ArticlePDF Available

Structure and function of the cassowary's casque and its implications for cassowary history, biology and evolution

Authors:

Abstract and Figures

Cassowaries (Casuarius) possess a cranial casque, sheathed by keratin and composed of modified cranial bones. We combine data and hypotheses on three areas of cassowary research. First, we present novel observations on casque anatomy. The bony core is fragile, incorporating a mass of trabeculae anteriorly and an empty space posteriorly. Secondly, we use these observations to evaluate hypotheses of casque function. Implications that the casque evolved within the context of activities involving percussive actions are unlikely and observations that might support these hypotheses are absent. It is most likely that the casque serves a sociosexual role and functions in visual and acoustic display. The similarity in casque form between males and females, combined with male parental investment, makes it plausible that the extravagant structures present in cassowaries evolved within the context of mutual sexual selection. Thirdly, we combine morphological, molecular and geological evidence to provide a new phylogenetic history for cassowaries. We suggest that cassowaries invaded New Guinea in at least two waves and provisionally regard crown–cassowaries as a geologically young, post-Pliocene clade. We provide these hypotheses as areas requiring discussion and urge other workers to test our ideas with new data on cassowary anatomy, behaviour and genetics.
Content may be subject to copyright.
This article was downloaded by: [University of Southampton Highfield]
On: 28 November 2014, At: 01:25
Publisher: Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,
37-41 Mortimer Street, London W1T 3JH, UK
Historical Biology: An International Journal of
Paleobiology
Publication details, including instructions for authors and subscription information:
http://www.tandfonline.com/loi/ghbi20
Structure and function of the cassowary's casque and
its implications for cassowary history, biology and
evolution
Darren Naisha & Richard Perronb
a Ocean and Earth Science, National Oceanography Centre, Southampton, University of
Southampton, Southampton SO14 3ZH, UK
b 6 Winchester House, Bishops Walk, Aylesbury HP21 7LD, UK
Published online: 27 Nov 2014.
To cite this article: Darren Naish & Richard Perron (2014): Structure and function of the cassowary's casque and its
implications for cassowary history, biology and evolution, Historical Biology: An International Journal of Paleobiology, DOI:
10.1080/08912963.2014.985669
To link to this article: http://dx.doi.org/10.1080/08912963.2014.985669
PLEASE SCROLL DOWN FOR ARTICLE
Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained
in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no
representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the
Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and
are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and
should be independently verified with primary sources of information. Taylor and Francis shall not be liable for
any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever
or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of
the Content.
This article may be used for research, teaching, and private study purposes. Any substantial or systematic
reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any
form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http://
www.tandfonline.com/page/terms-and-conditions
Structure and function of the cassowary’s casque and its implications for cassowary history,
biology and evolution
Darren Naish
a
*and Richard Perron
b1
a
Ocean and Earth Science, National Oceanography Centre, Southampton, University of Southampton, Southampton SO14 3ZH, UK;
b
6 Winchester House, Bishops Walk, Aylesbury HP21 7LD, UK
(Received and accepted 4 November 2014)
Cassowaries (Casuarius) possess a cranial casque, sheathed by keratin and composed of modified cranial bones.
We combine data and hypotheses on three areas of cassowary research. First, we present novel observations on casque
anatomy. The bony core is fragile, incorporating a mass of trabeculae anteriorly and an empty space posteriorly. Secondly,
we use these observations to evaluate hypotheses of casque function. Implications that the casque evolved within the context
of activities involving percussive actions are unlikely and observations that might support these hypotheses are absent. It is
most likely that the casque serves a sociosexual role and functions in visual and acoustic display. The similarity in casque
form between males and females, combined with male parental investment, makes it plausible that the extravagant structures
present in cassowaries evolved within the context of mutual sexual selection. Thirdly, we combine morphological, molecular
and geological evidence to provide a new phylogenetic history for cassowaries. We suggest that cassowaries invaded New
Guinea in at least two waves and provisionally regard crown– cassowaries as a geologically young, post-Pliocene clade.
We provide these hypotheses as areas requiring discussion and urge other workers to test our ideas with new data on
cassowary anatomy, behaviour and genetics.
Keywords: cassowaries; Casuarius; casques; birds; New Guinea; phylogeny
Introduction
Cassowaries (Casuarius) are large, black-plumaged ratite
birds, endemic to the rainforest habitats of New Guinea,
Queensland and various of the Aru Islands (Rothschild
1900; Folch 1992; Davies 2002). Cassowary distribution
and biogeography is complicated by the fact that people
have widely traded in these bids and hence transported
them beyond their natural range (a story that involves New
Britain, Seram, Borneo and even further afield). Notable
morphological peculiarities include their large, keratinous
head casques, brightly coloured dewlaps and carunculated
head and neck skin, and enlarged pedal digit II claws.
Strong morphological and molecular similarities with
emus (Dromaius) show that both taxa should be regarded
as close relatives within the ratite clade Casuariiformes
(Prager et al. 1976; Bledsoe 1988; Sibley and Ahlquist
1990; Lee et al. 1997; Dyke and van Tuinen 2004; Livezey
and Zusi 2007; Hackett et al. 2008), although authors have
differed as to whether they regard cassowaries and emus as
representing distinct ‘families’ (Dromaiidae and Casuar-
iidae, respectively) (Sibley and Ahlquist 1972; Cracraft
1981; Livezey and Zusi 2007) or ‘subfamilies’ or ‘tribes’
(Dromaiinae and Casuariinae, or Dromaiini and Casuar-
iini, respectively, both included within Casuariidae) within
this clade (Patterson and Rich 1987; Sibley and Ahlquist
1990; Boles 1992).
Three extant species are generally recognised within
Casuarius (Mayr 1979; Folch 1992; Dickinson 2003;
Clements 2008; Dickinson and Remsen 2013): the
Double-wattled or Southern cassowary Casuarius casuar-
ius Linnaeus 1758, Single-wattled cassowary Casuarius
unappendiculatus Blythe 1860 and Dwarf or Bennett’s
cassowary Casuarius bennetti Gould 1857 (Figure 1).
Each species is easily distinguished by the number or
absence of wattles on the foreneck. However, the
taxonomic history of the group has been volatile and
more than 20 species, and substantially more subspecies,
have been recognised in the recent past (Rothschild 1900;
Peters 1931). At least some of these numerous ‘additional’
taxa surely represent valid forms: their status mostly
remains untested and there is as yet no agreed-upon
subspecific classification for cassowaries. One of these
additional taxa Casuarius papuanus Schlegel, 1871 –
has recently been regarded as a valid species (Davies
2002), although note that the correct name is Casuarius
westermanni (Perron 2011). While we have previously
regarded this taxon as a subspecies of Casuarius bennetti
(Perron 2011), the possibility that it should be recognised
as a distinct species receives support from our molecular
analysis: we aim to examine this further in future work.
Fossil cassowaries are known from the Pliocene (Plane
1967) and Late Pleistocene of New Guinea (Rich et al.
q2014 Taylor & Francis
*Corresponding author. Email: eotyrannus@gmail.com
Historical Biology, 2014
http://dx.doi.org/10.1080/08912963.2014.985669
Downloaded by [University of Southampton Highfield] at 01:25 28 November 2014
1988), and from an undetermined part of the Pleistocene of
New South Wales (Lydekker 1891; Miller 1962).
While all cassowary species are mainly found in
rainforest habitats, each seems to favour or be adapted to a
specific elevation. Casuarius casuarius occurs up to 500m,
Casuarius unappendiculatus up to 1000 m and Casuarius
bennetti up to 3500 m (Coates 1985; Beehler et al. 1986).
In fact, these elevations may be to some degree dependent
on the presence of the other species lower down.
All extant cassowaries bear a cranial casque and the
group is remarkable in possessing this unique structure,
formed of a keratinous sheath externally and a bony core
internally. A considerable amount of curiosity and
uncertainty has been expressed about the casque’s structure
and function, but surprisingly little has been published on its
detailed anatomy. Indeed, very little is known about
cassowaries in general and a substantial amount of work
remains to be done on their anatomy, genetics, physiology,
ecology and behaviour. This paucity of knowledge about
the group – evident to anyone familiar with ratites, and well
expressed in a recent book on the birds (Mack 2013)–is
perhaps not obviously conveyed via the general ornitholo-
gical literature, and we here hope to impress upon readers
the fact that many ideas we have about these birds are still at
an initial, hypothesis-building stage. The present manu-
script – while presenting data on morphology, genetics and
phylogeny where possible – is unashamedly speculative in
places; we aim to build on our speculations and hypotheses
in subsequent work, but also hope that our proposals and
suggestions will promote discussion and encourage other
workers to investigate, or present data on, the topics we
discuss. To return to the topic of casque anatomy, the
alluded to paucity of data is illustrated by the fact that
Crome and Moore (1988)andRichardson(1991) represent
the only published articles dedicated to this topic. We aim
here to describe the detailed internal anatomy of the casque
for the first time. We then discuss these structural details
within the context of casque function and cassowary
evolution, couching them within a novel and speculative
hypothesis of cassowary history.
Casque structure
We privately obtained a Casuarius unappendiculatus
skull, sectioned it (Figure 2), and based many of our
observations on this specimen (RP, private collection). The
specimen concerned was a male, c. 18 years old, kept at
Ehime Tobe Zoo in Japan; its cause of death is registered
as heart failure. Provenance data for the specimen prior to
its arrival at the zoo do not exist, and there is no indication
that the specimen is morphologically unusual relative to
cassowaries in their natural state. Cassowary chicks hatch
Figure 1. (Colour online) The three currently recognised extant cassowary species. (A) Double-wattled or Southern cassowary
Casuarius casuarius. (B) Double-wattled cassowary in profile. (C) Single-wattled cassowary Casuarius unappendiculatus. (D) Dwarf or
Bennett’s cassowary Casuarius bennetti. Photographs by D. Naish and R. Perron.
2D. Naish and R. Perron
Downloaded by [University of Southampton Highfield] at 01:25 28 November 2014
with a thin, laterally compressed, sub-triangular keratinous
cranial plate. The casque increases in size during
ontogeny, its shape being highly variable between
individuals as well as between taxa. It is variously
subtriangular, rounded or trapezoidal, being tallest at a
point dorsal to anywhere between the orbit and quadrate
(Figures 2 and 3(A)). We are not aware of work that
precisely determines the homology or identity of the bones
involved in casque formation. However, an image of a
scanned cassowary embryo produced by WitmerLab at
Ohio University (and available online: http://www.oucom.
ohiou.edu/dbms-witmer/3D-Visualization.htm) reveals the
presence of distinct thickenings on each of the frontal
bones, suggesting that the casque primarily represents
novel hypertrophy of these bones. A study of casque
ontogeny is sorely needed. Anteriorly, the bony crest
extends well anterior to the base of the rostrum,
overlapping and fusing with the posterodorsal ramus of
the premaxilla. Despite major differences in shape and
size, the casque is intrinsically the same across all species.
The differences in casque form observed across all
cassowary species relate to ontogeny (older, adult
individuals typically having larger casques than juveniles
and younger adults) but perhaps to sex and adaptation to
Figure 3. (Colour online) External and internal details of the cassowary casque. (A) Complete skull of Casuarius bennetti (the
cassowary with the lowest casque and the only one where the casque is ordinarily subtriangular in profile). (B) Anterior part of interior of
sectioned casque of Casuarius unappendiculatus specimen shown in Figure 2, anterior to the left. (C) External keratinous sheath of casque
of Casuarius unappendiculatus specimen shown in Figure 2, showing flaked, cracked surface of the sort typically seen in live birds. (D)
Posterior part of interior of sectioned casque of Casuarius unappendiculatus specimen shown in Figure 2, anterior to the left. (E)
‘Sandwich layer’ at edge of casque.
Figure 2. (Colour online) Sectioned single-wattled cassowary
Casuarius unappendiculatus head used in this study. Specimen
from RP private collection.
Historical Biology 3
Downloaded by [University of Southampton Highfield] at 01:25 28 November 2014
local conditions. We also assume (based on the appearance
of individuals kept in captivity) that casque size and shape
reflect health and diet, individuals of ‘better quality’
apparently having larger, taller casques. Without the
dermis and epidermis that form the keratinous outer sheath
of the casque, it is a lightweight, fragile structure that can
be damaged easily through clumsy handling. The
keratinous sheath is sometimes damaged or partially
worn. The keratin surface of the specimen we examined
revealed some minor regions of flaking and cracking, as is
typical for captive and wild cassowaries. However, wear or
damage that might be informative with respect to the
behavioural hypotheses discussed below was not evident.
Internally, the casque is occupied by a loosely knit web
of irregularly arranged, sparse, extremely thin trabeculae:
these are most densely packed in the anterior half of the
casque (Figure 3(B)) but are absent posteriorly where a
cavity is present (Figure 3(D)). Surrounding the internal
mass of trabecular fibres is a bony shell composed of
denser bone, the external surface of which is marked with
foramina and shallow, dorsoventrally aligned, divaricating
canals for the reception of blood vessels and nerves;
Richardson (1991) described these as up to 1 mm deep and
nothing appears unusual about their number, density or
arrangement compared with the similar bony canals
present on the keratin-covered cranial bones (premaxillae
especially) seen in other birds.
The shell-like outer layer of the casque is approxi-
mately 23 mm thick and formed of thousands of tiny
cells formed by fine strut-like trabeculae arranged in a
semi-regular, honeycomb-like arrangement (Figure 3(E)),
all enclosed within inner and outer bone layers, the overall
effect being that of a ‘sandwich’ of bone cells. In places,
the cells are arranged in rows that are approximately
parallel to the inner and outer layers. Similar ‘sandwich’
layers formed of parallel rows of cells have been figured
for other birds where the rows may be double, four-deep or
more randomly arranged (Bu
¨hler 1988). This arrangement
is best known for the braincase bones of passerines but
occurs widely, including in the palate, sternum and the
ends of long bones (Bu
¨hler 1988). The dermis and
epidermis are in tight contact with the bony core of the
casque, the soft tissues together forming a keratinous
sheath over the skeletal component. The entire external
sheath of the casque is stiff along its anterior and dorsal
edges but soft and pliable elsewhere: it is not a hard
‘helmet’, but flexible and able to deform when subjected to
load (Crome and Moore 1988; Richardson 1991).
Descriptions have differed in their interpretation of
casque contents. Jones et al. (2003) noted that the casque
seemingly contains liquid of some kind; Crome and Moore
(1988) referred to the presence of ‘a core of firm, cellular
foam-like material that looks like some hi-tech plastic’
(p. 123); while Richardson (1991) referred to the presence
of ‘large amounts of darkly pigmented sludge [that came]
from the deeper regions of the casque’, indicating the
presence of ‘an extensive vascular network and possibly
other structures deep within the casque’ (p. 57).
Richardson (1991) presumed that the method of preparing
the skull was somehow responsible for the ‘sludge’. Our
observations of cassowary dissections lead us to conclude
that reports of liquid or sludge present between the bony
core and the keratinous casque in fact refer to blood that
has haemorrhaged from vessels associated with the
dermis: it is extremely easy to damage the outer layer of
the bony casque due to its fragility. The casque is not
occupied internally by liquid and contains only those
visible filaments. This discovery allows us to examine the
list of potential purposes in a new light.
Casque function
Six hypotheses have been put forward to explain the
evolution and function of the cassowary casque, typically
pertaining to the best known species, Casuarius casuarius.
Note that we have only heard some of the purported
functions reported in anecdotal fashion and are not aware
of their serious proposal in the literature: for the obvious
sake of completeness, we include them here anyway.
We note, in addition, that the casque has been shown to
play a role in heat dissipation (Phillips and Sanborn 1994);
because this role is similar in importance to that occurring
across exposed parts of the skin, it is likely incidental and a
specialised thermoregulatory role for the casque has not
been suggested to our knowledge. We here discuss each
proposal and evaluate it within the context of our new data
on casque structure.
1. Sexual ornamentation. The possibility that the
casque functions in display, that it is used as an indicator of
fitness and that it hence evolved under sexual selection
pressure is plausible, especially given unconfirmed
indications that casque height is sexually dimorphic.
It may not be adequately appreciated how little is known
about cassowary behaviour in the wild: we are not aware of
useful data that have been reported on how the casque
might function in sociosexual terms, nor have adequate
measurements yet been published on casque dimensions or
variability. It is one of our aims that relevant data be
collected and appropriate analysis be carried out in time.
2. Weapon used in intraspecific combat. The possibility
that the casque is used in intraspecific combat, presumably
in disputes over territory or access to mates, has been
considered. To our knowledge, observational data
supporting this possibility have not been reported. The
relatively light and fragile construction of the crest
strongly suggests that a role in combat should be
considered extremely unlikely. Furthermore, we regard it
as far more likely that intraspecific disputes between
cassowaries involve kicking and jabbing with the feet, as is
typical for ratites.
4D. Naish and R. Perron
Downloaded by [University of Southampton Highfield] at 01:25 28 November 2014
3. Moving foliage and detritus on the rainforest floor.
We are aware of one published observation describing use
of the casque to move leaf litter during foraging (Folch
1992). While, as noted above, surprisingly little observa-
tional data on wild cassowaries have been published, the
rarity of this behaviour, combined with the position and
form of the structure, indicates that regular use of the
casque (enough to exert a major selective pressure during
evolution) in this fashion is unlikely.
4. For knocking hanging branches to dislodge fruit. It
has been suggested that the casque is used as a tool for the
dislodging of fruit, with some people even suggesting that
the form of the Casuarius bennetti casque results from
habitual use of the structure in foraging of this sort. We are
not aware of observational data that might support this
suggestion. Furthermore, as with the previous suggestion,
there is no obvious indication from casque form or position
that it might be regularly used in this fashion; not regularly
enough to exert selective pressure during evolution,
anyway. Again, the relative fragility of the casque argues
against the idea that it could be regularly used in a
vigorous activity like branch-knocking.
5. For cranial protection when charging through
undergrowth. Suggestions that the casque functions as
head protection were favoured by Crome and Moore
(1988) who proposed that the ‘foam’ they regarded as
forming the internal contents of the casque’s core provided
shock-absorbing qualities. Again, observational data that
might support this possible role for the casque have not
been reported to our knowledge, nor does the casque
appear robust enough or tough enough to serve a useful
role in head protection.
6. As a resonance box in low frequency communi-
cation. Although the most recently mooted purpose, we
propose that this is most likely the primary one. It is
reasonably well documented that cassowaries produce
low-frequency vocalisations (Jones et al. 2003). During the
mating season the only time the normally solitary,
territorial (Bentrupperba
¨umer 1992) cassowaries are
amenable to contact with members of their own species
cassowaries perform ritualised dances with members of
the opposite sex. During these interactions, deep, guttural,
low-frequency (20–30 Hz) sounds (Jones et al. 2003) are
emitted. A vocalising bird lowers its head such that the
casque is held pointing towards the partner (RP, personal
observation). We suggest that this behaviour represents use
of the casque in directing vocalisations towards a partner,
the possibility then existing that casque size and form are
intrinsically linked to vocal signalling and hence to the
advertising of fitness; such a role suggests that sexual
selection has driven casque evolution in these birds.
Tropical rainforests can be very dense places where
vision is limited and sound does not travel very well. Low-
frequency sound has a much greater range, a fact exploited
by elephants and cetaceans and, among birds, by emus and
cassowaries. Emus inflate and then compress their cervical
air sac and long tracheal pouch: a small opening in the
ventral wall of the latter facilitates the creation of these
calls (Eastman 1969). Whereas the emu does not have a
casque, it lives in open environments where both vision
and sound are relatively undisturbed. Again, hard data on
cassowary vocalisations and acoustics are not currently
available (we are not aware of suitable recordings from the
wild, or from captive specimens, that are available for
analysis) but there are indications from tracheal anatomy
(Forbes 1881) that cassowaries and emus are similarly
equipped and capable of the same sorts of vocalisations.
Rothschild noted that ‘The voice of the cassowaries is a
curious sort of snorting, grunting, and bellowing, usually
not very loud, and differing according to the species’. The
use of vocal signals by cassowaries both warns intruders
and notifies availability during the mating season.
However, Starck (1995) suggested that cavernous
subdermal blood sinuses may play a role in the
amplification of the booming noises made by cassowaries,
raising the question as to whether these structures operate
in conjunction with the crest during vocalisation, or indeed
whether these sinuses take over the proposed acoustic
function of the casque entirely. Further work is needed to
determine which structures are used in amplification, if
either of them is.
Cassowary evolution: a speculative scenario
We propose the following hypothesis as a possible
explanation for cassowary casque evolution and for its
variation in size and form. We recognise that this model is
unavoidably speculative and cannot be fully evaluated due
to a scarce fossil record that provides little data on the
casque morphology of ancient cassowary taxa. Never-
theless, we propose this hypothesis as our best explanation
for the phylogeny and behavioural and morphological
variation discovered in these birds and aim to build on it in
future studies.
Fossils from the Pliocene and Pleistocene indicate that
small, Casuarius bennetti-sized cassowaries, mostly
referred to the problematic taxon C. lydekkeri and not
demonstrably related to any of the extant taxa, were
present in New Guinea and Australia during the Pliocene
and Pleistocene (Lydekker 1891; Miller 1962; Plane 1967;
Rich et al. 1988). There is no indication of close affinity
between these fossil forms and living cassowaries.
Furthermore, they lack characters common to the extant
taxa, possessing a shallower, narrower pelvis, more gracile
femur and a narrower proximal end to the tarsometatarsus
(Rich et al. 1988). Based on this distribution of characters,
we hypothesise that they are outside the clade that includes
the extant taxa and thus that crowncassowaries are a
post-Pliocene clade.
Historical Biology 5
Downloaded by [University of Southampton Highfield] at 01:25 28 November 2014
Over the past several years, we have collected mtDNA
data from numerous cassowary individuals belonging to
seven extant taxa (RP, unpublished data): the full extent
and results of this study will be presented elsewhere and
only a preliminary assessment is included here (Figure 4;
Appendix). These data indicate that Casuarius casuarius
is the sister taxon to remaining extant cassowaries.
Furthermore, both the Oligo-Miocene fossil Emuarius and
extant emus are Australian, suggesting that crown
cassowaries originated in Australia. A divergence date of
2025 million years was suggested for the cassowary
emu lineages by Sibley and Ahlquist (1990), and 3538
million years was suggested by Cooper et al. (2001).
If Emuarius guljaruba from the Upper Oligocene
Etadunna Formation of South Australia truly is an emu
as argued by Boles (2001), most of cassowary (and emu)
evolution occurred after this time (Emuarius appears to be
close to the time of emucassowary divergence). Little is
known about the habitat preferences or ecomorphology of
extinct cassowaries, but it is assumed that these taxa were
rainforest-adapted.
Given that casques are absent in emus and other ratites,
the casque is assumed to be a novelty that evolved after the
divergence of the cassowary lineage from the cassowary
emu common ancestor. The problems of communication
within a rainforest were alluded to above. Although
cassowaries are good swimmers, their distribution in New
Guinea (and at least some of the surrounding islands) is
almost certainly explained either by vicariance or by the
use of terrestrial land-bridges that existed during times of
low sea level (Figure 5). New Guinea has a complex
geological history and essentially consists of a mostly
central-southern and western Australian continental craton
in addition to a large number (over 30) of terranes (some of
which are of continental origin) that form the central-
northern and eastern regions. These accreted during
various parts of the Oligocene, Miocene and Pliocene (and
perhaps during the Eocene as well) (Pigram and Davies
1987; Polhemus and Polhemus 1998), the docking of
several of the larger terranes during the middle or late
Oligocene probably causing the New Guinea Orogeny that
initiated at this time (Pigram and Davies 1987). Given the
distribution of emus and the fossil occurrence of
cassowaries on mainland Australia (Lydekker 1891;
Miller 1962; Plane 1967; Boles 2001), our primary
assumption is that cassowaries are of Australian ancestry,
Figure 5. Speculative scenario linking cassowary evolutionary history to changing sea level and the emergence and submergence of
terrestrial connections between New Guinea and Australia.
Figure 4. Phylogeny generated from DNA sequences of eight cassowary specimens and one emu (see Appendix). The genetic distance
present between Casuarius bennetti westermanni and other specimens included in Casuarius bennetti is consistent with the view that
Casuarius bennetti westermanni should be recognised as a valid taxon (Perron 2011).
6D. Naish and R. Perron
Downloaded by [University of Southampton Highfield] at 01:25 28 November 2014
in which case any vicariance-based hypothesis of their
distribution must link their presence on New Guinea with
the separation of the northern part of the Australian
continental craton from the remainder of Australia.
So far as we can tell at present (a poor fossil record on
New Guinea being a primary limitation), the controlling
factor as goes the movement of terrestrial animals between
Australia and New Guinea is sea level, the high sea levels
of the Miocene and Pliocene seemingly preventing the
terrestrial migration of large animals: indeed, it appears
that New Guinea was mostly drowned during the Miocene
(Dow and Sukamto 1984). In view of this, it has generally
been assumed that terrestrial vertebrate taxa shared
between Australia and New Guinea split during the
Pleistocene in other words, that any taxon endemic to
New Guinea is geologically very young. However, a
growing number of molecular studies have proposed that
terrestrial snakes (Kuch et al. 2005), birds (Joseph et al.
2001), mammals (Rowe et al. 2008; Malekian et al. 2010;
Meredith et al. 2010; Macqueen et al. 2011) and other
vertebrates moved between Australia and New Guinea
during the Pliocene or even the Late Miocene. While we
remain open to the possibility that crown cassowaries
migrated to New Guinea during the Pliocene or Miocene,
the fact that the same species of cassowary Casuarius
casuarius, the sister-taxon of other crowncassowaries
(Figure 4) occurs on Australia as well as New Guinea
leads us to hypothesise that the movement of crown
cassowaries to New Guinea occurred during the Pleisto-
cene. This is because tetrapod species common to both
regions evolved during the Pleistocene (e.g. Aplin and
Ford 2014) and because sister-species within clades that
are common to both areas diverged during the Pleistocene
(e.g. Hocknull et al. 2007; Bryant et al. 2011; Rowe et al.
2011; Aplin and Ford 2014). Furthermore, we assume that
Casuarius casuarius is the oldest extant cassowary species
based on its phylogenetic position relative to other crown
cassowaries. We hope to see these contentions tested in
future work.
At which point during the Pleistocene might
cassowaries have dispersed to New Guinea? The first
period when sea level was sufficiently low to allow
terrestrial crossing lasted nearly 400,000 years (Chappell
1974; Chappell et al. 1996) and we suggest that Casuarius
casuarius extended its range during this time to include the
southern half of present day New Guinea. When sea level
rose during the Mindel Riss interglacial, this population
was stranded on New Guinea, then evolving in isolation
for the following 200,000 years (Figure 5).
We suggest that it was during this period of isolation
that the population concerned became genetically different
and specialised for New Guinea’s physical and botanical
environment. Several key events occurred during this
period of isolation: the mountains of central New Guinea
became considerably higher, perhaps by 700 m or more
(Audley-Charles and Hallam 1988), and the influence of
Asian botanical flora, particularly on the northern side,
increased in significance (Adam 1992). During the next
period of lowered sea level, New Guinea was invaded by
members of the Australian population of Casuarius
casuarius: while probably still able to interbreed with
the previously isolated group, we suggest that members of
both populations would now have inhabited distinct
habitats. The now endemic New Guinea cassowary had, to
some extent, adapted to local conditions and could utilise
more of the available habitat (most notably those at higher
elevation) than the Australian invaders. At some time in
the last 200,000 years, Casuarius bennetti has become
genetically and morphologically distinct from other extant
cassowaries. It is the only cassowary able to inhabit
elevations as high as 3500 m and dwell at sea level without
ill effects (RP, unpublished data). In the wild, it is probably
unable to interbreed with Casuarius casuarius.
Intriguingly, individuals of Casuarius unappendiculatus
exhibit casque variation that seems to span the morphologi-
cal ‘distance’ in casque form between Casuarius casuarius
and Casuarius bennetti. It may not be coincidental that
Casuarius unappendiculatus frequents altitudes also inter-
mediate between those frequented by these two species.
We consider it plausible that Casuarius unappendiculatus
occupies an ecomorphological niche ‘intermediate’ between
the other species a possibility consistent with its
phylogenetic position (Figure 4; Appendix); indeed, it may
even interbreed with both Casuarius casuarius and
Casuarius bennetti in the wild. The phylogenetic relation-
ships of these species, and the possible timescale of their
evolution, will be explored more fully elsewhere.
Conclusions and areas for future work
A surprising dearth of published data on cassowary casque
anatomy partly motivated us to publish this work.
We recognise that more detailed analyses should be
published in future but, meanwhile, have established some
basic parameters of casque anatomy. The casque is not
liquid-filled or occupied by a consistent foam-like material
but, instead, filled internally with a mass of fine trabeculae
anteriorly and an air-filled cavity posteriorly. We are
aware of six hypotheses that aim to present the main
selective force behind the casque’s evolution, all
speculative and untested or under-tested: we reject those
that seem inconsistent with the position and relatively
delicate anatomy of the casque (e.g. that it evolved under
selective pressure related to use of the casque in over-
turning leaf litter, or knocking or banging vegetation). The
idea that the casque is used as a visual signal in
sociosexual display, and as an acoustic organ that
similarity is important in social and sexual terms, seems
most consistent with casque anatomy. Preliminary data
supporting the acoustic function have been published
Historical Biology 7
Downloaded by [University of Southampton Highfield] at 01:25 28 November 2014
(Jones et al. 2003; Mack and Jones 2003) and our
additional data support it (RP, unpublished data).
Behavioural work on use of the casque as a sexual display
structure is needed. We note that this will be of broad
interest with respect to the evolution of extravagant
structures in birds and other archosaurs, because a major
area of debate concerns whether the superficially similar
bony cranial structures of Mesozoic dinosaurs evolved
within the context of sexual display or as species
identification badges (Hone and Naish 2013; Padian and
Horner 2014). As discussed above, extant cassowary
species are separated by altitude, rendering it unlikely that
a role in ‘species recognition’ exerted a selective pressure
on casque evolution (the concept that extravagant
structures have evolved within the context of a role in
species recognition is highly problematic in any case: see
Hone and Naish 2013). Furthermore, data suggest that
hybridisation between morphologically distinct cassowary
species (Casuarius casuarius and Casuarius unappendi-
culatus, and Casuarius unappendiculatus and Casuarius
bennetti) occurs on occasion in the wild an observation
at odds with the idea that extravagant cranial structures
specifically exist such that populations distinguish
themselves from others and hence avoid breeding with
them.
Furthermore, the fact that male and female cassowaries
are similarly ornamented with large casques (they exhibit
elaborate monomorphism) makes it likely that, whatever
the casque’s function, members of both sexes are using it
in similar ways. Elsewhere within birds, the possession of
extravagant display structures in both males and females is
plausibly explained by mutual sexual selection: the
phenomenon in which members of both sexes evaluate
potential partners on the basis of fitness and quality.
Mutual sexual selection is best known for certain grebes,
auks, swans and starlings (Huxley 1914; Jones and Hunter
1993; Kraaijeveld, Gregurke, et al. 2004; Kraaijeveld,
Carew, et al. 2004; Komdeur et al. 2005), but the presence
of elaborate display structures, patterns and colours in both
the males and females of many additional taxa have led to
suggestions that it might be more widespread than
currently realised (Jones 1992). Mutual sexual selection
is far from restricted to birds, also being documented in
insects (Chenoweth and Blows 2003; South and Arnqvist
2011), pipefishes (Widemo 2003), sticklebacks (Berg-
strom and Real 2000) and iguanian lizards (Ord and Stuart-
Fox 2006). Its prevalence in extant birds and other animals
has in fact inspired palaeontologists to propose it as a
viable explanation for the presence of extravagant
structures in both the males and females of Mesozoic
dinosaurs and pterosaurs (Hone et al. 2011). The extensive
role that male cassowaries play in parental care suggests
that males may exhibit a high degree of selectivity with
respect to female partners (Amundsen 2000); in other
words, we consider it plausible that mutual sexual
selection may be at play in these birds. We thus propose
this as an additional hypothesis that can only be supported
or refuted with the collection of field data on cassowary
social and reproductive behaviour. We are aware that
mutual sexual selection may not always explain the
presence of elaborate monomorphism (Tarvin and Murphy
2012; van Rooij and Griffith 2012).
Morphological characters suggest that the poorly known
fossil cassowaries of the Pliocene and Pleistocene (the
taxonomy of which is confused: use of the name Casuarius
lydekkeri for these taxa is provisional and may be technically
incorrect) are outside the clade that includes the extant
species. This requires confirmation through detailed analysis,
although the incomplete nature of the fossil remains
constrains examination at this point. New fossils that help
populate the long cassowary ghost lineage are needed for us to
better understand the evolution of these birds. Within living
cassowaries, we propose a new phylogenetic hypothesis that
we aim to test and examine in subsequent work.
We hope that future work examining and testing several
of the hypotheses and speculations mentioned or explored
here will be undertaken, and that the data required to test
them will be collected. The following areas could be
regarded as the focus for future work: What is the status and
validity of the more distinctive cassowary subspecies – are
they valid taxa, hybrids, artificially introduced populations
or representatives of intraspecific variation? Does the
casque convey information on maturity, sexual status and
fitness, and is it used as a sociosexual signal? Is the casque
used in the same manner in both male and female
cassowaries, and is mutual sexual selection at play? Finally,
can the detailed anatomical structure of the cassowary
casque, described and illustrated here for the first time, be
linked to selection associated with any of the special
functions proposed for this structure?
Acknowledgements
The authors acknowledge the kind and efficient cooperation of
Chiaki Tamura and Yasushi Mohri (Tobe Zoo, Japan) and
Hiroshi Hotta; Axel Hochkirch assisted in the collection and
analysis of cassowary DNA. The authors also thank Robert Prys-
Jones for access to specimens at Tring (Natural History Museum,
UK). Hanneke Meijer is thanked for many excellent and helpful
comments, as is a mysterious and anonymous second reviewer.
Note
1. Email: casuarius2006@yahoo.co.uk
References
Adam P. 1992. Australian rainforests. Oxford (UK): Clarendon Press.
Amundsen T. 2000. Why are female birds ornamented? Trends Ecol Evol.
15:149– 155.
Aplin K, Ford F. 2014. Murine rodents: late but highly successful
invaders. In: Prins HHT, Gordon IJ, editors. Invasion biology and
8D. Naish and R. Perron
Downloaded by [University of Southampton Highfield] at 01:25 28 November 2014
ecological theory: insights from a continent in transformation.
Cambridge: Cambridge University Press; p. 196 –240.
Audley-Charles MG, Hallam A. 1988. Gondwana and tethys. The
Geological Society. Oxford: Oxford University Press.
Beehler BM, Pratt TK, Zimmerman DA. 1986. Birds of New Guinea.
Princeton (NJ): Princeton University Press.
Bentrupperba
¨umer JM. 1992. Cassowary monitoring program for the
whole of Cardwell and part of Johnstone Shires, North Queensland.
Unpublished report to Queensland National Parks and Wildlife
Service.
Bergstrom CT, Real LA. 2000. Towards a theory of mutual mate choice:
lessons from two-sided matching. Evol Ecol Res. 2:493–508.
Bledsoe AH. 1988. A phylogenetic analysis of postcranial skeletal
characters of the ratite birds. Ann Carnegie Mus. 57:73– 90.
Boles WE. 1992. Revision of Dromaius gidju Patterson and Rich 1987
from Riversleigh, northwestern Queensland, Australia, with a
reassessment of its generic position. Sci Ser Nat Hist Mus Los
Angeles County. 36:195– 208.
Boles WE. 2001. A new emu (Dromaiinae) from the Late Oligocene
Etadunna Formation. Emu. 101:317– 321.
Bryant LM, Donnellan SC, Hurwood DA, Fuller SJ. 2011. Phylogenetic
relationships and divergence date estimates among Australo-Papuan
mosaic-tailed rats from the Uromys (Rodentia: Muridae). Zool
Script. 40:433– 447.
Bu
¨hler P. 1988. Light bones in birds. Los Angeles County Mus Nat Hist
Sci Ser. 36:385–393.
Chappell J. 1974. Geology of Coral Terraces, Huon Peninsula, New
Guinea: a study of quaternary tectonic movements and sea-level
changes. Geol Soc Am Bull. 85:553–570.
Chappell J, Omura A, Esat T, McCulloch M, Pandolfi J, Ota Y, Pillans B.
1996. Reconciliaion of late quaternary sea levels derived from coral
terraces at Huon Peninsula with deep sea oxygen isotope records.
Earth Planet Sci Lett. 141:227–236.
Chenoweth SF, BlowsMW. 2003. Signaltrait sexualdimorphismand mutual
sexual selection in Drosophila serrata. Evolution. 57:2326– 2334.
Clements JF. 2008. Birds of the world. 6th ed. London: Christopher Helm.
Coates BJ. 1985. The birds of Papua New Guinea. Vol. 1. Alderley: Dove
Publications.
Cooper A, Lalueza-Fox C, Anderson S, Rambaut A, Austin J, Ward R.
2001. Complete mitochondrial genome sequences of two extinct
moas clarify ratite evolution. Nature. 409:704– 707.
Cracraft J. 1981. Toward a phylogenetic classification of the recent birds
of the world (Class Aves). The Auk. 98:681– 714.
Crome FHJ, Moore LA. 1988. The cassowary’s casque. Emu. 88:123 –124.
Davies SJJF. 2002. Ratites and Tinamous. Oxford: Oxford University
Press.
Dickinson EC. 2003. The Howard and Moore complete checklist of the
birds of the world. 3rd ed. London: Christopher Helm.
Dickinson EC, Remsen JV. 2013. The Howard and Moore complete
checklist of the birds of the world. 4th ed., Vol. 1. Non-Passerines.
Eastbourne: Aves Press.
Dow DB, Sukamto R. 1984. Western Irian Jaya: the end-product of oblique
plate convergence in the late Tertiary. Tectonophysics. 106:109– 139.
Dyke GJ, van Tuinen M. 2004. The evolutionary radiation of modern
birds (Neornithes): reconciling molecules, morphology and the fossil
record. Zool J Linn Soc. 141:153– 177.
Eastman M. 1969. The life of the emu. London: Angus and Robertson.
Folch A. 1992. Family Casuariidae (cassowaries). In: del Hoyo J, Elliott
A, Sargatal J, editors. Handbook of the birds of the world. Vol. 1.
Barcelona: Lynx Edicions; p. 90– 97.
Forbes WA. 1881. On the conformation of the thoracic end of the trachea
in the ratite birds. Proc Zool Soc Lond. 49:778–788.
Hackett SJ, Kimball RT, Reddy S, Bowie RCK, Braun EL, Braun MJ,
Cjojnowski JL, Cox WA, Han K-L, Harshman J, et al. 2008. A
phylogenomic study of birds reveals their evolutionary history.
Science. 320:1763– 1768.
Hocknull SA, Zhao J-x, Feng Y-x, Webb GE. 2007. Responses of
quaternary rainforest vertebrates to climate change in Australia.
Earth Planet Sci Lett. 264:317–331.
Hone DWE, Naish D. 2013. The ‘species recognition hypothesis’ does
not explain the presence and evolution of exaggerated structures in
non-avialan dinosaurs. J Zool. 290:172 –180.
Hone DWE, Naish D, Cuthill IC. 2011. Does mutual sexual selection
explain the evolution of head crests in pterosaurs and dinosaurs?
Lethaia. 45:139– 156.
Huxley J. 1914. The courtship habits of the Great Crested Grebe
(Podiceps cristatus); with an addition to the theory of sexual
selection. Proc Zool Soc Lond. 35:491 –562.
Jones IL. 1992. Sexual selection and the evolution of extravagant traits in
birds: problems with testing good-genes models of sexual selection.
The Auk. 109:197– 199.
Jones IL, Hunter FM. 1993. Mutual sexual selection in a monogamous
seabird. Nature. 362:238– 239.
Jones J, Mack AL, Nelson DA. 2003. Low-frequency vocalisations by
cassowaries (Casuarius spp.). Auk. 120:1062– 1068.
Joseph L, Slikas B, Alpers D, Schodde R. 2001. Molecular systematics
and phylogeography of New Guinean logrunners (Orthonychidae).
Emu. 101:273– 280.
Komdeur J, Oorebeek M, van Overveld T, Cuthill IC. 2005. Mutual
ornamentation, age, and reproductive performance in the European
starling. Behav Ecol. 16:805–817.
Kraaijeveld K, Carew PJ, Billing T, Adcock GJ, Mulder RA. 2004. Extra-
pair paternity does not result in differential sexual selection in the
mutually ornamented black swan (Cygnus atratus). Mol Ecol. 13:
1625– 1633.
Kraaijeveld K, Gregurke J, Hall C, Komdeur J, Mulder RA. 2004. Mutual
ornamentation, sexual selection, and social dominance in the black
swan. Behav Ecol. 15:380–389.
Kuch U, Keogh JS, Weigel J, Smith LA, Mebs D. 2005. Phylogeography
of Australia’s king brown snake (Pseudechis australis) reveals
Pliocene divergence and Pleistocene dispersal of a top predator.
Naturwissenschaften. 92:121– 127.
Lee K, Feinstein J, Cracraft J. 1997. The phylogeny of ratite birds:
resolving conflicts between molecular and morphological data sets.
In: Mindell DP, editor. Avian molecular evolution and systematics.
London: Academic Press; p. 173 –211.
Livezey BC, Zusi RL. 2007. Higher-order phylogeny of modern birds
(Theropoda, Aves: Neornithes) based on comparative anatomy. II.
Analysis and discussion. Zool J Linn Soc. 149:1– 95.
Lydekker R. 1891. Catalogue of the fossil birds in the British Museum
(NaturalHistory), London. London: British Museum (Natural History).
Mack AL. 2013. Searching for pekpek: cassowaries and conservation in
the New Guinea rainforest. New Florence (PA): Cassowary
Conservation & Publishing.
Mack AL, Jones J. 2003. Low-frequency vocalizations by cassowaries
Casuarius spp. The Auk. 120:1062– 1068.
Macqueen P, Goldizen AW, Austin JJ, Seddon JM. 2011. Phylogeo-
graphy of the pademelons (Marsupialia: Macropodidae: Thylogale)
in New Guinea reflects both geological and climatic events during
the Plio-Pleistocene. J Biogeogr. 38:1732– 1747.
Malekian M, Cooper SJB, Norman JA, Christidis L, Carthew SM. 2010.
Molecular systematics and evolutionary origins of the genus
Petaurus (Marsupialia: Petauridae) in Australia and New Guinea.
Mol Phylogenet Evol. 54:122–135.
Mayr E. 1979. Check-list of birds of the world. 2nd ed., Vol. 1.
Cambridge (MA): Harvard University Press.
Meredith RW, Mendoza MA, Roberts KK, Westerman M. 2010. A
phylogeny and timescale for the evolution of Pseudocheiridae
(Marsupialia: Diprotodontia) in Australia and New Guinea.
J Mammal Evol. 17:75– 99.
Miller AH. 1962. The history and significance of the fossil Casuarius
lydekkeri. Rec Austral Mus. 25:235– 238.
Ord TJ, Stuart-Fox D. 2006. Ornament evolution in dragon lizards:
multiple gains and widespread losses reveal a complex history of
evolutionary change. J Evol Biol. 19:797– 808.
Padian K, Horner JR. 2014. The species recognition hypothesis explains
exaggerated structures in non-avialan dinosaurs better than sexual
selection does. Comptes Rendu Palevol. 13:97–107.
Patterson C, Rich PV. 1987. The fossil history of the emus, Dromaius
(Aves: Dromaiinae). Rec S Austral Mus. 21:85– 117.
Perron RM. 2011. The taxonomic status of Casuarius bennetti papuanus
and C. b. westermanni. Bull Brit Ornithol Club. 131:54–58.
Peters JL. 1931. Check-list of birds of the world. Vol. 1. Cambridge
(MA): Harvard University Press.
Historical Biology 9
Downloaded by [University of Southampton Highfield] at 01:25 28 November 2014
Phillips PK, Sanborn AF. 1994. An infrared, thermographic study of
surface temperature in three ratites: ostrich, emu and Double-wattled
cassowary. J Therm Biol. 19:423– 430.
Pigram CJ, Davies PJ. 1987. Terranes and the accretion history of the
New Guinea Orogen. BMR J Aust Geol Geophys. 19:193–212.
Plane MD. 1967. Stratigraphy and vertebrate fauna of the Otibanda
Formation, New Guinea. Bur Miner Resour Geol Geophys Bull. 86:
1–64.
Polhemus DA, Polhemus JT. 1998. Assembling New Guinea: 40 million
years of island arc accretion as indicated by the distributions of
aquatic Heteroptera (Insecta). In: Hall R, Holloway JD, editors.
Biogeography ad geological evolution of SE Asia. Leiden: Backhuys
Publishers; p. 327–340.
Prager EM, Wilson AC, Osuga DT, Feeney RE. 1976. Evolution
of flightless land birds on southern continents: transferrin comparison
shows monophyletic origin of ratites. J Mol Evol. 8:283– 294.
Rich PV, Plane M, Schroeder N. 1988. A pygmy cassowary (Casuarius
lydekkeri) from late Pleistocene bog deposits at Pureni, Papua New
Guinea. BMR J Aust Geol Geophys. 10:377 –389.
Richardson KC. 1991. The bony casque of the Southern cassowary,
Casuarius casuarius. Emu. 91:56– 58.
Rothschild W. 1900. A monograph of the genus Casuarius. Trans Zool
Soc Lond. 15:109–290.
Rowe KC, Aplin KP, Baverstock PR, Moritz C. 2011. Recent and rapid
speciation with limited morphological disparity in the genus Rattus.
Systemat Biol. 60:188–203.
Rowe KC, Reno ML, Richmond DM, Adkins RM, Steppan SJ. 2008.
Pliocene colonization and adaptive radiations in Australia
and New Guinea (Sahul): multilocus systematics of the old
endemic rodents (Muroidea: Murinae). Mol Phylogenet Evol. 47:
84–101.
Sibley CG, Ahlquist JE. 1972. A comparative study of the egg-white
proteins of non-passerine birds. Bull Peabody Mus Nat Hist. 39:
1–276.
Sibley CG, Ahlquist JE. 1990. Phylogeny and classification of birds. New
Haven (CT): Yale University Press.
South SH, Arnqvist G. 2011. Male, but not female, preference for an
ornament expressed in both sexes of the polygynous mosquito
Sabethes cyaneus. Anim Behav. 81:645 –651.
Starck JM. 1995. Comparative anatomy of the external and middle
ear of palaeognathous birds. Adv Anat Embryol Cell Biol. 131:
1–137.
Tarvin KA, Murphy TG. 2012. It isn’t always sexy when both are bright
and shiny: considering alternatives to sexual selection in elaborate
monomorphic species. Ibis. 154:439– 443.
van Rooij EP, Griffith SC. 2012. No evidence of assortative mating on the
basis of putative ornamental traits in long-tailed finches Poephila
acuticauda. Ibis. 154:444– 451.
Widemo MS. 2003. Mutual mate choice in the deep snouted pipefish
Syngnathus typhle. Acta Universitatis Upsaliensis. Comprehensive
Summaries of Uppsala Dissertations from the Faculty of Science and
Technology 801: 31.
10 D. Naish and R. Perron
Downloaded by [University of Southampton Highfield] at 01:25 28 November 2014
Appendix
MtDNA sequences coded for seven cassowary specimens and
one emu used in this study. Further discussion and data on
additional specimens will be presented in a future study. Four
sequences listed here (CBU76037, AF338713, NC_002778 and
NC_002784) are available via Genbank; others (E2–E7) are
novel and will be discussed in a future study. Abbreviations: C.
b., Casuarius bennetti; C. c., Casuarius casuarius;C.b.w.,
Casuarius bennetti westermanni; C. b. h., Casuarius bennetti
hecki; C. u., Casuarius unappendiculatus; D. n., Dromaius
novaehollandiae.
.
C. b._CBU76037 AAGGAACTAGGCAAACCTAAGGCCCGACTGTTTACCAAAAACATAGCCTT
C. c._AF338713 AAGGAACTAGGCAAACCTAAGGCCCGACTGTTTACCAAAAACATAGCCTT
C. c._NC_002778 AAGGAACTAGGCAAACCTAAGGCCCGACTGTTTACCAAAAACATAGCCTT
C. b. w._E2 ???????????????????????????????????CAAAAACATAGCCTT
C. b. w._E3 ???????????????????????????????????CAAAAACATAGCCTT
C. b. h._E4 ?????????????????????????????????????????????GCCTT
C. u._E7 ??????????????????????????????????????????????????
D. n._NC_002784 AAGGAACTAGGCAAACCAAAGGCCCGACTGTTTACCAAAAACATAGCCTT
C. b _CBU76037 CCAGCTAGCAACAAGTATTGAAGGTGATGCCTGCCCAGTGACTTATGTTCA
C. c._AF338713 CAGCTAACAACAAGTATTGAAGGTGATGCCTGCCCAGTGACTTATGTTTA
C. c._NC_002778 CAGCTAACAACAAGTATTGAAGGTGATGCCTGCCCAGTGACTTATGTTTA
C. b. w._E2 CAGCTAGCAACAAGTATTGAAGGTGATGCCTGCCCAGTGACTTATGTTTA
C. b. w._E3 CAGCTAGCAACAAGTATTGAAGGTGATGCCTGCCCAGTGACTTATGTTTA
C. b. h._E4 CAG?TAGCAACAAGTATTGAAGGTGATGCCTGCCCAGTGACTTATGTTCA
C. u._E7 ????TA?CAACAAGTATTGAAGGTGATGCCTGCCCAGTGACTTACGTTTA
D. n._NC_002784 CAGCTAACAACAAGTATTGAAGGTGATGCCTGCCCAGTGACTTATGTTTA
C. b _CBU76037 ACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGCAATCAATTGTCCCAT
C. c._AF338713 ACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGCAATCAATTGTCCCAT
C. c._NC_002778 ACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGCAATCAATTGTCCCAT
C. b. w._E2 ACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGCAATCAATTGTCCCAT
C. b. w._E3 ACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGCAATCAATTGTCCCAT
C. b. h._E4 ACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGCAATCAATTGTCCCAT
C. u._E7 ACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGCAATCAATTGTCCCAT
D. n._NC_002784 ACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGCAATCAATTGTCCCAT
C. b _CBU76037 AAATCGAGACTTGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTGCA
C. c._AF338713 AAATCGAGACTTGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTGCA
C. c._NC_002778 AAATCGAGACTTGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTGCA
C. b. w._E2 AAATCGAGACTTGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTGCA
C. b. w._E3 AAATCGAGACTTGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTGCA
C. b. h._E4 AAATCGAGACTTGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTGCA
C. u._E7 AAATCGAGACTTGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTGCA
D. n._NC_002784 AAATCGAGACTTGTATGAATGGCTAAACGAGGTCTTAACTGTCTCTTGCA
C. b _CBU76037 GATAATCAATGAAATTGATCTTCC-GTGCAAAAGCAGGAATATGAGCATAA
C. c._AF338713 GATAATCAGTGAAATTGATCTTCCTGTGCAAAAGCAGGAATATGAACATAA
C. c._NC_002778 GATAATCAGTGAAATTGATCTTCCTGTGCAAAAGCAGGAATATGAACATAA
C. b. w._E2 GACAATCAATGAAATTGATCTTCCTGTGCAAAAGCAGGAATATGAACATAA
C. b. w._E3 GACAATCAATGAAATTGATCTTCCTGTGCAAAAGCAGGAATATGAACATAA
C. b. h._E4 GATAATCAATGAAATTGATCTTCCTGTGCAAAAGCAGGAATATGAGCATAA
C. u._E7 GATAATCAATGAAATTGATCTTCCTGTGCAAAAGCAGGAATATGAACATAA
D. n._NC_002784 GATAATCAGTGAAATTGATCTTCCTGTGCAAAAGCAGGAATATGGACATAA
C. b _CBU76037 GACGAGAAGACCCTGTGGAACTTTAAAATCAAGGACCAATGCACTCAACT
C. c._AF338713 GACGAGAAGACCCTGTGGAACTTAAAAATCAAGGACCAATGCACTCAACT
C. c._NC_002778 GACGAGAAGACCCTGTGGAACTTAAAAATCAAGGACCAATGCACTCAACT
C. b. w._E2 GACGAGAAGACCCTGTGGAACTTAAAAATCAAGGACCAATGCACTCAACT
C. b. w._E3 GACGAGAAGACCCTGTGGAACTTAAAAATCAAGGACCAATGCACTCAACT
C. b. h._E4 GACGAGAAGACCCTGTGGAACTTAAAAATCAAGGACCAATGCACTCAACT
C. u._E7 GACGAGAAGACCCTGTGGAACTTAAAAATCAAGGACCAATGCACTCAACT
D. n._NC_002784 GACGAGAAGACCCTGTGGAACTTAAAAATCGAGGACCAATGCATTTAACT
(Continued)
Historical Biology 11
Downloaded by [University of Southampton Highfield] at 01:25 28 November 2014
C. b _CBU76037 TCCAAACCTACCAAGGTTCACTTCATCTGCAGCAATGGTCCCCATTTTTC
C. c._AF338713 TCCAAACCTACCAAGGTTCACTTCATCTGCAGCAATGGTCCTCATTTTTC
C. c._NC_002778 TCCAAACCTACCAAGGTTCACTTCATCTGCAGCAATGGTCCTCATTTTTC
C. b. w._E2 TCCAAACCTACCAAGGTTCACTTCATCTGCAGCAATGGTCCCCATTTTTC
C. b. w._E3 TCCAAACCTACCAAGGTTCACTTCATCTGCAGCAATGGTCCCCATTTTTC
C. b. h._E4 TCCAAACCTACCAAGGTTCACTTCATCTGCAGCAATGGTCCCCATTTTTC
C. u._E7 TCCAAACCTACCAAGGTTCACTTCATCTGCAGCAATGGTCCTCATTTTTC
D. n._NC_002784 TCCGAACCTACTGAGGCTCACTTTATATGCAATAATGGTCCCTATTTTTC
C. b _CBU76037 GGTTGGGGCGACCTTGGAGAAAAGAAGATCCTCCAAAAATAAGACCATTA
C. c._AF338713 GGTTGGGGCGACCTTGGAGGAAAGAAGATCCTCCAAAAATAAGACCATTA
C. c._NC_002778 GGTTGGGGCGACCTTGGAGGAAAGAAGATCCTCCAAAAATAAGACCATTA
C. b. w._E2 GGTTGGGGCGACCTTGGAGAAAAGAAGATCCTCCAAAAATAAGACCATTA
C. b. w._E3 GGTTGGGGCGACCTTGGAGAAAAGAAGATCCTCCAAAAATAAGACCATTA
C. b. h._E4 GGTTGGGGCGACCTTGGAGAAAAGAAGATCCTCCAAAAATAAGACCATTA
C. u._E7 GGTTGGGGCGACCTTGGAGAAAAGAAGAACCTCCAAAAATAAGACCATTA
D. n._NC_002784 GGTTGGGGCGACCTTGGAGAAAAAAGAATCCTCCAAAAATAAGACCATAA
C. b _CBU76037 ATCTTGACTAAGAACTACACCTCAAAGTACTAACAGTAACCAGACCCAAT
C. c._AF338713 ATCTTGACTAAGAACTACACCTCAAAGTACTAACAGTAACCAGACCCAAT
C. c._NC_002778 ATCTTGACTAAGAACTACACCTCAAAGTACTAACAGTAACCAGACCCAAT
C. b. w._E2 ATCTTGACTAAGAACTACACCTCAAAGTACTAACAGTAACCAGACCCAAT
C. b. w._E3 ATCTTGACTAAGAACTACACCTCAAAGTACTAACAGTAACCAGACCCAAT
C. b. h._E4 ATCTTGACTAAGAACTACACCTCAAAGTACTAACAGTAACCAGACCCAAT
C. u._E7 ATCTTGACTAAGAACTACACCTCAAAGTACTAACAGTAACCAGACCCAAT
D. n._NC_002784 ACCTTAACTAAGAACCACACCTCAAAGTACTAACAGTAACCAGACCCAAT
C. b _CBU76037 ATAATTGATTAATGAACCAAGCTACCCCAGGGATAACAGCGCAATCTCCT
C. c._AF338713 ATAATTGATTAATGAACCAAGCTACCCCAGGGATAACAGCGCAATCTCCT
C. c._NC_002778 ATAATTGATTAATGAACCAAGCTACCCCAGGGATAACAGCGCAATCTCCT
C. b. w._E2 ATAATTGATTAATGAACCAAGCTACCCCAGGGATAACAGCGCAATCTCCT
C. b. w._E3 ATAATTGATTAATGAACCAAGCTACCCCAGGGATAACAGCGCAATCTCCT
C. b. h._E4 ATAATTGATTAATGAACCAAGCTACCCCAGGGATAACAGCGCAATCTCCT
C. u._E7 ATAATTGATTAATGAACCAAGCTACCCCAGGGATAACAGCGCAATCTCCT
D. n._NC_002784 ATAATTGATTAATGAACCAAGCTACCCCAGGGATAACAGCGCAATCTCCT
C. b _CBU76037 TCAAGAGCCCATATCGACAAGGAGGTTTACGACCTCGATGTTGGATCAGG
C. c._AF338713 TCAAGAGCCCATATCGACAAGGAGGTTTACGACCTCGATGTTGGATCAGG
C. c._NC_002778 TCAAGAGCCCATATCGACAAGGAGGTTTACGACCTCGATGTTGGATCAGG
C. b. w._E2 TCAAGAGCCCATATCGACAAGGAGGTTTACGACCTCGATG?TGGATCAGG
C. b. w._E3 TCAAGAGCCCATATCGACAAGGAGGTTTACGACCTCGATG?TGGATCAGG
C. b. h._E4 TCAAGAGCCCATATCGACAAGGAGGTTTACGACCTCGATGTTGGATCAGG
C. u._E7 TCAAGAGCCCATAT?GACAAGGAGGTTTACGACCTCGATGTTGGATCAGG
D. n._NC_002784 TCAAGAGCCCATATCGACAAGGAGGTTTACGACCTCGATGTTGGATCAGG
C. b _CBU76037 ACATCCTAATGGTGCGCCCGCTATTAAGGGTTCGTTTGTTCAACGATTAA
C. c._AF338713 ACATCCTAATGGTGCAGCCGCTATTAAGGGTTCGTTTGTTCAACGATTAA
C. c._NC_002778 ACATCCTAATGGTGCAGCCGCTATTAAGGGTTCGTTTGTTCAACGATTAA
C. b. w._E2 ACATCCTAATGGTGCAGCCG??????????????????????????????
C. b. w._E3 ACATCCTAATGGTGCAGCCG??????????????????????????????
C. b. h._E4 ACATCCTAATGGTGCAGCCGCTATTAAGGGTTCGTTTGTTCAACGATTAA
C. u._E7 ACATCCTAATGGTGCAGCCGCTATTAAGGGTTCGTTTGTTCAACGATTAA
D. n._NC_002784 ACATCCTAATGGTGCAGCCGCTATTAAGGGTTCGTTTGTTCAACGATTAA
C. b _CBU76037 TAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTA
C. c._AF338713 TAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTA
C. c._NC_002778 TAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTA
C. b. w._E2 ??????????????????????????????????????????????????
C. b. w._E3 ??????????????????????????????????????????????????
C. b. h._E4 TAGTCCTACGTGATCTGAG???????????????????????????????
C. u._E7 TAGTCCTACGTGATCTGAGTTCAGACCGG?????????????????????
D. N._NC_002784 CAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTA
12 D. Naish and R. Perron
Downloaded by [University of Southampton Highfield] at 01:25 28 November 2014
... In some avian species, sexual dimorphism has been detected specifically in cranial ornaments, such as the casques of guineafowl (Numida; Angst et al., 2020) and hornbills (e.g., Bycanistes, Ceratogymna; Kemp, 2001;Gamble, 2007), the fleshy knobs of curassows (i.e., Crax; Buchholz, 1991;Mayr, 2018), and the feather crests of peafowl (i.e., Pavo; Dakin, 2011). It has been hypothesized that the casques of C. casuarius may be sexually dimorphic (Crome & Moore, 1988;Hone et al., 2012;Naish & Perron, 2016;Rothschild, 1900), enabling females to be distinguished from males based on casque shape (e.g., relative tallness). ...
... Australia. This is primarily the result of ancestral cassowary immigration across periodic land bridges between Australia, New Guinea, and smaller islands starting approximately 800,000 years ago (Naish & Perron, 2016). Glacially influenced sea level changes may have contributed to the geographic segregation of several populations of C. casuarius during this period (Naish & Perron, 2016). ...
... This is primarily the result of ancestral cassowary immigration across periodic land bridges between Australia, New Guinea, and smaller islands starting approximately 800,000 years ago (Naish & Perron, 2016). Glacially influenced sea level changes may have contributed to the geographic segregation of several populations of C. casuarius during this period (Naish & Perron, 2016). This history suggests that morphological variation in the casque may derive in part from the wide geographic distribution and regional isolation that C. casuarius experienced. ...
Full-text available
Article
The cranial casques of modern cassowaries (Casuarius) have long intrigued researchers; however, in‐depth studies regarding their morphological variation are scarce. Through visual inspection, it has been recognized that casque variability exists between conspecifics. Understanding casque variation has both evolutionary and ecological importance. Although hypothesized to be targeted by selection, intraspecific casque variation has not been quantified previously. Through a large sample of C. casuarius (n = 103), we compared casque shape (lateral and rostral views) between sexes and between individuals from non‐overlapping geographical regions using two‐dimensional (2D) geometric morphometrics. We found no statistically significant differences between the casque shape of females and males and few substantial shape differences between individuals from different geographic areas. Much of the intraspecific variation within C. casuarius is due to casque asymmetries (77.5% rightward deviating, 20.7% leftward deviating, and 1.8% non‐deviating from the midline; n = 111), which explain the high variability of southern cassowary casque shape, particularly from the rostral aspect. Finally, we discuss how our non‐significant findings implicate social selection theory, and we identify the benefits of quantifying such variation for further elucidating casque function(s) and the social biology of cassowaries. Cassowary casques are among the most iconic cranial ornaments among modern Aves. Geometric morphometric shape analysis of southern cassowary ornaments indicates no sexual dimorphism and few differences between regional populations. Instead, intraspecific casque shape variation is primarily due to directional, cranial asymmetries (illustrated as five typical casque orientations referenced to a single adult skull). These data from living cassowaries are crucial to our understanding of ornament evolution and functional morphology
... keratinous protrusions that extend dorsally above the orbits and neurocranium. In cassowaries, keratinous outer sheathing generally follows the shape of the bony casque surface, though it may exceed the height of the underlying pneumatized bone (Naish & Perron, 2016;Pycraft, 1900;Richardson, 1991). ...
... Starting in the late 19th century (Flower, 1871;Marshall, 1872;Parker, 1866;Pycraft, 1900;Rothschild, 1900), these cranial ornaments have been the subject of numerous hypotheses regarding their composition and function (Crome & Moore, 1988;Dodson, 1975;Eastick, Tattersall, Watson, Lesku, & Robert, 2019;Mack & Jones, 2003;Mayr, 2018;Naish & Perron, 2016;Phillips & Sanborn, 1994;Richardson, 1991;Starck, 1995). Interestingly, previous studies detailing the constitution of cassowary cranial casques have led to several different interpretations of their contributing bony elements. ...
... Together, these historical texts summarize which elements were thought to contribute to which anatomical aspect of the casque: the mesethmoid forming a rostrodorsal portion, a tentatively labeled median casque element occupying the most dorsal aspect, nasals contributing to the rostrolateral walls, lacrimals marginally involved in the base laterally, and frontals along with parietals supporting the caudolateral base. Expanding on these efforts, more recent osteological descriptions have produced other interpretations of element combinations to casque formation in cassowaries (Mayr, 2018;Naish & Perron, 2016;Richardson, 1991), resulting in the characterization of several casque phenotypes (refer Table 1 for historical interpretations). ...
Article
Extant cassowaries (Casuarius) are unique flightless birds found in the tropics of Indo‐Australia. They have garnered substantial attention from anatomists with focus centered on the bony makeup and function of their conspicuous cranial casques, located dorsally above the orbits and neurocranium. The osteological patterning of the casque has been formally described previously; however, there are differing interpretations between authors. These variable descriptions suggest that an anatomical understanding of casque anatomy and its constituent elements may be enhanced by developmental studies aimed at further elucidating this bizarre structure. In the present study, we clarify casque osteology of the southern cassowary (C. casuarius) by detailing casque anatomy across an extensive growth series for the first time. We used micro‐computed tomography (μCT) imaging to visualize embryonic development and post‐hatching ontogeny through adulthood. We also sampled closely related emus (Dromaius novaehollandiae) and ostriches (Struthio camelus) to provide valuable comparative context. We found that southern cassowary casques are comprised of three paired (i.e., nasals, lacrimals, frontals) and two unpaired elements (i.e., mesethmoid, median casque element). Although lacrimals have rarely been considered as casque elements, the contribution to the casque structure was evident in μCT images. The median casque element has often been cited as a portion of the mesethmoid. However, through comparisons between immature C. casuarius and D. novaehollandiae we document the median casque element as a distinct unit from the mesethmoid. This article is protected by copyright. All rights reserved.
... , pterosaurs (Bennett, 1992;Bennett, 1993;Bennett, 1996;Bennett, 2002;Kellner and Campos, 2002;Hone et al., 2012;Wang et al., 2014a;Wang et al., 2014b), and birds (Naish and Perron, 2016), they have been surprisingly scantily studied and they are therefore poorly understood, even for modern birds, thus making interpretations of such fossilized structures difficult. ...
... In the case of the cassowaries, several hypotheses have been proposed to explain the function of this crest: a sexual ornamentation, a weapon used in intraspecific combats, a tool for moving foliage and detritus on the rainforest floor or for knocking hanging branches to dislodge fruit, a cranial protection when charging through undergrowth, a resonance box for low frequency communication [see Naish and Perron, 2016 for a summary] or as a thermoregulation tool (Eastick et al., 2019). Until now, only a few studies have been published about the crest of cassowaries (Parker, 1866;Marshall, 1872;Dodson, 1975;Crome and Moore, 1988;Richardson, 1991;Mack and Jones, 2003;Naish and Perron, 2016;Eastick et al., 2019), and even more surprisingly, only one preliminary paper has dealt with the crest of the guinea fowl (Prinsloo et al., 2005) and attempted to use anatomical measurements to deduce sex differences. The results of these earlier studies are generally inconclusive and raise the need for further studies in this area, as highlighted recently by Mayr (2018). ...
... The bony crest of the guinea fowl is formed from the two frontal bones (Fig. 4), and it appears that this is also the case for cassowaries (Naish and Perron, 2016). However, the bony crest of modern cassowaries extends anteriorly to the base of the rostrum and fuses with the posterodorsal ramus of the premaxilla (Naish and Perron, 2016). ...
Full-text available
Article
Crested vertebrates are known from a wide variety of modern and fossil taxa, however, the actual formation and function of the crest is still debatable. Among modern birds, the globally distributed guinea fowl (Numida meleagris) is characterized by having a cranial bony crest (overlain by keratin), but surprisingly little is known about its development. Here, we studied the crest of 202 wild guinea fowl from the same population, using anatomical measurements as well as 2D‐morphometry. Our results show that juveniles have smaller skulls than adults and have smaller, simpler crests that are visible even in very young individuals. Among adults, female skulls are smaller than males, and they have smaller, simpler shaped crests, which permit a discrimination between the sexes of 93% when the keratin is preserved with the bony crest, and of 89% when only the bony crest is available. By extrapolation, these results confirm that the crest can be used as an ontogenetic character, as well as for sex discrimination in the fossil record. Our results also show that the overlying keratin does not always mimic the underlying bony crest, which should be considered when reconstructing extinct crested vertebrates. Anat Rec, 2019. © 2019 American Association for Anatomy
... Unfortunately, no elements from this specimen overlap with those from the Otibanda Formation specimen [355], so the relationship between the only known fossil cassowaries remains a mystery. Naish and Perron [360] speculated that crown cassowaries may be a relatively young clade that evolved in post-Pliocene Australia, with movement into New Guinea occurring during the Pleistocene with the appearance of land bridges between the two landmasses. Of course, this scenario will remain purely speculative until more of these elusive fossils come to light. ...
Full-text available
Article
The extant diversity of the avian clade Palaeognathae is composed of the iconic flightless ratites (ostriches, rheas, kiwi, emus, and cassowaries), and the volant tinamous of Central and South America. Palaeognaths were once considered a classic illustration of diversification driven by Gondwanan vicariance, but this paradigm has been rejected in light of molecular phylogenetic and divergence time results from the last two decades that indicate that palaeognaths underwent multiple relatively recent transitions to flightlessness and large body size, reinvigorating research into their evolutionary origins and historical biogeography. This revised perspective on palaeognath macroevolution has highlighted lingering gaps in our understanding of how, when, and where extant palaeognath diversity arose. Towards resolving those questions, we aim to comprehensively review the known fossil record of palaeognath skeletal remains, and to summarize the current state of knowledge of their evolutionary history. Total clade palaeognaths appear to be one of a small handful of crown bird lineages that crossed the Cretaceous-Paleogene (K-Pg) boundary, but gaps in their Paleogene fossil record and a lack of Cretaceous fossils preclude a detailed understanding of their multiple transitions to flightlessness and large body size, and recognizable members of extant subclades generally do not appear until the Neogene. Despite these knowledge gaps, we combine what is known from the fossil record of palaeognaths with plausible divergence time estimates, suggesting a relatively rapid pace of diversification and phenotypic evolution in the early Cenozoic. In line with some recent authors, we surmise that the most recent common ancestor of palaeognaths was likely a relatively small-bodied, ground-feeding bird, features that may have facilitated total-clade palaeognath survivorship through the K-Pg mass extinction, and which may bear on the ecological habits of the ancestral crown bird.
... The southern cassowary is endemic to the tropical rainforests of New Guinea and Australia [8,9]. It has a solitary nature [10] and a preference for dense forested habitats [11], hence relatively little is known about cassowary ecology in comparison to its extant relatives [12]. These gaps in knowledge extend to the phenotype: poorly studied structures in the cassowary include the syrinx, hyoid and larynx, despite morphological and comparative analyses of these structures in other palaeognaths, and their importance for primary biological functions and potentially phylogenetic inferences. ...
Full-text available
Preprint
Background: The Palaeognathae are a basal clade within Aves and include the large and flightless ratites and the smaller, volant tinamous. Although much research has been conducted on various aspects of palaeognath morphology, ecology, and evolutionary history, there are still areas which require investigation. This study aimed to fill gaps in our knowledge of the Southern Cassowary, Casuarius casuarius, for which information on the skeletal systems of the syrinx, hyoid and larynx is lacking - despite these structures having been recognised as performing key functional roles associated with vocalisation, respiration and feeding. Previous research into the syrinx and hyoid have also indicated these structures to be valuable for determining evolutionary relationships among neognath taxa, and thus suggest they would also be informative for palaeognath phylogenetic analyses, which still exhibits strong conflict between morphological and molecular trees. Results: The morphology of the syrinx, hyoid and larynx of C. casuarius is described from CT scans. The syrinx is of the simple tracheo-bronchial syrinx type, lacking specialised elements such as the pessulus; the hyoid is relatively short with longer ceratobranchials compared to epibranchials; and the larynx is comprised of entirely cartilaginous, standard avian anatomical elements including a concave, basin-like cricoid and fused cricoid wings. As in the larynx, both the syrinx and hyoid lack ossification and all three structures were most similar to Dromaius. We documented substantial variation across palaeognaths in the skeletal character states of the syrinx, hyoid, and larynx, using both the literature and novel observations (e.g. of C. casuarius). Notably, new synapomorphies linking Dinornithiformes and Tinamidae are identified, consistent with the molecular evidence for this clade. These shared morphological character traits include the ossification of the cricoid and arytenoid cartilages, and an additional cranial character, the articulation between the maxillary process of the nasal and the maxilla. Conclusion: Syrinx, hyoid and larynx characters of palaeognaths display greater concordance with molecular trees than do other morphological traits. These structures might therefore be less prone to homoplasy related to flightlessness and gigantism, compared to typical morphological traits emphasised in previous phylogenetic studies. Key Words: Palaeognathae, Cassowary, Syrinx, Hyoid, Larynx, Morphology, Phylogenetics, Optimisation
... An impressive sagittal crest occurs in the Veiled chameleon, Chamaeleo calyptratus, from the Arabian Peninsula, where it appears to play a role in display, becoming increasingly larger and developing elaborate stripes with age (Measey et al., 2009). In the Cassowary, the casque is used for resonating sound, and perhaps for visual display (Naish and Perron, 2014). In all these cases, the sagittal crest becomes large and more ornate during ontogeny. ...
Article
A new pterosaur, Afrotapejara zouhri gen. et sp. is described on the basis of a partial rostral fragment from the Cretaceous Kem Kem beds of Takmout, near Erfoud in southern Morocco. The taxon is distinguished from all other Tapejaridae on the possession of a dorsal expansion of the rostral margin a short distance from the rostral tip. Tapejarid features include a downturned rostrum (autapomorphic), edentuly, expansion of the rostral median crest (autapomorphic) and the presence of small foramina on the lateral margins and occlusal surface. The new specimen is the fourth edentulous pterosaur taxon from the Kem Kem beds and is the first unambiguous occurrence of Tapejaridae in Africa.
... The southern cassowary is endemic to the tropical rainforests of New Guinea and Australia [8,9]. It has a solitary nature [10] and a preference for dense forested habitats [11], hence relatively little is known about cassowary ecology in comparison to its extant relatives [12]. These gaps in knowledge extend to the phenotype: poorly studied structures in the cassowary include the syrinx, hyoid and larynx, despite morphological and comparative analyses of these structures in other palaeognaths, and their importance for primary biological functions and potentially phylogenetic inferences. ...
Full-text available
Article
Background: Palaeognathae is a basal clade within Aves and include the large and flightless ratites and the smaller, volant tinamous. Although much research has been conducted on various aspects of palaeognath morphology, ecology, and evolutionary history, there are still areas which require investigation. This study aimed to fill gaps in our knowledge of the Southern Cassowary, Casuarius casuarius, for which information on the skeletal systems of the syrinx, hyoid and larynx is lacking - despite these structures having been recognised as performing key functional roles associated with vocalisation, respiration and feeding. Previous research into the syrinx and hyoid have also indicated these structures to be valuable for determining evolutionary relationships among neognath taxa, and thus suggest they would also be informative for palaeognath phylogenetic analyses, which still exhibits strong conflict between morphological and molecular trees. Results: The morphology of the syrinx, hyoid and larynx of C. casuarius is described from CT scans. The syrinx is of the simple tracheo-bronchial syrinx type, lacking specialised elements such as the pessulus; the hyoid is relatively short with longer ceratobranchials compared to epibranchials; and the larynx is comprised of entirely cartilaginous, standard avian anatomical elements including a concave, basin-like cricoid and fused cricoid wings. As in the larynx, both the syrinx and hyoid lack ossification and all three structures were most similar to Dromaius. We documented substantial variation across palaeognaths in the skeletal character states of the syrinx, hyoid, and larynx, using both the literature and novel observations (e.g. of C. casuarius). Notably, new synapomorphies linking Dinornithiformes and Tinamidae are identified, consistent with the molecular evidence for this clade. These shared morphological character traits include the ossification of the cricoid and arytenoid cartilages, and an additional cranial character, the articulation between the maxillary process of the nasal and the maxilla. Conclusion: Syrinx, hyoid and larynx characters of palaeognaths display greater concordance with molecular trees than do other morphological traits. These structures might therefore be less prone to homoplasy related to flightlessness and gigantism, compared to typical morphological traits emphasised in previous phylogenetic studies.
Full-text available
Article
Bony cranial ornamentation is developed by many groups of vertebrates, including ankylosaur dinosaurs. To date, the morphology and ontogenetic origin of ankylosaurian cranial ornamentation has primarily focused on a limited number of species from only one of the two major lineages, Ankylosauridae. For members of the sister group Nodosauridae, less is known. Here, we provide new details of the cranial anatomy of the nodosaurid Hungarosaurus from the Santonian of Europe. Based on a number of previously described and newly identified fragmentary skulls and skull elements, we recognize three different size classes of Hungarosaurus . We interpret these size classes as representing different stages of ontogeny. Cranial ornamentation is already well-developed in the earliest ontogenetic stage represented herein, suggesting that the presence of outgrowths may have played a role in intra- and interspecific recognition. We find no evidence that cranial ornamentation in Hungarosaurus involves the contribution of coossified osteoderms. Instead, available evidence indicates that cranial ornamentation forms as a result of the elaboration of individual elements. Although individual differences and sexual dimorphism cannot be excluded, the observed variation in Hungarosaurus cranial ornamentation appears to be associated with ontogeny.
Preprint
The group Tapejaridae forms a clade of toothless pterosaurs easily recognized by their premaxillary sagittal crests and particularly large nasoantorbital fenestrae. The tapejarids represent the most representative group of pterosaurs from the Lower Cretaceous Crato Formation of the Araripe Basin (Northeastern Brazil). The holotype of the large tapejarid Tupandactylus imperator Campos and Kellner, 1997 is known by two main slabs from the New Olinda Member of the Crato Formation, however, only one of the slabs containing the sagittally bipartite skull is referred to the holotype of Tupandactylus imperator, remain the counter-slab be properly described. The cotype is fragmented in several broken pieces and presents a significative number of cranial elements. A medial internasal septum completely preserved inside the nasoantorbital fenestra is reported for the first time for pterosaurs. The exceptional preservation of a collagenous septum and other integumentary structures visible in the cotype specimen is extremely rare and supports the concept of the unusual pattern of soft tissue observed in the fossils from the Crato Konservat-Lagerstätte, specially pterosaurs. Herein is presented the description of the cotype of Tupandactylus imperator, in complementation to the previously designated slab of the holotype of this tapejarid species. The occurrence of casques in pterosaurs is supported by comparative anatomy with the bird galliform Pauxi (Cracidae). Besides that, it is discussed on the skull with extravagant cranial crests of Tupandactylus imperator and the significance of the associated soft tissues and other cranial integuments, which indicates an expressive morphological and taxonomic diversity among the tapejarid pterosaurs.
Full-text available
Article
Many ideas have been put forward for the adaptive value of the cassowary casque; and yet, its purpose remains speculative. Homeothermic animals elevate body temperature through metabolic heat production. Heat gain must be offset by heat loss to maintain internal temperatures within a range for optimal performance. Living in a tropical climate, cassowaries, being large bodied, dark feathered birds, are under thermal pressure to offload heat. We tested the original hypothesis that the casque acts as a thermal window. With infrared thermographic analyses of living cassowaries over an expansive range of ambient temperatures, we provide evidence that the casque acts as a thermal radiator, offloading heat at high temperatures and restricting heat loss at low temperatures. Interestingly, at intermediate temperatures, the casque appears thermally heterogeneous, with the posterior of the casque heating up before the front half. These findings might have implications for the function of similar structures in avian and non-avian dinosaurs.
Full-text available
Article
Although some birds can detect wavelengths in the infrasound range, there has been litle evidence that birds produce very low frequencies. We made nine recordings of a captive Dwarf Cassowary (Casuarius benneti) and one recording of a wild Southern Cassowary (C. casuarius) near Crater Mountain, Papua New Guinea. Both species produced sounds near the floor of the human hearing range in their pulsed booming notes: down to 32 Hz for C. casuarius and 23 Hz in C. benneti. Recordings of C. benneti indicate four levels of harmonics with the 23 Hz fundamental frequency. Such low frequencies are probably ideal for communication among widely dispersed, solitary cassowaries in dense rainforest. The discovery of very low-frequency communication by cassowaries creates new possibilities for studying those extremely secretive birds and for learning more about the evolution of avian vocalizations.
Full-text available
Article
Many conservationists argue that invasive species form one of the most important threats to ecosystems the world over, often spreading quickly through their new environments and jeopardising the conservation of native species. As such, it is important that reliable predictions can be made regarding the effects of new species on particular habitats. This book provides a critical appraisal of ecosystem theory using case studies of biological invasions in Australasia. Each chapter is built around a set of 11 central hypotheses from community ecology, which were mainly developed in North American or European contexts. The authors examine the hypotheses in the light of evidence from their particular species, testing their power in explaining the success or failure of invasion and accepting or rejecting each hypothesis as appropriate. The conclusions have far-reaching consequences for the utility of community ecology, suggesting a rejection of its predictive powers and a positive reappraisal of natural history.
Article
Because of confusion in depictions by J. G. Keulemans, Walter Rothschild's monograph on cassowaries wrongly illustrated and described Casuarius papuanus. The description and sketch referred in fact to C. Westermanni and this has led to over a century of incorrect nomenclature in scientific and other publications. A revision is proposed here.
Article
Bones of a tiny cassowary from late Pleistocene bog deposits in the Southern Highlands of New Guinea are indistinguishable from bones of Casuarius lydekkeri of unknown provenance. The relationship of these fossils to another small fossil cassowary from Pliocene sediments in the Bulolo area of New Guinea is unknown. All the fossil cassowary material is distinct from corresponding bones of extant cassowaries. Until more material is found it will be impossible to determine the relationship between the extinct and extant forms. -Authors