Assessment of allele-specific gene silencing by RNA interference with mutant and wild-type reporter alleles

Article (PDF Available)inJournal of RNAi and Gene Silencing 2(1):154-60 · February 2006with24 Reads
Source: PubMed
Abstract
Allele-specific gene silencing by RNA interference (RNAi) is therapeutically useful for specifically suppressing the expression of alleles associated with disease. To realize such allele-specific RNAi (ASPRNAi), the design and assessment of small interfering RNA (siRNA) duplexes conferring ASP-RNAi is vital, but is also difficult. Here, we show ASP-RNAi against the Swedish- and London-type amyloid precursor protein (APP) variants related to familial Alzheimer's disease using two reporter alleles encoding the Photinus and Renilla luciferase genes and carrying mutant and wild-type allelic sequences in their 3'-untranslated regions. We examined the effects of siRNA duplexes against the mutant alleles in allele-specific gene silencing and off-target silencing against the wild-type allele under heterozygous conditions, which were generated by cotransfecting the reporter alleles and siRNA duplexes into cultured human cells. Consistently, the siRNA duplexes determined to confer ASP-RNAi also inhibited the expression of the bona fide mutant APP and the production of either amyloid beta 40- or 42-peptide in Cos-7 cells expressing both the full-length Swedish- and wild-type APP alleles. The present data suggest that the system with reporter alleles may permit the preclinical assessment of siRNA duplexes conferring ASP-RNAi, and thus contribute to the design and selection of the most suitable of such siRNA duplexes.
© Ohnishi et al | Journal of RNAi and Gene Silencing | February 2006 | Vol 2, No 1 | 154-160 | OPEN ACCESS
154
NEW METHODS AND TECHNOLOGIES
Assessment of allele-specific gene silencing by RNA interference with mutant
and wild-type reporter alleles
Yusuke Ohnishi
1,2
, Katsushi Tokunaga
2
, Kiyotoshi Kaneko
1
and Hirohiko Hohjoh
1,
*
1
National Institute of Neuroscience, NCNP, 4-1-1 Ogawahigashi, Kodaira, Tokyo 187-8502, Japan;
2
Department of
Human Genetics, Graduate School of Medicine, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033,
Japan
*
Correspondence to: Hirohiko Hohjoh, Email: hohjohh@ncnp.go.jp, Tel: +81 42 342 2711, ext 5951, Fax: +81 42 346 1755
Journal of RNAi and Gene Silencing (2006), 2(1), 154-160
© Copyright Yusuke Ohnishi et al
(Received 06 February 2006; Accepted 13 February 2006; Available online 28 February 2006; Published 28 February 2006)
ABSTRACT
Allele-specific gene silencing by RNA interference (RNAi) is therapeutically useful for specifically
suppressing the expression of alleles associated with disease. To realize such allele-specific RNAi (ASP-
RNAi), the design and assessment of small interfering RNA (siRNA) duplexes conferring ASP-RNAi is
vital, but is also difficult. Here, we show ASP-RNAi against the Swedish- and London-type amyloid
precursor protein (APP) variants related to familial Alzheimer’s disease using two reporter alleles encoding
the Photinus and Renilla luciferase genes and carrying mutant and wild-type allelic sequences in their 3’-
untranslated regions. We examined the effects of siRNA duplexes against the mutant alleles in allele-specific
gene silencing and off-target silencing against the wild-type allele under heterozygous conditions, which
were generated by cotransfecting the reporter alleles and siRNA duplexes into cultured human cells.
Consistently, the siRNA duplexes determined to confer ASP-RNAi also inhibited the expression of the bona
fide mutant APP and the production of either amyloid β 40- or 42-peptide in Cos-7 cells expressing both the
full-length Swedish- and wild-type APP alleles. The present data suggest that the system with reporter alleles
may permit the preclinical assessment of siRNA duplexes conferring ASP-RNAi, and thus contribute to the
design and selection of the most suitable of such siRNA duplexes.
KEYWORDS: RNAi, allele-specific gene silencing, amyloid precursor protein, Swedish mutation, London
mutation, reporter allele
INTRODUCTION
RNA interference (RNAi) is a powerful tool for suppressing
the expression of a gene of interest (Dykxhoorn et al, 2003;
Meister and Tuschl, 2004; Mello and Conte, 2004). In
mammals, RNAi can be induced by direct introduction of
synthetic small interfering RNA (siRNA) duplexes into cells
or generation of siRNA duplexes using short-hairpin RNA
expression vectors and its application is expanding to
various fields of science; therapeutic use of RNAi in
medical science and pharmacogenesis is particularly
promising (Caplen, 2004; Dykxhoorn et al, 2003; Hannon
and Rossi, 2004; Karagiannis and El-Osta, 2005; Wood et
al, 2003). Allele-specific gene silencing by RNAi (allele-
specific RNAi: ASP-RNAi) is an advanced application of
RNAi techniques, by which the expression of an allele of
interest can be inhibited (Victor et al, 2002). Accordingly,
ASP-RNAi is thought to be therapeutically useful, i.e., it
can specifically suppress the expression of alleles causing
disease without inhibiting the expression of corresponding
wild-type alleles. To realize and control such ASP-RNAi,
the following issues must be addressed: selection of
competent siRNA duplexes that strongly induce ASP-
RNAi; and qualitative and quantitative evaluation of allele-
specific gene silencing.
In this article, we describe an easy assay system for
assessment of ASP-RNAi with mutant and wild-type
reporter alleles encoding the Photinus and Renilla
luciferase genes. Using the amyloid precursor protein
© Ohnishi et al | Journal of RNAi and Gene Silencing | February 2006 | Vol 2, No 1 | 154-160 | OPEN ACCESS
155
(APP) variants (the Swedish- and London-type variants)
related to familial Alzheimer’s disease (Goate et al, 1991;
Mullan et al, 1992) as model mutant alleles, we
determined the effects of siRNA duplexes against the
mutant APP on allele-specific silencing as well as off-
target silencing against the wild-type allele. The siRNA
duplexes having the potential to specifically suppress the
expression of the mutant reporter allele consistently
inhibited the expression of the bona fide mutant APP as
well as amyloid β 40- and 42-peptides in Cos-7 cells
expressing both the full-length Swedish- and wild-type
APP alleles. These observations suggest that the present
system could permit the selection of siRNA duplexes
having the potential to confer ASP-RNAi.
MATERIALS AND METHODS
Preparation of oligonucleotides
DNA and RNA oligonucleotides were obtained from
INVITROGEN and TAKARA, respectively. For
preparation of duplexes, sense- and antisense-stranded
oligonucleotides (20 µM each) were mixed and annealed
as described previously (Hohjoh, 2002). The sequences of
synthesized oligonucleotides are shown in Tables 1 and 2.
Non-silencing siRNA duplex (siControl; Qiagen) was used
as a negative control.
Cell culture
HeLa, T98G and Cos-7 cells were grown at 37°C in
Dulbecco’s modified Eagle’s medium (Wako) supplemented
with 10% fetal bovine serum (Sigma), 100 U/ml penicillin
and 100 µg/ml streptomycin (Sigma) in 5% CO
2
-humidified
chamber. T98G cells (Registry No. IFO50295) were
obtained from the Health Science Research Resources Bank.
Construction of reporter and expression plasmids
In order to construct plasmids carrying reporter alleles, the
phRL-TK (Promega) and pGL3-TK (Ohnishi et al., 2005)
plasmids encoding the Renilla and Photinus luciferase
genes, respectively, both of which were driven by the
same herpes simplex virus thymidine kinase (TK)
promoter, were digested with Xba I and Not I, and were
subjected to ligation with synthetic oligonucleotide
duplexes corresponding to the Swedish-, London- and
wild-type APP alleles (sequences of the oligonucleotides
used are indicated in Table 1). The resultant plasmids
carry allelic APP sequences in the 3’-untranslated regions
(UTRs) of the luciferase genes (Figure 1A). Expression
plasmids, pAPP695
WT
and pAPP695
SWE
encoding full-
length cDNAs of the wild- and Swedish-type APP alleles,
respectively, were kindly provided by Dr Tanahashi
(Tanahashi and Tabira, 2001).
Transfection and reporter assay
The day before transfection, cells were trypsinized, diluted
with fresh medium without antibiotics, and seeded into 24-
well culture plates (approximately 0.5 × 10
5
cells/well).
Cotransfection of synthetic siRNA duplexes with reporter
plasmids was carried out using Lipofectamine 2000
transfection reagent (Invitrogen) according to the
manufacturer’s instructions, and to each well, 0.24 µg (40
nM) of siRNA duplexes, 0.2 µg of pGL3-TK-backbone
plasmid, 0.05 µg of phRL-TK-backbone plasmid and 0.1
µg of pSV-β-Galactosidase control vector (Promega) were
applied. Twenty-four hours after transfection, cell lysate
was prepared and expression levels of luciferase and β-
Galactosidase were examined by the Dual-Luciferase
reporter assay system (Promega) and Beta-Glo assay
system (Promega), respectively, according to the
manufacturer’s instructions. In the case of transfection of
siRNA duplexes and expression plasmids (pAPP695
WT
and pAPP695
SWE
) into Cos-7 cells, 0.4 µg of each plasmid
and 0.24 µg of siRNA duplexes were applied. Forty-eight
hours after transfection, culture media was collected and
cell lysate was prepared.
Western blotting and ELISA
Culture media and cell lysate prepared from transfected
Cos-7 cells were examined by western blotting as described
previously (Lesne et al., 2003). Equal amounts of proteins
were separated by SDS-PAGE and electrophoretically
blotted onto PVDF membranes (Millipore). Membranes
were blocked for 1 h in blocking solution (5 % (v/w) fat-
free milk and 0.05 % (v/v) Tween-20 in PBS) and
Table 1. Synthetic DNA oligonucleotides
Name Sequence (5'---------------3')
ssAPPwt(Sw)
CTAGCATGCAGGAGATCTCTGAAGTGAAGATGGATGCAGAATTCCGACA
asAPPwt(Sw)
GGCCTGTCGGAATTCTGCATCCATCTTCACTTCAGAGATCTCCTGCATG
ssAPP(K670N-M671L)
CTAGCATGCAGGAGATCTCTGAAGTGAATCTGGATGCAGAATTCCGACA
asAPP(K670N-M671L)
GGCCTGTCGGAATTCTGCATCCAGATTCACTTCAGAGATCTCCTGCATG
ssAPPwt(Lo)
CTAGCATGCTGTCATAGCGACAGTGATCGTCATCACCTTGGTGATGCTGA
asAPPwt(Lo)
GGCCTCAGCATCACCAAGGTGATGACGATCACTGTCGCTATGACAGCATG
ssAPP(V717I )
CTAGCATGCTGTCATAGCGACAGTGATCATCATCACCTTGGTGATGCTGA
asAPP(V717I )
GGCCTCAGCATCACCAAGGTGATGATGATCACTGTCGCTATGACAGCATG
ssAPP(V717F )
CTAGCATGCTGTCATAGCGACAGTGATCTTCATCACCTTGGTGATGCTGA
asAPP(V717F )
GGCCTCAGCATCACCAAGGTGATGAAGATCACTGTCGCTATGACAGCATG
ssAPP(V717G)
CTAGCATGCTGTCATAGCGACAGTGATCGGCATCACCTTGGTGATGCTGA
asAPP(V717G )
GGCCTCAGCATCACCAAGGTGATGCCGATCACTGTCGCTATGACAGCATG
© Ohnishi et al | Journal of RNAi and Gene Silencing | February 2006 | Vol 2, No 1 | 154-160 | OPEN ACCESS
156
Table 2. Synthetic siRNAs used in this study. Sense- and
antisense-stranded siRNA elements are indicated by ‘-ss’ and ‘-
as’, respectively.
siRNAs against the Swedish APP mutant
Name Sequence (5'---------------3')
si(T7/C8)-ss
AGUGAAUCUGGAUGCAGAAUUU
si(T7/C8)-as
AUUCUGCAUCCAGAUUCACUUU
si(T8/C9)-ss
AAGUGAAUCUGGAUGCAGAAUU
si(T8/C9)-as
UUCUGCAUCCAGAUUCACUUUU
si(T9/C10)-ss
GAAGUGAAUCUGGAUGCAGAUU
si(T9/C10)-as
UCUGCAUCCAGAUUCACUUCUU
si(T10/C11)-ss
UGAAGUGAAUCUGGAUGCAGUU
si(T10/C11)-as
CUGCAUCCAGAUUCACUUCAUU
si(T11/C12)-ss
CUGAAGUGAAUCUGGAUGCAUU
si(T11/C12)-as
UGCAUCCAGAUUCACUUCAGUU
si(T12/C13)-ss
UCUGAAGUGAAUCUGGAUGCUU
si(T12/C13)-as
GCAUCCAGAUUCACUUCAGAUU
siRNAs against the London APP mutants
Name Sequence (5'---------------3')
si(A8)-ss
AGUGAUCAUCAUCACCUUGUU
si(A8)-as
CAAGGUGAUGAUGAUCACUUU
si(A9)-ss
CAGUGAUCAUCAUCACCUUUU
si(A9)-as
AAGGUGAUGAUGAUCACUGUU
si(A10)-ss
ACAGUGAUCAUCAUCACCUUU
si(A10)-as
AGGUGAUGAUGAUCACUGUUU
si(A11)-ss
GACAGUGAUCAUCAUCACCUU
si(A11)-as
GGUGAUGAUGAUCACUGUCUU
si(A12)-ss
CGACAGUGAUCAUCAUCACUU
si(A12)-as
GUGAUGAUGAUCACUGUCGUU
si(T8)-ss
AGUGAUCUUCAUCACCUUGUU
si(T8)-as
CAAGGUGAUGAAGAUCACUUU
si(T9)-ss
CAGUGAUCUUCAUCACCUUUU
si(T9)-as
AAGGUGAUGAAGAUCACUGUU
si(T10)-ss
ACAGUGAUCUUCAUCACCUUU
si(T10)-as
AGGUGAUGAAGAUCACUGUUU
si(T11)-ss
GACAGUGAUCUUCAUCACCUU
si(T11)-as
GGUGAUGAAGAUCACUGUCUU
si(T12)-ss
CGACAGUGAUCUUCAUCACUU
si(T12)-as
GUGAUGAAGAUCACUGUCGUU
si(G8)-ss
GUGAUCGGCAUCACCUUGGUU
si(G8)-as
CCAAGGUGAUGCCGAUCACUU
si(G9)-ss
AGUGAUCGGCAUCACCUUGUU
si(G9)-as
CAAGGUGAUGCCGAUCACUUU
si(G10)-ss
CAGUGAUCGGCAUCACCUUUU
si(G10)-as
AAGGUGAUGCCGAUCACUGUU
si(G11)-ss
ACAGUGAUCGGCAUCACCUUU
si(G11)-as
AGGUGAUGCCGAUCACUGUUU
si(G12)-ss
GACAGUGAUCGGCAUCACCUU
si(G12)-as
GGUGAUGCCGAUCACUGUCUU
were incubated with anti-APP antibody 22C11 (Chemicon) or
anti-α-tubulin antibody DM1A (Sigma) followed by washing
in PBS and further incubation with horseradish peroxidase-
conjugated donkey anti-mouse IgG (Jackson ImmunoResearch
Laboratories). Antigen-antibody complexes were visualized
using ECL chemiluminescent reagent (Amersham). Levels of
Aβ40 and Aβ42 production in culture media were examined by
human/rat β amyloid 40 and 42 ELISA kits (Wako) according
to the manufacturer’s instructions.
RT-PCR
Total RNA extraction, including treatment with DNase I
(Ambion) twice followed by reverse transcription, were
carried out as described previously (Sago et al., 2004). The
resultant cDNAs were examined by real-time (RT)-PCR
using the ABI PRISM 7300 sequence detection system
(Applied Biosystems) with a SYBER green PCR master
mix (Applied Biosystems) according to the manufacturer’s
instructions. PCR primers used were as follows:
For detection of the Renilla luciferase transcript:
renilla-F; 5’-GTTCTTTTCCAACGCTATTG-3’
renilla-R; 5’-GAAGCTCTTGATGTACTTAC-3’
For detection of the Photinus luciferase transcript:
photinus-F; 5’-TTTGATATGTGGATTTCGAG-3’
photinus-R; 5’-ATCGTATTTGTCAATCAGAG-3’
RESULTS
Assessment of siRNAs in heterozygous model system
In this study, the Swedish- and London-type mutants of the
APP gene, which are involved in familial Alzheimer’s
disease, were used as model mutant alleles. The Swedish-
and London-type APP mutants carry double and single
nucleotide substitutions, respectively, which are followed by
amino acid substitutions (K670N-M671L in the Swedish
APP; V717I, V717F or V717G in the London APP) (Goate
et al, 1991; Mullan et al, 1992). The resultant amino acid
sequences in the Swedish and London-type APPs are
preferably digested by β- and γ-secretase, respectively,
resulting in accumulation of Aβ40 and Aβ42 peptides,
which are the key factors of Alzheimer’s disease (Cai et al,
1993; Citron et al, 1992; Mattson, 2004; Suzuki et al, 1994).
Mutant and wild-type reporter alleles were constructed as
described in Materials and Methods. The resultant reporter
alleles (Figure 1A), synthetic siRNA duplex against the
mutant allele and the
β
-galactosidase gene (control) were
cotransfected into human cells. Note that the transfected
cells are artificially heterozygous with the mutant and wild-
type APP reporter alleles; thus, the effects of test siRNA
duplexes on suppression of both the mutant and wild-type
alleles can be simultaneously examined.
ASP-RNAi against the Swedish-type APP allele
When the Renilla and Photinus luciferase genes were
regarded as the Swedish and wild-type reporter alleles,
respectively, the effects of the si(T7/C8) - si(T12/C13)
duplexes against the Swedish mutant on allele-specific
gene silencing were examined in HeLa cells. The results
© Ohnishi et al | Journal of RNAi and Gene Silencing | February 2006 | Vol 2, No 1 | 154-160 | OPEN ACCESS
157
Figure 1. Assessment of ASP-RNAi with reporter alleles. (A)
Schematic drawing of reporter alleles. Reporter alleles were
constructed based on the Photinus and Renilla luciferase reporter
genes driven by the same TK promoter, and allelic sequences of
wild-type and mutant (synthetic oligonucleotides) were inserted
into the 3’-UTRs of the reporter genes, i.e., the reporter alleles
encode luciferase reporter genes carrying artificially inserted
allele sequences of interest. Assessment of siRNA duplexes on
the induction of ASP-RNAi against the Swedish APP mutant (B)
and against the London APP mutants (C-E) was carried out.
Synthetic siRNA duplexes against the mutants indicated were
cotransfected with the mutant and wild-type reporter alleles and
the
β
-galactosidase gene (control) into HeLa cells. The Photinus
and Renilla luciferase genes carry the mutant and wild-type
allelic sequences, respectively. Twenty-four hours after
transfection, dual-luciferase and β-galactosidase assays were
carried out. The levels of either Photinus (blue boxes) or Renilla
(pink boxes) luciferase activity was normalized against the levels
of β-galactosidase activity, and the ratios of mutant and wild-
type luciferase activities in the presence of siRNA duplexes were
normalized against the control ratio obtained in the presence of
the siControl duplex (siCont). Data are averages of at least three
independent determinations. Error bars represent standard
deviations.
are shown in Figure 1B. The siRNA duplexes, except for
the si(T12/C13) duplex, appeared to induce inhibition of
mutant (Photinus) allele expression, while little or moderate
inhibition of wild-type (Renilla) allele expression was seen,
suggesting that the siRNA duplexes were able to
discriminate the mutant reporter allele from the wild-type
reporter allele. The si(T12/C13) duplex appeared to yield
little or no RNAi activity. Considering the influence of the
siRNA duplexes on the expression of the wild-type allele,
the si(T8/C9) duplex appears to be the most suitable siRNA
duplex conferring ASP-RNAi against the mutant allele. As
for the si(T9/C10) and si(T11/12) duplexes inducing
moderate levels of inhibition of wild-type allele expression,
further analyses were carried out (Figure 4). Similar results
were also obtained when the luciferase genes were
exchanged between the mutant and wild-type reporter
alleles, i.e., the Photinus and Renilla luciferase genes
carried the wild-type and Swedish allele sequences,
respectively (data not shown). In addition, when T98G cells,
a human glioblastoma cell line, and Cos-7 cells were used
instead of HeLa cells, results similar to those obtained in
HeLa cells were observed (data not shown).
ASP-RNAi against London-type APP alleles
Because the London-type mutant possesses three types of
single nucleotide change involved in amino acid substitution
at position 717 (V717I, V717F and V717G), three mutant
reporter alleles and corresponding wild-type reporter allele
were constructed, and the effects of synthetic siRNA
duplexes against the London-type mutants on suppression of
the expression of either the target mutant allele or wild-type
allele were examined under the present system. As shown in
Figure 1C-E, various levels of gene silencing were observed
and some of the siRNA duplexes, si(T9) and si(T12) (Figure
1D), appeared to discriminate the mutant alleles from the
wild-type allele to some degree, resulting in ASP-RNAi;
however, the other siRNA duplexes examined yielded less
significant ASP-RNAi. Compared with the results for ASP-
RNAi against the Swedish allele (Figure 1B), the induction
and activation of ASP-RNAi against the London alleles
appeared to be inferior to those against the Swedish mutant.
Western blot analyses of wild-type and Swedish APP in
ASP-RNAi
We further investigated ASP-RNAi of siAPP duplexes
against the Swedish mutant with full-length cDNAs of the
Swedish and wild-type APP alleles, which were transiently
Inserted allelic sequences
0
0.2
0.4
0.6
0.8
1
1.2
1.4
siC
on
t
s
i(T7/C8)
si
(T
8
/C9)
s
i
(T
9
/C10)
si(
T
1
0
/C11
)
si(T11/C12)
s
i
(T12
/
C13
)
Photinus luc.
TK
Renilla luc.
TK
(A)
(B)
Norm.Luc/β-gal
V717F
0
0.2
0.4
0.6
0.8
1
1.2
1.4
siCon
t
s
i
(
T8
)
si(T
9
)
si(T10)
si(T11)
s
i
(T
1
2
)
V717I
0
0.2
0.4
0.6
0.8
1
1.2
1.4
siC
on
t
s
i
(A8
)
s
i
(
A9)
si(
A
1
0
)
si
(
A
11
)
si(A
12
)
V717G
0
0.2
0.4
0.6
0.8
1
1.2
1.4
siCont
si(G
8
)
si(G9)
s
i
(
G
1
0
)
si(G11)
si(
G
12)
Norm.Luc/β-gal
Norm.Luc/β-gal
Norm.Luc/β-gal
(C)
(D)
(E)
N670N-M671L
Inserted allelic sequences
0
0.2
0.4
0.6
0.8
1
1.2
1.4
siC
on
t
s
i(T7/C8)
si
(T
8
/C9)
s
i
(T
9
/C10)
si(
T
1
0
/C11
)
si(T11/C12)
s
i
(T12
/
C13
)
Photinus luc.
TK
Renilla luc.
TK
(A)
(B)
Norm.Luc/β-gal
V717F
0
0.2
0.4
0.6
0.8
1
1.2
1.4
siCon
t
s
i
(
T8
)
si(T
9
)
si(T10)
si(T11)
s
i
(T
1
2
)
V717I
0
0.2
0.4
0.6
0.8
1
1.2
1.4
siC
on
t
s
i
(A8
)
s
i
(
A9)
si(
A
1
0
)
si
(
A
11
)
si(A
12
)
V717G
0
0.2
0.4
0.6
0.8
1
1.2
1.4
siCont
si(G
8
)
si(G9)
s
i
(
G
1
0
)
si(G11)
si(
G
12)
Norm.Luc/β-gal
Norm.Luc/β-gal
Norm.Luc/β-gal
(C)
(D)
(E)
V717F
0
0.2
0.4
0.6
0.8
1
1.2
1.4
siCon
t
s
i
(
T8
)
si(T
9
)
si(T10)
si(T11)
s
i
(T
1
2
)
V717I
0
0.2
0.4
0.6
0.8
1
1.2
1.4
siC
on
t
s
i
(A8
)
s
i
(
A9)
si(
A
1
0
)
si
(
A
11
)
si(A
12
)
V717G
0
0.2
0.4
0.6
0.8
1
1.2
1.4
siCont
si(G
8
)
si(G9)
s
i
(
G
1
0
)
si(G11)
si(
G
12)
Norm.Luc/β-gal
Norm.Luc/β-gal
Norm.Luc/β-gal
(C)
(D)
(E)
N670N-M671L
© Ohnishi et al | Journal of RNAi and Gene Silencing | February 2006 | Vol 2, No 1 | 154-160 | OPEN ACCESS
158
expressed in Cos-7 cells. The pAPP695
SWE
and/or
pAPP695
WT
expression plasmids encoding full-length
cDNAs of the Swedish and wild-type APP alleles,
respectively, and siRNA duplexes targeting the Swedish
mutant were cotransfected into Cos-7 cells, and expression
of wild-type APP (APP
WT
) and Swedish APP (APP
SWE
)
was examined by Western blotting. As shown in Figure 2,
under homo(or hemi)zygous-like conditions, in which
either APP
WT
or APP
SWE
was expressed, the signal
intensity of sAPP
SWE
(secreted APP) and cAPP
SWE
(celluar
APP) was apparently decreased in the presence of the
si(T8/C9), si(T9/C10) and si(T11/C12) duplexes. In
contrast, signals for either sAPP
WT
or cAPP
WT
were
detected in the presence of any of the siRNA duplexes
examined, which is consistent with the data for the
reporter alleles described above. When APP
SWE
and
APP
WT
were both expressed in the cells (heterozygous-like
conditions), signals for APP were seen in the presence of
any of the siRNA duplexes. Based on the results under
homozygous-like conditions, the signals for APP in the
presence of the si(T8/C9), si(T9/C10) and si(T11/C12)
duplexes were most likely derived from APP
WT
.
Figure 2. Expression of APP
WT
and APP
SWE
polypeptides
under ASP-RNAi. Either the pAPP695
WT
(A) and
pAPP695
SWE
(B) expression plasmids or the plasmids (C)
together with the indicated siRNA duplexes against the
Swedish mutant were introduced into Cos-7 cells, and
expressed APP polypeptides in culture media (secreted APP:
sAPP) and in cells (cellar APP: cAPP) were examined by
Western blotting. Lane 1 (control) shows no transfected Cos-7
cells, in which endogenous APP is detectable. Lanes 2-9 are
cells transfected with expression plasmid(s), and lanes 3-9 are
cotransfected cells with the indicated siRNA duplexes.
Expression of α-tubulin (control) is also shown.
The utility of ASP-RNAi using the siRNA duplexes
assessed here in medical treatment can be demonstrated by
confirming a significant decrease in Aβ peptides, which
are a key factor in the development of Alzheimer’s disease
under heterozygous conditions expressing both APP
SWE
and APP
WT
. We thus determined the production levels of
Aβ40 and Aβ42 peptides by means of ELISA. As shown
in Figure 3, significant decreases in the production of
either Aβ40 or Aβ42 peptide by RNAi (Figure 3A-C) and
ASP-RNAi (Figure 3D-F) with the evaluated siRNA
duplexes, particularly si(T8/C9), si(T9/C10) and
si(T11/C12), was confirmed under homozygous and
heterozygous conditions, respectively. Therefore, these
results suggest the potential utility of such siRNA
duplexes as therapeutic agents.
DISCUSSION
While ASP-RNAi is believed to be a useful technique, to
realize and control ASP-RNAi, it is vital to design and
select competent siRNA duplexes conferring ASP-RNAi;
however, this is rather difficult without a procedure for
assessing such siRNA duplexes. The system we present
here could allow assessment, if designed siRNA duplexes
have the potential for specifically inhibiting the expression
of target alleles without suppressing the expression of
other alleles. From a series of experiments with the
Swedish- and London-type APP variants as model mutant
alleles, we were able to determine potential siRNA
duplexes for inducing ASP-RNAi. With regard to siRNA
duplexes targeting the Swedish mutant, we further
demonstrated that the si(T8/C9), si(T9/C10) and
si(T11/C12) siRNA duplexes were able to significantly
decrease the production of either Aβ40 or Aβ42 peptide in
Cos-7 cells expressing both the full-length Swedish- and
wild-type APP alleles. Accordingly, such competent
siRNA duplexes conferring ASP-RNAi against mutant
alleles likely hold utility as therapeutic agents.
In contrast to the Swedish mutant, there were difficulties in
suppressing the London-type mutants carrying single
nucleotide substitutions from the wild-type allele by ASP-
RNAi. The difference between ASP-RNAi activities against
the Swedish- and London-type mutants may have been
caused by the number of base substitutions: the former and
latter mutants carry double and single base substitutions,
respectively. Another important point to note in the results
for the London-type mutant is that different substitutions
showed different ASP-RNAi activities, suggesting that the
type of base change between the mutant and wild-type
alleles could influence ASP-RNAi. With regard to the
V717I (Figure 1C) and V717G (Figure 1E) mutants, a
possible wobble base pair between siRNA and the wild-type
mRNA (Du et al, 2005) and high GC content of siRNA
used(Ui-Tei et al, 2004), respectively, might have
negatively influenced the induction of ASP-RNAi; these
possibilities require further examination in the future.
To further progress ASP-RNAi, it is necessary to design
competent siRNA duplexes conferring strong allele-
specific gene silencing. Chemical modifications (Chiu and
Rana, 2003; Hall et al, 2004) and structural devices in
siRNAs are considered to be applicable for improving
c
o
n
t
r
o
l
n
o
s
i
R
N
A
s
i
C
o
n
t
s
i
(
T
7
/
C
8
)
s
i
(
T
8
/
C
9
)
s
i
(
T
9
/
C
1
0
)
s
i
(
T
1
0
/
C
1
1
)
s
i
(
T
1
1
/
C
1
2
)
sAPP
cAPP
Tubulin
sAPP
cAPP
Tubulin
sAPP
cAPP
Tubulin
s
i
(
T
1
2
/
C
1
3
)
1 2 3 4 5 6 7 8 9
(A)
(B)
(C)
c
o
n
t
r
o
l
n
o
s
i
R
N
A
s
i
C
o
n
t
s
i
(
T
7
/
C
8
)
s
i
(
T
8
/
C
9
)
s
i
(
T
9
/
C
1
0
)
s
i
(
T
1
0
/
C
1
1
)
s
i
(
T
1
1
/
C
1
2
)
sAPP
cAPP
Tubulin
sAPP
cAPP
Tubulin
sAPP
cAPP
Tubulin
s
i
(
T
1
2
/
C
1
3
)
1 2 3 4 5 6 7 8 9
(A)
(B)
(C)
© Ohnishi et al | Journal of RNAi and Gene Silencing | February 2006 | Vol 2, No 1 | 154-160 | OPEN ACCESS
159
ASP-RNAi, and assessment of such siRNAs is feasible
using the system we presented here. Altogether, it is
suggested that the present assay system may contribute to
the design and selection of the most suitable of siRNA
duplexes conferring ASP-RNAi.
Finally, we add data indicating the possible inhibition of
wild-type allele translation by the present siRNA duplexes.
Because si(T9/C10) and si(T11/C12) exhibited moderate
levels of inhibition of the expression of wild-type reporter
allele (Figure 1B), we further investigated RNA levels of
the wild-type allele by RT (real-time)-PCR. As shown in
Figure 4, the levels of RNA expression of the wild-type
allele in the presence of si(T9/C10) were similar to those
in the presence of siControl, suggesting the possible
inhibition of translation of the wild-type allele by the
si(T9/C10) duplex. This may be due to a microRNA-like
effect (Poy et al, 2004; Tang, 2005), and further study into
this possibility remains necessary. With regard to the
si(T11/C12) duplex, because a decrease trend in the levels
of wild-type allele transcript was seen, it is possible that
off-target gene silencing (Jackson et al, 2003) of the wild-
type allele may occur in the presence of the duplex.
Consequently, it is conceivable that the present system
could further contribute to studies into off-target gene
silencing and the function of microRNAs.
Figure 3. Production of Aβ40 and Aβ42 peptides under ASP-RNAi. The pAPP695
SWE
(A-C) plasmid and both the pAPP695
SWE
and
pAPP695
WT
(D-F) plasmids together with the indicated siRNA duplexes against the Swedish mutant were cotransfected into Cos-7 cells, and
expressed sAPP polypeptide and Aβ40 and Aβ42 peptides in culture media were examined by western blotting (A, D) and ELISA (B, C, E, F),
respectively. “Vectorindicates cells transfected with only plasmid(s). Endogenous and exogenous (expressed) sAPPs are indicated by asterisks
and arrow heads, respectively. ELISA data are averages of three independent determinations. Error bars represent standard deviations.
Figure 4. Possible translation inhibition and off-target silencing of wild-type reporter allele by siAPP duplexes. The si(T9/C10) or
si(T11/C12) duplexes against the Swedish mutant allele together with either wild or mutant reporter allele plasmid carrying Photinus
luciferase and the phRL-TK plasmid encoding Renilla luciferase (control) were introduced into HeLa cells. Twenty-four hours after
transfection, dual-luciferase assay and isolation of total RNA were carried out. Off-target (to wild-type reporter allele) (A) and on-
target (RNAi; to mutant reporter allele) (C) gene silencing were assessed based on luciferase activities. Ratios of normalized target
(Photinus) luciferase activity to control (Renilla) luciferase activity are indicated: the ratios of luciferase activity determined in the
presence of the si(T9/C10) or si(T11/C12) duplexes were normalized against the ratios obtained in the presence of the siControl
duplex (siCont). Isolated RNAs in (B) and (D) corresponding to (A) and (C), respectively, were subjected to reverse transcription to
SW (Aβ
1-40
)
0
5
10
15
20
25
(pmol/L)
0
v
ector
s
iCo
nt
s
i(T7/C8)
si(T8/C9)
s
i
(
T
9/C10)
s
i
(T10/C11)
s
i
(T11/C12)
si(
T
12/
C
13)
(pmol/L)
0
v
ector
s
iCon
t
s
i(
T
7/
C
8)
s
i
(T8/C9)
si
(
T
9
/C10)
s
i
(T10/C11)
s
i(
T
1
1/C12)
si
(
T
1
2/C13)
0
(B) (E)
vector
s
iC
ont
si(T7/
C
8)
s
i(T8/C9)
s
i(T9
/
C
10)
s
i
(T10/C11)
si(
T
11/
C
12)
s
i
(T12/C13)
vect
o
r
s
iCon
t
si(T7/C8)
s
i
(
T
8/C9)
si
(
T
9
/C10)
s
i(
T
1
0/C11)
s
i(T1
1/
C
12)
si(T12/C13)
vector
s
iC
on
t
si(T7/C8)
s
i(T
8
/C
9
)
si(T
9
/C
1
0)
si(T
1
0/C11)
s
i(T
1
1
/C
12
)
si(T12/C13)
(A)
(C)
(D)
(F)
* *
ve
c
to
r
siCont
si(T7/C8)
si(T8/C9)
si(T9/C10)
s
i(T
10/C
1
1)
si(T11/C12)
s
i(T
1
2
/C
13
)
WT/SW (Aβ
1-42
)
0.5
1
1.5
2
2.5
(pmol/L)
SW (Aβ
1-42
)
0.5
1
1.5
2
2.5
(pmol/L)
WT/SW (Aβ
1-40
)
5
10
15
20
SW (Aβ
1-40
)
0
5
10
15
20
25
(pmol/L)
0
v
ector
s
iCo
nt
s
i(T7/C8)
si(T8/C9)
s
i
(
T
9/C10)
s
i
(T10/C11)
s
i
(T11/C12)
si(
T
12/
C
13)
(pmol/L)
0
v
ector
s
iCon
t
s
i(
T
7/
C
8)
s
i
(T8/C9)
si
(
T
9
/C10)
s
i
(T10/C11)
s
i(
T
1
1/C12)
si
(
T
1
2/C13)
0
(B) (E)
vector
s
iC
ont
si(T7/
C
8)
s
i(T8/C9)
s
i(T9
/
C
10)
s
i
(T10/C11)
si(
T
11/
C
12)
s
i
(T12/C13)
vect
o
r
s
iCon
t
si(T7/C8)
s
i
(
T
8/C9)
si
(
T
9
/C10)
s
i(
T
1
0/C11)
s
i(T1
1/
C
12)
si(T12/C13)
vector
s
iC
on
t
si(T7/C8)
s
i(T
8
/C
9
)
si(T
9
/C
1
0)
si(T
1
0/C11)
s
i(T
1
1
/C
12
)
si(T12/C13)
(A)
(C)
(D)
(F)
* *
ve
c
to
r
siCont
si(T7/C8)
si(T8/C9)
si(T9/C10)
s
i(T
10/C
1
1)
si(T11/C12)
s
i(T
1
2
/C
13
)
WT/SW (Aβ
1-42
)
0.5
1
1.5
2
2.5
(pmol/L)
WT/SW (Aβ
1-42
)
0.5
1
1.5
2
2.5
(pmol/L)
SW (Aβ
1-42
)
0.5
1
1.5
2
2.5
(pmol/L)
WT/SW (Aβ
1-40
)
5
10
15
20
Photinus-WT Luc
0
0.25
0.5
0.75
1
1.25
1.5
siCont si(T9/C10) si(T11/C12)
Photinus-WT mRNA
0
0.25
0.5
0.75
1
1.25
1.5
siCont si(T9/C10) si(T11/C12)
(B)
(A)
Norm.Luc/Renilla-Luc
Norm.Luc/Renilla-mRNA
Photinus-SW Luc
0
0.25
0.5
0.75
1
1.25
1.5
siCont
si(T9/C10) si(T11/C12)
(C)
Norm.Luc/Renilla-Luc
Photinus-SW mRNA
0
0.25
0.5
0.75
1
1.25
1.5
siCont si(T9/C10) si(T11/C12)
Norm.Luc/Renilla-mRNA
(D)
Photinus-WT Luc
0
0.25
0.5
0.75
1
1.25
1.5
siCont si(T9/C10) si(T11/C12)
Photinus-WT mRNA
0
0.25
0.5
0.75
1
1.25
1.5
siCont si(T9/C10) si(T11/C12)
(B)
(A)
Norm.Luc/Renilla-Luc
Norm.Luc/Renilla-mRNA
Photinus-SW Luc
0
0.25
0.5
0.75
1
1.25
1.5
siCont
si(T9/C10) si(T11/C12)
(C)
Norm.Luc/Renilla-Luc
Photinus-SW mRNA
0
0.25
0.5
0.75
1
1.25
1.5
siCont si(T9/C10) si(T11/C12)
Norm.Luc/Renilla-mRNA
(D)
© Ohnishi et al | Journal of RNAi and Gene Silencing | February 2006 | Vol 2, No 1 | 154-160 | OPEN ACCESS
160
synthesize first-stranded cDNAs. The resultant cDNAs were examined by real-time PCR with specific primers for Photinus and
Renilla luciferase. RNA expression levels for Photinus luciferase are normalized against those of Renilla luciferase, and the ratios of
Photinus luciferase RNA expression levels in the presence of the si(T9/C10) or si(T11/C12) duplexes are normalized against the
ratios obtained in the presence of the siControl duplex. Data are averages of at least three independent determinations. Error bars
represent standard deviations.
CONCLUSIONS
The present assay system with wild-type- and mutant-
reporter alleles could permit assessment of siRNA
duplexes having the potential for specifically inhibiting the
expression of the mutant allele without inhibiting the
expression of the wild-type allele, and thus contribute to
the design and selection of siRNA duplexes suitable for
allele-specific gene silencing.
ACKNOWLEDGEMENTS
This work was supported in part by research grants from
the Ministry of Health, Labor, and Welfare in Japan and
by Promega KK. We would like to thank Dr. H.
Tanahashi for providing the pAPP695
SWE
and pAPP695
WT
plasmids and Drs. Y. Wang and K. Wada for providing
Cos-7 cells. We also thank Y. Tamura, T. Sakai, K. Omi
and Dr. A. Hasegawa for their helpful cooperation.
STATEMENT OF COMPETING INTERESTS
Corresponding author has a pending patent on the method
of this paper.
LIST OF ABBREVIATIONS
ASP-RNAi; Allele-specific RNA interference
APP; Amyloid precursor protein
TK; Thymidine kinase
UTR; Untranslated region
sAPP; Secreted APP
cAPP; Celluar APP
Aβ; Αmyloid β
REFERENCES
Cai XD, Golde TE and Younkin SG. 1993. Release of excess
amyloid beta protein from a mutant amyloid beta protein
precursor. Science, 259, 514-516.
Caplen NJ. 2004. Gene therapy progress and prospects.
Downregulating gene expression: the impact of RNA
interference. Gene Ther, 11, 1241-1248.
Chiu YL and Rana TM. 2003. siRNA function in RNAi: a
chemical modification analysis. RNA 9, 1034-1048.
Citron M, Oltersdorf T, Haass C et al. 1992. Mutation of the
beta-amyloid precursor protein in familial Alzheimer's disease
increases beta-protein production. Nature, 360, 672-674.
Du Q, Thonberg H, Wang J, Wahlestedt C and Liang Z. 2005. A
systematic analysis of the silencing effects of an active siRNA
at all single-nucleotide mismatched target sites. Nucleic Acids
Res 33, 1671-1677.
Dykxhoorn DM, Novina CD and Sharp PA. 2003. Killing the
messenger: short RNAs that silence gene expression. Nat Rev
Mol Cell Biol, 4, 457-467.
Goate A, Chartier-Harlin MC, Mullan M et al. 1991. Segregation
of a missense mutation in the amyloid precursor protein gene
with familial Alzheimer's disease. Nature, 349, 704-706.
Hall AH, Wan J, Shaughnessy EE, Ramsay Shaw B and Alexander KA.
2004. RNA interference using boranophosphate siRNAs: structure-
activity relationships. Nucleic Acids Res, 32, 5991-6000.
Hannon GJ and Rossi JJ. 2004. Unlocking the potential of the
human genome with RNA interference. Nature, 431, 371-378.
Hohjoh H. 2002. RNA interference (RNAi) induction with
various types of synthetic oligonucleotide duplexes in cultured
human cells. FEBS Lett, 521, 195-199.
Jackson AL, Bartz SR, Schelter J et al. 2003. Expression profiling reveals
off-target gene regulation by RNAi. Nat Biotechnol, 21, 635-637.
Karagiannis TC and El-Osta A. 2005. RNA interference and
potential therapeutic applications of short interfering RNAs.
Cancer Gene Ther, 12, 787-795.
Lesne S, Docagne F, Gabriel C et al. 2003. Transforming growth
factor-beta 1 potentiates amyloid-beta generation in astrocytes
and in transgenic mice. J Biol Chem, 278, 18408-18418.
Mattson, M. P. (2004). Pathways towards and away from
Alzheimer's disease. Nature 430, 631-639.
Meister G and Tuschl T. 2004. Mechanisms of gene silencing by
double-stranded RNA. Nature, 431, 343-349.
Mello CC and Conte D, Jr. 2004. Revealing the world of RNA
interference. Nature, 431, 338-342.
Mullan M, Crawford F, Axelman K et al. 1992. A pathogenic
mutation for probable Alzheimer's disease in the APP gene at
the N-terminus of beta-amyloid. Nat Genet, 1, 345-347.
Ohnishi Y, Tokunaga K and Hohjoh H. 2005. Influence of
assembly of siRNA elements into RNA-induced silencing
complex by fork-siRNA duplex carrying nucleotide mismatches
at the 3'- or 5'-end of the sense-stranded siRNA element.
Biochem Biophys Res Commun, 329, 516-521.
Poy MN, Eliasson L, Krutzfeldt J et al. 2004. A pancreatic islet-specific
microRNA regulates insulin secretion. Nature, 432, 226-230.
Sago N, Omi K, Tamura Y et al. 2004. RNAi induction and
activation in mammalian muscle cells where Dicer and eIF2C
translation initiation factors are barely expressed. Biochem
Biophys Res Commun, 319, 50-57.
Suzuki N, Cheung TT, Cai XD et al. 1994. An increased percentage of
long amyloid beta protein secreted by familial amyloid beta protein
precursor (beta APP717) mutants. Science, 264, 1336-1340.
Tanahashi H and Tabira T. 2001. Three novel alternatively
spliced isoforms of the human beta-site amyloid precursor
protein cleaving enzyme (BACE) and their effect on amyloid
beta-peptide production. Neurosci Lett, 307, 9-12.
Tang G. 2005. siRNA and miRNA: an insight into RISCs.
Trends Biochem Sci, 30, 106-114.
Ui-Tei K, Naito Y, Takahashi F et al. 2004. Guidelines for the
selection of highly effective siRNA sequences for mammalian
and chick RNA interference. Nucleic Acids Res, 32, 936-948.
Victor M, Bei Y, Gay F et al. 2002. HAT activity is essential for
CBP-1-dependent transcription and differentiation in
Caenorhabditis elegans. EMBO Rep, 3, 50-55.
Wood MJ, Trulzsch B, Abdelgany A and Beeson D. 2003.
Therapeutic gene silencing in the nervous system. Hum Mol
Genet, 12 Spec No 2, R279-284.
SHORT COPYRIGHT STATEMENT
This is an open access article, published under the terms of the
Licence for Users available at http://www.libpubmedia.co.uk/
RNAiJ/LicenceForUsers.pdf. This licence permits non-
commercial use, distribution and reproduction of the article,
provided the original work is appropriately acknowledged with
correct citation details.
    • "However, the differentiation of the allele's expression level on the basis of a single mismatch occurring within siRNA duplexes or RNA/DNA duplexes of SNP variants of RNA is not as obvious and simple as it might seem. Single mismatch was reported as a target for allele discrimination mostly with the use of RNA interference [39, 40, 42, 47,555657 . The data presented here showed that a single mismatch used in the tandem ASO oligonucleotide approach could be applied to the SNP-selective degradation of WT and Mut RNAs. "
    [Show abstract] [Hide abstract] ABSTRACT: Antisense oligonucleotides have been studied for many years as a tool for gene silencing. One of the most difficult cases of selective RNA silencing involves the alleles of single nucleotide polymorphisms, in which the allele sequence is differentiated by a single nucleotide. A new approach to improve the performance of allele selectivity for antisense oligonucleotides is proposed. It is based on the simultaneous application of two oligonucleotides. One is complementary to the mutated form of the targeted RNA and is able to activate RNase H to cleave the RNA. The other oligonucleotide, which is complementary to the wild type allele of the targeted RNA, is able to inhibit RNase H cleavage. Five types of SNPs, C/G, G/C, G/A, A/G, and C/U, were analyzed within the sequence context of genes associated with neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease, ALS (Amyotrophic Lateral Sclerosis), and Machado-Joseph disease. For most analyzed cases, the application of the tandem approach increased allele-selective RNA degradation 1.5-15 fold relative to the use of a single antisense oligonucleotide. The presented study proves that differentiation between single substitution is highly dependent on the nature of the SNP and surrounding nucleotides. These variables are crucial for determining the proper length of the inhibitor antisense oligonucleotide. In the tandem approach, the comparison of thermodynamic stability of the favorable duplexes WT RNA-inhibitor and Mut RNA-gapmer with the other possible duplexes allows for the evaluation of chances for the allele-selective degradation of RNA. A larger difference in thermodynamic stability between favorable duplexes and those that could possibly form, usually results in the better allele selectivity of RNA degradation.
    Full-text · Article · Nov 2015
    • "DNA oligonucleotides and siRNAs used in this study were synthesized by and purchased from Sigma-Aldrich (St Louis, MO, USA). Construction of reporter alleles, transfection and heterozygous reporter assay Construction of mutant and wild-type reporter alleles, transfections, and the in vitro assay using the reporter alleles were carried out as described previously [5, 11, 12, 15, 20]. The DNA oligonucleotide sequences of the target and non-target alleles used in the construction of the reporter alleles and the sequences of siRNAs examined are indicated in Supplementary Table S1 and S2. "
    [Show abstract] [Hide abstract] ABSTRACT: Allele-specific silencing by RNA interference (ASP-RNAi) is an atypical RNAi that is capable of discriminating target alleles from non-target alleles, and may be therapeutically useful for specific inhibition of disease-causing alleles without affecting their corresponding normal alleles. However, it is difficult to design and select small interfering RNA (siRNAs) that confer ASP-RNAi. A major problem is that there are few appropriate measures in determining optimal allele-specific siRNAs. Here we show two novel formulas for calculating a new measure of allele-discrimination, named "ASP-score". The formulas and ASP-score allow for an unbiased determination of optimal siRNAs, and may contribute to characterizing such allele-specific siRNAs.
    Full-text · Article · Jul 2014
    • "For verifying efficacy of siRNA, we used mouse NIH3T3 embryonic fibroblast cell line (35 mm diameter), in which endogenous Col6a1 expression was quite low. The luciferase-based reporter alleles in phRL-TK (Renila luciferase) and pGL3-TK (Photinus luciferase) plasmids were generated according to previous report.25 The wild-type or mutated 31-bp sequences which contain each upstream and downstream 15-bp sequences around a mutation site in COL6A1 were inserted into 3′-untranslated region of luciferase genes (Figure 1b). "
    [Show abstract] [Hide abstract] ABSTRACT: Ullrich congenital muscular dystrophy (UCMD) is an inherited muscle disorder characterized clinically by muscle weakness, distal joint hyperlaxity, and proximal joint contractures. Sporadic and recessive mutations in the three collagen VI genes, COL6A1, COL6A2, and COL6A3, are reported to be causative. In the sporadic forms, a heterozygous point mutation causing glycine substitution in the triple helical domain has been identified in higher rate. In this study, we examined the efficacy of siRNAs, which target point mutation site, on specific knockdown toward transcripts from mutant allele and evaluated consequent cellular phenotype of UCMD fibroblasts. We evaluated the effect of siRNAs targeted to silence-specific COL6A1 alleles in UCMD fibroblasts, where simultaneous expression of both wild-type and mutant collagen VI resulted in defective collagen localization. Addition of mutant-specific siRNAs allowed normal extracellular localization of collagen VI surrounding fibroblasts, suggesting selective inhibition of mutant collagen VI. Targeting the single-nucleotide COL6A1 c.850G>A (p.G284R) mutation responsible a sporadic autosomal dominant form of UCMD can potently and selectively block expression of mutant collagen VI. These results suggest that allele-specific knockdown of the mutant mRNA can potentially be considered as a therapeutic procedure in UCMD due to COL6A1 point mutations.
    Full-text · Article · Jun 2014
Show more

Recommended publications

Discover more