Changes in plumage color and patterns in Polbar breed chicks (Polish conservative breed) during their first weeks after hatching

Abstract

Autosexing is one of the most interesting issue in poultry science. In practice, the sex-linked genes give 100%
certainty in sex differentation based on phenotypic features. This phenomenon is of practical importance because farms producing table eggs can use only hens for rearing, while reproductive farms provide themselves with pullets and cockerels in the appropriate proportions. Polbar is a unique Polish native hen breed created in 1946–1953 from crossing of Greenleg Partridge hens and barred Plymouth Rock cocks, which are characterized by autosexing. The aim of the study was the evaluation of young chicks plumage pattern during the first month of their hatching. Furthermore, the age of the birds, in which the chicks coloration disappears and the coloration of young pullets and cockerels unify should be defined. The second part of the study was designed to check whether there is a relationship between changes in the level of methylation of the CDKN2B gene, associated with the development of color, and changes in plumage color and patterns in Polbar breed chicks. Obtained results indicate that both on the 1st day of life and in the 22nd week, cytosine in the amplified fragment can become methylated. It means that the investigated gene is largely active. It was also found that differences in the exterior of pullets and cockerels are most evident on the 1st day after hatching. The varied coloration of opposite sex specimens remains intensively until 28–30 days after hatching. With age, chicks’ feathers on wings and dorsal parts of body get similar barred coloration. Observations on the time-point where the pattern and colors of the plumage become similar in young pullets and cockerels may have not only practical significance, but can be used in future in studies on melanogenesis and its disorders in humans.

Full text

Europ.Poult.Sci., 78. 2014, ISSN 1612-9199, © Verlag Eugen Ulmer, Stuttgart. DOI: 10.1399/eps.2014.70
Changes in plumage color and patterns in Polbar breed chicks (Polish
conservative breed) during their first weeks after hatching
Veränderungen in der Farbe und im Muster des Gefieders von Polbar-Hühnern (Polnische
Erhaltungszucht) in den ersten Lebenswochen nach dem Schlupf
Magdalena Gryzińska1, Justyna Batkowska1, Katarzyna Andraszek2, Beata Horecka1 and Grażyna Jeżewska-Witkowska1
1Dept. of Biological Basis of Animal Production, University of Life Sciences in Lublin, Lublin, Poland
2Dept. of Animal Genetics and Horse Breeding, Siedlce University of Natural Sciences and Humanities, Siedlce, Poland
Correspondence: justyna.batkowska@up.lublin.pl
Manuscript received 28 June 2014, accepted 3 October 2014
Introduction
Autosexing is one of the most interesting issues in poultry science. In practice it gives 100% certainty in sex
distinction based on phenotypic features (plumage colour and pattern, feathering rate, leg colour). This method can
be a non-invasive alternative for both the most popular sexing methods i.e. Japanese method determining sex by the
presence a rudimentary phallus in the ventral part of the cloaca of males or its lack in females (MASUI and
HASHIMOTO, 1933) as well as for endoscopic sex identification, which may result in the injury of genitals of young
birds (GRAJDA and SMORĄG, 2007).
Autosexing uses the genes located on the sex chromosomes. The first reports showing the linkage of “barring”
pattern with sex chromosome in birds date from 1908 (SPILLMAN, 1908). Precursors in developing autosexing breeds
were PUNNETT and PEASE (1930). Crossing barred Plymouth Rock cocks (PR) with golden Campine hens they obtained
hybrids with barred plumage (inherited from father), which were then backcrossed with Campine cocks. The breed
developed in 1929 was called “campbar”. It was the first autosexing hen breed in the world. In a similar way PUNNETT
(1940) created: legbar” breed (♀ Patridgenous leghorn × ♂PR) while JAAP (1941) “oklabar” (♀ rhode island red ×♂
PR). Other autosexing breeds are buffbar, brussbar, dorbar. The element “bar” in the names is used to emphasize the
gene causing chicks autosexing.
In each case PR cocks with sex-linked genes (bar and silver) were used. In any case to create them PR cocks were used,
which have two sex-linked genes (bar and silver). The dominant allele of the bar gene (B) inhibits melanin
accumulation and causes the occurrence of white bars on feathers (“barring”). ZBZB cocks are brighter than ZBW hens,
because double dose of the bar gene causes bigger highlighting of the stripes on feathers than a single dose. While
dominant allele of the silver gene (S) determines the silver colour, its recessive variant golden colour (s). PR cocks
were also used in Polbar breed creation crossing them with Greenleg Partridge (GP) hens. The work started in 1946
(WÓJCIK et al., 2012). The first generation had black or black with white patches on chick-down. Both sexes differed
phenotypically. In order to create the F2 generation, the hybrids (cocks and hens) were crossed as well as the hybrid
cocks (♀GP×♂PR) were backcrossed with GP hens. In the second generation a greater variability of chick-down were
observed, as well as it was shown that female birds had patridgenous coloration of plumage (dark with characteristic
eyebrow extending from the eye to the back of the head), male birds were brighter (light gray). It was found that
homozygous silver barred breed (♂ZBSZBS; ♀ZBSW) can be obtained using appropriate crossing (KAUFMAN, 1963;
GRYZIŃSKA and NIESPODZIEWAŃSKI, 2009; GRYZIŃSKA et al., 2013b). Adult hens are slightly darker than cocks.
Plumage is rich and soft, adjacent to the body. Polbar occurs only in one particular color variety (GRYZIŃSKA et al.,
2012; ANDRASZEK et al., 2012). The only Polbar hen population in the world is maintained as a conservative stock at
Laura Kaufman Didactic and Research Station of Small Animals that belongs to the University of Life Sciences in
Lublin (Poland). The pure breed is kept for more than 50 generations in the number about 1000 birds and sex ratio of
10♀:1♂.
Europ.Poult.Sci., 78. 2014, ISSN 1612-9199, © Verlag Eugen Ulmer, Stuttgart. DOI: 10.1399/eps.2014.70
1/ 1
0
16
.
12
.
2014

Major pigments determining an individual coloration are melanins. Melanogenesis pathway is controlled by a
number of proteins, and therefore it can be modified in many stages and color inheritance is dependent pn a number
of genes. CDKN2B (Cyclin-dependent kinase inhibitor 2B) gene is located on the Z chromosome at the bar locus with
four other genes: 31 micro-RNA (miRNA-31), methylthioadenosine phosphorylase (MTAP), tripartite motif 36
(TRIM36) and protein geranylgeranyltransferase type I, β subunit (PGGT1B). All are responsible for the activity of
melanin in melanocytes (CAMPO, 1991).
The aim of the study was the evaluation of young chicks plumage pattern during the first month after their hatching.
Furthermore, the age of the birds, in which the chicks coloration disappears and the coloration of young pullets and
cockerels unify were defined. The second part of the study was designed to check whether there is a relationship
between changes in the level of methylation of the CDKN2B gene, associated with the development of color, and
changes in plumage color and patterns in Polbar breed chicks.
Material and methods
Chicks of of Polbar breed were used for the study. After hatching chicks were individually marked with wing clips.
DNA isolation from blood (as a model tissue) of 1-day and 22-weeks-old hens was performed with a QIAamp DNA
Blood Mini Kit (QIAGEN). Cytosine to uracil and methylocytosine to cytosine conversion with sodium
hydrogensulfate was carried out using Imprint DNA Modification Kit (Sigma). Primers used for the reaction were
designed so that one pair annealed in the position of methylation occurrence, where the methylcytosine remained
cytosine, and the second pair at the point where cytosine deaminated to uracil. Primers were designed with
MethPrimer® software, on the basis of CDKN2B (Gallus gallus) gene sequence (NCBI, Gene ID: 395076). The reactions
(25 μL total volume) contained 2μl of DNA after conversion and 1.0 U Taq polymerase (Ampli Taq Gold 360 DNA
Polymerase, Applied Biosystems) in the manufacturer's buffer, adjusted to a final concentration of 2.5 mM MgCl2,
0.2 mM of each dNTP and 0.1 mM of each primer. A Thermal Cycler (MJ Researche) was programmed for an initial
incubation at 94˚C for 5 min; 35 cycles each with denaturing at 94˚C for 45 sec., annealing at 57˚C for 45 sec, and
extension at 72˚C for 45 sec and a final cycle at 72˚C for 7min. Primers melting temperatures were defined with Tm
Calculator software (Applied Biosystems).
Methylation analysis was performed by MSP (methylation-specyfic PCR) technique. PCR amplification products were
size-separated by electrophoresis in 1.8% agarose gels and visualized by UV illumination after staining with
ethidium bromide. The characteristic of primers for MSP reaction is presented in Table1.
Table 1. Characteristic of primers for MSP reaction
Charakteristika der für die MSP-Reaktion verwendeten Primer
No Primer Sequence 5’ → 3’ Product size
1 MF CDKN2B ATTTCGTCGTTTGAGAGTTGTC 173 bp
2 MR CDKN2B CCGTACTAACCGCTCTCTACG
3 UF CDKN2B TGTTGTTTGAGAGTTGTTGGG 176 bp
4 UR CDKN2B CCATACTAACCACTCTCTACACCA
MF – complementary starter for the leading strand at the methylation site
MR – complementary starter for the delayed strand at the methylation site
UF – complementary starter for the leading strand at the non-methylated site
UR – complementary starter for the delayed strand at the non-methylated site
Additionally, the photographs of chicks – pullets and cockerels were taken on 1st day after hatching and
subsequently on 14th, 21st and 28th day of life as well as at 22 weeks of age (adult birds).
Europ.Poult.Sci., 78. 2014, ISSN 1612-9199, © Verlag Eugen Ulmer, Stuttgart. DOI: 10.1399/eps.2014.70
2/ 1
0
16
.
12
.
2014

Results
The electropherogram concerns MSP (Figure1). The upper part of the electropherogram (A) relates to 1-day-old
individuals, while the lower part (1B) to the 22-weeks-old chicks. Each pair of neighbouring lanes represents one
individual. On the attached electropherogram MSP products responsible for the presence of methylated and non-
methylated gene in case of both age groups are visible. There is no clear pattern of methylation for any of age group.
Obtained results indicate that both on the 1st day of life and in the 22nd week, cytosine in the amplified fragment can
become methylated. It means that the investigated gene maintains active in the studied period. Probably studies of
hens at a later age might indicate a difference.
Figure 1. MSP reaction results for CDKN2B gene on 1 day old and 22th week of the chicken. A – 1-day-old individuals; B – 22-weeks-old
individuals; Mk – molecular weight marker, M – MSP product with primers complementary to the methylated template; U – MSP product
with primers specific to non-methylated template
Ergebnisse der MSP-Reaktion für das Gen CDKN2B bei einem Tag und 22 Wochen alten Hühnern. A – 1 Tag alte Küken, B – 22 Wochen alte
Hühner; Mk – Molekulargewicht des Markers, M – MSP-Produkt mit zum methylierten Template komplementären Primern, U – MSP-Produkt
mit zum nicht-methylierten Template komplementären Primern
The Polbar chicks on 1st day after hatching are presented in Figure2. Other photographs (Figures3,4,5 and6)
illustrate the chicks on 14th, 21st and 28th day of their life, while Figure5 presents adult birds. Based on carried out
observations and comparison of the photographic material wide variation in the plumage patterns and colors of
Polbar chicks is visible. Immediately after hatching pullets were separated from cockerels. In the genetically fixed
breed, pullets (♀ZBSW) have dark chick-down with patridgenous pattern on olive background and the characteristic
dark line in the extension of the outer eye corner. Females are haploids with a single gene dose located on Z
chromosome. In contrast, cockerels coloration (♂ZBSZBS) is uniformly creamy or yellow, often with a darker streak
running along the back (Figure2). The characteristic coloration of pullets and cockerels maintains in 2nd and 3rd week
of their life (Figures3 and 4). In 4th week pullets and cockerels are darker than adult cockerels (Figure5) and from
that moment the colour unification between males and female continues. Differences in appearance between
specimens of opposite sexes on average, remains intensely until 28–30 days after hatching.
Europ.Poult.Sci., 78. 2014, ISSN 1612-9199, © Verlag Eugen Ulmer, Stuttgart. DOI: 10.1399/eps.2014.70
3/ 1
0
16
.
12
.
2014

Figure 2. The Polbar chicks on 1st day after hatching (on the left male, on the right female)
Das Polbar-Küken am ersten Tag nach dem Schlupf (Hahn links, Henne rechts)
Figure 3. The Polbar chicks on 14th day of life (on the left male, on the right female)
Das Polbar-Küken am 14. Lebenstag (Hahn links, Henne rechts)
Europ.Poult.Sci., 78. 2014, ISSN 1612-9199, © Verlag Eugen Ulmer, Stuttgart. DOI: 10.1399/eps.2014.70
4/ 1
0
16
.
12
.
2014

Figure 4. The Polbar chicks on 21st day of life (on the left male, on the right female)
Das Polbar-Küken am 21. Lebenstag (Hahn links, Henne rechts)
Europ.Poult.Sci., 78. 2014, ISSN 1612-9199, © Verlag Eugen Ulmer, Stuttgart. DOI: 10.1399/eps.2014.70
5/ 1
0
16
.
12
.
2014

Figure 5. The Polbar chicks on 28th day of life (on the left male, on the right female)
Das Polbar-Küken am 28. Lebenstag (Hahn links, Henne rechts)
Figure 6. The adult birds of Polbar breed (on the left male, on the right female)
Adulte Tiere der Rasse Polbar (Hahn links, Henne rechts)
The similarity of adult birds is evident on the basis of the plumage coloration, but cocks are considerably more
“barred” compared to hens (Figure6). Additionally, adult birds are characterized by sexual dimorphism,
characteristic for Gallus gallus (large comb and wattles and sickle feathers in cockerels tail). Black stripes on feathers
are clearer and more densely spaced which makes the roosters are more expressive than hens whose color is darker
from chick age to sexual maturity. The photographs illustrate the differences in the plumage coloration of chicks as
Europ.Poult.Sci., 78. 2014, ISSN 1612-9199, © Verlag Eugen Ulmer, Stuttgart. DOI: 10.1399/eps.2014.70
6/ 1
0
16
.
12
.
2014

well as in their adult life. They confirm differences in chick-down colour of both sexes and reduction of this
differentiation at the age of sexual maturity.
Discussion
W chromosome constitutes of less than 2% of the chicken genome and contains only a few coding sequences.
Therefore, much attention is focused on genetic effects of Z chromosome, which contains the genes influencing
features of feather colour and growth (NANDA et al., 2000; SCHMID et al., 2000). The inheritance of sex-linked traits
depends on crossing direction and on presence of dominant allel in male or female genotype. Cross inheritance is
used in poultry breeding and farming to determine the sex of birds immediately after hatching. In autosexing chick
creation S – silver, K-slow feathering and B – bar genes are used (RALPH and SOMES, 1971).
It was indicated that dominant B gen is localized 13,7 cM from inhibitor of dermal melanin (Id) on the long arm of Z
chromosome of Gallus gallus (GGZ). Subsequent reports located this gene in 210cM distance from the Id gene (LEVIN
et al., 1993). Following studies suggest that this fragment with a distance of 2.8 Mb from the distal end of the GGZ is
associated with melanin deposition in feathers. It is a region with a length of 355 kb between NCS0012 and
NCS0017, where 5 genes are located: micro-RNA 31 (miRNA-31), methylthioadenosine phosphorylase (MTAP),
cyclin-dependent kinase inhibitor 2B (CDKN2B), tripartite motif 36 (TRIM36), and protein geranylgeranyltransferase
type I, β subunit (PGGT1B) (DORSHORST and ASHWELL, 2009). It is supposed that all of them are associated with the
activity of melanin in the melanocytes.
CDKN2B gene in fowl is responsible for the activity of melanin in the melanocytes and encodes proteins similar to
one of the cyclin-dependent kinase inhibitors while in other vertebrates for their occurrence CDKN2A gene is
responsible (KIM et al., 2006). Additionally, CDKN2A and MTAP genes are associated with malignant melanoma in
humans, this fact suggests that they may also play a significant role in the cells proliferation. In epigenetic studies
methylation level of CDKN2B gene in Polbar chicken embryo was determined using the MSP technique (methylation-
specific PCR) (GRYZIŃSKA et al., 2014). This gene was not silenced in the examined periods, which can promote the
active production of melanin in melanocytes as well as differentiation of pullets and cockerels on the 1st day after
hatching (GRYZIŃSKA et al., 2013a). A plausible mechanism for the sex-related striped pattern in chickens is that the
CDKN2A mutation (or mutations) results in premature cell death, which in turn leads to the formation of white
stripes lacking melanocytes. This may be then followed by a new wave of melanocytes recruited from a pool of stem
cells, which migrate, colonize the feather follicle, produce melanin and form the next black stripe. Thus, the
mutations causing sex-related striation in chickens may have an opposite effect than mutations associated with
familiar forms of melanoma in humans (HELLSTRÖM et al., 2010). Analyses of DNA methylation in the CDKN2B gene
in Polbar chickens have provided information on epigenetic mechanisms of autosexing in this species and broadened
the general knowledge of the function of epigenetic mechanisms in birds. As one of the locus bar genes, CDKN2B is
responsible for melanin activity in melanocytes (CAMPO, 1991; HELLSTRÖM et al., 2010). The experiment presented
here indicates that CDKN2B expression is not only controlled at the genomic level (mutations) but also at the level of
the epigenome (methylation). The experiment will be continued by measuring the tissue-specific (feather follicles)
methylation patterns.
The hypotheses formulated by NICKERSON (1944) about inhibiting synthesis of melanin and BOWERS (1988) about the
untimely death of cells are important due to the limited current state of knowledge on morphogenesis and
melanoblasts differentiation in feathers. However, it was demonstrated in in vitro studies that melanocytes are able
to live and produce pigment in culture for 30 days (BOWERS and GATLIN, 1985). The CDKN2B gene role in cell cycle
regulation (DORSHORST and ASHWELL, 2009) complements the Bowers hypothesis (1988) about the untimely cell
death. The results of our experiment are similar to those obtained by other investigators (BOWERS and GATLIN, 1985)
about 30-day period of viability and pigment production by melanocytes.
Observation of pattern and color uniformity of pullets and cockerels chick-down may have not only practical
significance, but can also be used in future studies on melanogenesis and its disorders in humans.
Europ.Poult.Sci., 78. 2014, ISSN 1612-9199, © Verlag Eugen Ulmer, Stuttgart. DOI: 10.1399/eps.2014.70
7/ 1
0
16
.
12
.
2014

Conclusions
Autosexing is the fastest method to identify poultry sex, which is characterized by high accuracy provided that
maternal and paternal components are properly matched, as it is in the case of Polbar breed. The sex determination
of other breeds of day-old chicks is very difficult, or sometimes impossible, as long as differences in their appearance
are emphasized with birds' growth. Autosexing has practical importance in poultry production, as well as it can be
used in studies on melanogenesis and its disorders in humans. The differences in appearance of cockerels and pullets
is most visible on the 12th day after hatching. The varied coloration of both sexes specimens remains intense for 28
–30 days after hatching. With chicks aging, feathers on wings and on dorsal parts of body take similar barred
coloration.
Summary
Autosexing is one of the most interesting issue in poultry science. In practice, the sex-linked genes give 100%
certainty in sex differentation based on phenotypic features. This phenomenon is of practical importance because
farms producing table eggs can use only hens for rearing, while reproductive farms provide themselves with pullets
and cockerels in the appropriate proportions. Polbar is a unique Polish native hen breed created in 1946–1953 from
crossing of Greenleg Partridge hens and barred Plymouth Rock cocks, which are characterized by autosexing. The
aim of the study was the evaluation of young chicks plumage pattern during the first month of their hatching.
Furthermore, the age of the birds, in which the chicks coloration disappears and the coloration of young pullets and
cockerels unify should be defined. The second part of the study was designed to check whether there is a relationship
between changes in the level of methylation of the CDKN2B gene, associated with the development of color, and
changes in plumage color and patterns in Polbar breed chicks.
Obtained results indicate that both on the 1st day of life and in the 22nd week, cytosine in the amplified fragment can
become methylated. It means that the investigated gene is largely active. It was also found that differences in the
exterior of pullets and cockerels are most evident on the 1st day after hatching. The varied coloration of opposite sex
specimens remains intensively until 28–30 days after hatching. With age, chicks’ feathers on wings and dorsal parts
of body get similar barred coloration. Observations on the time-point where the pattern and colors of the plumage
become similar in young pullets and cockerels may have not only practical significance, but can be used in future in
studies on melanogenesis and its disorders in humans.
Key words
Chicken, genetics, Polbar, Greenleg Partridge, Plymouth Rock, sex determination, autosexing
Zusammenfassung
Veränderungen in der Farbe und im Muster des Gefieders von Polbar-Hühnern (Polnische Erhaltungszucht) in den
ersten Lebenswochen nach dem Schlupf
Die Geschlechtssortierung anhand von geschlechtsgebundenen Gefiedermerkmalen (Autosexing) ist ein höchst
interessantes Gebiet, da hier die Geschlechter anhand von phänotypischen Charakteristika mit 100%iger Sicherheit
bestimmt werden können. Dieses Phänomen hat vor allem beim Schlupf von Küken der Legeherkünfte eine große
praktische Bedeutung. Polbar ist eine einheimische, polnische Hühnerrasse, die zwischen 1946 und 1953 aus der
Kreuzung von Greenleg Partridge und gestreiften Plymouth Rock, die für das Autosexing bekannt sind, entstanden
und inzwischen weit verbreitet ist. Das Ziel der Untersuchung war die Erfassung der Veränderung der
Gefiedercharakteristika von Polbar-Küken in den ersten Lebenswochen bis zum adulten Tier. Ferner sollte das Alter
bestimmt werden, bei dem die Färbung des Kükengefieders verschwindet und sich die Färbung der Hennen und
Hähne angleicht. Im zweiten Teil der Studie sollte geprüft werden, inwieweit beim Polbar-Küken eine Verbindung
zwischen den Veränderungen im Methylierungsgrad des CDKN2B-Gens und der Entwicklung der Gefiederfarbe- und
-strukturen besteht.
Die Ergebnisse deuten darauf hin, dass das Cytosin im amplifizierten Fragment sowohl am ersten Lebenstag als auch
in der 22. Lebenswoche methyliert werden kann. Das bedeutet, dass dieses Gen sehr lange aktiv ist. Es wurde ferner
festgestellt, dass die Unterschiede in der Gefiederfärbung und -strukturen der Hennen und Hähne am 1. Lebenstag
am deutlichsten sind. Diese Unterschiede in der Gefiederfarbe zwischen den Geschlechtern bleiben etwa bis zum
Europ.Poult.Sci., 78. 2014, ISSN 1612-9199, © Verlag Eugen Ulmer, Stuttgart. DOI: 10.1399/eps.2014.70
8/ 1
0
16
.
12
.
2014

28.-30. Lebenstag bestehen. Mit zunehmendem Alter nehmen die Federn an den Flügeln und am Rücken eine
ähnliche gestreifte Färbung an. Die Beobachtung der Angleichung der Strukturen und der Farbe des Gefieders
zwischen Legehennen und Hähnen hat nicht nur eine praktische Bedeutung. Sie kann in Zukunft auch als Basis für
Studien zur Melanogenese und deren Störungen beim Menschen dienen.
Stichworte
Huhn, Genetik, Polbar, Greenleg Partridge, Plymouth Rock, Geschlechtsbestimmung, Autosexing
References
ANDRASZEK, K., M. GRYZIŃSKA, S. KNAGA, E. WÓJCIK, E. SMALEC, 2012: Number and size of nucleoli in the
spermatocytes of chicken and Japanese Quail. Folia Biol. 60, 121-127.
BOWERS, R., J. GATLIN, 1985: A simple method for the establishment of tissue culture melanocytes from regenerating
fowl feathers. In Vitro Cell. Dev. Biol. Plant 21, 39-44.
BOWERS, R.R., 1988: The melanocyte of the chicken: A review. Prog. Clin. Biol. Res. 256, 49-63.
CAMPO, J.L., 1991: Use of the sex-linked barring (B) gene for chick sexing on an eumelanotic columbian background.
Poult Sci. 70, 1469-73.
DORSHORST, B.J., C.M. ASHWELL, 2009: Genetic mapping of the sex-linked barring gene in the chicken. Poult. Sci.
88, 1811-1817.
GRAJDA, B., Z. SMORĄG, 2007: Application of reproduction biotechnology methods in animal biodiversity
conservation. Biotechnology 79, 55-65.
GRYZIŃSKA, M., K. ANDRASZEK, G. JEZEWSKA-WITKOWSKA, 2014: Estimation of Global Content of 5-methylcytosine in
DNA during Allantoic and Pulmonary Respiration in the Chicken Embryo. Fol. Biol. (Kraków) 62, 97-101.
GRYZIŃSKA, M., E. BŁASZCZAK, A. STRACHECKA, G. JEŻEWSKA-WITKOWSKA, 2013b: Analysis of age-related global DNA
methylation in chicken. Biochem. Genet. 51, 554-563.
GRYZIŃSKA, M., K. ANDRASZEK, G. JOCEK, 2013a: DNA methylation analysis of the gene CDKN2B in Gallus gallus
(Chicken). Folia Biol. 61, 165-171.
GRYZIŃSKA, M., M. KRAUZE, A. STRACHECKA, 2012: Ca(2+)-ATPase activity according to the sex and age of Polbar
hens. Med. Weter. 68, 483-487.
GRYZIŃSKA, M., M. NIESPODZIEWAŃSKI, 2009: History of the autosexing breed of Polbar (Pb) hens. Zootechnical News
260, 31-35 (in Polish).
HELLSTRÖM, A.R., E. SUNDSTRÖM, U. GUNNARSSON, B. BED'HOM, M. TIXIER-BOICHARD, C.F. HONAKER, A.S. SAHLQVIST,
P. JENSEN, O. KÄMPE, P.B. SIEGEL, S. KERJE, L. ANDERSSON, 2010: Sex-linked barring in chickens is controlled by the
CDKN2A/B tumour suppressor locus. Pigment Cell Melanoma Res. 23, 521-530.
JAAP, R.G., 1941: Auto-sexlinkage accuracy with the gene for barred feathers in red to black color genotypes. Poult.
Sci. 20, 317-321.
KAUFMAN, L., 1963: Polbar – a new autosexing breed. Rocz. Nauk. Rol. 82, 361-372 (in Polish).
KIM, S.H., J. ROWE, H. FUJII, R. JONES, B. SCHMIERER, B.W. KONG, K. KUCHLER, D. FOSTER, D. ISH-HOROWICZ, G. PETERS,
2006: Upregulation of chicken p15INK4b at senescence and in the developing brain. J. Cell. Sci. 119, 2435-2443.
LEVIN, I., L.B. CRITTENDEN, J.B. DODGSON, 1993: Genetic map of the chicken Z chromosome using random amplified
polymorphic DNA (RAPD) markers. Genomics 16, 224-230.
MASUI, K., J. HASHIMOTO, 1933: Sexing young chicks. Journal Printing Co. Ltd., Vancouver, Canada.
NANDA, I., E. ZEND-AJUSCH, Z. SHAU, M. SCHARTL, W. CHNEIDER, M. SCHMID, D.W. BURT, V.M. FOVER, S. MINUZO, T.
HAAF, G.T. DENACHT, G. GOODWIN, M. KOECHLER, 2000: Conserved systems between the chicken Z sex
Europ.Poult.Sci., 78. 2014, ISSN 1612-9199, © Verlag Eugen Ulmer, Stuttgart. DOI: 10.1399/eps.2014.70
9/ 1
0
16
.
12
.
2014

chromosome and human chromosome 9 includes the male regulatory gene DMRT1 a comparative (re)view on
avian sex determination. Cytogenet. Cell. Genet. 89, 67-78.
NICKERSON, M., 1944: An experimental analysis of barred pattern formation in feathers. J. Exp. Zool. 95, 361-394.
PUNNETT, R.C., 1940: Genetics studies in poultry. XI. The Legbar. J. Genet. 41, 1-8.
PUNNETT, R.C., M.S. PEASE, 1930: Genetics in poultry. VIII on a case of sex-linkage within a breed. J. Genet. 22, 395.
RALPH, G., J. SOMES, 1971: Buff Brahma, an autosexing breed of chicken. Poult. Sci. 50, 1798-1801.
SCHMID, M., I. NANDA, M. GUTTENACH, T. HAAF, R. FRIES, D. GRIFFIN, K. WIMMERS, R. FRIES, D. BURT, A. VIGNAL, V.
FILLON, H. CHENG, F. PITEL, M. DELANY, 2000: First raport on chicken genes and chromosomes. Cytogenet. Cell.
Genet. 90, 169-171.
SPILLMAN, W.J., 1908: Spurious allelomorphism: Results of some recent investigations. Am. Nat. 42, 610-615.
WÓJCIK, E., K. ANDRASZEK, M. GRYZIŃSKA, A. WITKOWSKI, M. PAŁYSZKA, E. SMALEC, 2012: Sister chromatid exchange
in Greenleg Partridge and Polbar hens covered by the gene-pool protection program for farm animals in Poland.
Poult. Sci. 91, 2424-2430.
Correspondence: Justyna Batkowska PhD, Department of Biological Basis of Animal Production, University of Life Sciences in Lublin, 13 Akademicka St, 20
–950 Lublin, Poland; e-mail: justyna.batkowska@up.lublin.pl
Europ.Poult.Sci., 78. 2014, ISSN 1612-9199, © Verlag Eugen Ulmer, Stuttgart. DOI: 10.1399/eps.2014.70
1
0
/ 1
0
16
.
12
.
2014