Altered Disease Development in the eui Mutants and Eui Overexpressors Indicates that Gibberellins Negatively Regulate Rice Basal Disease Resistance

Article · May 2008with42 Reads
DOI: 10.1093/mp/ssn021 · Source: PubMed
Abstract
Gibberellins (GAs) form a group of important plant tetracyclic diterpenoid hormones that are involved in many aspects of plant growth and development. Emerging evidence implicates that GAs also play roles in stress responses. However, the role of GAs in biotic stress is largely unknown. Here, we report that knockout or overexpression of the Elongated uppermost internode (Eui) gene encoding a GA deactivating enzyme compromises or increases, respectively, disease resistance to bacterial blight (Xanthomonas oryzae pv. oyrzae) and rice blast (Magnaporthe oryzae). Exogenous application of GA(3) and the inhibitor of GA synthesis (uniconazol) could increase disease susceptibility and resistance, respectively, to bacterial blight. Similarly, uniconazol restored disease resistance of the eui mutant and GA(3) decreased disease resistance of the Eui overexpressors to bacterial blight. Therefore, the change of resistance attributes to GA levels. In consistency with this, the GA metabolism genes OsGA20ox2 and OsGA2ox1 were down-regulated during pathogen challenge. We also found that PR1a induction was enhanced but the SA level was decreased in the Eui overexpressor, while the JA level was reduced in the eui mutant. Together, our current study indicates that GAs play a negative role in rice basal disease resistance, with EUI as a positive modulator through regulating the level of bioactive GAs.
4 Figures
Molecular Plant Volume 1 Number 3 Pages 528–537 May 2008 RESEARCH ARTICLE
Altered Disease Development in the eui Mutants
and Eui Overexpressors Indicates that Gibberellins
Negatively Regulate Rice Basal Disease Resistance
Dong-Lei Yang
a
, Qun Li
a
, Yi-Wen Deng
a
, Yong-Gen Lou
b
, Mu-Yang Wang
a
, Guo-Xing Zhou
b
,
Ying-Ying Zhang
a
and Zu-Hua He
a,1
aNational Key Laboratory of Plant Molecular Genetics, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy
of Sciences, Shanghai, China
bInstitute of Insect Science, College of Agriculture and Biotechnology, Zhejiang University, Hangzhou, China
ABSTRACT Gibberellins (GAs) form a group of important plant tetracyclic diterpenoid hormones that are involved in
many aspects of plant growth and development. Emerging evidence implicates that GAs also play roles in stress responses.
However, the role of GAs in biotic stress is largely unknown. Here, we report that knockout or overexpression of the
Elongated uppermost internode (Eui) gene encoding a GA deactivating enzyme compromises or increases, respectively,
disease resistance to bacterial blight (Xanthomonas oryzae pv. oyrzae) and rice blast (Magnaporthe oryzae). Exogenous
application of GA
3
and the inhibitor of GA synthesis (uniconazol) could increase disease susceptibility and resistance,
respectively, to bacterial blight. Similarly, uniconazol restored disease resistance of the eui mutant and GA
3
decreased
disease resistance of the Eui overexpressors to bacterial blight. Therefore, the change of resistance attributes to GA levels.
In consistency with this, the GA metabolism genes OsGA20ox2 and OsGA2ox1 were down-regulated during pathogen
challenge. We also found that PR1a induction was enhanced but the SA level was decreased in the Eui overexpressor,
while the JA level was reduced in the eui mutant. Together, our current study indicates that GAs play a negative role
in rice basal disease resistance, with EUI as a positive modulator through regulating the level of bioactive GAs.
INTRODUCTION
Plants encounter various abiotic and biotic environmental
stresses during their lifetimes. They have to modulate growth
and development to adapt to different stress conditions. Many
constitutive defense mutants, such as cpr1,mpk4,bon1, and
mekk1, reduce growth (Bowling et al., 1994; Petersen et al.,
2000; Yang and Hua, 2004; Ichimura et al., 2006), indicating
that defense response may down-regulate growth and devel-
opment. This hypothesis is further supported by the snc1 yucca
and cpr6 yucca double mutants in which the phenotypes of
yucca are mostly suppressed by snc1 or cpr6, which are in-
volved in disease resistance (Wang et al., 2007a). On the other
hand, mutation of genes that are involved in growth and de-
velopment, like axr2 (Wang et al., 2007a) and as1 (Nurmberg
et al., 2007), enhance disease resistance; thus, defense re-
sponse antagonizes development and growth in many cases.
It is well known that salicylic acid (SA), jasmonic acid (JA),
and ethylene (ET) are the phytohormones involved in disease
resistance. Recently, the development-regulating hormones
abscisic acid (ABA) (de Torres-Zabala et al., 2007; Adie et al.,
2007), cytokinin (Siemens et al., 2006), auxin (Navarro et al.,
2006; Wang et al., 2007a; Zhang et al., 2007), and brassinoste-
roid (Nakashita et al., 2003) were also reported to be involved in
disease resistance. ABA is an important hormone that is
involved in many aspects of plant development and responses
to abiotic stress, such as drought, low temperature, and salinity,
and also acts as a negative regulator in many defense responses
(Mauch-Mani and Mauch, 2005; de Torres-Zabala et al., 2007).
Auxin regulates almost all growth and development pro-
cesses in plants. It has been shown that Agrobacterium tume-
faciens,Agrobacterium rhizogenes, and other gall-forming
bacteria can produce the hormone for their fitness in the
host (Robert-Seilaniantz et al., 2007). Pseudomonas syringae
(P. syringae) secretes the type III effector AvrRpt2 to modulate
the host auxin physiology to promote disease (Chen et al., 2007).
Interestingly, a member of the GH3 family of early auxin-
responsive genes, GH3.5, acts as a bifunctional modulator in
1
To whom correspondence should be addressed. E-mail zhhe@sibs.ac.cn,
fax 86–21–54924015.
ªThe Author 2008. Published by the Molecular Plant Shanghai Editorial
Office in association with Oxford University Press on behalf of CSPP and
IPPE, SIBS, CAS.
doi: 10.1093/mp/ssn021, Advance Access publication 29 April 2008
by guest on June 9, 2013http://mplant.oxfordjournals.org/Downloaded from
both SA and auxin signaling during pathogen infection in Ara-
bidopsis (Zhang et al., 2007). Overexpression of the GH3.5 gene
led to elevated accumulation of both SA and IAA, and increased
susceptibility to avirulent P. syringae pathogens. The repression
of auxin signaling, through down-regulating the auxin recep-
tor genes by the microRNA miR393a that is induced by the path-
ogen flagellin-derived peptide flg22, resulted in increased
resistance (Navarro et al., 2006). These studies indicate that
auxin plays an important role in disease susceptibility path-
ways. Consistent with these observations, recently, it has been
shown that SA enhances disease resistance partially through
repression of auxin signaling (Wang et al., 2007a).
Cytokinin homeostasis genes were down-regulated during
the ArabidopsisPlasmodiophora brassicae interaction; over-
expression of the cytokinin degradation genes could enhance
disease resistance to the pathogen (Siemens et al., 2006). By
contrast, another growth-regulating hormone, brassinoste-
roid, could increase disease resistance in rice and tobacco
(Nakashita et al., 2003). These data suggest that plants might
employ different hormone signaling pathways to manipulate
growth, development, and defense responses during patho-
gen attack.
Gibberellins (GAs) are a group of isoprenoid plant hormones
that regulate many aspects of growth and development in
plants, including seed germination, stem elongation, and
flowering. GAs were originally identified from the fungal
pathogen Gibberella fujikuroi (Yabuta and Sumiki, 1938),
which causes super-elongated rice, named bakanea rice. GA-
deficient fungal mutants do not affect fungal development,
suggesting that GAs produced by fungal pathogens may
have a pathogenicity role in plants (reviewed by Robert-
Seilaniantz et al., 2007). A direct link of GA biosynthesis with
plant disease symptoms came from the rice dwarf virus (RDV)
study showing that the outer capsid protein P2 of RDV inter-
acts with the host ent–kaurene oxidases (KAO), which play
a key role in the biosynthesis of GAs (Zhu et al., 2005). They
also found that KAO expression was reduced in the infected
plants, leading to decreased levels of GA
1
in the infected
plants. Moreover, the interaction between P2 and rice
ent–kaurene oxidase-like proteins may decrease phytoalexin
biosynthesis and make plants more competent for virus rep-
lication. ELONGATED UPPERMOST INTERNODE (EUI) is a P450
monooxygenase identified recently in our laboratory, which
deactivates biologically active GAs through a novel reaction
(Zhu et al., 2006). The loss-of-function mutants of Eui accumu-
late large amounts of bioactive GAs and extremely elongate
the uppermost internode, whereas overexpression of Eui
resulted in the GA-deficient phenotype with severe dwarfing,
dark-green leaves, and male sterility (Xu et al., 2004; Zhu et
al., 2006). Interestingly, the GA-overproducing eui rice seems
more susceptible to bacterial and fungal pathogens in the
field (Yang and He, unpublished data), implying that GA ho-
meostasis may cross-talk with disease resistance. However,
the underlying mechanism of this GA-related susceptibility
is elusive.
In this work, we compared disease resistance in the eui
mutants and the Eui overexpressors (Eui–OX) with the corre-
sponding wild types, and the effects of exogenous application
of GA and the GA synthesis inhibitor on rice basal disease re-
sistance to bacterial blight (Xanthomonas oryzae pv. oyrzae,
Xoo) and fungal blast (Magnaporthe oryzae,M. oryzae)—two
of the most destructive diseases in rice. We demonstrate that
the GA-mediated development actively impacts in disease re-
sistance in rice, revealing another dimension of the complex
cross-talk between development and defense.
RESULTS
eui Mutants Are More Susceptible to Bacterial Blight
In order to examine the role of Eui-mediated GA homeostasis
in disease resistance, three alleles of the eui mutation and
their corresponding wild-type plants (Zhu et al., 2006) were
inoculated with Xoo Philippine race 6 (strain PXO99A) and
Korean race 1 (strain DY89031) using the leaf-clipping
method. Lesion lengths of more than 50 leaves for each line
were recorded at 14 d post inoculation (dpi). As shown in
Figure 1, the mutants displayed significantly longer lesion
to PXO99A than their controls. Similar results were obtained
with infection by DY89031 (data not shown). Similarly, the
representative transgenic lines S73 and S74, in which Eui
expression was knocked down with RNAi (Zhang et al.,
2008), phenocopied the susceptibility of the eui mutants to
both the strains (Figure 2A and 2B and Supplemental Figure
1A). We also observed slightly enhanced resistance to Xoo
in semi-dwarf rice containing the mutant ‘Green Revolution’
Figure 1. Enhanced Susceptibility to Xoo in the eui Mutants.
Eight-week-old plants were inoculated with Xoo strain PXO99A
using the leaf-clipping method in the eui mutants and the
corresponding wild types. The lesion length of more than 50 leaves
was recorded after 2 weeks. Bars indicate standard error. ** indi-
cates that lesions of the eui mutants were significantly longer than
their wild types (student’s t-test: P= 0.004 with eui-1 and ZS97,
P= 4.1E–12 with eui-3 and ZH11, P= 1E–8 with eui-4 and
02428). These experiments were repeated three times, with
similar results.
Yang et al. dGibberellin Regulates Disease Resistance |529
by guest on June 9, 2013http://mplant.oxfordjournals.org/Downloaded from
gene sd1, in comparison with the near-isogenic tall rice
carrying the wild-type Sd1 gene that encodes a GA20 oxidase
(data not shown; Sasaki et al., 2002). Therefore, the loss of
function of Eui decreased disease resistance, suggesting
that EUI might be a positive modulator of basal disease resis-
tance in rice.
Overexpression of Eui Increases Disease Resistance to
Bacterial Blight
We further analyzed disease resistance of the Eui over-
expressors, Eui–OX (Zhu et al., 2006). These dwarf Eui–OX
lines exhibited significantly increased disease resistance as
compared with the wild-type and the separated negative
transgenic plants (Figure 2 and Supplemental Figure 1B).
We also observed that dwarf severity was somehow correlated
with resistance degree, since lines OX-21, OX-22, OX-39, and
OX-47 were more dwarf and appeared more resistant than
OX-7, OX-11, and OX-15 (Figure 2B and data not shown). In
consistency with disease symptom, a three- to five-fold reduc-
tion in bacterial growth was measured in OX-39 compared
with the wild-type at 8–14 dpi. These results further support
the notion that EUI positively regulates disease resistance
against bacterial blight.
Silence of Eui Leads to Reduction of Resistance and
Overexpression of Eui Enhances Resistance to
Rice Blast Fungus
We have shown that the eui mutants and Eui overexpressors
exhibited opposite resistance phenotypes to bacterial blight.
We next determined whether the EUI-mediated development
process also modulates disease resistance to rice blast. The
RNAi lines S73 and S74 exhibited slightly severer symptoms
than the wild-type (Figure 3A and 3B). For grade 5 disease in-
dex (the most susceptible symptom), S73 and S74 displayed 20
and 19%, respectively, in comparison with 9% in the wild-type
(Figure 3B). Similar reduction of blast resistance was also ob-
served in the eui-1 mutant (data not shown). In contrast, the
overexpression lines OX-7, OX-11, OX-21, and OX-39 exhibited
Figure 2. Enhanced Resistance to Xoo PXO99A in the Eui Overexpressors.
(A) Disease symptoms of the Eui overexpressors OX-7 and OX-39, the RNAi line S73 and the wild-type TP309 at 14 dpi with Xoo strain
PXO99A.
(B) Lesion lengths of the Eui overexpressors and RNAi lines in comparison with the wild-type. More than 50 leaves for each line were
recorded. ** indicates that the P-value was less than 0.0001. This experiment was repeated independently three times, with similar results.
(C) The growth of Xoo strain PXO99A in OX-39 (square) and the wild-type TP309 (triangle). Three leaves of each line at the appointed time
were ground and the diluted extractions were incubated on potato sucrose agar medium with 200 lM azacytidine. Colony-forming units
(CFUs) were counted after 3 d. This experiment was repeated, with similar results.
530 |Yang et al. dGibberellin Regulates Disease Resistance
by guest on June 9, 2013http://mplant.oxfordjournals.org/Downloaded from
significantly enhanced resistance to the fungus, with 70–83%
of grade 0 and 1, in comparison with 18% in the wild-type,
while the percentages for grades 4 and 5 were greatly de-
creased in these lines (Figure 3B). The further determination
of fungal growth in the host using Southern hybridization
with the fungal 28S rDNA probe (Qi and Yang, 2002) confirmed
that fungal growth was greatly limited in the Eui overexpres-
sors, and slightly increased in the RNAi lines compared with the
wild-type (Figure 3C). These data demonstrated that Eui also
positively regulates resistance to rice blast.
GAs Negatively Regulate Disease Resistance
EUI is an enzyme that deactivates bioactive GAs, the eui
mutants and the overexpression transgenic plants accumulate
high or low levels of bioactive GAs, respectively (Zhu et al.,
2006). Therefore, we logically speculate that GA accumulation
negatively regulates basal defense. To further examine this hy-
pothesis, we treated rice with either GA
3
(10 lM) or the GA
biosynthesis inhibitor uniconazol (10 lM) before inoculation
with Xoo. As expected, the plants treated with GA
3
displayed
longer lesions, and those treated with uniconazol exhibited
shorter lesions in comparison with the non-treated control
(Figure 4A). To exclude the possibilitythat the EUI protein itself
but not its GA-deactivating activity plays a direct role in disease
resistance, we applied GA
3
or uniconazol on the Eui overex-
pressors and the RNAi lines before inoculation with Xoo.
GA
3
suppressed disease resistance of the Eui overexpressors,
while uniconazol restored basal resistance in the RNAi lines
(Figure 4). Taken together, GAs negatively regulate rice disease
resistance, and the changes of resistance in the eui mutants
and Eui overexprssors most likely attributed to the endoge-
nous GA-level alteration.
SA and JA Levels Decrease Respectively in the
Eui Overexpressors and eui Mutant
The antagonistic interaction between the SA-dependent and
JA/ET-dependent defense pathways in Arabidopsis is well
known (Thomma et al., 1998; Petersen et al., 2000; Spoel
et al., 2003; Li et al., 2004). Interestingly, the loss-of-function
mutants in DELLAs, the suppressors of the GA signaling
Figure 3. Enhanced Resistance to M.
oryzae in the Eui Overexpressors.
(A) Disease symptoms of rice blast in
OX-7, S73, and the wild-type TP309.
Two-week-old seedlings were inocu-
lated with M. oryzae ZB1. The photo-
graph was taken at 5 dpi.
(B) Blast disease severity of OX-7, OX-
11, OX-21, OX-39, S73, and S74 com-
pared with the wild-type. More than
100 seedlings for each line were an-
alyzed. The criterion of grade was
described in the Methods section.
(C) Detection of M. oryzae in-planta
growth by Southern hybridization
using the fungal 28S rDNA as probe.
Rice leaves at 1 and 4 dpi were har-
vested for DNA extraction and each
lane contained about 20 lg DNA as
detected by ethidium bromide (EtBr)
staining.
Figure 4. Exogenous Application of GA
3
and Uniconazol Changes
Disease Resistance.
Eight-week-old plants were treated with 10 lMGA
3
or 10 lM uni-
conazol; 1 week later, the plants were inoculated with Xoo strain
PXO99A. More than 50 leaves were recorded for lesion length at
14 dpi. P-values for each treatment were less than 0.0001 with stu-
dent’s t-test analysis.
Yang et al. dGibberellin Regulates Disease Resistance |531
by guest on June 9, 2013http://mplant.oxfordjournals.org/Downloaded from
pathway, up-regulate the SA-mediated defense and down-
regulate the JA/ET-mediated defense in Arabidopsis (Robert-
Seilaniantz et al., 2007). In rice, endogenous SA protects rice
from oxidative stress and the SA-deficient transgenic NahG
plants are more susceptible to M. oryzae (Yang et al., 2004),
while enhancing JA generation could increase PR expression
and blast resistance (Mei et al., 2006). This led us to analyze
SA and JA levels in the eui mutant and Eui overexpressors.
The SA level did not change in the eui mutant but significantly
decreased in the overexpressors (Figure 5A), similarly to the pre-
vious result that the transgenic poplar plants overproducing
mutant DELLA protein gai1 or rgl1 accumulated less SA (Busov
et al., 2006). However, the decreased SA level seemed not to
compromise disease resistance in the Eui overexpressors, in con-
trast to the NahG plants that mostly deprive SA (Yang et al.,
2004). The JA level was reduced in the eui mutant but main-
tained the wild-type level in the overexpressors (Figure 5B). This
result suggests that the enhanced disease susceptibility of the
eui mutant might partially be attributed to the reduced JA level.
Expression Patterns of Pathogenesis- and GA-Related
Genes in the Eui Overexpression Plants
In order to investigate the potential molecular mechanisms of
the GA-mediated disease susceptibility, we first analyzed the
induction of pathogenesis-related (PR) genes in wild-type
and Eui overexpressor and RNAi plants during infection by
M. oryzae. As shown in Figure 6A, PR1a induction was en-
hanced at 12 h but greatly decreased to the control level at
96 h post inoculation (hpi) in the overexpressor compared
with its pattern in the wild-type. Its induction appeared
delayed in the RNAi S73 compared with the wild-type. We
did not observe differential expression of PR1b and PR10 in
these plants (Figure 6A). These results implied that GA homeo-
stasis might modulate the induction dynamics of specific PR
genes in rice.
We also analyzed the GA biosynthesis gene GA20ox2
(Sd1) and the GA catabolism gene GA2ox1 during blast infec-
tion. Interestingly, both GA20ox2 and GA2ox1 were down-
regulated with similar expression patterns in the wild-type
and the Eui overexpressor (Figure 6B). GA2ox1 is also down-
regulated, while GA20ox2 seems less affected in S73 with un-
known mechanism. This result was reminiscent of cytokinin
synthases and oxidases, which were both down-regulated
during the ArabidopsisPlasmodiophora brassicae interaction,
while overexpression of cytokinin oxidases enhanced resis-
tance (Siemens et al., 2006). Consistently with their patho-
gen-mediated expression dynamics, cis-element analysis
revealed several pathogen-responsive W-boxes within the 1-
kb promoter regions of GA20ox2 and GA2ox1 (Figure 6C).
These results suggest that GA homeostasis could be regulated
during the rice–M. oryzae interaction. In addition, we did not
observe expression change of SLR1 during blast infection,
which encodes a DELLA protein in rice GA signaling (Ikeda
et al., 2001). Whether GA signaling changes during this path-
ogenesis process requires further investigation.
DISCUSSION
GA-Mediated Development Cross-Talks with Defense
Response
Gibberellins are widely recognized as phytohormones that
regulate plant growth and development. Although the GA
level is observed as reduced during virus infection in rice
(Zhu et al., 2005), there is a lack of fundamental information
on GA effects on disease resistance. Here, we have demon-
strated that GAs exhibit a negative effect on basal disease
resistance through genetic and physiological analysis. Our cur-
rent study would shed light on obscure roles of the diterpe-
noid hormone on biotic stress.
The mutations of the DELLA proteins cause Arabidopsis
to be more resistant to the biotrophic pathogen Pst
DC3000 and more susceptible to the necrotrophic pathogen
A.brassicicola (Robert-Seilaniantz et al., 2007). These studies
implicate that GAs may have either a positive or a negative role
in resistance to different pathogens in Arabidopsis. Our results
indicate that GAs display negative roles in resistance to both
biotrophic (Xoo) and hemibiotrophic (M. oryzae) pathogens in
rice. These observations suggest that GAs, in addition to auxin
Figure 5. The SA and JA Levels in the eui Mutant and Eui Overex-
pressors.
(A) The SA levels of 2-week-old seedling leaves were detected by
HPLC with three biological repeats. FW, fresh weight.
(B) JAs were extracted from 2-week-old seedling leaves and were
measured by GC–MS. Experiments were repeated three times,
with similar results. * indicates the P-value of less than 0.05 using
student’s t-test.
532 |Yang et al. dGibberellin Regulates Disease Resistance
by guest on June 9, 2013http://mplant.oxfordjournals.org/Downloaded from
(Zhang et al., 2007), may be another virulent factor in disease
susceptibility. It would be interesting to further examine
resistance phenotypes of the GA signaling mutants such as
slr1,gid1, and gid2 mutants in rice.
Many pathogens can produce phytohormones. Gall-forming
bacteria produce auxin and cytokinin that are required for dis-
ease development (Robert-Seilaniantz et al., 2007). ABA is also
produced by saprophytic and parasitic fungi (Mauch-Mani and
Mauch, 2005). The functional analog of JA, coronatine, is se-
creted by P. syringae to suppress the SA-mediated defense
(Kloek et al., 2001) and ABA-mediated stomatal closure
(Melotto et al., 2006). GAs were first identified from the fungus
G. fujikuroi, causing bakanae disease in rice. Another phyto-
pathogenic fungus, Sphaceloma sp., can also produce GAs
and causes super-elongation disease (Hiroshi, 2006). However,
there is no information on pathogenicity of those fungal
mutants defective in GA biosynthesis. In our study, both endog-
enous and exogenous GAs have negative roles in disease resis-
tance to bacterial and fungal pathogens. We propose that GAs
produced by the pathogenic fungi may also have a virulent role.
Moreover, some host GA synthesis and signaling components
may be potential targets of pathogen virulence effectors, as
discovered with the virus P2 protein (Zhu et al., 2005).
Antagonism between Disease Resistance and
Development
Growth versus retardation of plants is fine-tuned under dif-
ferent conditions. Plants relocate the resource and produce
defensive components upon pathogen attack. Therefore,
growth could be limited in defensive situations (Purrington,
2000). Many Arabidopsis mutants constitutively expressing de-
fense-related genes, such as mpk4,cpr1,snc1,bon1, and
mekk1, exhibit growth defects and dwarfism. Interestingly,
other mutants, such as pad4,sid2, and rar1, that compromise
disease resistance can rescue the growth retardation of these
growth-defective mutants, while reducing the resistance abil-
ity (Petersen et al., 2000; Jirage et al; 2001; Zhang et al., 2003;
Yang and Hua, 2004; Ichimura et al., 2006). On the other hand,
some mutants defective in growth can enhance disease resis-
tance. For example, the gain-of-function mutation of AXR2/
IAA7 results in growth and development defects (Nagpal
et al., 2000), but enhances disease resistance (Wang et al.,
2007a). ASYMMETRIC LEAVES 1 (AS1) is a key regulator of leaf
development and stem cell function (Byrne et al., 2000); its
loss-of-function mutant enhances resistance against necrotro-
phic fungi (Nurmberg et al., 2007). These data indicate that dis-
ease resistance can antagonize plant growth, as proposed
previously (Purrington, 2000).
In contrast, some components are required for both defense
and normal development. BAK1 (BRI1-associated kinase 1)
regulates both brassinosteroid-dependent development and
brassinosteroid-independent defense response (Chinchilla
et al., 2007; He et al., 2007; Heese et al., 2007; Kemmerling
et al., 2007). The MAPK signaling pathway regulates innate
immunity in plants; the components MKK4/MKK5-MPK3/
MPK6 were found to be involved in stomatal differentiation
(Wang et al., 2007b). Because diverse signaling pathways or-
chestrate the development in plants, it is reasonable to spec-
ulate that cross-talks widely exists between defense responses
and development.
Figure 6. The Expression Patterns of Pathogenisis- and GA-Related Genes during the Rice–Blast Interaction.
(A) The induction of PR1a,PR1b, and PR10 after inoculation with M. oryzae, detected by RT–PCR using actin as control.
(B) The expression patterns of GA2ox1,GA20ox2, and SLR1 after inoculation with M. oryzae, detected by RT–PCR using actin as control.
(C) W-box locations in the 1-kb promoter regions of GA2ox1 and GA20ox2. There are eight and thirteen W-boxes in the regions of GA20ox2
and GA2ox1, respectively. The elements in the sense and antisense strands are indicated above and below the lines, respectively. Numbers
indicate locations within the 1-kb promoter region.
Yang et al. dGibberellin Regulates Disease Resistance |533
by guest on June 9, 2013http://mplant.oxfordjournals.org/Downloaded from
Crop ‘Green Revolution’, which largely increases grain pro-
duction, was achieved by the application of the GA malfunc-
tion mutant sd1 in rice and rht in wheat. Sd1 encodes GA20ox2
that synthesizes bioactive GAs and its loss-of-function mutants
result in high-yield semi-dwarf phenotypes (Sasaki et al., 2002).
RHT is a DELLA protein that represses the GA signaling path-
way; its gain-of-function is also desirable semi-dwarf (Peng
et al., 1999). We observed that tall eui rice plants were more
susceptible and dwarf plants exhibited enhanced disease resis-
tance (Figures 1 and 2 and data not shown). Thus, the increase
in crop production in ‘Green Revolution’ is probably attributed
partially to increased disease resistance in rice and wheat. This
might further provide a practical approach to crop design
breeding for a better yield potential and disease resistance.
Possible Mechanisms of GA-Modulated Disease Resistance
Although we detected the down-regulation of the GA biosyn-
thesis and metabolism genes, changes of SA or JA levels, and
different expression of PR1a in the eui mutant and Eui over-
expressors, the mechanism of the GA involvement in disease
resistance remains largely unknown currently. One possibility
is that GA has negative regulatory roles on expression of a spe-
cific set of PR genes, including PR1a, to support pathogen
growth. Another possibility is that GA may modify plant me-
tabolism profiles, resulting in decreased antimicrobial substan-
ces or increased nutrient efflux favoring microbes, as observed
in the auxin-mediated susceptibility (Zhang et al., 2007). In
supporting the latter possibility, the evidence showed that
the transgenic poplar overexpressing the mutant DELLA pro-
teins gai1 and rgl1, which constitutively repress GA signaling
and are GA-insensitive, accumulated less glucose, fructose, and
galactose (Busov et al., 2006). Metabolism changes may also
result in cell wall modification, known to be a critical aspect
of the plant basal defense. Many mutants defective in cell wall
formation, such as the callose synthesis gene powdery mildew
resistant 4 (Nishimura et al., 2003), powdery mildew resistant 5
affecting pectin composition (Vogel et al., 2002), botrytis-
resistant 1 encoding long-chain acyl–CoA synthetase 2 (LACS2)
(Bessire et al., 2007), three cellulose synthetase genes (CESA4/
IRREGULAR XYLEM5,CESA7/IRX3, and CESA/IRX1) for second-
ary cell wall formation (Herna
´ndez-Blanco et al., 2007), are
more resistant to pathogens. Similarly to overexpression of
AtGA2ox in tobacco (Biemelt et al., 2004), we observed that
Eui overexpression also decreased lignin content (data not
shown). The variation of cell wall composition may modulate
disease resistance in Eui–OX.
There is also the third possibility that GA may directly mod-
ulate SA and/or JA homeostasis. However, rice plants accumu-
late high levels of SA (Silverman et al., 1995; Chen et al., 1997;
Yuan et al., 2007); a slight change in the SA level unlikely
results in the altered disease resistance observed in this study.
It will be informative to conduct detailed microarray analysis
of GA-, SA-, JA-, and pathogen-induced global expression pro-
files of rice genes in which defense signaling keeps being
established, which might provide molecular clues of how
GA regulates defense responses.
METHODS
Rice Materials
Three alleles of eui mutations (eui-1 and the wild-type ZS97,
eui-3 and the wild-type ZH11, eui-4 and the wild-type
02428), the RNAi lines S73 and S74 (Zhang et al., 2008) and
overexpression lines OX-7, OX-11, OX-15, OX-21, OX-24, OX-
39, and OX-47 (Zhu et al., 2006) and the wild-type TP309 were
used in the study.
Pathogen Inoculation and Disease Index
For Xoo resistance assays, rice plants were planted in an iso-
lated paddy field. Three independent inoculation experiments
were conducted with 8-week-old adult plants. Xoo strains Phil-
ippine race 6 (PXO99A) and Korea race 1 (DY89031) were used
for inoculation. Bacteria were incubated on a potato-agar me-
dium at 28C for 3 d. Inoculum was prepared by suspending
the bacterial mass in sterilized water at a concentration of
OD600 = 1.0. Lesion length was recorded at 14 dpi. Bacterial
growth was record for PXO99A.
For M. oryzae resistance, rice seedlings were planted in
greenhouses at a temperature of 28C/24C (day/night). The
strain of blast CH14 (ZB1) was used in the experiments.
Two-week-old seedlings were spray-inoculated with spore sus-
pensions (1 310
5
spores ml
1
) in a dew growth chamber for
24 h in darkness at 26C, and were subsequently kept at 12 h/
12 h (day/night), 26C and 90% relative humidity for 5 d. Then,
lesion types on leaves were scored from 0 (resistant) to 5 (sus-
ceptible) according to the standard scale (Bonman et al., 1986),
with the criterion of disease severity: grade 0, no visible lesion;
grade 1, diseased lesion diameter smaller than 0.5 mm, yellow
brink; grade 2, diseased lesion 0.5–1.0 mm in diameter, black-
brown brink; grade 3, diseased lesion 1.0–1.5 mm in diameter,
yellow-brown brink; grade 4, diseased lesion 1.5–2.0 mm in di-
ameter, water soaking, gray or brown blink; grade 5, diseased
lesion much more than 2.0 mm in diameter or cover across two
small leaf veins.
Statistical analysis was performed for Xoo and M. oryzae
disease index with large sample size (.50 leaves for each in-
oculation).
DNA Extraction and Southern Hybridization
Total DNA of rice with fungal mycelia was extracted according
to the method described previously (Qi and Yang, 2002).
Briefly, infected rice leaves were grounded with liquid nitro-
gen and transferred into extraction buffer (0.3 M NaCl,
50 mM Tris-HCl, pH 7.5, 20 mM EDTA, 2% sarkosyl, 0.5% so-
dium dodecylsulfate, 5 M urea, and 5% Phenol), followed
by the extraction by phenol/chloroform solution (pH 8.0).
After centrifugation, the supernatants were precipitated
with 0.7 volume of isopropanol by centrifugation for 5 min
534 |Yang et al. dGibberellin Regulates Disease Resistance
by guest on June 9, 2013http://mplant.oxfordjournals.org/Downloaded from
at 12 000 rpm. After being washed with 70% ethanol,
the resultant DNA samples were dissolved in Tris-EDTA (TE)
buffer containing RNase. DNA (20 lg) was transferred to
Hybond-N
+
membranes (Amersham) for Southern blot. A
330-bp fragment of M. oryzae 28S rDNA was amplified
from fungal genomic DNA using the primers 5#–TACGA-
GAGGAACCGCTCATTCAGATAATTA–3’ and 5#–TCAGCAGATC-
GTAACGATAAAGCTACTC–3#, as described previously (Qi and
Yang., 2002), and labelled with [a-
32
P] dCTP using a ran-
dom primer labeling kit (TaKaRa) for hybridization and
autoradiography.
RNA Extraction and Reverse PCR
TotalRNA was extracted using TRIzol reagent from leaves of rice
at different inoculation times. Reverse transcription–PCR (RT–
PCR) was conducted using SuperScript III First-Strand Synthesis
System (Invitrogen). Primers used in semi-quantitative PCR are
GA20ox2F: 5#–CGCACGGGTTCTTCCAGGTGTC–3#; GA20ox2R:
5#–CTCCAGGAGTTCCATGATCGTCAGC–3#; GA2ox1F: 5#–CGAG-
CAAACGATGTGGAAGGGCTACAGG–3#; GA2ox1R: 5#–TGGCTC-
AGGCGGAGTGAGTACATTGTCG–3#;SLR1F: 5#–GGTGCGGCCAA-
GGATCGTCA–3#; SLR1R: 5#–AGGAGCGTGCTCGCCTGTTT–3#;
PR1aF: 5#–AGTTCGTCGAGCAGGTTATCCT–3#; PR1aR: 5#–AGAT-
TGGCCGACGAAGTTG–3#; PR1bF: 5#–TATCCAAGCTGGCCATTG-
CTTT–3#; PR1bR: 5#–TAAGGCCTCTGTCCGACGAA–3#; PR10F:
5#–TGTGGAAGGTCTGCTTGGA–3#; PR10R: 5#–CACTCGTGAAG-
CAAAAACACA–3#; ActinF: 5#–GTACCCGCATCAGGCATCTG –3#;
ActinR: 5#–TCCATCTTGGCATCTCTCAG –3#.
SA and JA Assay
Free and total SA were extracted from the leaves of 2-week-old
plants grown in a growth chamber at 28C/22C and 16 h/8 h
(day/night), and measured as described previously (Zhang
et al., 2007). For JA assay, 2-week-old rice leaves were har-
vested. JA was analyzed by gas chromatography–mass
spectrometry (GC–MS) with the labeled internal standard
D3-JA, as described previously (Lou and Baldwin, 2003), and
JA levels were determined with three biological repeats.
SUPPLEMENTARY DATA
Supplementary Data are available at Molecular Plant
Online.
FUNDING
The study was support by the grants of the National Natural Science
Foundation of China (30730064 and 30721061).
ACKNOWLEDGMENTS
We thank W. Tang for critical reading of the manuscript. No conflict
of interest declared.
REFERENCES
Adie, B.A., Perez-Perez, J., Perez-Perez, M.M., Godoy, M., Sanchez-
Serrano, J.J., Schmelz, E.A., and Solano, R. (2007). ABA is an
essential signal for plant resistance to pathogens affecting JA
biosynthesis and the activation of defenses in Arabidopsis. Plant
Cell 19, 1665–1681.
Bessire, M., Chassot, C., Jacquat, A.C., Humphry, M., Borel, S.,
Pete
´tot, J.M., Me
´traux, J.P., and Nawrath, C. (2007). A permeable
cuticle in Arabidopsis leads to a strong resistance to Botrytis cin-
erea. EMBO J. 26, 21.
Biemelt, S., Tschiersch, H., and Sonnewald, U. (2004). Impact of al-
tered gibberellin metabolism on biomass accumulation, lignin
biosynthesis, and photosynthesis in transgenic tobacco plants.
Plant Physiol. 135, 254–265.
Bonman, J.M., VergelDe Dios, T.I., and Khin, M.M. (1986). Physio-
logical specialization of Pyricularia oryzae in the Philippines.
Plant Dis. 70, 767–769.
Bowling, S.A., Guo, A., Cao, H., Gordon, A.S., Klessig, D.F., and
Dong, X. (1994). A mutation in Arabidopsis that leads to consti-
tutive expression of systemic acquired resistance. Plant Cell 6,
1845–1857.
Busov, V., Meilan, R., Pearce, D.W., Rood, S.B., Ma, C.,
Tschaplinski, T.J., and Strauss, S.H. (2006). Transgenic modifica-
tion of gai or rgl1 causes dwarfing and alters gibberellins, root
growth, and metabolite profiles in Populus. Planta 224, 288–299.
Byrne, M.E., Barley, R., Curtis, M., Arroyo, J.M., Dunham, M.,
Hudson, A., and Martienssen, R.A. (2000). Asymmetric leaves1
mediates leaf patterning and stem cell function in Arabidopsis.
Nature 408, 967–971.
Chen, Z., Agnew, J.L., Cohen, J.D., He, P., Shan, L., Sheen, J., and
Kunkel, B.N. (2007). Pseudomonas syringae type III effector
AvrRpt2 alters Arabidopsis thaliana auxin physiology. Proc. Natl
Acad. Sci. U S A 104, 20131–21136.
Chen, Z., Iyer, S., Caplan, A., Klessig, D.F., and Fan, B. (1997). Differ-
ential accumulation of salicylic acid and salicylic acid-sensitive
catalase in different rice tissues. Plant Physiol. 114, 193–201.
Chinchilla, D., Zipfel, C., Robatzek, S., Kemmerling, B.,
Nu
¨rnberger, T., Jones, J.D., Felix, G., and Boller, T. (2007).
A flagellin-induced complex of the receptor FLS2 and BAK1 ini-
tiates plant defence. Nature 448, 497–500.
de Torres-Zabala, M., Truman, W., Bennett, M.H., Lafforgue, G.,
Mansfield, J.W., Rodriguez, Egea, P., Bo¨ gre, L., and Grant, M.
(2007). Pseudomonas syringae pv. tomato hijacks the Arabidop-
sis abscisic acid signalling pathway to cause disease. EMBO J 26,
1434–1443.
He, K., Gou, X., Yuan, T., Lin, H., Asami, T., Yoshida, S., Russell, S.D.,
and Li, J. (2007). BAK1 and BKK1 regulate brassinosteroid-
dependent growth and brassinosteroid-independent cell-death
pathways. Curr. Biol. 17, 1109–1115.
Heese, A., Hann, D.R., Gimenez-Ibanez, S., Jones, A.M., He, K., Li, J.,
Schroeder, J.I., Peck, S.C., and Rathjen, J.P. (2007). The receptor-
like kinase SERK3/BAK1 is a central regulator of innate immunity
in plants. Proc. Natl Acad. Sci. U S A 104, 12217–12222.
Herna
´ndez-Blanco, C., et al. (2007). Impairment of cellulose syn-
thases required for Arabidopsis secondary cell wall formation
enhances disease resistance. Plant Cell 19, 890–903.
Yang et al. dGibberellin Regulates Disease Resistance |535
by guest on June 9, 2013http://mplant.oxfordjournals.org/Downloaded from
Kawaide, H. (2006). Biochemical and molecular analyses of gibberel-
lin biosynthesis in fungi. Biosci. Biotechnol. Biochem 70, 583–590.
Ichimura, K., Casais, C., Peck, S.C., Shinozaki, K., and Shirasu, K.
(2006). MEKK1 is required for MPK4 activation and regulates tis-
sue-specific and temperature-dependent cell death in Arabidop-
sis. J. Biol. Chem. 281, 36969–36976.
Ikeda, A., Ueguchi-Tanaka, M., Sonoda, Y., Kitano, H., Koshioka, M.,
Futsuhara, Y., Matsuoka, M., and Yamaguchi, J. (2001). slender
rice, a constitutive gibberellin response mutant, is caused by
a null mutation of the SLR1 gene, an ortholog of the height-
regulating gene GAI/RGA/RHT/D8. Plant Cell 13, 999–1010.
Jirage, D., Zhou, N., Cooper, B., Clarke, J.D., Dong, X., and
Glazebrook, J. (2001). Constitutive salicylic acid-dependent
signaling in cpr1 and cpr6 mutants requires PAD4. Plant J. 26,
395–407.
Kemmerling, B., et al. (2007). The BRI1-associated kinase 1, BAK1,
has a brassinolide-independent role in plant cell-death control.
Curr. Biol. 17, 1116–1122.
Kloek, A.P., Verbsky, M.L., Sharma, S.B., Schoelz, J.E., Vogel, J.,
Klessig, D.F., and Kunkel, B.N. (2001). Resistance to Pseudomonas
syringae conferred by an Arabidopsis thaliana coronatine-
insensitive (coi1) mutation occurs through two distinct mecha-
nisms. Plant J. 26, 509–522.
Li, J., Brader, G., and Palva, E.T. (2004). The WRKY70 transcription
factor: a node of convergence for jasmonate-mediated and
salicylate-mediated signals in plant defense. Plant Cell 16,
319–331.
Lou, Y., and Baldwin, I.T. (2003). Manduca sexta recognition and
resistance among allopolyploid Nicotiana host plants. Proc. Natl
Acad. Sci. U S A 100, 14581–14586.
Mauch-Mani, B., and Mauch, F. (2005). The role of abscisic acid in
plant–pathogen interactions. Curr. Opin. Plant Biol. 8, 409–414.
Mei, C., Qi, M., Sheng, G., and Yang, Y. (2006). Inducible overexpres-
sion of a rice allene oxide synthase gene increases the endoge-
nous jasmonic acid level, PR gene expression, and host resistance
to fungal infection. Mol. Plant Microbe Interact 19, 1127–1137.
Melotto, M., Underwood, W., Koczan, J., Nomura, K., and He, S.Y.
(2006). Plant stomata function in innate immunity against bac-
terial invasion. Cell 126, 969–980.
Nagpal, P., Walker, L.M., Young, J.C., Sonawala, A., Timpte, C.,
Estelle, M., and Reed, J.W. (2000). AXR2 encodes a member of
the Aux/IAA protein family. Plant Physiol. 123, 563–574.
Nakashita, H., Yasuda, M., Nitta, T., Asami, T., Fujioka, S., Arai, Y.,
Sekimata, K., Takatsuto, S., Yamaguchi, I., and Yoshida, S. (2003).
Brassinosteroid functions in a broad range of disease resistance
in tobacco and rice. Plant J 33, 887–898.
Navarro, L., Dunoyer, P., Jay, F., Arnold, B., Dharmasiri, N.,
Estelle, M., Voinnet, O., and Jones, J.D. (2006). A plant miRNA
contributes to antibacterial resistance by repressing auxin signal-
ing. Science 312, 436–439.
Nishimura, M.T., Stein, M., Hou, B.H., Vogel, J.P., Edwards, H., and
Somerville, S.C. (2003). Loss of a callose synthase results in sali-
cylic acid-dependent disease resistance. Science 301, 969–972.
Nurmberg, P.L., Knox, K.A., Yun, B.W., Morris, P.C., Shafiei, R.,
Hudson, A., and Loake, G.J. (2007). The developmental selector
AS1 is an evolutionarily conserved regulator of the plant im-
mune response. Proc. Natl Acad. Sci. U S A 104, 18795–18800.
Peng, J., et al. (1999). ‘Green revolution’ genes encode mutant
gibberellin response modulators. Nature 400, 256–261.
Petersen, M., et al. (2000). Arabidopsis map kinase 4 negatively
regulates systemic acquired resistance. Cell 103, 1111–1120.
Purrington, C.B. (2000). Costs of resistance. Curr. Opin. Plant Biol. 3,
305–308.
Qi, M., and Yang, Y. (2002). Quantification of Magnaporthe grisea
during infection of rice plants using real-time polymerase chain
reaction and northern blot/phosphoimaging analyses. Phytopa-
thology 92, 870–876.
Robert-Seilaniantz, A., Navarro, L., Bari, R., and Jones, J.D. (2007).
Pathological hormone imbalances. Curr. Opin. Plant Biol. 10,
372–379.
Sasaki, A., et al. (2002). Green revolution: a mutant gibberellin-
synthesis gene in rice. Nature 416, 701–702.
Siemens, J., Keller, I., Sarx, J., Kunz, S., Schuller, A., Nagel, W.,
Schmu
¨lling, T., Parniske, M., and Ludwig-Mu
¨ller, J. (2006). Tran-
scriptome analysis of Arabidopsis clubroots indicate a key role
for cytokinins in disease development. Mol. Plant Microbe Inter-
act 19, 480–494.
Silverman, P., Seskar, M., Kanter, D., Schweizer, P., Metraux, J.P., and
Raskin, I. (1995). Salicylic acid in rice (biosynthesis, conjugation,
and possible Role). Plant Physiol. 108, 633–639.
Spoel, S.H., et al. (2003). NPR1 modulates cross-talk between salic-
ylate- and jasmonate-dependent defense pathways through
a novel function in the cytosol. Plant Cell 15, 760–770.
Thomma, B.P., Eggermont, K., Penninckx, I.A., Mauch-Mani, B.,
Vogelsang, R., Cammue, B.P., and Broekaert, W.F. (1998). Separate
jasmonate-dependentand salicylate-dependentdefense–response
pathways in Arabidopsis are essential for resistance to distinct
microbial pathogens. Proc. Natl Acad. Sci. U S A 95, 15107–15111.
Vogel, J.P., Raab, T.K., Somerville, C.R., and Somerville, S.C. (2004).
Mutations in PMR5 result in powdery mildew resistance and
altered cell wall composition. Plant J. 40, 968–978.
Wang,D., Pajerowska-Mukhtar,K., Culler, A.H., andDong, X. (2007a).
Salicylic acid inhibits pathogen growth in plants through repres-
sion of the auxin signaling pathway. Curr. Biol. 17, 1784–1790.
Wang, H., Ngwenyama, N., Liu, Y., Walker, J.C., and Zhang, S.
(2007b). Stomatal development and patterning are regulated
by environmentally responsive mitogen-activated protein
kinases in Arabidopsis. Plant Cell 19, 63–73.
Xu, Y.H., Zhu, Y.Y., Zhou, H.C., Li, Q., Sun, Z.X., Liu, Y.G., Lin, H.X.,
and He, Z.H. (2004). Identification of a 98-kb DNA segment
containing the rice Eui gene controlling uppermost internode
elongation, and construction of a TAC transgene sublibrary.
Mol. Genet. Genomics 272, 149–155.
Yabuta, T., and Sumiki, Y. (1938). On the crystal of gibberellin, a sub-
stanceto promoteplantgrowth.J. Agric.Chem. Soc.Japan14, 1526.
Yang, S., and Hua, J. (2004). A haplotype-specific resistance gene
regulated by BONZAI1 mediates temperature-dependent
growth control in Arabidopsis. Plant Cell 16, 1060–1067.
Yang, Y., Qi, M., and Mei, C. (2004). Endogenous salicylic acid pro-
tects rice plants from oxidative damage caused by aging as well
as biotic and abiotic stress. Plant J. 40, 909–919.
Yuan, Y., Zhong, S., Li, Q., Zhu, Z., Lou, Y., Wang, L., Wang, J.,
Wang, M., Li, Q., Yang, D., and He, Z. (2007). Functional analysis
536 |Yang et al. dGibberellin Regulates Disease Resistance
by guest on June 9, 2013http://mplant.oxfordjournals.org/Downloaded from
of rice NPR1-like genes reveals that OsNPR1/NH1 is the rice ortho-
logue conferring disease resistance with enhanced herbivore
susceptibility. Plant Biotechnol. J. 5, 313–324.
Zhang, Y., Goritschnig, S., Dong, X., and Li, X. (2003). A gain-of-
function mutation in a plant disease resistance gene leads to
constitutive activation of downstream signal transduction pathways
in suppressor of npr1-1, constitutive 1. Plant Cell 15, 2636–2646.
Zhang, Y., Zhu, Y., Peng, Y., Yan, D., Li, Q., Wang, J., Wang, L., and
He, Z. (2008). Gibberellin homeostasis and plant height control
by EUI and a role for gibberellin in root gravity responses in rice.
Cell Research 18, 412–421.
Zhang, Z., Li, Q., Li, Z., Staswick, P.E., Wang, M., Zhu, Y., and He, Z.
(2007). Dual regulation role of GH3.5 in salicylic acid and auxin
signaling during Arabidopsis–Pseudomonas syringae interac-
tion. Plant Physiol. 145, 450–464.
Zhu, S., Gao, F., Cao, X., Chen, M., Ye, G., Wei, C., and Li, Y. (2005).
The rice dwarf virus P2 protein interacts with ent–kaurene
oxidases in vivo, leading to reduced biosynthesis of gibberellins
and rice dwarf symptoms. Plant Physiol. 139, 1935–1945.
Zhu, Y., et al. (2006). ELONGATED UPPERMOST INTERNODE encodes
a cytochrome P450 monooxygenase that epoxidizes gibberellins
in a novel deactivation reaction in rice. Plant Cell 18, 442–456.
Yang et al. dGibberellin Regulates Disease Resistance |537
by guest on June 9, 2013http://mplant.oxfordjournals.org/Downloaded from
    • This initial investigation revealed that the woody perennial had a similar defense mechanism to that found in herbaceous systems. For example, it was found that high levels of SA contribute to resistance in tobacco (Verberne et al., 2000) and that GA has a negative effect on resistance in rice (Qin et al., 2012; Yang et al., 2016). Furthermore, the results suggest that C. austroafricana encounters two different host environments, and we hypothesize that the fungus employs different mechanisms to respond to the phytohormone signaling and other defenses in each host.
    [Show abstract] [Hide abstract] ABSTRACT: Chrysoporthe austroafricana is a fungal pathogen that causes the development of stem cankers on susceptible Eucalyptus grandis trees. Clones of E. grandis that are partially resistant and highly susceptible have been identified based on the extent of lesion formation on the stem upon inoculation with C. austroafricana. These interactions have been used as a model pathosystem to enhance our understanding of interactions between pathogenic fungi and woody hosts, which may be different to herbaceous hosts. In previous research, transcriptomics of host responses in these two clones to C. austroafricana suggested roles for salicylic acid and gibberellic acid phytohormone signaling in defense. However, it is unclear how the pathogen infiltrates host tissue and which pathogenicity factors facilitate its spread in the two host genotypes. The aim of this study was to investigate these two aspects of the E. grandis–C. austroafricana interaction and to test the hypothesis that the pathogen possesses mechanisms to modulate the tree phytohormone-mediated defenses. Light microscopy showed that the pathogen occurred in most cell types and structures within infected E. grandis stem tissue. Notably, the fungus appeared to spread through the stem by penetrating cell wall pits. In order to understand the molecular interaction between these organisms and predict putative pathogenicity mechanisms of C. austroafricana, fungal gene expression was studied in vitro and in planta. Fungal genes associated with cell wall degradation, carbohydrate metabolism and phytohormone manipulation were expressed in planta by C. austroafricana. These genes could be involved in fungal spread by facilitating cell wall pit degradation and manipulating phytohormone mediated defense in each host environment, respectively. Specifically, the in planta expression of an ent-kaurene oxidase and salicylate hydroxylase in C. austroafricana suggests putative mechanisms by which the pathogen can modulate the phytohormone-mediated defenses of the host. These mechanisms have been reported in herbaceous plant–pathogen interactions, supporting the notion that these aspects of the interaction are similar in a woody species. This study highlights ent-kaurene oxidase and salicylate hydroxylase as candidates for further functional characterization.
    Full-text · Article · Dec 2016
    • Importantly, the OsNPR1-mediated disease resistance was not attenuated by the 287 OsGH3.8 knockdown (Fig. 7H). Therefore, we genetically confirmed that OsGH3.8 is Yang et al., 2008Yang et al., , 2012Yang et al., , 2013).
    [Show abstract] [Hide abstract] ABSTRACT: Systemic acquired resistance (SAR) is a long-lasting and broad-spectrum disease resistance to pathogens. Our previous study demonstrated that overexpression of OsNPR1, a master gene for SAR in rice, greatly enhanced resistance to bacterial blight caused by Xanthomonas oryzae pv. oryzae (Xoo). However, the growth and development of the OsNPR1 overexpression (OsNPR1-OX) plants were restrained, and the mechanism remained elusive. In this study, we dissected the OsNPR1-induced growth inhibition. We found that the OsNPR1-OX lines displayed phenotypes mimicking auxin-defective mutants, with decreases in root system, seed number and weight, internode elongation, and tiller number. Whole-genome expression analysis revealed that genes related to the auxin metabolism and signaling pathway were differentially expressed between the OsNPR1-OX and wild-type plants. Consistently, the indole-3-acetic acid (IAA) content was decreased and auxin distribution pattern was altered in OsNPR1-OX plants. Importantly, we found that some GH3 family members in particular OsGH3.8 coding IAA-amido synthetase was were constitutively up-regulated in OsNPR1-OX plants. Decreased OsGH3.8 expression by RNA interference could partially restore IAA level and largely rescue the restrained growth and development phenotypes but did not affect the disease resistance of OsNPR1-OX plants. Taken together, we revealed that OsNPR1 affects rice growth and development by disrupting the auxin pathway at least partially through indirectly up-regulating OsGH3.8 expression.
    Full-text · Article · Jul 2016
    • In our experiments, UPS and GASA4 gene expression in the PNG- S clone may have been potentially under the control of GA. Yang et al. (2008) [76] demonstrated on rice that exogenous GA treatment increases susceptibility to disease, whereas treatment with a GA inhibitor increases resistance. It therefore appears that GA has a negative effect on disease resistance.
    [Show abstract] [Hide abstract] ABSTRACT: Cocoa black pod caused by Phytophthora is one of the most serious diseases affecting cocoa production. This project set out was to improve our knowledge of the molecular mechanisms involved in Theobroma cacao resistance. We performed a transcriptional screening using macroarrays containing 89 ESTs from subtractive libraries enriched with genes differentially expressed in response to T. cacao/Phytophthora interactions. A gene expression analysis revealed the induction of genes involved in stress signal transduction, general and specific defence genes and genes involved in hormone signalling pathways. RT-qPCR showed that the level expression of two genes in the resistant plant was higher during the first eight hours after pathogen inoculation. Three genes from a family encoding a protease inhibitor displayed different levels of expression depending on resistant and susceptible T. cacao clones. A comparison of promoter sequences revealed a motif present only in genes that were up-expressed in the resistant plant.
    Full-text · Article · Oct 2015
    • beneath appressoria (Figure 2), a cellular reaction clearly associated with diminished penetration resistance [17]. This observation is in accordance with the results published by Yang and co-workes [32] who demonstrated that rice mutant plants with reduced GA 3 -level showed a higher degree of resistance against M. oryzae.
    [Show abstract] [Hide abstract] ABSTRACT: Background Plant hormones are well known regulators which balance plant responses to abiotic and biotic stresses. We investigated the role of abscisic acid (ABA) in resistance of barley (Hordeum vulgare L.) against the plant pathogenic fungus Magnaporthe oryzae.ResultsExogenous application of ABA prior to inoculation with M. oryzae led to more disease symptoms on barley leaves. This result contrasted the finding that ABA application enhances resistance of barley against the powdery mildew fungus. Microscopic analysis identified diminished penetration resistance as cause for enhanced susceptibility. Consistently, the barley mutant Az34, impaired in ABA biosynthesis, was less susceptible to infection by M. oryzae and displayed elevated penetration resistance as compared to the isogenic wild type cultivar Steptoe. Chemical complementation of Az34 mutant plants by exogenous application of ABA re-established disease severity to the wild type level. The role of ABA in susceptibility of barley against M. oryzae was corroborated by showing that ABA application led to increased disease severity in all barley cultivars under investigation except for the most susceptible cultivar Pallas. Interestingly, endogenous ABA concentrations did not significantly change after infection of barley with M. oryzae.Conclusion Our results revealed that elevated ABA levels led to a higher disease severity on barley leaves to M. oryzae. This supports earlier reports on the role of ABA in enhancing susceptibility of rice to the same pathogen and thereby demonstrates a host plant-independent function of this phytohormone in pathogenicity of monocotyledonous plants against M. oryzae.
    Full-text · Article · Jan 2015
    • In rice, however, strikingly different results have been obtained in that exogenous GA was found to enhance susceptibility against the hemibiotrophic pathogens Xoo and Magnaporthe oryzae (Yang et al., 2008). Moreover, ectopic expression of a GA-deactivating enzyme designated elongated uppermost internode (EUI) significantly reduced rice SA and JA levels and enhanced resistance to the latter pathogens, whereas EUI loss-of-function mutations led to increased susceptibility (Yang et al., 2008). Other mutants deficient in biosynthesis or perception of GA showed similar gain-of-resistance phenotypes when challenged with either Xoo or Magnaporthe oryzae (Tanaka et al., 2006; Qin et al., 2013).
    [Show abstract] [Hide abstract] ABSTRACT: Phytohormones are not only essential for plant growth and development but also play central roles in triggering the plant immune signaling network. Historically, research aimed at elucidating the defense-associated role of hormones has tended to focus on the use of experimentally tractable dicot plants such as Arabidopsis thaliana. Emerging from these studies is a picture whereby complex crosstalk and induced hormonal changes mold plant health and disease, with outcomes largely dependent on the lifestyle and infection strategy of invading pathogens. However, recent studies in monocot plants are starting to provide additional important insights into the immune-regulatory roles of hormones, often revealing unique complexities. In this review, we address the latest discoveries dealing with hormone-mediated immunity in rice, one of the most important food crops and an excellent model for molecular genetic studies in monocots. Moreover, we highlight interactions between hormone signaling, rice defense and pathogen virulence, and discuss the differences and similarities with findings in Arabidopsis. Finally, we present a model for hormone defense networking in rice and describe how detailed knowledge of hormone crosstalk mechanisms can be used for engineering durable rice disease resistance.
    Full-text · Article · Nov 2014
    • For example , in rice, the GAs have been shown to negatively regulate resistance to both the bacterial blight pathogen Xanthomonas oryzae pv. oryzae (Xoo) and fungal blast pathogen Magnaporthe oryzae (Yang et al., 2008; Qin et al., 2013 ). Moreover, recently, the production of GA by G. fujikuroi has also been reported to play a role in the virulence of this rice plant pathogen (Wiemann et al., 2013).
    [Show abstract] [Hide abstract] ABSTRACT: Both plants and fungi produce ent-kaurene as a precursor to the gibberellin plant hormones. A number of rhizobia contain functionally conserved, sequentially acting ent-copalyl diphosphate and ent-kaurene synthases (CPS and KS, respectively), which are found within a well-conserved operon that may lead to the production of gibberellins.Intriguingly, the rice bacterial leaf streak pathogen Xanthomonas oryzae pv. oryzicola (Xoc) contains a homologous operon. Here, we report biochemical characterization of the encoded CPS and KS, and the impact of insertional mutagenesis on virulence and the plant defense response for these genes, as well as that for one of the cytochromes P450 (CYP112) found in the operon.Activity of the CPS and KS found in this phytopathogen was verified – that is, Xoc is capable of producing ent-kaurene. Moreover, knocking out CPS, KS or CYP112 led to mutant Xoc that exhibited reduced virulence. Investigation of the effect on marker gene transcript levels suggests that the Xoc diterpenoid affects the plant defense response, most directly that mediated by jasmonic acid (JA).Xoc produces an ent-kaurene-derived diterpenoid as a virulence factor, potentially a gibberellin phytohormone, which is antagonistic to JA, consistent with the recent recognition of opposing effects for these phytohormones on the microbial defense response.
    Full-text · Article · Nov 2014
Show more