vector during the cloning step would result
in [psi
] cells. These Sup35-27 clones were excluded from our
analysis.
Red colonies were deemed to have lost [PSI
]. In contrast,
colonies were considered capable of efficiently maintaining
[PSI
] if they were white on YPD and stably maintained this white
phenotype upon restreaking on YPD but grew red on YPD after
guanidine treatment. Clones of intermediate phenotype (which
were substantially pink or sectored on YPD, or that were initially
white on YPD but showed any loss of the prion upon restreaking
on nonselective medium) were excluded from the study. A total of
65 distinct white mutants and 87 red mutants were sequenced (see
Table S3 in the supplemental material).
Compositional biases among the propagating prion isolates.
For each of the amino acids, an odds ratio was calculated accord-
ing to equation 3. Six amino acids showed statistically significant
differences between the prion-maintaining (white) and prion-los-
ing (red) isolates: Trp, Tyr, and Cys were significantly overrepre-
sented among the prion-maintaining isolates, while Val, Leu, and
Arg were significantly underrepresented (Table 2). When chemi-
cally similar amino acids were grouped together, aromatic amino
acids were overrepresented among the [PSI
] isolates (P10
4
),
and charged residues were underrepresented (P0.0002), as in
each of the previous libraries; however, nonaromatic hydrophobic
residues were substantially underrepresented (P10
4
). Thus,
focusing specifically on prion maintenance amplified the previ-
ously observed differences seen between the ND and ORD librar-
ies for nonaromatic hydrophobic residues (Fig. 2B and C). The
differences observed for nonaromatic hydrophobic residues be-
tween the ORD prion-propagating library experiments and both
Sup35-27 and the ND were highly statistically significant (P
10
4
). Interestingly, even the difference between the ORD prion-
propagating experiments and the original ORD library experi-
ments approached statistical significance (P0.077), suggesting
that in the original ORD experiments, nonaromatic hydrophobic
residues may have had partially offsetting effects, promoting prion
formation while inhibiting prion maintenance.
Failures of ORD mutants to maintain [PSI
] were not due to
failure to add onto existing wild-type aggregates. In the prion
maintenance library experiments, a protein could fail to maintain
[PSI
] for one of two reasons: a mutant could fail to add onto the
preexisting wild-type aggregates (Fig. 3A, after step 2), or the mu-
tant could successfully add onto preexisting aggregates but have a
defect in the subsequent prion maintenance steps (Fig. 3A, after
step 3). To distinguish between these two possibilities, plasmids
expressing mutant SUP35 from individual nonpropagating clones
were isolated and retransformed into wild-type [PSI
] cells. The
phenotype of transformants was examined before and after selec-
tion for the loss of wild-type plasmid (analogous to before and
after step 3 in Fig. 3A). If a mutant is unable to add onto the
preexisting wild-type aggregates, then it should remain soluble
(active), even in the presence of wild-type [PSI
], resulting in a
red phenotype (Fig. 3B). Of the 14 clones examined (indicated
with an asterisk in Table S3 in the supplemental material), none
was fully red when the wild-type and mutant proteins were coex-
pressed, although three (FYSVSILDRR, GCPRVVIHVD, and PH
FALVHSTH) showed a mild pink phenotype, suggesting a slightly
reduced efficiency of adding onto wild-type aggregates or a par-
tially dominant defect in prion aggregate fragmentation; by con-
trast, all 14 were red or highly sectored after loss of the wild-type
plasmid (Fig. 3B and data not shown).
TABLE 3 Prion propensity and prion maintenance propensity scores
from each library
Amino acid(s)
a
Prion propensity score for prion
formation library of
b
:
Prion
maintenance
propensity
score
c
Sup35-27
d
Sup35 ND Sup35 ORD
Individual amino acids
Phenylalanine 0.84 1.06 0.37 0.33
Isoleucine 0.81 0.47 0.37* 0.57*
Valine 0.81 0.47 0.12* 0.35*
Tyrosine 0.78 0.49 0.34 1.03
Methionine 0.67 0.04 0.63 1.80*
Tryptophan 0.67 0.41 0.039 1.40
Cysteine 0.42 0.10 0.30 0.45
Serine 0.13 0.14 0.084 0.18
Asparagine 0.08 0.67 0.81 0.18
Glutamine 0.069 0.88 0.067 0.11
Glycine 0.039 0.49 0.047 0.047
Leucine 0.04 0.10 0.039 0.48
Threonine 0.12 0.37 0.069 0.059
Histidine 0.28 0.077 0.23 0.064
Alanine 0.40 0.036 0.34 0.28
Arginine 0.41 1.37 0.89 0.88
Glutamic acid 0.61 0.87 0.63 0.99
Proline 1.20 0.73 0.36 0.065*
Aspartic acid 1.28 0.51 0.56 0.19
Lysine 1.58 NA
e
1.17 NA
e
Groups of amino acids
Charged (D, E, K,
R)
0.90 1.04 0.83 0.54
Hydrophobic (I, L,
M, V)
0.68 0.34 0.13** 0.53****
Prion-promoting
nonaromatic
hydrophobic
(I, M, V)
0.88 0.47 0.15*** 0.48****
Aromatic (F, W, Y) 0.84 0.71 0.35 0.76
Polar (N, Q, S, T) 0.064 0.13 0.24 0.15
a
Amino acids are listed in the order of their prion propensity according to PAPA.
b
Prion formation libraries were compiled as illustrated in Fig. 1C. Prion propensity
scores were calculated as the natural log of the odds ratios, according to equation 2.
Statistically significant differences relative to the Sup35-27 library (13) are indicated: *,
P0.05; **, P0.01; ***, P0.001; ****, P0.0001.
c
The prion maintenance library experiment was performed as illustrated in Fig. 1D.
Prion maintenance propensity scores were calculated according to equation 4.
Statistically significant differences relative to the Sup35-27 library (13) are indicated: *,
P0.05; **, P0.01; ***, P0.001; ****, P0.0001.
d
From Toombs et al. (13).
e
NA, not applicable; lysine was not found in any of the prion-forming sequences in the
ND library or in any of the white colonies in the prion propagation library.
MacLea et al.
904 mcb.asm.org March 2015 Volume 35 Number 5Molecular and Cellular Biology
on October 20, 2015 by guesthttp://mcb.asm.org/Downloaded from
These results indicate that the majority of library sequences
that failed to maintain [PSI
] were competent for adding onto the
preexisting wild-type aggregates but had a defect in the subse-
quent maintenance steps. However, it remained possible that rare
mutants with a defect in addition to preexisting aggregates could
skew the results of the library screen. To more comprehensively
examine this issue, the library experiment was repeated with an
additional selection step to remove such mutants. After mating
the mutant library strains with wild-type [PSI
]-containing cells
(Fig. 3A, step 2), the selection step to select for diploid cells was
FIG 2 Nonaromatic hydrophobic residues show different prion formation and maintenance propensities. Comparisons of the previously determined log odds
ratios based on mutagenesis of Sup35-27 (13) were undertaken to the log odds ratios from the ND (A) or ORD (B) prion formation library experiments, the ORD
prion maintenance library experiment (C), or the prion propagation library experiment in which an additional step was added to remove mutants that were not
efficiently recruited into wild-type prion aggregates (D). While the odds ratios for charged, aromatic, polar residues (filled diamonds) showed similar trends in
each library, nonaromatic hydrophobic residues (open diamonds) scored substantially worse in the ORD prion formation and maintenance libraries. Charged
residues are Asp, Glu, Lys, and Arg. Polar residues are Ser, Thr, Asn, and Gln. Aromatic residues are Trp, Tyr, and Phe. Nonaromatic hydrophobic residues are
Leu, Ile, Val, and Met. Error bars indicate standard errors, calculated according to equation 5.
FIG 3 Prion maintenance library experiments. (A) Experimental scheme. [psi
] cells in which Sup35C was expressed from a URA3 plasmid as the sole copy of
Sup35 were transformed with a randomly mutated version of Sup35 and then selected for loss of the wild-type plasmid (step 1). These cells were mated with
wild-type [PSI
] cells in which the sole copy of Sup35 was expressed from a URA3 plasmid (step 2). After selection for loss of the URA3 plasmid (step 3), red and
white clones were sequenced. In the modified protocol to select against mutants with a defect in adding onto wild-type aggregates, selection for diploid cells in
step 2 was done in the absence of adenine. (B) Plasmids expressing mutant Sup35s from individual red prion maintenance library isolates were transformed into
[PSI
] cells in which the sole copy of Sup35 was expressed from a URA3 plasmid. To test whether the mutant Sup35s were inactivated in the presence of wild-type
[PSI
], cells were plated on limiting adenine medium, selecting for both the wild-type and mutant Sup35-expressing plasmids (left). Cells were then retested on
YPD after selection for loss of the wild-type plasmid (right). Representative examples are shown, with the sequences of the mutagenized regions indicated.
Sup35-27, a scrambled version of Sup35 that is not incorporated into wild-type [PSI
] aggregates, and wild-type Sup35 are shown as controls.
Compositional Determinants of Prion Maintenance
March 2015 Volume 35 Number 5 mcb.asm.org 905Molecular and Cellular Biology
on October 20, 2015 by guesthttp://mcb.asm.org/Downloaded from
undertaken in the absence of adenine; this selected against mu-
tants that remained functional in the presence of wild-type [PSI
]
(i.e., that were not efficiently incorporated into [PSI
] aggre-
gates). Then, after selecting for loss of the wild-type plasmid, each
clone was examined as before for its ability to propagate [PSI
]
when expressed as the sole copy in the cell. This method has the
substantial downside that it adds an additional prion selection
step; nevertheless, it allowed us to confirm that selecting against
mutants with a defect in adding to preexisting aggregates did not
substantially change the outcome. With a smaller set of 19 prion-
maintaining mutants and 26 nonpropagators (see Table S3 in the
supplemental material), the broad trends from the original main-
tenance library held in this altered experimental system (Fig. 2C
and D).
Predicting propagating versus nonpropagating sequences.
To assess whether the biases seen in the prion maintenance library
experiments were sufficient to predict the behavior of individual
library isolates, we used the standard leave-one-out method of
cross-validation. Briefly, there were 152 sequences in the prion
maintenance library data set (65 white and 87 red). To calculate
the PMP score for each sequence, the sequence was excluded (i.e.,
left out) from the data set, and the remaining 151 sequences were
used to calculate prion maintenance propensity scores for each
amino (PMP
aa
) acid according to equation 4. The PMP score for
the excluded sequence was then calculated as the sum of the
PMP
aa
values for each of the 10 amino acids in the mutated region.
This process was iteratively repeated for all 152 sequences. White
clones had significantly higher PMP scores (P0.0001 by two-
sided ttest) than red clones, although there was significant overlap
between the two sets (Fig. 4). For example, 73.4% of the white
clones had positive PMP scores, while only 32% of the red clones
did, and the 26 lowest-scoring sequences were all red. In contrast,
PAPA showed almost no ability to distinguish between the red and
white clones (Fig. 4), consistent with the idea that PAPA is better
correlated with prion formation propensity than prion mainte-
nance propensity (Fig. 2).
We then tested whether the observed PMP
aa
values from the
full library data set (Table 3) were sufficient to rationally design
sequences that could substitute for the third repeat of the ORD
(the region mutagenized in the ORD library experiments) in sup-
porting prion propagation. We constructed a random library of
10-amino-acid segments in silico and then used the PMP scores to
identify segments with predicted high or low prion maintenance
propensities. Six of the randomly designed sequences that were
predicted to be very good at maintaining [PSI
] (in the 95th per-
centile among the in silico library) and six versions predicted to
maintain [PSI
] poorly (5th percentile) were inserted in the place
of the third repeat. Plasmids expressing these mutants were trans-
formed into wild-type [PSI
] cells in which the sole copy of Sup35
was expressed from a plasmid. After selection for loss of wild-type
plasmid, cells were examined for [PSI
] loss (Fig. 5A). While all
six predicted prion-maintaining mutants were uniformly white
when plated on YPD (Fig. 5A, left side), the predicted nonpropa-
gators were more variable. Three clones showed a mixture of red
FIG 4 Receiver operator characteristic (ROC) plot (57) assessing the ability of
PMP scores and PAPA to predict the prion-propagating library mutants. A
leave-one-out method of cross-validation was used to assess whether PMP
scores from the prion maintenance library experiment were sufficient to pre-
dict which library members would successfully propagate [PSI
]. PMP scores
showed reasonable prediction accuracy (area under the curve [AUC], 0.79);
the star indicates the point on the ROC plot for a PMP score of zero. PAPA
showed virtually no ability to distinguish between red and white isolates (AUC,
0.56), with prediction accuracy barely above what would be expected by ran-
dom chance (dotted line). False positive rate (number of red isolates scored
as prion propagating)/(total number of red isolates). True positive rate
(number of white isolates scored as prion propagating)/(total number of red
isolates).
FIG 5 Successful design of prion-propagating sequences. A library of random
10-amino-acid sequences was built in silico. The library was screened using the
PMP scores from the ORD prion propagation library experiment. Six high-
scoring sequences (left side of each panel) and six low-scoring sequences (right
side) were selected and inserted into Sup35 in place of the third repeat of the
ORD. Mutants were introduced to wild-type [PSI
] cells. Transformants were
spotted onto 5-FOA to select for loss of the plasmid expressing wild-type
Sup35, and either streaked onto YPD medium to test for loss of [PSI
] (A) or
streaked onto SC medium plus 4 mM guanidine-HCl and then streaked onto
YPD medium to test for loss of [PSI
] (B). Untreated wild-type [PSI
] and
[psi
] cells are shown as controls.
MacLea et al.
906 mcb.asm.org March 2015 Volume 35 Number 5Molecular and Cellular Biology
on October 20, 2015 by guesthttp://mcb.asm.org/Downloaded from
and white colonies, reflecting a high degree of prion loss, while the
others showed only very modest pink phenotypes (Fig. 5A, right
side). All 12 mutants were red after treatment with guanidine-HCl
(Fig. 5B). Collectively, these results suggest that our PMP values
are sufficient to identify broad trends but not sufficient to predict
whether a given sequence will support prion maintenance.
Essential role for aromatic residues in prion maintenance.
We designed targeted mutations to further examine the differ-
ences between the effects of aromatic and nonaromatic residues
on [PSI
] maintenance. The Sup35 PFD contains 20 Tyr residues,
one Phe, and no Trp, Ile, or Val. Five of the Tyr residues are
located in the ND, and nonaromatic hydrophobic residues can
replace these ND tyrosines in supporting prion activity (42). Here,
we examined the effects of replacing different residues for Tyr in
the ORD.
We replaced the five tyrosine residues in the third, fourth, and
fifth repeat of the ORD with Ala, Val, Ile, Leu, Met, Phe, or Trp.
Each mutant was transformed into a wild-type [PSI
] cell in
which the sole copy of Sup35 was expressed from a plasmid. After
selection for loss of the wild-type plasmid, only the two constructs
with aromatic substitutions were able to stably maintain [PSI
]
(Fig. 6A). Prion loss was not due to an inability to be recruited to
preexisting Sup35 aggregates. When GFP fusions of each mutant
PFD were transiently expressed for2hinwild-type [psi
] cells,
each remained diffuse (Fig. 6B); however, when the GFP fusions
were transiently expressed in [PSI
] cells, each rapidly coalesced
into foci (Fig. 6B), indicating that the mutants were efficiently
recruited into wild-type [PSI
] aggregates.
Although these results suggest that replacement of ORD ty-
rosines with nonaromatic hydrophobic residues results in a defect
in [PSI
] maintenance, it remained possible that these constructs
are able to maintain some variant of [PSI
], but just not the spe-
cific [PSI
] variant present in these cells. Therefore, each of the
mutants was tested for the ability to form [PSI
]de novo when
expressed as the sole copy of Sup35 in the cell. Cells were grown
either with or without overexpression of the matching PFD and
then plated onto SC-Ade medium to test for prion formation.
PFD overexpression increases prion formation by increasing the
probability of the initial prion-forming nucleation events (5). All
of the constructs were able to form Ade
colonies upon PFD over-
FIG 6 Aromatic residues in the ORD are critical for prion propagation. (A) Prion maintenance by tyrosine substitution mutants. The five tyrosines in repeats
3 to 5 of the Sup35 ORD were replaced with Ala, Val, Ile, Leu, Met, Phe, or Trp. These mutants were introduced into wild-type [PSI
] cells expressing wild-type
Sup35 from a plasmid. After selection for loss of the wild-type plasmid, cells were streaked onto YPD medium to test for the ability to maintain [PSI
]. Strain
YER632/pJ533 was included as a [psi
] control (632). (B) Tyrosine substitution mutants were efficiently incorporated into wild-type [PSI
] aggregates. Plasmids
expressing GFP fusions of each tyrosine substitution mutant PFD under the control of the GAL1 promoter were transformed into wild-type [PSI
] and [psi
]
strains. Cells were grown in galactose/raffinose dropout medium for 2 h and visualized by confocal microscopy. Foci were observed for each fusion in [PSI
] cells
but not [psi
] cells. (C) Prion formation by tyrosine substitution mutants. [psi
] strains expressing each mutant as the sole copy of Sup35 were transformed
either with an empty vector (left) or with a plasmid expressing the matching Sup35 mutant under the control of the GAL1 promoter (right). All strains were
cultured for 3 days in galactose/raffinose dropout medium, and then 10-fold serial dilutions were plated onto medium lacking adenine to select for [PSI
]. (D)
Tryptophan, alanine, and phenylalanine substitution mutants form stable, curable prions. Ade
isolates from panel B were streaked onto either SC medium ()
or SC plus 3 mM guanidine-HCl () and then restreaked onto YPD to test for prion loss. Two representative Ade
isolates are shown for each mutant. (E)
Overexpression of the tyrosine substitution mutants induced wild-type [PSI
] formation. Yeast expressing wild-type Sup35 were transformed with either an
empty vector (vector) or the vector modified to express either the wild-type Sup35 NM domain (wild-type) or the NM domain of the ORD tyrosine substitution
mutants under the control of the GAL1 promoter. Cells were then tested for [PSI
] formation.
Compositional Determinants of Prion Maintenance
March 2015 Volume 35 Number 5 mcb.asm.org 907Molecular and Cellular Biology
on October 20, 2015 by guesthttp://mcb.asm.org/Downloaded from
expression (Fig. 6C), albeit at various frequencies; in fact, the Trp
substitutions actually substantially increased prion formation.
However, the Ade
colonies formed by the Phe and Trp substitu-
tion constructs, and to a lesser extent by the Ile construct, were
substantially bigger than those formed by the Ala, Val, Leu, or Met
constructs. Furthermore, as in the plasmid shuffling experiments
(Fig. 6A), Phe and Trp constructs were able to consistently main-
tain a white [PSI
] phenotype when passaged on YPD medium,
while the Val, Ile, Leu, and Met Ade
isolates all reverted to a red
phenotype after growth on nonselective medium (Fig. 6D). The
only mutant that behaved differently from the results of the shuf-
fling experiment was the Ala substitution mutant, which was able
to form rare stable, curable prions (Fig. 6D).
The low frequency of Ade
colonies seen for some of the mu-
tants (Fig. 6C) could have been due to either a defect in prion
nucleation or in maintenance of prion aggregates. However, over-
expression of each of the mutants efficiently stimulated wild-type
Sup35 to form prions, suggesting that these mutants do not have a
nucleation defect (Fig. 6E). Collectively, these results indicated
that the mutants containing nonaromatic hydrophobic replace-
ments for tyrosine are able to efficiently aggregate but are unable
to stably propagate these aggregates as prions.
Yeast PFDs that successfully propagate show similar compo-
sitional biases. Alberti et al. previously generated a large data set
in which the 100 yeast protein fragments (averaging about 160
amino acids in length) with the greatest compositional similarity
to the Sup35, Ure2, Rnq1, and New1 PFDs were tested in four
distinct assays of prion-like activity (12). The four assays used in
this study included three measures of aggregation (formation of
fluorescent foci when expressed as an enhanced yellow fluores-
cent protein [EYFP] fusion, formation of SDS-resistant aggre-
gates in an SDD-AGE assay, and in vitro aggregation of purified
recombinant proteins, as monitored by thioflavin-T fluores-
cence) and one assay (replacement of the PFD of Sup35 with
each fragment) that was tested for the ability to support true
prion activity (12).
Eighteen of the fragments in the data set passed all four assays
(12). Another 12 of the fragments passed all three of the aggrega-
tion assays but failed the Sup35 fusion assay; this indicated that
these domains have an ability to form aggregates but may have
a defect in prion maintenance, although it is important to note
that proteins can fail the Sup35 fusion assay for a variety of
reasons and that even some known PFDs fail in this assay (see
Discussion). These two sets had very similar Q/N contents (Fig.
7A) and predicted aggregation propensities according to PAPA
(data not shown). However, consistent with the results of our
library screens, aromatic residues were overrepresented (Fig.
7B) and nonaromatic hydrophobic residues were underrepre-
sented (Fig. 7C) among the proteins that passed all four assays.
Strikingly, each of the most hydrophobic nonaromatic residues
(Ile, Met, Val, and Leu) was more common among the proteins
that passed the three aggregation assays but failed the Sup35
assay, although this bias was only statistically significant for
Leu and Val (P0.008 and 0.0002, respectively). While neither
the overrepresentation of aromatics nor the underrepresenta-
tion of nonaromatic hydrophobics was absolute, both were
statistically significant (P0.0003 for nonaromatic hydropho-
bics and P0.05 for aromatics), suggesting that the trends
identified in our library experiments may extend to other
prion-like domains.
DISCUSSION
We previously showed that the ND and ORD have distinct com-
positional requirements (26). Here, we made the first steps toward
quantitatively defining these requirements. Most significantly, we
found that aliphatic residues promote prion activity in the ND
while inhibiting prion activity in the ORD. It appears that this
difference is due to the distinct functions of the two regions in
supporting prion activity. Consistent with earlier work suggesting
that the ORD is largely dispensable for prion formation (22), re-
placement of aromatic residues in the ORD with aliphatic residues
did not significantly affect the ability of the PFD to nucleate prion
formation, but it did disrupt maintenance of prion aggregates.
These experiments nicely complement previous work that
used polyglutamine to study the effects of amino acid composition
on fiber fragmentation (34,38). Alexandrov et al. inserted differ-
FIG 7 Aromatic residues are overrepresented and nonaromatic hydrophobics are underrepresented among domains with prion activity. Alberti et al. (12) tested
100 prion-like domains in four assays for prion-like activity. Three of the assays tested aggregation activity, while a fourth tested the ability of the domains to
support prion activity when inserted in place of the Sup35 PFD. Box-and-whisker plots show the frequency of Q/N residues (A), aromatic residues (B), and
nonaromatic hydrophobic residues (C; Ile, Leu, Met, and Val) among each of the Alberti proteins that passed all tests (white bars) or that passed all tests except
the Sup35-fusion protein assay (gray bars).
MacLea et al.
908 mcb.asm.org March 2015 Volume 35 Number 5Molecular and Cellular Biology
on October 20, 2015 by guesthttp://mcb.asm.org/Downloaded from
ent residues into polyglutamine stretches and found that aromatic
residues reduced average aggregate size (34). However, there are
challenges in interpreting these experiments. While poly-Q forms
aggregates, it does not form prions per se, and it is not clear how
similar the structures of poly-Q aggregates are to prion aggregates;
Alexandrov et al. suggested that the uniform sequence of poly-Q
likely results in “staggered” aggregates, rather than the ordered,
in-register parallel -sheet aggregates formed by Sup35 (34). Ad-
ditionally, while a smaller aggregate size is consistent with an in-
crease in fiber fragmentation, average aggregate size would also be
expected to be a function of the frequency of spontaneous aggre-
gate nucleation and the rate of fiber growth rates. For example,
spontaneous nucleation, like fragmentation, creates new indepen-
dently segregating aggregates, so if nucleation rates were excep-
tionally high, such that many nucleation events happen per-cell
division, this would increase the number of independent aggre-
gates and thus decrease average aggregate size. The current exper-
iments expand on this previous work by beginning to parse the
specific steps in prion activity affected by each amino acid.
The observation that specific amino acids can have different
effects at different positions is itself not surprising or unprece-
dented. For example, Bondarev et al. recently showed that inser-
tion of lysine residues into the first or second repeat of the Sup35
ORD resulted in [PSI
] loss, but similar insertions in the other
repeats did not (52). This result makes sense; the ND and first two
repeats of the ORD are required for efficient nucleation of prion
formation and for addition to preexisting [PSI
] aggregates (22),
suggesting that this region forms critical contacts that mediate
fiber growth. In contrast, the third through fifth repeats are dis-
pensable for these activities. Therefore, it is not surprising that
mutations in the first two repeats might have stronger effects.
Indeed, we saw what may be a similar effect: proline and glycine,
both of which have low -sheet propensities, were better tolerated
in the ORD than the ND. However, our results also showed some-
thing more unexpected—that amino acids that promote prion
activity at one region in a PFD can actually inhibit prion activity in
other regions.
Although the differences between the amino acid composi-
tions of red and white clones in our prion maintenance library
experiments were highly statistically significant, they were not suf-
ficient to predict with 100% accuracy whether a given mutant
could propagate prions (Fig. 4 and 5). Part of this could be due to
the large confidence intervals associated with each amino acid’s
PMP score. Also, factors other than just simple amino acid com-
position may affect prion maintenance. For example, there may be
certain positions where specific amino acids are favored or disfa-
vored. We did not observe any strong positional biases in any of
our libraries, but this in part could have been due to limitations of
our sample sizes. We also examined whether a number of other
factors might, in conjunction with PMP score, improve discrimi-
nation between the sets. These include presence/absence of groups
of amino acids, total number of charges, net charges of each 10-
mer, distribution of charges within each 10-mer, hydrophobicity,
predicted -sheet propensity, and disorder propensity. However,
none of these improved the discrimination between the propagat-
ing and nonpropagating sequences compared to PMP scores
alone (data not shown).
Similarly, the biases for aromatic residues and against aliphatic
residues among domains that can substitute for the Sup35 PFD in
supporting prion activity were also not absolute. The prion pro-
tein Ure2 is a good example of this. The Ure2 PFD has only two
aromatic residues (both F) and 12 nonaromatic hydrophobic res-
idues (I, L, V, and M) (53). It is possible that other residues that
modestly promote prion maintenance can substitute for aromatic
residues when present at a high enough density; for example, Ure2
has very high Ser and Asn content, both of which scored as mod-
estly promoting prion maintenance in our assays. Alternatively,
different prions have different chaperone requirements (54), so
the trends that we observed might be specific for the constellation
of chaperones that propagate [PSI
]. Consistent with this, Crist et
al. (28) identified repeat sequences lacking aromatic residues that
could substitute for the Sup35 ORD in supporting prion activity,
but the resulting prions were Hsp104 independent. Thus, more
detailed comparison of the amino acid compositions and chaper-
one requirements of different PFDs may provide insight into the
mechanism by which specific compositional features promote
prion maintenance.
Because of the distinct chaperone requirements for different
prions, it may prove difficult to develop a simple method to pre-
dict whether a given sequence will be able support prion mainte-
nance. The prion prediction algorithm PAPA is able to effectively
discriminate between Q/N-rich proteins that have high versus low
aggregation propensity (19), but for proteins that show high ag-
gregation propensity it is ineffective at predicting which will be
able to support full-fledged prion activity. The current experi-
ments explain why: the prion propensity scores that make up
PAPA match the ND library scores more closely than the ORD
library scores (Fig. 2), suggesting that PAPA predominantly scores
aggregation propensity.
There are some important caveats to consider when analyzing
constructs in the Sup35 fusion assay (as in Fig. 7). First, Sup35 is
an essential gene, so any [PSI
] prion that too effectively seques-
ters and inactivates Sup35 will be lethal; indeed, many spontane-
ously formed [PSI
] variants are lethal (55). Thus, a fragment
could fail the Sup35 assay because it forms too strong a prion
variant. Additionally, context does affect prion activity. Some
known PFDs fail to support prion activity when fused to Sup35,
and conversely, many of the fragments that support prion activity
when fused to Sup35 have not yet been shown to form prions in
their native context. Therefore, while our analysis may help ex-
plain why some prion-like fragments fail in the Sup35 fusion as-
say, additional experiments will be needed to determine whether
similar effects would be seen in other sequence contexts.
Finally, it should be noted that the prion maintenance library
experiments were done with a single strong [PSI
] strain. We
chose to use a strong [PSI
] variant for two reasons. First, it in-
creased the chances that any red clones were due to a prion main-
tenance defect, as opposed to the spontaneous prion loss that
would be common with a weak strain. Second, various evidence
suggests that the amyloid core extends further into the ORD in
weak prion variants (24,56), increasing the chances that red iso-
lates could be due to an inability to add onto preexisting aggre-
gates rather than a defect in the subsequent maintenance steps.
The difference in prion maintenance ability between aromatic and
aliphatic residues appears to be prion variant independent, as the
ORD mutants in which tyrosines were replaced with aliphatic res-
idues not only failed to propagate an existing strong prion variant
(Fig. 6A) but also were unable to form their own stable prion
variants (Fig. 6D). Nevertheless, it remains possible that some of
the other observed biases are prion variant dependent.
Compositional Determinants of Prion Maintenance
March 2015 Volume 35 Number 5 mcb.asm.org 909Molecular and Cellular Biology
on October 20, 2015 by guesthttp://mcb.asm.org/Downloaded from
ACKNOWLEDGMENTS
This work was supported by the National Science Foundation (MCB-
1023771) and National Institutes of Health (GM105991).
We thank the laboratories of P. Shing Ho and Olve Peersen for helpful
comments. We thank the undergraduate researchers who assisted in li-
brary screening, including Robert Newell, Jr., Lauren Gonzales, Taylor
Beairsto, Stephen Gross, and Alexander Queen. We also thank Connor
Hendrich and the rest of the Ross lab, as well as Emily Davis and James
Knox in the MacLea lab, for comments and technical support.
REFERENCES
1. Chiti F, Dobson CM. 2006. Protein misfolding, functional amyloid, and
human disease. Annu Rev Biochem 75:333–366. http://dx.doi.org/10
.1146/annurev.biochem.75.101304.123901.
2. Prusiner SB. 1982. Novel proteinaceous infectious particles cause scrapie.
Science 216:136–144. http://dx.doi.org/10.1126/science.6801762.
3. Prusiner SB. 1991. Molecular biology of prion diseases. Science 252:
1515–1522. http://dx.doi.org/10.1126/science.1675487.
4. Weissmann C. 1991. Spongiform encephalopathies. The prion’s progress.
Nature 349:569–571. http://dx.doi.org/10.1038/349569a0.
5. Wickner RB. 1994. [URE3] as an altered URE2 protein: evidence for a
prion analog in Saccharomyces cerevisiae. Science 264:566–569.
6. Wickner RB, Masison DC, Edskes HK. 1995. [PSI] and [URE3] as yeast
prions. Yeast 11:1671–1685.
7. Lindquist S. 1997. Mad cows meet psi-chotic yeast: the expansion of the
prion hypothesis. Cell 89:495–498.
8. Sondheimer N, Lindquist S. 2000. Rnq1: an epigenetic modifier of pro-
tein function in yeast. Mol Cell 5:163–172. http://dx.doi.org/10.1016/S10
97-2765(00)80412-8.
9. Derkatch IL, Bradley ME, Hong JY, Liebman SW. 2001. Prions affect the
appearance of other prions: the story of [PIN()]. Cell 106:171–182. http:
//dx.doi.org/10.1016/S0092-8674(01)00427-5.
10. Michelitsch MD, Weissman JS. 2000. A census of glutamine/asparagine-
rich regions: implications for their conserved function and the prediction
of novel prions. Proc Natl Acad SciUSA97:11910–11915. http://dx.doi
.org/10.1073/pnas.97.22.11910.
11. MacLea KS, Ross ED. 2011. Strategies for identifying new prions in yeast.
Prion 5:1–6. http://dx.doi.org/10.4161/pri.17918.
12. Alberti S, Halfmann R, King O, Kapila A, Lindquist S. 2009. A system-
atic survey identifies prions and illuminates sequence features of priono-
genic proteins. Cell 137:146 –158. http://dx.doi.org/10.1016/j.cell.2009.02
.044.
13. Toombs JA, McCarty BR, Ross ED. 2010. Compositional determinants
of prion formation in yeast. Mol Cell Biol 30:319–332. http://dx.doi.org
/10.1128/MCB.01140-09.
14. Ter-Avanesyan MD, Kushnirov VV, Dagkesamanskaya AR, Didichenko
SA, Chernoff YO, Inge-Vechtomov SG, Smirnov VN. 1993. Deletion
analysis of the SUP35 gene of the yeast Saccharomyces cerevisiae reveals
two non-overlapping functional regions in the encoded protein. Mol Mi-
crobiol 7:683–692.
15. Ter-Avanesyan MD, Dagkesamanskaya AR, Kushnirov VV, Smirnov
VN. 1994. The SUP35 omnipotent suppressor gene is involved in the
maintenance of the non-Mendelian determinant [psi] in the yeast Sac-
charomyces cerevisiae. Genetics 137:671–676.
16. DePace AH, Santoso A, Hillner P, Weissman JS. 1998. A critical role for
amino-terminal glutamine/asparagine repeats in the formation and prop-
agation of a yeast prion. Cell 93:1241–1252.
17. Liu J-J, Sondheimer N, Lindquist SL. 2002. Changes in the middle region
of Sup35 profoundly alter the nature of epigenetic inheritance for the yeast
prion [PSI]. Proc Natl Acad SciUSA99(Suppl 4):S16446–S16453.
http://dx.doi.org/10.1073/pnas.252652099.
18. Ross ED, Edskes HK, Terry MJ, Wickner RB. 2005. Primary sequence
independence for prion formation. Proc Natl Acad SciUSA102:12825–
12830. http://dx.doi.org/10.1073/pnas.0506136102.
19. Toombs JA, Petri M, Paul KR, Kan GY, Ben-Hur A, Ross ED. 2012. De
novo design of synthetic prion domains. Proc Natl Acad SciUSA109:
65196524. http://dx.doi.org/10.1073/pnas.1119366109.
20. Ross ED, MacLea KS, Anderson C, Ben-Hur A. 2013. A bioinformat-
ics method for identifying Q/N-rich prion-like domains in proteins.
Methods Mol Biol 1017:219 –228. http://dx.doi.org/10.1007/978-1
-62703-433-8_16.
21. Paushkin SV, Kushnirov VV, Smirnov VN, Ter-Avanesyan MD. 1996.
Propagation of the yeast prion-like [psi] determinant is mediated by
oligomerization of the SUP35-encoded polypeptide chain release factor.
EMBO J 15:3127–3134.
22. Osherovich LZ, Cox BS, Tuite MF, Weissman JS. 2004. Dissection and
design of yeast prions. PLoS Biol 2:e86. http://dx.doi.org/10.1371/journal
.pbio.0020086.
23. Liu JJ, Lindquist S. 1999. Oligopeptide-repeat expansions modulate
“protein-only” inheritance in yeast. Nature 400:573–576.
24. Shkundina IS, Kushnirov VV, Tuite MF, Ter-Avanesyan MD. 2006. The
role of the N-terminal oligopeptide repeats of the yeast Sup35 prion pro-
tein in propagation and transmission of prion variants. Genetics 172:827–
835. http://dx.doi.org/10.1534/genetics.105.048660.
25. Parham SN, Resende CG, Tuite MF. 2001. Oligopeptide repeats in the
yeast protein Sup35p stabilize intermolecular prion interactions. EMBO J
20:2111–2119. http://dx.doi.org/10.1093/emboj/20.9.2111-2119.
26. Toombs JA, Liss NM, Cobble KR, Ben-Musa Z, Ross ED. 2011. [PSI]
maintenance is dependent on the composition, not primary sequence, of
the oligopeptide repeat domain. PLoS One 6:e21953. http://dx.doi.org/10
.1371/journal.pone.0021953.
27. Ohhashi Y, Ito K, Toyama BH, Weissman JS, Tanaka M. 2010. Differ-
ences in prion strain conformations result from non-native interactions in
a nucleus. Nat Chem Biol 6:225–230. http://dx.doi.org/10.1038/nchembio
.306.
28. Crist CG, Nakayashiki T, Kurahashi H, Nakamura Y. 2003. [PHI], a
novel Sup35-prion variant propagated with non-Gln/Asn oligopeptide
repeats in the absence of the chaperone protein Hsp104. Genes Cells
8:603–618. http://dx.doi.org/10.1046/j.1365-2443.2003.00661.x.
29. Derdowski A, Sindi SS, Klaips CL, DiSalvo S, Serio TR. 2010. A size
threshold limits prion transmission and establishes phenotypic diversity.
Science 330:680683. http://dx.doi.org/10.1126/science.1197785.
30. Chernoff YO, Lindquist SL, Ono B, Inge-Vechtomov SG, Liebman SW.
1995. Role of the chaperone protein Hsp104 in propagation of the yeast
prion-like factor [psi]. Science 268:880884.
31. Wegrzyn RD, Bapat K, Newnam GP, Zink AD, Chernoff YO. 2001.
Mechanism of prion loss after Hsp104 inactivation in yeast. Mol Cell Biol
21:46564669. http://dx.doi.org/10.1128/MCB.21.14.4656-4669.2001.
32. Ness F, Ferreira P, Cox BS, Tuite MF. 2002. Guanidine hydrochloride
inhibits the generation of prion “seeds” but not prion protein aggregation
in yeast. Mol Cell Biol 22:5593–5605. http://dx.doi.org/10.1128/MCB.22
.15.5593-5605.2002.
33. Helsen CW, Glover JR. 2012. Insight into molecular basis of curing of
[PSI] prion by overexpression of 104-kDa heat shock protein (Hsp104).
J Biol Chem 287:542–556. http://dx.doi.org/10.1074/jbc.M111.302869.
34. Alexandrov AI, Polyanskaya AB, Serpionov GV, Ter-Avanesyan MD,
Kushnirov VV. 2012. The effects of amino acid composition of glu-
tamine-rich domains on amyloid formation and fragmentation. PLoS
One 7:e46458. http://dx.doi.org/10.1371/journal.pone.0046458.
35. Wadsworth JDF, Hill AF, Beck JA, Collinge J. 2003. Molecular and
clinical classification of human prion disease. Br Med Bull 66:241–254.
http://dx.doi.org/10.1093/bmb/66.1.241.
36. Prusiner SB, Scott MR, DeArmond SJ, Cohen FE. 1998. Prion protein
biology. Cell 93:337–348.
37. Vitrenko YA, Pavon ME, Stone SI, Liebman SW. 2007. Propagation of
the [PIN] prion by fragments of Rnq1 fused to GFP. Curr Genet 51:309
319. http://dx.doi.org/10.1007/s00294-007-0127-0.
38. Alexandrov IM, Vishnevskaya AB, Ter-Avanesyan MD, Kushnirov VV.
2008. Appearance and propagation of polyglutamine-based amyloids in
yeast: tyrosine residues enable polymer fragmentation. J Biol Chem 283:
15185–15192. http://dx.doi.org/10.1074/jbc.M02071200.
39. Rüdiger S, Germeroth L, Schneider-Mergener J, Bukau B. 1997. Sub-
strate specificity of the DnaK chaperone determined by screening cellu-
lose-bound peptide libraries. EMBO J 16:1501–1507.
40. Rüdiger S, Schneider-Mergener J, Bukau B. 2001. Its substrate specificity
characterizes the DnaJ co-chaperone as a scanning factor for the DnaK
chaperone. EMBO J 20:1042–1050. http://dx.doi.org/10.1093/emboj/20.5
.1042.
41. Sherman F. 1991. Getting started with yeast. Methods Enzymol 194:3–21.
42. Gonzalez Nelson AC, Paul KR, Petri M, Flores N, Rogge RA,
Cascarina SM, Ross ED. 2014. Increasing prion propensity by hydro-
phobic insertion. PLoS One 9:e89286. http://dx.doi.org/10.1371
/journal.pone.0089286.
43. Song Y, Wu Y-X, Jung G, Tutar Y, Eisenberg E, Greene LE, Masison
MacLea et al.
910 mcb.asm.org March 2015 Volume 35 Number 5Molecular and Cellular Biology
on October 20, 2015 by guesthttp://mcb.asm.org/Downloaded from
DC. 2005. Role for Hsp70 chaperone in Saccharomyces cerevisiae prion
seed replication. Eukaryot Cell 4:289–297. http://dx.doi.org/10.1128/EC
.4.2.289-297.2005.
44. Morris JA, Gardner MJ. 1988. Statistics in medicine: calculating confi-
dence intervals for relative risks (odds ratios) and standardised ratios and
rates. BMJ 296:1313–1316.
45. Agresti A. 2007. An introduction to categorical data analysis, 2nd ed.
Wiley, Hoboken, NJ.
46. Tyedmers J, Madariaga ML, Lindquist S. 2008. Prion switching in re-
sponse to environmental stress. PLoS Biol 6:e294. http://dx.doi.org/10
.1371/journal.pbio.0060294.
47. Cox BS. 1965. , a cytoplasmic suppressor of super-suppressor in yeast.
Heredity (Edinb) 20:505–521.
48. Tuite MF, Mundy CR, Cox BS. 1981. Agents that cause a high frequency
of genetic change from [psi] to [psi-] in Saccharomyces cerevisiae. Ge-
netics 98:691–711.
49. Jung G, Masison DC. 2001. Guanidine hydrochloride inhibits Hsp104
activity in vivo: a possible explanation for its effect in curing yeast prions.
Curr Microbiol 43:7–10. http://dx.doi.org/10.1007/S002840010251.
50. Ferreira PC, Ness F, Edwards SR, Cox BS, Tuite MF. 2001. The elimi-
nation of the yeast [PSI] prion by guanidine hydrochloride is the result
of Hsp104 inactivation. Mol Microbiol 40:1357–1369. http://dx.doi.org
/10.1046/j.1365-2958.2001.02478.x.
51. Street AG, Mayo SL. 1999. Intrinsic beta-sheet propensities result from
van der Waals interactions between side chains and the local backbone.
Proc Natl Acad Sci U S A 96:9074–9076.
52. Bondarev SA, Shchepachev VV, Kajava AV, Zhouravleva GA. 2013.
Effect of charged residues in the N-domain of Sup35 protein on prion
[PSI] stability and propagation. J Biol Chem 288:28503–28513. http:
//dx.doi.org/10.1074/jbc.M113.471805.
53. Du Z. 2011. The complexity and implications of yeast prion domains.
Prion 5:311–316. http://dx.doi.org/10.4161/pri.18304.
54. Reidy M, Masison DC. 2011. Modulation and elimination of yeast prions
by protein chaperones and co-chaperones. Prion 5:245–249. http://dx.doi
.org/10.4161/pri.17749.
55. McGlinchey RP, Kryndushkin D, Wickner RB. 2011. Suicidal [PSI]is
a lethal yeast prion. Proc Natl Acad SciUSA108:5337–5341. http://dx
.doi.org/10.1073/pnas.1102762108.
56. Toyama BH, Kelly MJS, Gross JD, Weissman JS. 2007. The structural
basis of yeast prion strain variants. Nature 449:233–237. http://dx.doi.org
/10.1038/nature06108.
57. Fawcett T. 2006. An introduction to ROC analysis. Pattern Recognit Lett
27:861–874. http://dx.doi.org/10.1016/j.patrec.2005.10.010.
Compositional Determinants of Prion Maintenance
March 2015 Volume 35 Number 5 mcb.asm.org 911Molecular and Cellular Biology
on October 20, 2015 by guesthttp://mcb.asm.org/Downloaded from
... When substituted in the place of a portion of the Sup35 PD, the hnRNPA1 and hnRNPA2B1 PrLDs are able to support prion activity in a mutation-dependent manner (Kim et al. 2013;Paul et al. 2017). We, therefore, randomly mutagenized a segment of the G-rich PrLDs within these fusion proteins in a manner analogous to previous mutagenesis of the Sup35 PD (Toombs et al. 2010;MacLea et al. 2015). Interestingly, while non-aromatic hydrophobic residues (I, L, M, and V) strongly promote prion formation in the Sup35 PD (Toombs et al. 2010;MacLea et al. 2015), the same residues led to rapid, proteasome-mediated degradation of the G-rich PrLDs. ...
... We, therefore, randomly mutagenized a segment of the G-rich PrLDs within these fusion proteins in a manner analogous to previous mutagenesis of the Sup35 PD (Toombs et al. 2010;MacLea et al. 2015). Interestingly, while non-aromatic hydrophobic residues (I, L, M, and V) strongly promote prion formation in the Sup35 PD (Toombs et al. 2010;MacLea et al. 2015), the same residues led to rapid, proteasome-mediated degradation of the G-rich PrLDs. However, when the degradation-promoting sequences were substituted into the Q/N-rich Sup35 PD, they did not noticeably accelerate degradation. ...
... Finally, native Q/N-rich domains tend to have fewer aromatic residues compared to the non-aromatic hydrophobic residues. This is somewhat surprising, given that the Q/N-rich prion domains from canonical yeast prion proteins tend to exhibit secondary biases for aromatic residues (particularly tyrosine; Harrison and Gerstein 2003;MacLea et al. 2015). However, when Q/N-rich domains from the known yeast prion proteins (Wickner 1994;Sondheimer and Lindquist 2000;Derkatch et al. 2001;Du et al. 2008;Alberti et al. 2009;Patel et al. 2009;Halfmann et al. 2012;Suzuki et al. 2012;Chernova et al. 2017a) are considered as a separate class, these domains exhibit lower ILMV and higher FWY content relative to Q/N-rich domains as a unified class. ...
Article
Full-text available
Protein aggregation in vivo is generally combated by extensive proteostatic defenses. Many proteostasis factors specifically recognize aggregation-prone features and re-fold or degrade the targeted protein. However, protein aggregation is not uncommon, suggesting that some proteins employ evasive strategies to aggregate in spite of the proteostasis machinery. Therefore, in addition to understanding the inherent aggregation propensity of protein sequences, it is important to understand how these sequences affect proteostatic recognition and regulation in vivo. In a recent study, we used a genetic mutagenesis and screening approach to explore the aggregation or degradation promoting effects of the canonical amino acids in the context of G-rich and Q/N-rich prion-like domains (PrLDs). Our results indicate that aggregation propensity scales are strongly influenced by the interplay between specific PrLD features and proteostatic recognition. Here, we briefly review these results and expand upon their potential implications. In addition, a preliminary exploration of the yeast proteome suggests that these proteostatic regulation heuristics may influence the compositional features of native G-rich and Q/N-rich domains in yeast. These results improve our understanding of the features affecting the aggregation and proteostatic regulation of prion-like domains in a cellular context, and suggest that the sequence space for native prion-like domains may be shaped by proteostatic constraints.
... The PrLDs used in that update (28 total) included all but one of the most promising PrLDs identified by Alberti et al. in the original study using this algorithm [11]. The candidate domains did not necessarily score the highest in the algorithmic output but all were among the top 100 candidates and also scored the highest in four biochemical tests designed to determine prionogenic propensity [2,3,23]. Despite their high scores, it should be noted that many of these PrLDs have not been verified as being part of bona fide prions. ...
... Another limitation of this model is that it focuses on Q/N rich PrLDs with no consideration for other prion determinants. It has been shown that while the Q/N-rich region is required for prion formation, certain oligopeptide patterns outside of the Q/Nrich region are also required for prion maintenance [23]. Additionally, Q/N richness appears to be a non-specific determinant of prionogenic propensity since not only do many proteins which exhibit distinct Q/N-rich regions ultimately end up not being prions [1,11] but also since certain organisms possess an inherently disproportionate amount of Q/N-rich regions across their entire proteome. ...
Chapter
Recently a likely prion was found in the proteome of Arabidopsis thaliana based on inclusive compositional similarity to known yeast prion-like domains (PrLDs) and gene ontology analysis. A total of 474 proteins in the Arabidopsis thaliana proteome showed significant compositional similarity to known PrLDs in yeast warranting further analysis. In this chapter, we describe the use and limitations of the PLAAC (Prion-Like Amino Acid Composition) software for the identification of prions, specifically as it has recently been applied to identifying the first prion in plants. Our interest in this method, though presented from a plant-based perspective here, is broad and is primarily in using the method for comparative assessment with novel prion identification algorithms currently under development in our lab. This chapter is not meant to serve as a replete description of the architecture and use of HMM in prion prediction in general but is intended to serve as a reference for implementation and interpretation of output from PLAAC and its application to plant proteomes.
... Using centralized PTM databases, we mapped PTMs to human PrLDs. While the contribution of each of the canonical amino acids to aggregation of PrLDs has been fairly well-characterized [7,84], consistent effects of each type of PTM on aggregation of PrLDs have not been defined. Therefore, we mapped PTMs to PrLDs using a relaxed aggregation propensity threshold (PAPA cutoff = 0.0, rather than the standard 0.05 threshold), which accounts for the possibility that PTMs could increase aggregation propensity or regulate the solubility of proteins whose aggregation propensity is near the standard 0.05 aggregation threshold. ...
... Nevertheless, one could speculate about what the effects of each PTM might be with respect to aggregation of PrLDs based on prion propensities for the 20 canonical amino acids and the physicochemical characteristics of the PTM. For example, charged residues typically inhibit prion aggregation within PrLDs [7,84], so phosphorylation of serine, threonine, or tyrosine residues may tend to suppress prion-like activity [93]. Conversely, lysine acetylation or N-terminal acetylation neutralizes the charge, increases hydrophobicity, and introduces hydrogen bond acceptors, which may positively contribute to prion activity. ...
Article
Full-text available
Background: Impaired proteostatic regulation of proteins with prion-like domains (PrLDs) is associated with a variety of human diseases including neurodegenerative disorders, myopathies, and certain forms of cancer. For many of these disorders, current models suggest a prion-like molecular mechanism of disease, whereby proteins aggregate and spread to neighboring cells in an infectious manner. The development of prion prediction algorithms has facilitated the large-scale identification of PrLDs among "reference" proteomes for various organisms. However, the degree to which intraspecies protein sequence diversity influences predicted prion propensity has not been systematically examined. Results: Here, we explore protein sequence variation introduced at genetic, post-transcriptional, and post-translational levels, and its influence on predicted aggregation propensity for human PrLDs. We find that sequence variation is relatively common among PrLDs and in some cases can result in relatively large differences in predicted prion propensity. Sequence variation introduced at the post-transcriptional level (via alternative splicing) also commonly affects predicted aggregation propensity, often by direct inclusion or exclusion of a PrLD. Finally, analysis of a database of sequence variants associated with human disease reveals a number of mutations within PrLDs that are predicted to increase prion propensity. Conclusions: Our analyses expand the list of candidate human PrLDs, quantitatively estimate the effects of sequence variation on the aggregation propensity of PrLDs, and suggest the involvement of prion-like mechanisms in additional human diseases.
... Nevertheless, one could speculate about what the effects of each PTM might be with respect to aggregation of PrLDs based on prion propensities for the 20 canonical amino acids and the physicochemical characteristics of the PTM. For example, charged residues typically inhibit prion aggregation within PrLDs (7,80), so phosphorylation of serine, threonine, or tyrosine residues may tend to suppress prion-like activity (90). Conversely, lysine acetylation or N-terminal acetylation neutralizes the charge, increases hydrophobicity, and introduces hydrogen bond acceptors, which may positively contribute to prion activity. ...
... Therefore, PTMs likely play an important role in regulating the aggregation propensity of certain PrLDs.Using centralized PTM databases, we mapped PTMs to human PrLDs. While the contribution of each of the canonical amino acids to aggregation of PrLDs has been fairly wellcharacterized(7,80), consistent effects of each type of PTM on aggregation of PrLDs have not been defined. Therefore, we mapped PTMs to PrLDs using a relaxed aggregation propensity threshold (PAPA cutoff=0.0, ...
Preprint
Full-text available
Protein aggregation is involved in a variety of muscular and neurodegenerative disorders. For many of these disorders, current models suggest a prion-like molecular mechanism of disease, whereby proteins aggregate and spread to neighboring cells in an infectious manner. A variety of proteins with prion-like domains (PrLDs) have recently been linked to these disorders. The development of prion prediction algorithms has facilitated the large-scale identification of PrLDs among "reference" proteomes for various organisms. However, the degree to which intraspecies protein sequence diversity influences predicted aggregation propensity for PrLDs has not been systematically examined. Here, we explore protein sequence variation introduced at genetic, post-transcriptional, and post-translational levels, and its influence on predicted aggregation propensity for human PrLDs. We find that sequence variation is relatively common among PrLDs and in some cases can result in relatively large differences in predicted aggregation propensity. Analysis of a database of sequence variants associated with human disease reveals a number of mutations within PrLDs that are predicted to increase aggregation propensity. Our analyses expand the list of candidate human PrLDs, estimate the effects of sequence variation on the aggregation propensity of PrLDs, and suggest the involvement of prion-like mechanisms in additional human diseases.
... These two subdomains have distinct compositional requirements. Specifically, while both hydrophobic and aromatic residues promote prion formation, only aromatic residues appear to promote prion maintenance [82]. Insertion of aromatic residues into polyglutamine segments reduces the average aggregate size in yeast [83], suggesting that aromatic residues promote chaperone-dependent aggregate cleavage. ...
Article
Full-text available
Stress granules are ribonucleoprotein assemblies that form in response to cellular stress. Many of the RNA-binding proteins found in stress granule proteomes contain prion-like domains (PrLDs), which are low-complexity sequences that compositionally resemble yeast prion domains. Mutations in some of these PrLDs have been implicated in neurodegenerative diseases, including amyotrophic lateral sclerosis and frontotemporal dementia, and are associated with persistent stress granule accumulation. While both stress granules and prions are macromolecular assemblies, they differ in both their physical properties and complexity. Prion aggregates are highly stable homopolymeric solids, while stress granules are complex dynamic biomolecular condensates driven by multivalent homotypic and heterotypic interactions. Here, we use stress granules and yeast prions as a paradigm to examine how distinct sequence and compositional features of PrLDs contribute to different types of PrLD-containing assemblies.
... Tyrosine was also the most abundant hydrophobic residue in PrDs identified in yeast (Alberti et al. 2009;. MacLea et al. (2015) showed that tyrosine is necessary for stable prion variants of Sup35. Later it was proposed that aromatic residues are favored in PrDs, because they promote prion formation and chaperone-dependent prion propagation while avoiding detection by the degradation machinery (Gonzalez Nelson et al. 2014;Cascarina et al. 2018). ...
Article
Full-text available
Prions, proteins that can convert between structurally and functionally distinct states and serve as non-Mendelian mechanisms of inheritance, were initially discovered and only known in eukaryotes, and consequently considered to likely be a relatively late evolutionary acquisition. However, the recent discovery of prions in bacteria and viruses has intimated a potentially more ancient evolutionary origin. Here we provide evidence that prion-forming domains exist in the domain archaea, the last domain of life left unexplored with regard to prions. We searched for archaeal candidate prion-forming protein sequences computationally, described their taxonomic distribution and phylogeny, and analyzed their associated functional annotations. Using biophysical in vitro assays, cell-based and microscopic approaches, and dye-binding analyses, we tested select candidate prion-forming domains for prionogenic characteristics. Out of the 16 tested, 8 formed amyloids, and 6 acted as protein-based elements of information transfer driving non-Mendelian patterns of inheritance. We also identified short peptides from our archaeal prion candidates that can form amyloid fibrils independently. Lastly, candidates that tested positively in our assays had significantly higher tyrosine and phenylalanine content than candidates that tested negatively, an observation that may help future archaeal prion predictions. Taken together, our discovery of functional prion-forming domains in archaea provides evidence that multiple archaeal proteins are capable of acting as prions—thus expanding our knowledge of this epigenetic phenomenon to the third and final domain of life and bolstering the possibility that they were present at the time of the last universal common ancestor (LUCA).
... The sequence features of the Sky1 PrLD that drive recruitment are also unclear. The amino acid composition of PrLDs is a key determinant of prion activity, LLPS, and interactions with the proteostasis machinery (Cascarina et al. 2018;MacLea et al. 2015;Pak et al. 2016;Ross et al. 2005), but it is not clear whether it is the dominant determinant of recruitment of the Sky1 PrLD to granules. Additionally, although PrLD deletion reduced Sky1 recruitment to stress granules, it did not significantly affect the rate of stress granule dissolution, so the relationship between Sky1 localization and its dissolution activity is unclear. ...
Article
Full-text available
Serine‐arginine (SR) protein kinases regulate diverse cellular activities, including various steps in RNA maturation and transport. The yeast Saccharomyces cerevisiae expresses a single SR kinase, Sky1. Sky1 has a bipartite kinase domain, separated by an aggregation-prone prion-like domain (PrLD). The assembly of PrLDs is involved in the formation of various membraneless organelles, including stress granules; stress granules are reversible ribonucleoprotein assemblies that form in response to a variety of stresses. Here, we review a recent study suggesting that Sky1’s PrLD promotes Sky1 recruitment to stress granules, and that Sky1 regulates stress granule dissolution by phosphorylating the RNA-shuttling protein Npl3.
... Prion-like status has been demonstrated experimentally to be largely composition-dependent, although special roles in prion propagation have been determined for specific parts of priondeterminant sequence or specific repeat patterns ( Toombs et al., 2010;MacLea et al., 2015;Shattuck et al., 2017). Domains of prion-like composition also have roles in formation of stress granules and other biomolecular condensates ( Jain et al., 2016;Franzmann et al., 2018). ...
Article
Full-text available
Prions in eukaryotes have been linked to diseases, evolutionary capacitance, large-scale genetic control, and long-term memory formation. Prion formation and propagation have been studied extensively in the budding yeast Saccharomyces cerevisiae. Here, we have analysed the conservation of sequence and of prion-like composition for prion-forming proteins and for other prion-like proteins from S. cerevisiae, across three evolutionary levels. We discover that prion-like status is well-conserved for about half the set of prion-formers at the Saccharomycetes level, and that prion-forming domains evolve more quickly as sequences than other prion-like domains do. Such increased mutation rates may be linked to the acquisition of functional roles for prion-forming domains during the evolutionary epoch of Saccharomycetes. Domain scores for prion-like composition in S. cerevisiae are strongly correlated with scores for such composition weighted evolutionarily over the dozens of fungal species examined, indicating conservation of such prion-like status. Examples of notable prion-like proteins that are highly conserved both in sequence and prion-like composition are discussed.
... 35 A subsequent study confirmed that aromatic and hydrophobic residues promote prion formation. 36 In another work it was also shown that insertions of valines or isoleucines in the polyglutamine sequence that was fused to the Sup35p MC-domain instead of the N-domain, increase protein aggregation compared with the polyglutamine. 37 These results are in accordance with the parallel and in-register superpleated b-structure, where the hydrophobic residues are placed one over the other along the fibril and should form energetically favorable contacts that can stabilize the fibril structure. ...
Article
Full-text available
Yeast [PSI+] prion is one of the most suitable and well characterized system for the investigation of the prion phenomenon. However, until recently, the lack of data on the 3D arrangement of Sup35p prion fibrils hindered progress in this area. The recent arrival in this field of new experimental techniques led to the parallel and in-register superpleated b-structure as a consensus model for Sup35p fibrils. Here, we analyzed the effect of amino acid substitutions of the Sup35 protein through the prism of this structural model. Application of a newly developed computational approach, called ArchCandy, gives us a better understanding of the effect caused by mutations on the fibril forming potential of Sup35 protein. This bioinformatics tool can be used for the design of new mutations with desired modification of prion properties. Thus, we provide examples of how today, having progress toward elucidation of the structural arrangement of Sup35p fibrils, researchers can advance more efficiently to a better understanding of prion [PSI+] stability and propagation.
Article
Full-text available
Prions are self-propagating alternative states of protein domains. They are linked to both diseases and functional protein roles in eukaryotes. Prion-forming domains in Saccharomyces cerevisiae are typically domains with high intrinsic protein disorder ( i.e., that remain unfolded in the cell during at least some part of their functioning), that are converted to self-replicating amyloid forms. S. cerevisiae is a member of the fungal class Saccharomycetes , during the evolution of which a large population of prion-like domains has appeared. It is still unclear what principles might govern the molecular evolution of prion-forming domains, and intrinsically disordered domains generally. Here, it is discovered that in a set of such prion-forming domains some evolve in the fungal class Saccharomycetes in such a way as to absorb general mutation biases across millions of years, whereas others do not, indicating a spectrum of selection pressures on composition and sequence. Thus, if the bias-absorbing prion formers are conserving a prion-forming capability, then this capability is not interfered with by the absorption of bias changes over the duration of evolutionary epochs. Evidence is discovered for selective constraint against the occurrence of lysine residues (which likely disrupt prion formation) in S. cerevisiae prion-forming domains as they evolve across Saccharomycetes . These results provide a case study of the absorption of mutational trends by compositionally biased domains, and suggest methodology for assessing selection pressures on the composition of intrinsically disordered regions.
Article
Full-text available
Prion formation involves the conversion of proteins from a soluble form into an infectious amyloid form. Most yeast prion proteins contain glutamine/asparagine-rich regions that are responsible for prion aggregation. Prion formation by these domains is driven primarily by amino acid composition, not primary sequence, yet there is a surprising disconnect between the amino acids thought to have the highest aggregation propensity and those that are actually found in yeast prion domains. Specifically, a recent mutagenic screen suggested that both aromatic and non-aromatic hydrophobic residues strongly promote prion formation. However, while aromatic residues are common in yeast prion domains, non-aromatic hydrophobic residues are strongly under-represented. Here, we directly test the effects of hydrophobic and aromatic residues on prion formation. Remarkably, we found that insertion of as few as two hydrophobic residues resulted in a multiple orders-of-magnitude increase in prion formation, and significant acceleration of in vitro amyloid formation. Thus, insertion or deletion of hydrophobic residues provides a simple tool to control the prion activity of a protein. These data, combined with bioinformatics analysis, suggest a limit on the number of strongly prion-promoting residues tolerated in glutamine/asparagine-rich domains. This limit may explain the under-representation of non-aromatic hydrophobic residues in yeast prion domains. Prion activity requires not only that a protein be able to form prion fibers, but also that these fibers be cleaved to generate new independently-segregating aggregates to offset dilution by cell division. Recent studies suggest that aromatic residues, but not non-aromatic hydrophobic residues, support the fiber cleavage step. Therefore, we propose that while both aromatic and non-aromatic hydrophobic residues promote prion formation, aromatic residues are favored in yeast prion domains because they serve a dual function, promoting both prion formation and chaperone-dependent prion propagation.
Article
Full-text available
Recent studies have shown that Sup35p prion fibrils probably have a parallel in-register β-structure. However, the part(s) of the N-domain critical for fibril formation and maintenance of the [PSI+] phenotype remains unclear. Here we designed a set of five SUP35 mutant alleles (sup35KK) with lysine substitutions in each of five N-domain repeats, and investigated their effect on infectivity and ability of corresponding proteins to aggregate and coaggregate with wild type Sup35p in the [PSI+] strain. Alleles sup35-M1 (Y46K/Q47K) and sup35-M2 (Q61K/Q62K) led to prion loss, whereas sup35-M3 (Q70K/Q71K), sup35-M4 (Q80K/Q81K), and sup35-M5 (Q89K/Q90K) were able to maintain the [PSI+] prion. This suggests that the critical part of the parallel in-register β-structure for the studied [PSI+] prion variant lies in the first 63–69 residues. Our study also reveals an unexpected interplay between the wild type Sup35p and proteins expressed from the sup35KK alleles during prionization. Both Sup35-M1p and Sup35-M2p coaggregated with Sup35p, but only sup35-M2 led to prion loss in a dominant manner. We suggest that in the fibrils, Sup35p can bind to Sup35-M1p in the same conformation, whereas Sup35-M2p only allowed the Sup35p conformation that leads to the non-heritable fold. Mutations sup35-M4 and sup35-M5 influence the structure of the prion forming region to a lesser extent, and can lead to the formation of new prion variants.
Article
Full-text available
An official journal of the Genetics Society, Heredity publishes high-quality articles describing original research and theoretical insights in all areas of genetics. Research papers are complimented by News & Commentary articles and reviews, keeping researchers and students abreast of hot topics in the field.
Article
Interpreting the Logistic Regression ModelInference for Logistic RegressionLogistic Regression with Categorical PredictorsMultiple Logistic RegressionSummarizing Effects in Logistic RegressionProblems
Article
Two protein-based genetic elements (prions) have been identified in yeast. It is not clear whether other prions exist, nor is it understood how one might find them. We established criteria for searching protein databases for prion candidates and found several. The first examined, Rnq1, exists in distinct, heritable physical states, soluble and insoluble. The insoluble state is dominant and transmitted between cells through the cytoplasm. When the prion-like region of Rnq1 was substituted for the prion domain of Sup35, the protein determinant of the prion [PSI+], the phenotypic and epigenetic behavior of [PSI+] was fully recapitulated. These findings identify Rnq1 as a prion, demonstrate that prion domains are modular and transferable, and establish a paradigm for identifying and characterizing novel prions.
Article
Prions are self-propagating protein conformations. Recent research brought insight into prion propagation, but how they first appear is unknown. We previously established that the yeast non-Mendelian trait [PIN+] is required for the de novo appearance of the [PSI+] prion. Here, we show that the presence of prions formed by Rnq1 or Ure2 is sufficient to make cells [PIN+]. Thus, [PIN+] can be caused by more than one prion. Furthermore, an unbiased functional screen for [PIN+] prions uncovered the known prion gene, URE2, the proposed prion gene, NEW1, and nine novel candidate prion genes all carrying prion domains. Importantly, the de novo appearance of Rnq1::GFP prion aggregates also requires the presence of other prions, suggesting the existence of a general mechanism by which the appearance of prions is enhanced by heterologous prion aggregates.
Article
Numerous proteins contain domains that are enriched in glutamine and asparagine residues, and aggregation of some of these proteins has been linked to both prion formation in yeast and a number of human diseases. Unfortunately, predicting whether a given glutamine/asparagine-rich protein will aggregate has proven difficult. Here we describe a recently developed algorithm designed to predict the aggregation propensity of glutamine/asparagine-rich proteins. We discuss the basis for the algorithm, its limitations, and usage of recently developed online and downloadable versions of the algorithm.