Article

The anti-leukaemic activity of novel synthetic naphthoquinones against acute myeloid leukaemia: Induction of cell death via the triggering of multiple signalling pathways

Institute of Haematology, Soroka University Medical Centre, Beer-Sheva, Israel.
British Journal of Haematology (Impact Factor: 4.71). 08/2009; 147(4):459-70. DOI: 10.1111/j.1365-2141.2009.07867.x
Source: PubMed

ABSTRACT

Naphthoquinones, such as menadione, display lower toxicity than anthracyclins used in cancer chemotherapy. Novel anti-leukaemic compounds comprised of chloro-amino-phenyl naphthoquinones with substitutions on the benzoic ring were developed. Structure-activity relationship studies indicated that the analogue with both methyl and amine substitutions (named TW-92) was the most efficient in killing leukaemic cells. Treatment of U-937 promonocytic cells with TW-92 induced apoptotic or necrotic cell death, dependent on incubation and dose conditions. TW-92 induced rapid phosphorylation of p38 mitogen-activated protein kinase (p38(MAPK)) and of extracellular signal-regulated protein kinases (ERK1/2). The generation of apoptosis was preceded by intracellular H(2)O(2) accumulation accompanied by glutathione depletion, the former inhibited by di-phenyl-iodonium (DPI), an inhibitor of NADPH oxidase. TW-92 induced swelling of isolated rat liver mitochondria, indicative of a direct effect on mitochondria. Apoptosis in intact cells was accompanied by a decrease in mitochondrial membrane potential, cytochrome c release and caspase activation. In addition, the level of Mcl-1, an anti-apoptotic regulatory protein, was down-regulated, whereas the expression of the pro-apoptotic BAX was elevated. Finally, TW-92 exerted strong pro-apoptotic and necrotic effects in primary acute myeloid leukaemia samples when given in submicromolar concentrations. Together, these findings demonstrate that TW-92 may provide an effective anti-leukaemic strategy.

Full-text

Available from: Yossf Granot, Oct 17, 2014
The anti-leukaemic activity of novel synthetic naphthoquinones
against acute myeloid leukaemia: induction of cell death via the
triggering of multiple signalling pathways
New therapeutic strategies aimed at eliminating leukaemic
cells often involve the activation of apoptosis. Actively
proliferating human myeloid leukaemic cells are, however,
variably resistant to the apoptosis induced by ionising
radiation or chemotherapeutic drugs (Hannun, 1997; Dash &
Gilliland, 2001). As such, the search for candidate compounds
that may interact with molecular targets specific for leukaemic
cells remains ongoing.
Certain natural and synthetic quinoid compounds bearing
one [benzoquinones (BQs)], two [naphthoquinones (NQs)] or
three benzoic rings (anthraquinones), and their derivatives,
display bioreductive and alkylating activity and thus serve as
anti-tumour agents (Lin et al, 1973, 1975; Thomson, 1987).
Indeed, quinones are the most clinically-used anti-cancer drugs
in the United States. The cytotoxicity of quinones may be due
to two competing mechanisms, namely, soft electrophilic
arylation and redox cycling oxidation (Monks et al, 1992).
Most quinone anti-tumour drugs present complex chemical
structures, containing different active functional groups. Thus,
cytotoxic effects may be mediated by a variety of mechanisms,
with the exact contribution of the quinone group to anti-
tumour activity remaining uncertain. (Powis, 1989; Myers et al,
1990; Qiu et al, 1998). Among the various quinone drugs, the
anthacyclines, doxorubicin, daunorubicin, mitomycin C, as
well as BQ derivatives, play a prominent role in cancer
chemotherapy (Schultz et al, 1997). The naphthoquinones,
Maher Hallak,
1,2
Thida Win,
6
Ofer
Shpilberg,
4
Shmuel Bittner,
3
Yosef
Granot,
5
Itai Levy
1
and Ilana Nathan
1,2
1
Institute of Haematology, Soroka University
Medical Centre,
2
Department of Clinical
Biochemistry,
3
Department of Chemistry,
Ben-Gurion University of the Negev, Beer Sheva,
4
Rabin Medical Centre, Beilinson Campus, Petah
Tikva,
5
Department of Life Sciences, Ben-Gurion
University of the Negev, Beer Sheva, Israel, and
6
Kyaukse University, Kyaukse, Myanmar
Received 5 May 2009; accepted for
publication 17 July 2009
Correspondence: Professor Ilana Nathan,
Department of Clinical Biochemistry,
Ben-Gurion University of the Negev, Beer-Sheva
84101, Israel. E-mail: nathan@bgu.ac.il
Summary
Naphthoquinones, such as menadione, display lower toxicity than
anthracyclins used in cancer chemotherapy. Novel ant i-leukaemic
compounds comprised of chloro-amino-phenyl naphthoquinones with
substitutions on the benzoic ring were developed. Structure–activity
relationship studies indicated that the analog ue with both methyl and
amine substitutions (named TW-92) was the most efficient in killing
leukaemic cells. Treatment of U-937 promonocytic cells with TW-92 induced
apoptotic or necrotic cell death, dependent on incubation and dose
conditions. TW- 92 induced rapid phosphorylati on of p38 mitogen-
activated protein kinase (p38
MAPK
) and of extracellular signal-regulated
protein kinases (ERK1/2). The generation of apoptosis was preceded by
intracellular H
2
O
2
accumulation accompanied by glutathione depletion, the
former inhibited by di-phenyl-iodonium (DPI), an inhibitor of NADPH
oxidase. TW-92 induced swelli ng of isolated rat liver mitochondria, indicative
of a direct effect on mitochondria. Apoptosis in intact cells was accompanied
by a decrease in mitochondrial membrane potential, cy tochrome c release
and caspase activation. In addition, the level of Mcl-1, an anti-apoptotic
regulatory protein, was down-regulated, whereas the expression of the
pro-apoptotic BAX was elevated. Finally, TW-92 exerted strong pro-apoptotic
and necrotic effects in primary acute myeloid leukaemia samples when given
in submicromolar concentrations. Together, these findings demonstrate that
TW-92 may provide an effective anti-leukaemic strategy.
Keywords: apoptosis, mitogen-activated protein kinases, mitochondria,
reactive oxygen species, TW-92.
research paper
First published online 31 August 2009
ª 2009 Blackwell Publishing Ltd, British Journal of Haematology, 147, 459–470 doi:10.1111/j.1365-2141.2009.07867.x
Page 1
present in a quinoid structure with two rings, include
menadione (2-methyl-1,4-naphthoquinone), also known as
vitamin K3. Given its broad range of anti-tumour activities in
human cells and a toxicity lower than that of doxorubicin,
daunorubicin or mitomycin C, menadione has attracted the
attention of numerous investigators.
Most cytotoxic drugs used in the treatment of haematolog-
ical malignancies eliminate leukaemic cells via the induction of
apoptosis. One of the major apoptotic signalling pathways
involves the mitochondria-dependent pathway (i.e. the intrin-
sic pathway), responding to extracellular cues and internal
insults, such as DNA damage. The Bcl-2 family of proteins plays
a central role in the regulation of this pathway. Pro-apoptotic
members of the Bcl-2 family, such as BAX, translocate from the
cytosol to mitochondria, leading to the release of cytochrome c
into the cytosol (Liu et al, 1996). On the other hand,
anti-apoptotic Bcl-2 family members inhibit apoptosis by
dimerizing with pro-apoptotic proteins. Among the latter,
Bcl-2 and Mcl-1 have been intensively studied with regard to
their ability to induce chemo-resistance in acute myeloid
leukaemia (AML) (O’Gormon & Cotter, 2001; Guzman et al,
2002). Another family of signalling molecules involved in the
regulation of stress response and apoptosis is composed of the
extracellular signal-regulated kinases (ERK 1/2). The p-38
mitogen-activated protein kinases (MAPKs) are also often
associated with apoptosis (Chen et al, 1986; Raingeaud et al,
1995; Juo et al, 1997; Seimiya et al, 1997; Franklin et al, 1998;
Wang et al, 1998; Von Knethen et al, 1999).
In an attempt to improve current therapeutic strategies for
leukaemia, we studied the in vitro effects of newly-synthesized
naphthoquinone compounds on myeloid leukaemic U937
cells and defined their modes of action. The novel com-
pounds correspond to 2-chloro, -3-amino-phenyl-1, 4 naph-
thoquinone derivatives, with various substitutions at the R3
and R4 positions of the amino phenyl ring. The current study
have investigated the anti-leukaemic effects of one of these
novel naphthoquinones, TW-92, addressing the signalling
pathways it affects leading to cell death, including reactive
oxygen species (ROS) formation, and its challenge to the
balance between pro- and anti-apoptotic proteins, factors that
ultimately coordinate the activation of the mitochondrial
death pathway.
Materials and methods
Chemicals, cell culture and treatments
2-chloro-3-(3-amino-4-methyl-phenylamino)-1,4-naphtho-
quinone (TW-92), was synthesized as follows: 2,3-dichloro-1,4-
naphthoquinone (1Æ0g, 4Æ4 mmol) and 2,4-diaminotoluene
(1Æ07 g, 8Æ8 mmol) were dissolved in 150 ml of ethanol, the
mixture was then stirred at room temperature for 16 h and the
solvent was evaporated under reduced pressure. The crude
residue was washed with 40 ml of cold dichloromethane and
some insoluble impurities were filtered off. Evaporation of the
solvent under reduced pressure yielded a dark solid (52% yield)
which was recrystallized from CH
3
CN to afford pure dark red
crystals of the product, melting at 201–202C.
1
H nuclear
magnetic resonance (NMR): [200 MHz, dimethyl sulfoxide
(DMSO)- d
6
]2Æ04 (s, 3H); 6Æ28 (dd, 1H, J =2Æ2 Hz); 6Æ39
(d, 1H, J =2Æ0 Hz); 6Æ84 (d, 1H, J =7Æ8 Hz); 7Æ8 (dqt, 1H,
1Æ9 Hz); 8Æ01 (d, 1H, J =1Æ9, 7Æ4 Hz); 8Æ06 (d, 1H, J =2Æ0,
7Æ0 Hz). HPLC proved purity to be 99Æ4%.
In parallel, a series of 2-chloro-3-amino-phenyl 1,4-naph-
thoquinone derivatives with substitutions on the phenyl ring
were synthesized. In these compounds, different substituents
were positioned on the amino-phenyl ring. Specifically, in the
different naphthoquinones, substitutions were made at the R
position of the naphthoquinone group and/or at the R¢
position of the amino-phenyl ring. In compounds TW-69,
TW-53, and TW-92, a halogen group (Cl) was introduced at
the R position of the naphthoquinones. In compound TW-
69, a methyl group was attached to the R¢ position of the
amino-phenyl ring, while in TW-53, an amide group was
added at this position. In TW-92, both R¢ modifications were
performed. The synthetic chloro-amino-phenyl-naphtho-
quinone analogue (TW-92) was dissolved in DMSO as a
stock solution of 20 mmol/l and stored at )20C. Working
solutions were also prepared in DMSO and diluted in
phosphate-buffered saline (PBS) before being added directly
to cell culture medium. Suspension cultures of the human
monoblastic leukaemia cell line (U937), obtained from
patients with diffuse histocytic lymphomas, were grown in
RPMI 1640 medium, (Gibco BRL, Gaithersburg, MD, USA),
containing 10% fetal bovine serum (FBS) (Hyclone Labora-
tories, Logan, UT, USA), 100 i/u per ml penicillin, and
100 lg/ml streptomycin in a humidified 5% CO
2
environ-
ment at 37C at a density of 3 · 10
5
cells/ml, in the presence
or absence of various concentrations of TW-92. Appropriate
amounts of DMSO (final concentration, 0Æ1%) were included
in control experiments.
Dichlorodihydrofluorescein diacetate (DCFH-DA) and 3,3¢-
dihehexylcarbocyanine iodide (DiOC
6
) were obtained from
Molecular Probes (Eugene, OR, USA). The MAPK inhibitors,
SB203580 and PD98059, and the caspase-3-specific inhibitor,
DEVD-CHO, were obtained from Calbiochem-Novabiochem
(La Jolla, CA, USA). Antibodies against MAPKs, namely anti-
human total antibodies as well as anti-phospho p38
MAPK
/
ERK1/2 p44/42
MAPK
(Thr
202
/Tyr
204
) antibodies, were pur-
chased from Calbiochem (Aharonovitz et al, 1998; Levy &
Granot, 2006; Dvir et al, 2007). Anti-human polyclonal
procaspase 3/9 antibodies were obtained from Pharmingen
(San Diego, CA, USA). Polyclonal anti-Mcl-1 and anti-human
actin antibodies were obtained from Santa Cruz Biotechnology
Inc., Santa Cruz, CA, USA.
Determination of cell viability, apoptosis and necrosis
Cell viability analysis of U937 cells was performed using a
commercial colorimetric assay relying on a XTT tetrazoluim
M. Hallak et al
460
ª 2009 Blackwell Publishing Ltd, British Journal of Haematology, 147, 459–470
Page 2
assay. Data are expressed as the mean percentage of three
replicates, normalized to the untreated control. Cell counts
were determined using trypan blue dye exclusion stain and a
hematocytometer. For determination of apoptosis, cells were
harvested (650 g, 7 min) and stained with acridine orange/
ethiduim bromide at a final concentration of 0Æ05 mg/ml. The
death mode for each cell was verified using fluorescence
microscopy. Apoptotic cell death was also assessed by quan-
tification of those cells containing hypo-diploid DNA. Cells
were fixed using 70% ethanol/saline and kept for 1 week at
)20C. The cells were collected, pelleted, washed twice with
PBS, treated with 0Æ5 ml RNase-free DNase (50 mg/ml) and
0Æ2% Triton X-100, and kept on ice for 5 h. The proportion of
cells containing hypodiploid DNA was assessed by flow
cytometry after staining with propiduim iodide (0Æ 05 mg/ml)
(Hayon et al, 2003). Cell debris was considered as the material
yielding signals in the lowest 10% range of fluorescence and
were eliminated from subsequent analysis. SB203580 and
PD98059 were dissolved in DMSO as 40 mmol/l stock
solution and used to pre-treat U-937 cells at a 10 lmol/l final
concentration for 1 h prior to incubation with the naphtho-
quinone compound for an additional 24 h.
Measurement of hydrogen peroxide and mitochondrial
transmembrane potential
The intracellular H
2
O
2
concentration was measured by use of a
fluorescent dye, DCFH-DA, which can be converted to DCFH by
an esterase when taken up by the cell. DCFH reacts with ROS to
produce the highly fluorescent compound, dichlorofluorescein,
which can be detected by flow cytometry. Cells were thus
incubated with DCFH-DA (5 lmol/l) at 37C for 30 min, and
then measured using fluorescent-activated cell sorting
(FACS). To evaluate the mitochondrial transmembrane poten-
tial (Dw
m
), naphthoquinone-treated as well as untreated cells
were washed with PBS and then incubated with PBS containing
3-3¢ dihexycarbocyanine iodide (DiOC
6
) (40 nmol/l) for
20 min at room temperature. After washing with PBS, the cells
were resuspended in PBS and the percentage of cells exhibiting
a decreased level of DiOC
6
, reflecting a loss of Dw
m
, was
determined using flow cytometry.
Mitochondrial preparation and swelling studies
Mitochondria were isolated from the livers of male Wistar rats
(200–300 g) (Harlan Labs, Jerusalem, Israel) by differential
centrifugation, as described previously (Hallak et al, 2008).
Quantification of cellular glutathione levels
Glutathione (GSH) levels in the cell were measured using a
glutathione assay. Briefly, cells were exposed to TW-92 for
various intervals, pelleted by centrifugation and homogenised
by sonication in cold buffer (50 mmol/l phosphate, 1 mmol/l
EDTA, pH 6–7). Cell lysates were centrifuged at 10 000 g for
20 min, and the protein content of the supernatant was
determined by the Bradford assay, with bovine serum albumin
as standard. Sample protein levels were made equivalent
upon dilution with phosphate buffer and then subjected to
GSH estimation spectrophotometrically upon reaction with
5,5¢-dithiobis-(2-nitrobenzoic acid) (DTNB) at 405 nm, as
compared to a GSH standard.
Isolation and purification of normal and AML peripheral
blood mononuclear cells
Peripheral blood lymphocytes from three AML patients and
two healthy donors were obtained from Haemato–Oncology
Department of the Soroka University Medical Centre, Israel.
The in vitro study of cells from patients with newly diagnosed
AML was subject to the standard clinical and laboratory
criteria of a high (>60%) blast count. Leukaemic cells were
phenotyped for cell surface markers by flow cytometry. Blood
was collected into tubes containing EDTA, layered onto a 1:1
(v/v) Ficoll/Hypaque (Seromed, Berlin, Germany) gradient.
Peripheral blood mononuclear cells (PBMC) were isolated by
centrifugation at 150 g for 30 min, suspended and diluted in
RPMI-1640 medium to a concentration of 1 · 10
6
cells/ml.
Immunoblot assay
After the indicated periods of incubation with TW-92, U937
cells were collected and washed with cold PBS. For analysis of
cytochrome c, cells were lysed in Buffer A [20 mmol/l Tris–
HCl (pH 7Æ4), 150 mmol/l KCl, 1 mmol/l EDTA, 1 mmol/l
EGTA, 100 mmol/l MgCl
2
, 1 mmol/l DTT, 150 mmol/l
Sucrose] using a B-pestle homogenizer and 150 strokes, after
which the lysates were centrifuged at 12 000 g for 30 min. The
supernatant, consisting of the cytosolic fraction, was collected,
while the pellet, containing the mitochondrial fraction, was
resuspended in an equal volume of Buffer A. For analysis
of caspase activity, (1 · 10
7
) cells were disrupted in radio-
immunoprecipitation assay buffer for 30 min and extracts
were collected by centrifugation at 15 000 g for 30 min. For
analysis of protein phosphorylation, 1 mmol/l each of Na
vanadate and Na pyrophosphate were added to 1 · sample
buffer. An equal volume of 5 · sample buffer was added to the
reaction mixture, and the sample was boiled for 5 min. Equal
amounts of protein (40 lg) were separated by 15% sodium
dodecyl sulphate polyacrylamide gel electrophoresis (SDS–
PAGE).
Total RNA extraction and cDNA synthes is
After incubation with naphthoquinone for 1–3 h, cells were
washed with RPMI buffer and total RNA was extracted using
a MasterPure RNA purification kit (Epicentre Technolo-
gies, Madison, WI, USA), according to the manufacturer’s
protocol. Total RNA was eluted with 30 ll Tris–EDTA buffer
containing diethylpyocarbonate (DEPC) water with RNase
TW-92 Induces Apoptosis in AML
ª 2009 Blackwell Publishing Ltd, British Journal of Haematology, 147, 459–470 461
Page 3
inhibitor. Total RNA (1 lg) was determined spectrophoto-
metically. Total RNA from each sample was heated to 60Cin
a water bath for 10 min and then cooled on ice for 2 min.
Complementary DNA (cDNA) was synthesized from 1 lgof
total RNA, using 0Æ5 lg oligo (dT) primers SuperScript First-
Strand Synthesis kit (Promega, Madison, WI, USA).
Real-time quantitat ive reverse transcriptase -polymerase
chain reaction (RT-PCR) assay
Real time RT-PCR was performed using the following
primer sets: BAX reverse (GTCAGAAATGGGTTTCCCAGTTT
CAG) and forward (AGAGCACAGCTTTTTCAAAGGTGTTG),
ACTB reverse (GTAGTTTCGTGGATGCCACA) and forward
(TCCCTGGAGAAGAGCTACG). Primers were designed using
the oligo computer programme, based on the published cDNA
structure of the genes obtained from Genebank. PCRs were
performed in triplicate in 20 ll reaction volumes using 1Æ5 ll
cDNA 1 · SYBER Green master mix (ABgene, Epsom, UK),
and 5 pmol of each primer. The PCR conditions used were:
Incubation at 50C for 2 min, denaturation at 95C for 10 min,
35 cycles of 15 s at 95C, and 61C for 1 min. Gene expression
was quantified using the comparative C
T
method of relative
quantification, using 7500 system sds software (Applied
Biosystems, Foster City, CA, USA). The mean fold changes,
of three replicates plus or minus standard error of the mean
(SEM), were calculated.
Quantification of gene expression
Standard curves for determining BAX and ACTB RNA levels
were generated using serial dilutions (10
)3
–10
)8
) of RNA
derived from U937 cell line. ACTB transcripts were monitored
as a control to quantify tested gene transcripts levels. BAX
expression levels were normalized with respect to actin
transcription levels and expressed as the ratio of BAX to
ACTB RNA levels.
Statistical analysis
Results are expressed as mean of ±SEM of three experiments,
performed in duplicate. The significance of differences
obtained between tested experimental conditions was deter-
mined using the two-tailed Student’s t-test and Prism version
3.0 software (Graph Pad software, San Diego, CA, USA).
P values <0Æ05 were considered significant: *P value <0Æ05,
**P value <0Æ 01 and ***P value <0Æ001.
Results
TW-92 decreases viability and induces cell death in U937
leukaemic cells
The effects of three naphthoquinones, differing in terms of
substitutions on the phenyl moiety, on the viability of cells of
the U937 human promonocytic leukaemic cell line were
studied. Compound TW-92, comprising a methyl group at the
para (p) position and an amino group at the meta (m)
position, was more active than the two other naphthoquinones
tested, i.e., TW-69 and TW-53, each presenting either of the
substitutions found in TW-92 (Fig 1). Among the two single
substituted compounds, TW-53 was found to be more active
than TW-69 (Fig 2A), indicating that the amino substituent at
the (m) position conferred better cytotoxic activity. The results
indicated a strong reduction in cell viability upon treatment
with 3 lmol/l TW-92 for 72 h, as evaluated by the XTT
tetrazoluim assay. The effect of TW-92 on cell viability was
further confirmed by trypan blue dye exclusion (data not
shown).
Given the efficacy of TW-92, we investigated its mode of
action. The effect of TW-92 was compared to that of the
parental compound, menadione. The results show the TW-92
compound to be several-fold more active than menadione,
which lacks the substituted benzoic ring found in TW-92
(Fig 2A). Kinetics studies revealed that TW-92 was effective
within 24 h of application (Fig 2B). To investigate whether
the reduction in cell viability was caused by cell death,
acridine orange/ethiduim bromide staining was used to
morphologically assess the percentage of apoptotic cells with
condensed fragmented nuclei, as compared to control cells
under the same incubation conditions. The results indicate
that TW-92 (3 lmol/l) caused cell death mainly via apopto-
sis, with dead cells being identified by the presence of
apoptotic bodies. Nevertheless, a small population of necrotic
cells was also observed (Fig 3C). In addition, following cell
staining with propidium iodide (PI) and cell cycle phase
analysis, a hypoploid sub-G1 peak was evident after treatment
with 3 lmol/l TW-92 for 24 h (Fig 3B). The results thus
indicate that TW-92 induces cell death at micromolar
concentrations. The Effect of TW-92 was also studied on
other transformed cell lines, such as HL-60 and K562 cells. At
a similar concentration as used with U937 cells, TW-92
elicited a mixed form of cell death in HL-60 cells. No effect,
however, was seen with K562 cells. At higher concentrations,
(A) (B)
Fig 1. Molecular formulas. (A) General structure of naphthoquinones,
(B) The structure of para-and meta-methyl-amino-chloro naphtho-
quinone compounds tested for cell death induction in U-937 cells.
M. Hallak et al
462
ª 2009 Blackwell Publishing Ltd, British Journal of Haematology, 147, 459–470
Page 4
necrosis dominated. Under the same growth conditions, in
the presence of 10 lmol/l of TW-92, cell death of breast
cancer MCF-7 as well as cervical cancer HeLa cells was
observed (data not shown). Nevertheless, our mechanistic
studies were performed with U937 cells since in these cells,
optimal separation of cells experiencing apoptosis from
necrosis was obtained.
It has been suggested that naphthoquinones display strong
oxidizing activity. To examine the role of ROS in TW-92-
mediated cell death, the effects of the anti-oxidants, N-acetyl
cysteine (NAC) and vitamin E, on TW-92-induced apoptosis
were studied. As shown in Fig 3D, the apoptosis induced by
TW-92 was inhibited in the presence of both anti-oxidants,
indicating that ROS formed as a result of TW-92 treatment
might serve as important regulators of TW-92-mediated cell
death. Finally, the idea that TW-92 evoked the apoptotic mode
of cell death was further supported by the use of a caspase-3-
specific inhibitor (DEVD-CHO), which afforded protection
against apoptotic but not necrotic cell death upon TW-92
treatment (Fig 3E).
Exposure of leukaemic cells to TW-92 results in a marked
increase in ROS-dependent cell death
To further evaluate the signalling that leads to cell death and in
light of the results showing inhibition of apoptosis by
treatment with anti-oxidants, ROS generation by U937 cells
in response to TW-92 was studied. For this, a fluorescent cell
sorting method using C-DCFH-DA as a probe to detect the
intracellular production of peroxides was employed. As shown
in Fig 4A, TW-92-treated cells showed a significant increase in
fluorescence intensity as early as 1 min after the onset of
treatment and which peaked after 5 min. The increase in
intracellular ROS was suppressed by dephenylene iodonium
(DPI), an inhibitor of flavin-containing oxidative enzymes
(Fig 4B), indicating that TW-92-induced ROS formation is
mediated through the NADH/NADPH oxidase system.
It had previously been reported that the ROS-mediated
cytotoxicity induced by various drugs induced depletion of
endogenous levels of GSH. To determine whether a similar
phenomenon occurred in cells exposed to naphthoquinone
treatment, GSH levels were monitored in U937 cells treated
with 3 lmol/l TW-92, versus untreated controls. Treatment
with TW-92 resulted in a rapid decline in endogenous cellular
GSH (65%), consistent with earlier reports of naphthoqui-
none-induced oxidative injury (Rao & Berk, 1992). Collec-
tively, these findings suggest that enhanced oxidative injury
plays a significant functional role in the anti-leukaemic activity
of this reagent (Fig 4C).
TW-92 induces the apoptotic machinery
The data based on time course analysis of TW-92-mediated
cell death indicated that TW-92 caused first a fast and transient
increase in ROS, with the decline in the mitochondrial
membrane potential (MMP) that leads to apoptosis possibly
being a relatively later event.
One of the early events in apoptotic signalling appears to be
an alteration of mitochondrial membrane integrity. The
permeability transition (PT) pore is a large, high-conductance,
non-specific channel spanning both the mitochondrial inner
and outer membranes. Opening of the PT pore may cause a
loss of mitochondrial W
m
, accompanied by selective release of
cytochrome c to activate caspases, leading to apoptotic cell
death. Accordingly, mitochondria were energised with succi-
nate and then treated with naphthoquione compounds. As
observed stereoscopically at 540 nm, mitochondria presented a
rapid and large decrease in absorbance upon TW-92 treatment
(Fig 5A), indicating swelling.
In view of the observed change in the mitochondrial PT
pore, we examined whether naphthoquinones could directly
cause changes in MMP. The effect of TW-92 on the MMP in
intact cells was examined using the fluorescent dye, DiOC
6
.As
shown in Fig 5B, the fluorescence intensity of DiOC
6
shifted to
the left as early as 30 min after the addition of TW-92,
demonstrating the ability of TW-92 to depolarize the MMP. As
(A)
(B)
Fig 2. Naphthoquinones inhibit cell growth of U-937 cells. (A) U937
cells were incubated with different concentrations of naphthoquinone
TW-92, menadione, or the naphthoquinones, TW-69 and TW-53, or
0Æ1% DMSO (control) for 72 h. (B) U937 cells were treated with the
indicated concentrations of TW-92, after which time cell viability was
monitored at intervals from 24 to 72 h. The data are expressed as mean
percentage ±SEM of three experiments performed in triplicate. * and
**indicate a significant difference of P <0Æ05 and P <0Æ01, respec-
tively, from TW-92 treated cells.
TW-92 Induces Apoptosis in AML
ª 2009 Blackwell Publishing Ltd, British Journal of Haematology, 147, 459–470 463
Page 5
depolarization of MMP may lead to cytochrome c release, we
investigated cytochrome c release in response to TW-92
treatment. Accumulation of cytochrome c in the cytosol was
seen within 2 h of treatment, and reached a maximum level
after 12 h (Fig 5C). To further investigate the apoptotic
pathways involved in TW-92-mediated cell death, we investi-
gated whether caspases were activated in response to TW-92.
As shown in Fig 5D, TW-92 induced a dramatic decrease in
the level of pro-caspase-9 within 1 h of treatment, while
pro-caspase-3 levels were significantly down-regulated only
after 12 h, indicating its activation to be an event downstream
of caspase-9 processing.
In view of mitochondrial involvement in the apoptosis
caused by TW-92 and the role of Bcl-2 family proteins in the
regulation of apoptosis, we next examined whether changes in
the expression of Bcl-2 family members contributed to the cell
death induced by the compound. Treatment of U-937 cells with
TW-92 at levels sufficient to induce apoptosis did not alter the
expression of Bcl-2, even after 24 h (data not shown). By
contrast, a rapid decrease in the expression of the Mcl-1 protein,
a member of the Bcl-2 family, in TW-92-treated cells was
observed (Fig 5E), suggesting that downregulation of Mcl-1
may also be important in TW-92-induced cell death. Figure 5E
also shows the increased level of Bax protein expression in TW-
92-treated cells, as compared to untreated U937 cells. The fast
and early decline in Mcl-1 protein expression points to its
possible role in cell death at the mitochondrial level. These
results suggest that TW-92 induces apoptosis independent of
Bcl-2 levels and that post-translational modifications of the
protein may affect its anti-apoptotic functions. In TW-92-
treated cells, the relative expression level of BAX mRNA
increased by 50%, as compared to the level in untreated cells,
within 3 h of incubation (Fig 5F). This change paralleled the
increase in Bax protein levels.
(A)
0
0 50 100 150 200 250
0 50 100 150 200 250
200
8·7%
48%
400 600
FL2-H
CountsCounts
% of
necrosis/apoptosis
% of
necrosis/apoptosis
% of apoptosis
800 1000
0
100
80
50
40
30
20
10
0
50
40
30
20
10
0
10
20
30
40
60
40
20
0
20
40
Control NAC
(10 mmol/l)
Vit E
(300 µmol/l)
Control
Control
DEVD-CHO
TW-92 (3 µmol/l)
TW-92 + DEVD-CHO
1 µmol/l
3 µmol/l
200 400 600
FL2-H
**
Control
TW-92
*
*
*
800 1000
(B)
(C)
(D)
(E)
Fig 3. Induction of apoptosis by TW-92 is attenuated by the free-
radical scavengers, NAC and vitamin E, as well as by a caspase
inhibitor. FACS analysis of apoptotic cells was performed after cells
were treated for 24 h with either (A) 0Æ1% DMSO or (B) 3 lmol/l TW-
92 and then evaluated for DNA content after PI-staining. The fractions
of apoptotic cells are indicated. Results represent the mean of a
representative experiment, performed in duplicate. (C) Evidence for
apoptosis was obtained by staining with acridine orange/ethiduim
bromide after a 24 h TW-92 treatment (3 lmol/l). Each bar represents
the mean ± SEM of three separate experiments. (D) The free radical
scavengers, L-NAC and vitamin E, block TW-92-induced apoptosis in
U937 cells. U937 cells were exposed to 3 lmol/l TW-92 alone, for
30 min after pre-treatment with L-NAC and vitamin E. (E) Naph-
thoquinone-mediated cell death is realized through activation of
execution caspases. U937 cells were preincubated with the caspase-3
inhibitor, DEVD-CHO (10 lmol/l), alone or in combination with
TW-92, after which apoptotic morphology was determined using
acridine orange/ethiduim bromide staining. Values represent the
means ± SEM of three separate experiments, performed in duplicate.
Upper panels represent the percentage of apoptotic cells, while lower
panels represent necrotic cells. *indicate a significant difference of
P <0Æ05 from TW-92 treated cells.
M. Hallak et al
464
ª 2009 Blackwell Publishing Ltd, British Journal of Haematology, 147, 459–470
Page 6
TW-92-induced cell death is regulated th rough interplay
between the activation of ERK and p38 kinase
To further examine the intracellular signalling mechanisms
responsible for the regulation of TW-92-induced cell death, we
determined which MAPK family members were phosphory-
lated, i.e. activated, in response to TW-92, in a parallel pathway
to the classical apoptotic cascade. To determine levels of
phosphorylation, U937 cells were incubated for various times
(5–60 min) with TW-92 (3 lmol/l). Cell lysates were then
prepared and phosphorylated proteins were visualized by
immunoblot analysis. Treatment of U937 cells with TW-92
increased the levels of both phosphorylated ERK and p38, after
a 5-min incubation (Fig 6A, B). This increase reached its
maximum by 60 min. It is established that Jun phosphorylation
is activated by ROS (Chen et al, 1986; Wang et al, 1998),
Unfortunately, using our antibodies against phosphorylated
Jun did not reveal phosphorylated proteins (data not shown).
To further evaluate whether activation of the MAPKs
contributes to the induction of programmed cell death in this
system, the effect of selective MAPKs inhibitors on the
cytotoxic effect of TW-92 on U937 cells was examined. We
found that the p38 kinase inhibitor, SB203580 (10 lmol/l),
which alone had no effect on cell morphology or viability,
decreased apoptotic cell death, and in parallel, increased the
necrotic cell death induced by TW-92 (Fig 6B). This implies
that p38 plays a role in the induction of apoptosis by TW-92
and that its inhibition prevents execution of apoptotic cell
death. On the other hand, treatment with a MEK inhibitor
(PD98058) did not inhibit the apoptosis induced by TW-92
treatment (Fig 6C). These results are consistent with the
actions of ERK as an upstream event in the inhibition of the
apoptotic process acting via activation of survival pathways.
Moreover, the inhibition of the necrotic process by PD98058
points to a role for ERK in mediating the necrotic cell death
induced by TW92.
Cytotoxic effect of TW-92 on AML cells
We further validated the cytotoxic effect of TW-92 on
mononuclear cells obtained from AML patients. Cells were
incubated with various concentrations of TW-92 for 48 h and
the effect on AML cell viability was assessed. TW-92 signif-
icantly decreased cell numbers, indicating a lower cytotoxic
effect on the malignant cells (Fig 7A). It can be seen that
apoptotic cell death predominated at concentrations up to
0Æ3 lmol/l, while at higher concentrations, the necrotic mode
of cell death dominated (Fig 7B). Comparison of malignant
and PBMC obtained from healthy donors revealed that the
patients’ cells were already sensitive to TW-92 at concentra-
tions of 0Æ1 lmol/l, with a 40% reduction in the viability of the
AML cells being obtained at a 1 lmol/l concentration. On the
other hand, normal PBMC were unresponsive at concentra-
tions up to 1 lmol/l (Fig 7C).
Discussion
Our studies focussed on novel chloro-naphthoquinones with
structures related to that of menadione. To the best of our
knowledge, this is the first report characterizing the anti-
leukaemic effects of a novel group of 2-chloro-naphthoquinones
in which a differentially substituted amino phenyl group has
been introduced at the 3-position of the naphthoquinone.
Studies of structure–activity relationships reveal that the
combined (m)-amine and (p)-methyl substitutions on the
amino-phenyl ring (TW-92) increase the anti-leukaemic
activity of the compounds, as compared to those compounds
presenting single substitutions.
The in vitro anti-leukaemic activity of TW-92 is dependent
on a combination of two factors, i.e., drug concentration and
(A)
(C)
(B)
Fig 4. Treatment of leukaemic cells with TW-92 leads to an increase in
intracellular peroxide generation and lethality, accompanied by
depletion in glutathione levels. U937 cells (1 · 10
6
cells/ml) were
pre-incubated with DCFH/DA for 30 min in the (A) absence or
(B) presence of DPI and then treated with 3 lmol/l TW-92 at 37C,
after which levels of ROS generation were measured at the indicated
intervals. DCF fluorescence in cells was measured with a flow cyto-
meter. DCF fluorescence was excited at 488 nm and emitted fluores-
cence was measured at 525 nm. For each sample, 10 000 cells were
analysed. The experiment shown is representative of two repeats. (C)
U937 cells (5 · 10
5
cells/ml) were pre-treated with 3 lmol/l TW-92
for 1, 5, 10, or 30 min at 37C. The cells then were harvested and
homogenised, after which time protein levels were determined and
cellular GSH content was analysed, as described in Materials and
methods. Each data point represents the mean ± SEM of three exper-
iments. The data are presented as a percentage of the values obtained
with control cells. * and **indicate a significant difference of P < 0.05
and P < 0.01, respectively, from TW-92 treated cells.
TW-92 Induces Apoptosis in AML
ª 2009 Blackwell Publishing Ltd, British Journal of Haematology, 147, 459–470 465
Page 7
the duration of drug exposure. The primary mechanism
responsible for decreased leukaemic cell survival appears to be
the induction of apoptosis, as shown by acridine orange/
ethiduim bromide staining and the appearance of a pre-G1
fraction of cells during cell cycle analysis. Apoptosis induction
was further validated by demonstrating TW-92-induced
caspase activation and inhibition of TW-92-mediated apopto-
sis by a caspase-3-specific inhibitor (DEVD-CHO). At higher
concentrations of TW-92 or upon longer incubation times,
necrotic cell death was evident.
The mechanisms underlying TW-92 action were investi-
gated. According to the results, ROS plays a major role in the
induction of cell death. ROS may have been generated by single
electron reduction, because such naphthoquinones form
semiquinones, which readily auto-oxidize back to quinine,
with concomitant production of active oxygen species, causing,
in turn, a reduction in GSH levels. Depletion of GSH may lead
to the accumulation of hydrogen peroxide. Our results showed
that DPI abolished the increase in ROS elicited by TW-92,
indicating that TW-92 also increases intracellular ROS through
the activation of NADH/NADPH oxidase in promonocytic
(A)
(B)
(C)
(D)
(E)
(F)
220
200
180
160
140
120
100
80
60
40
20
Control
3 h
Bax
21
43
42
kDa
43
32
47
kDa
Mcl-1
Procaspase3
Procaspase9
Cytochrome c (cyt) 17 kDa
Cytochrome c (Mit) 17 kDa
1
Cont
12
(h)
24
1
Cont
6
(h)
Time (s)
0
0·00
0·25
0·50
0·75
1·00
1·25
100 200 300
TW-92
Ca
Control
12
02
(h)
10
0
10
1
10
2
FL1-H
TW-92
Control
ψ
ψ
m
10
3
10
4
12
24
β
-actin
β
-actin
**
BAX/ACTB ratio
(% of control)
Counts
O.D (520 nmol/l)
TW-92
0
Fig 5. TW-92 treatment induces permeability transition (PT) pore
opening, decrease in mitochondrial membrane potential (Dw
m
),
upregulation of Bax expression, downregulation of Mcl-1 expression,
cytochrome c release, and processing of caspases 3 and 9. (A) The effect
of TW-92 on mitochondrial PT pore opening. Rat liver mitochondria
(0Æ5 mg/ml) were assayed for swelling and PT pore opening in the
presence or absence of naphthoquinones. The reaction was initiated by
addition of either Ca
+2
(100 lmol/l) as a positive control (data not
shown), or the naphthoquinone compound alone. All assays were
conducted at room temperature, for 5 min. The experiment was
repeated three times, yielding similar results each time. (B) DiOC
6
assay to evaluate the reduction in mitochondrial membrane potential.
U937 cells were cultured in the presence or absence of TW-92 for
30 min together with DiOC
6
(40 nmol/l). An aliquot of the cells was
used for the determination of the DiOC
6
-associated fluorescence
retained by the cells. U-937 cells were pre-treated with TW-92
(3 lmol/l), with the loss in Dw
m
being measured by DiOC
6
staining.
No effect was seen using DMSO alone, as compared to controls (not
shown). (C) Western blot analysis of the level of cytochrome c release.
Mitochondrial (Mit) and cytosolic (cyt) proteins were separated by
15% SDS–PAGE and immunoblotted with antibodies against
cytochrome c . Results of a representative experiment are shown. Two
additional studies yielded equivalent results. (D) TW-92 enhances
caspase 3/9 processing. Total cell lysates of U937 cells, treated with or
without TW-92 for the indicated times, were extracted, subjected to
SDS–PAGE and probed with antibodies to determine cleavage of
pro-caspase-9 and 3. (E) Time-dependent inhibition of Mcl-1
expression after treatment with TW-92. Cells were treated with
(3 lmol/l) TW-92 for the indicated times. The level of Mcl-1 was
determined by Western blotting. Results of a representative experiment
are shown. Western analysis of b-actin indicates similar protein
loading in each lane. (F) Real-time PCR analysis for the detection of
BAX levels. U937 cells were pre-incubated in the presence or absence of
TW-92 for 1, 3 or 6 h, after which time total RNA was extracted, as
described in Materials and Methods. Total RNA transcripts were
assessed for ACTB transcripts levels. BAX to ACTB transcript ratios
were described. **indicates a significant difference of P <0Æ01 from
TW-92-treated cells.
M. Hallak et al
466
ª 2009 Blackwell Publishing Ltd, British Journal of Haematology, 147, 459–470
Page 8
U937 cells. The increase in ROS was also made evident by the
observed decrease in GSH levels. ROS have been shown to
induce apoptosis through the intrinsic pathway. Indeed, an
early change in mitochondrial membrane integrity supports
the involvement of the intrinsic cell death pathway.
In general, O
2
)
is rapidly dismutated to H
2
O
2
. Both O
2
)
and
H
2
O
2
have been reported to activate ERK (Rao & Berk, 1992;
Chen et al, 1995). In most cellular models, ERK activation
seems to inversely correlate with apoptosis, In our experi-
ments, PD980059 enhanced apoptosis and decreased necrosis
induced by TW-92, which was prominent after 48 h of
incubation, suggesting that the extent of ERK activation might
also be important in determining the mode of death and
contribute to necrotic death induction.
The rapid phosphorylation of p38
MAPK
and the ability of
SB203580 to reduce apoptosis suggest that this kinase plays an
early role in the regulation of TW-92-provoked apoptosis.
Activation of this p38 stress kinase can be mediated by either
MKK3 and MKK6 kinases (Giafis et al, 2006; Kannan-Thula-
siraman et al, 2006) or MAPK phosphatase inactivation. It was
demonstrated that ROS inhibits MAPK phosphatase activity
(Kamata et al, 2005). Thus, our results showing an increase in
ROS levels followed by MAPK phosphorylation could be
attributed to an inhibition of phosphatase activity.
Another member of the MAPK family whose activation may
be linked to oxidative stress responses is c-Jun N-terminal
kinase (JNK). Our results showed partial inhibition of
apoptosis induced by TW-92 in response to the JNK inhibitor
SP600125 (data not shown). The role of this MAPK in chloro-
naphthoquinones activity deserves further investigation.
BAX promotes cell death, and its upregulation has been
associated with direct induction of cytochrome c release and
enhanced apoptosis. TW-92 induced an increase in BAX
mRNA and Bax protein levels. This increase in Bax protein
expression may augment the early mitochondrial dysfunction
already observed after TW-92 addition. Other studies have
shown that p38
MAPK
may modulate nuclear factor (NF)-jB-
driven gene activation (Gerritsen et al, 1997; Shou et al, 2003).
Therefore, p38
MAPK
may modulate NF-jB-mediated transcrip-
tion, including that of Bax, in response to TW-92. Although
p38
MAPK
may principally act via a transcription-dependent
pathway, it may also intersect with phosphorylation-dependent
events to regulate cell death (Ghatan et al, 2000). The fast
activation of p38
MAPK
suggests that it acts upstream of MMP
(w
m
) disruption and thus may represent an early response
which could affect TW-92-mediated cell death by multiple
mechanisms (Fig 7D). The response of cells to apoptotic
stimuli critically depends on the balance between pro- and
anti-apoptotic members of the Bcl-2 family (Boise et al, 1995)
while TW-92 did not affect the expression of Bcl-2 (data not
shown), it reduced the level of Mcl-1, an anti-apoptotic
member of the Bcl-2 family (Reynolds et al, 1994) in a time-
dependent manner. Thus, reduction in Mcl-1 levels may play a
major role in TW-92- mediated cell death. Caspase-dependent
proteolysis of Mcl-1 has been reported in a number of cell
types (Derouet et al, 2006). Another study reported that Mcl-1
possesses phosphorylation sites at the PEST sequence that can
be phosphorlayted by JNK and p38 upon H
2
O
2
treatment
(Inoshita et al, 2002), targeting it for proteasome-mediated
proteolysis. This ability of TW-92 to down-regulate Mcl-1
(A)
(B)
(C)
(D)
Fig 6. TW-92 stimulates ERK1/2-p38 activation/phosphorylation.
Western blot analysis of U937 cells revealed activation of (A) ERK 1/2
and (B) p38 MAPK. Phosphorylation of MAPK active forms was
observed using specific antibodies against phospho-ERK, phospho-
p38
MAPK
following SDS–PAGE and electrotransferred to nitrocellulose.
U937 cells (5 · 10
5
) were cultured under standard conditions for 48 h
prior to exposure to either 10 lmol/l PD98059 (C) or 10 lmol/l
SB203580 and (D) then incubated with TW-92 for an additional 24
and 48 h. Cell death was monitored using acridine orange/ethidium
bromide staining (mean ± SEM, three independent experiments).
* and **indicate a significant difference of P <0Æ05 and P <0Æ01,
respectively, from TW-92-treated cells.
TW-92 Induces Apoptosis in AML
ª 2009 Blackwell Publishing Ltd, British Journal of Haematology, 147, 459–470 467
Page 9
levels may be of great value, especially in light of the reported
elevated level of Mcl-1 in acute myeloid leukaemia cells and its
relation to resistance to chemotherapy (Kitada et al, 2000).
Nevertheless, the mechanism underlying the downregulation
of Mcl-1 warrants further investigation.
Treatment with TW-92 showed marked toxicity toward
primary AML cells, especially at high drug concentrations,
while lower effects were obtained with primary normal human
mononuclear cells. TW-92-mediated cell cytotoxicity, there-
fore, appears to be preferentially directed at malignant cells.
Because U937 cells lack p53, it appears that TW-92 may trigger
apoptosis independent of this oncogene. The results obtained
upon TW-92 treatment of normal cells are much better
that those obtained with the other quinones, such as either
doxorubicin (Wang et al, 2004) or menadione (Chiou et al,
2003; Kaminiski et al, 2004), to which the sensitivity of the
normal cells was much higher than that of the transformed
cells.
In conclusion, our data provide the first evidence that
exposure to the novel 2-chloro-3-phenylamino-1,4-naphtho-
quinone, TW-92, induces apoptosis in myeloid leukaemic cells,
while at higher concentrations, necrotic cell death was more
prominent. On the basis of these data, we propose a model for
apoptotic induction by multiple pathways (Fig 7D). TW-92
has a direct effect on mitochondria by induction of PT-pore
opening. In parallel, it causes ROS formation, probably
through NADPH-oxidase activation, which affects Dw
m
,
leading to the cytochrome c release that activates caspases,
up-regulates the expression of the pro-apoptotic Bax protein
and decreases Mcl-1 levels. Hence, our data indicate the
potential usefulness of TW-92 in the treatment of human
(A)
(B)
(C)
(D)
120
100
80
60
40
20
0
40
20
0
20
40
60
80
100
100
80
60
40
20
0
Control
0·1 µmol/l
0·3 µmol/l
1 µmol/l
3 µmol/l
010
–1
Conc (µm)
Cell viability
(% of control)
Cell viability
(% of control)
% of
necrosis/apoptosis
TW-92
10
0
Apoptosis
TW-92
*
***
Necrosis
**
PBMCs
**
**
**
AML
10
1
010
–1
TW-92
NADPH-oxidase
ROS
pp38
Bax
Mcl-1
Apoptosis
Caspase activation
Cytochrome c
Mitochondria
DPI
Ψ
M
?
?
Conc (µmol/l)
10
0
10
1
10
2
Fig 7. Treatment with TW-92 induces death of peripheral blood
mononuclear cells from patients with AML, while exhibiting little
effect toward normal mononuclear cells. (A) The viability of AML cells
treated with TW-92 was determined by cell counting via trypan blue
exclusion. (B) Primary human AML blasts obtained from three
patients were suspended in culture medium at a cell density of 1 · 10
6
/
ml, then incubated for 48 h with various concentrations of TW-92,
ranging from 0Æ1to0Æ3 lmol/l. Cell death was monitored using
acridine orange/ethiduim bromide staining, as described in Materials
and methods, and is expressed as a percentage of control cells. Data
show the mean of ±SEM of triplicate experiments. (C) A parallel
experiment was also performed with normal peripheral blood mono-
nuclear cells (PBMC) from two healthy donors. Cell viability was
determined using the XTT assay. Results represent the mean ± SEM of
triplicate determinations. *, ** and ***indicate a significant difference
of P <0Æ05, P <0Æ01, and P <0Æ001, respectively, from TW-92-treated
cells. (D) Proposed model for the mode of action of TW-92 in
leukaemic U937 cells. The putative pro-apoptotic actions of ROS
produced upon TW-92 treatment may be opposed by the NADPH-
oxidase inhibitor, DPI. ROS cause mitochondrial dysfunction through
stress kinase activation of pp38, which leads to excess Bax accumula-
tion, cytochorme c accumulation in the cytosol, caspase activation,
Mcl-1 downregulation and ultimately, apoptosis. Our results thus
indicate that, in addition to MAPKs, ROS and direct mitochondrial
activation by TW-92 also affects the level of pro-and anti-apoptotic
proteins by mechanisms that warrants further study.
M. Hallak et al
468
ª 2009 Blackwell Publishing Ltd, British Journal of Haematology, 147, 459–470
Page 10
myeloid leukaemias, including AML. In addition, the inde-
pendence of TW-92 from p53, as well as its cytotoxic effect at
submicromolar concentrations, make TW-92 a possible agent
for the treatment of other types of cancer. Given the current
interest in developing of new naphthoquinone-based agents as
chemo-preventative agents, the entire aminophenyl naphtho-
quinone class may merit further scrutiny.
Acknowledgements
We thank Natalia Tsesin for help in preparing and isolating the
rat liver mitochondria used in this study. This work was
supported by grants from the Lyonel Israels’ Chair Fund and
BGNegev Technologies.
References
Aharonovitz, O., Aboulafia-Etzion, S., Leor, J., Battler, A. & Granot, Y.
(1998) Stimulation of 42/44 kDa mitogen-activated protein kinases
by arginine vasopressin in rat cardiomyocytes. Biochimica et Bio-
physica Acta, 1401, 105–111.
Boise, L.H., Gottschalk, A.R., Quintans, J. & Thompson, C.B. (1995)
Bcl-2 and Bcl-2 related proteins in apoptosis regulation. Current
Topics in Microbiology and Immunology, 200, 107–121.
Chen, Y.R., Wang, X., Templeton, D., Davis, R.J. & Tan, T.H. (1986)
The role of c-Jun N-terminal kinase (JNK) in apoptosis induced by
ultraviolet C and gamma radiation. Duration of JNK activation may
determine cell death and proliferation. Journal of Biological Chem-
istry, 271, 31929–31936.
Chen, Q., Olashaw, N. & Wu, J. (1995) Participation of reactive oxygen
species in the lysophosphatidic acid-stimulated mitogen activated
protein kinase kinase activation pathway. Journal of Biological
Chemistry, 270, 28499–28502.
Chiou, T.J., Chu, S.T. & Tzeng, W.F. (2003) Protection of cells from
menadione-induced apoptosis by inhibition of lipid peroxidation.
Toxicology, 191, 77–88.
Dash, A. & Gilliland, D.G. (2001) Molecular genetics of acute myeloid
leukemia. Best Practice and Research. Clinical Haematology, 14, 49–64.
Derouet, M., Thomas, L., Moulding, D.A., Akgul, C., Cross, A., Moots,
R.J. & Edwards, S.W. (2006) Soduim salicylate promotes neutrophil
apoptosis by stimulating caspase-dependent turnover of Mcl-1.
Journal of Immunology, 176, 957–965.
Dvir, T., Levy, O., Shachar, M., Granot, Y. & Cohen, S. (2007) Acti-
vation of the ERK1/2 cascade via pulsatile interstitial fluid flow
promotes cardiac tissue assembly. Tissue Engineering, 13, 2185–2193.
Franklin, C.C., Srikanth, S. & Kraft, A.S. (1998) Conditional expression
of mitogen-activated protein kinase phosphatase-1, MKP-1, is
cytoprotective against UV-induced apoptosis. Proceedings of the
National Academy of Sciences of the United States of America, 95,
3014–3019.
Gerritsen, M.A., Williams, A.J., Neish, A.S., Moore, S., Shi, Y. &
Collins, T. (1997) CREB-binding protein/p300 are transcriptional
coactivators of p65. Proceedings of the National Academy of Sciences
of the United States of America, 94, 2927–2932.
Ghatan, S., Larner, S., Kinoshita, Y., Hetman, M., Patel, L., Xia, Z.,
Youle, R.J. & Morrison, R.S. (2000) p38 MAP kinase mediates Bax
translocation in nitric oxide-induced apoptosis in neurons. The
Journal of Cell Biology, 150, 335–347.
Giafis, N., Katsoulidis, E., Sassano, A., Tallman, M.S., Higgins, L.S.,
Nebreda, A.R., Davis, R.J. & Platanias, L.C. (2006) Role of the p38
mitogen-activated protein kinase pathway in the generation of
arsenic trioxide-dependent cellular responses. Cancer Research, 66,
6763–6771.
Guzman, M.l., Swiderski, C.F., Howard, D.S., Grimes, B.A., Rossi,
R.M., Szilvassy, S.J. & Jordan, C.T. (2002) Preferential induction of
apoptosis for primary human leukemic stem cells. Proceedings of the
National Academy of Sciences of the United States of America, 99,
16220–16225.
Hallak, M., Vazana, L., Shpilberg, O., Levy, I., Mazar, J. & Nathan, I.
(2008) A molecular mechanism for mimosine-induced apoptosis
involving oxidative stress and mitochondrial activation. Apoptosis,
13, 147–155.
Hannun, Y.A. (1997) Apoptosis and the dilemma of cancer chemo-
therapy. Blood,
89, 1845–1853.
Hayon, T., Atlas, L., Levy, E., Dvilansky, A., Shpilberg, O. & Nathan, I.
(2003) Multifactorial activities of nonsteroidal antiestrogens against
leukemia. Cancer Detection and Prevention, 27, 389–396.
Inoshita, S., Takeda, K., Terada, Y., Sano, M., Junichi, H., Umezawa, A.
& Ichijo, H. (2002) Phosphorylation and Inactivation of myekoid
cell leukaemia by JNK in Response to oxidative stress. Journal of
Biological Chemistry, 277, 43730–43734.
Juo, P., Kuo, C.J. & Reynolds, S.E. (1997) Fas Activation of the
p38 mitogen-activated protein kinase signalling pathway requires
ICE/CED-3 family proteases. Molecular and Cellular Biology, 17, 24–
25.
Kamata, H., Honda, S., Maeda, S., Chang, L., Hirata, H. & Karin, M.
(2005) Reactive oxygen species promote TNF-a-induced death and
sustained JNK activation by inhibiting MAP kinase phosphatases.
Cell, 120, 649–661.
Kaminiski, M., Niemczyk, E., Masaoka, M., Karbowski, M., Hallmann,
A., Kedzior, J., Majczak, A., Knap, D., Nishizawa, Y., Usukura, J.,
Woziak, M., Klimek, J. & Wakabyashi, T. (2004) The switch
mechanism of the cell death mode from apoptosis to necrosis in
menadione-treated human osteosarcoma cell line 143B cells.
Microscopy Research and Technique, 64, 255–268.
Kannan-Thulasiraman, P., Katsoullidis, E., Tallman, M.S., Arthur, J.S.
& Platanias, L.C. (2006) Activation of the mitogen and stress acti-
vated kinase 1 by arsenic trioxide. Journal of Biological Chemistry, 28,
22446–22452.
Kitada, S., Zapata, J.M., Andreef, M. & Reed, J.C. (2000) Protein kinase
inhibitors flavopiridol and 7-hydroxy-staurosporine down-regulate
antiapoptosis proteins in B-cell chronic lymphocytic leukemia.
Blood, 96, 393–397.
Levy, O. & Granot, Y. (2006) Arginine-vasopressin activates the JAK-
STAT pathway in vascular smooth muscle cells. Journal of Biological
Chemistry, 281, 15597–15604.
Lin, A.J., Pardini, R.S., Cosby, L.A., Lillis, B.J., Shansky, C.W. & Sar-
torelli, A.C. (1973) Potential bioreductive alkylating agents. Anti-
tumor effect and biochemical studies of naphtoquinone derivatives.
Journal of Medicinal Chemistry, 16, 1268–1271.
Lin, A.J., Lillis, B.J. & Sartorelli, A.C. (1975) Potential bioreductive
alkylating agents. Antineoplastic activity of quinoline-5,8-diones,
aphthazarins, and naphthoquinones. Journal of Medicinal Chemistry,
18, 917–921.
Liu, X.S., Kim, C.N., Yang, J., Jemmerson, R. & Wang, X.D. (1996)
Induction of apoptotic program in cell free extracts: requirement for
dATP and cytochrome c. Cell, 86, 147–157.
TW-92 Induces Apoptosis in AML
ª 2009 Blackwell Publishing Ltd, British Journal of Haematology, 147, 459–470 469
Page 11
Monks, T.J., Hanzlik, R.P., Cohen, G.M., Ross, D. & Graham, D.G.
(1992) Quinone chemistry and toxicity. Toxicology and Applied
Pharmacology, 112, 2–16.
Myers, C.E., Chabner, B.A., Chabner, B.A. & Collins, J.M., eds. (1990)
Anthracyclines in Cancer Chemotherapy: Principles and Practice. 356–
381. Lippincott, Philadelphia.
O’Gormon, D.M. & Cotter, T.G. (2001) Molecular signals in anti-
apoptotic survival pathways. Leukemia, 15, 21–34.
Powis, G. (1989) Free radical formation by anti-tumor quinones. Free
Radical Biology and Medicine, 6, 63–101.
Qiu, X.B., Schonthal, A.H. & Cadenas, E. (1998) Anticancer quinones
induces pRb-preventable G2/M cell cycle arrest and apoptosis. Free
Radical Biology and Medicine, 24, 848–854.
Raingeaud, J., Gupta, S. & Rogers, J. (1995) Pro-inflammatory cyto-
kines and environmental stress cause p38 mitogen-activated protein
kinase activation by dual phosphorylation on tyrosine and threo-
nine. Journal of Biological Chemistry, 270, 7420–7426.
Rao, G.N. & Berk, B.C. (1992) Active oxygen species stimulate vascular
smooth muscle growth and proto-oncogene expression. Circulation
Research, 70, 593–599.
Reynolds, J.E., Yang, T., Qian, L., Jenkinson, J.D., Zhou, P., Eastman,
A. & Craig, R.W. (1994) Mcl-1, a member of the Bcl-2 family, delays
apoptosis induced by c-Myc overexpression in Chinese hamster
ovary cells. Cancer Research, 54, 6348–6352.
Schultz, T.W., Sinks, G.D. & Cronin, M.T.D. (1997) Quinone-induced
toxicity to Tetrahymena: structure–activity relationships. Aquatic
Toxicology, 39, 267–278.
Seimiya, H., Mashima, T., Yohi, M. & Tsuurruo, T. (1997) c-Jun NH2-
terminal kinase-mediated activation of interleukin-1 beta converting
enzyme/CED-3-like protease during anticancer drug-induced
apoptosis. Journal of Biological Chemistry, 272, 4631–4636.
Shou, Y., Li, L., Prabhakaran, K., Borowitz, J.L. & Isom, G.E. (2003)
p38 Mitogen-activated protein kinase regulates Bax translocation in
cyanide-induced apoptosis. Toxicological Sciences, 75, 99–107.
Thomson, R.H.. (1987) Naturally Occurring Quinones III: Recent
Advances. Chapman and Hall, New York.
Von Knethen, A., Callsen, D. & Brune, B. (1999) Superoxide attenuates
macrophage apoptosis by NF-kappa B and AP-1 activation that
promotes cyclooxygenase-2 expression. Journal of Immunology, 163,
2858–2866.
Wang, X., Martindale, L., Liu, Y. & Holbrook, N.J. (1998) The cellular
response to oxidative stress: influences of mitogen-activated protein
kinase signalling pathways on cell survival. Biochemical Journal, 333,
291–300.
Wang, S., Konorev, E.A., Kotamraju, S., Joseph, J., Kalivendi, S. &
Kalyanaraman, B. (2004) Doxorubicin induces apoptosis in Norman
and tumor cells via distinctly different mechanisms. Journal of
Biological Chemistry, 279, 25535–25543.
M. Hallak et al
470
ª 2009 Blackwell Publishing Ltd, British Journal of Haematology, 147, 459–470
Page 12
  • Source
    [Show abstract] [Hide abstract] ABSTRACT: Dimeric naphthoquinones (BiQ) were originally synthesized as a new class of HIV integrase inhibitors but have shown integrase-independent cytotoxicity in acute lymphoblastic leukemia cell lines suggesting their use as potential anti-neoplastic agents. The mechanism of this cytotoxicity is unknown. In order to gain insight into the mode of action of binaphthoquinones we performed a systematic high-throughput screen in a yeast isogenic deletion mutant array for enhanced or suppressed growth in the presence of binaphthoquinones. Exposure of wild type yeast strains to various BiQs demonstrated inhibition of yeast growth with IC(50)s in the microM range. Drug sensitivity and resistance screens were performed by exposing arrays of a haploid yeast deletion mutant library to BiQs at concentrations near their IC(50). Sensitivity screens identified yeast with deletions affecting mitochondrial function and cellular respiration as having increased sensitivity to BiQs. Corresponding to this, wild type yeast grown in the absence of a fermentable carbon source were particularly sensitive to BiQs, and treatment with BiQs was shown to disrupt the mitochondrial membrane potential and lead to the generation of reactive oxygen species (ROS). Furthermore, baseline ROS production in BiQ sensitive mutant strains was increased compared to wild type and could be further augmented by the presence of BiQ. Screens for resistance to BiQ action identified the mitochondrial external NAD(P)H dehydrogenase, NDE1, as critical to BiQ toxicity and over-expression of this gene resulted in increased ROS production and increased sensitivity of wild type yeast to BiQ. In yeast, binaphthoquinone cytotoxicity is likely mediated through NAD(P)H:quonine oxidoreductases leading to ROS production and dysfunctional mitochondria. Further studies are required to validate this mechanism in mammalian cells.
    Preview · Article · May 2010 · PLoS ONE
  • Source
    [Show abstract] [Hide abstract] ABSTRACT: In the title compound, C18H21ClN2O4, the mol­ecular sytructure is stabilized by two intra­molecular N—H⋯O hydrogen bonds. In the crystal, mol­ecules are linked by pairs of C—H⋯O hydrogen bonds, forming inversion dimers with graph-set motif R 2 2(10). N—H⋯O hydrogen bonds further link the dimers into C(10) chains along [010].
    Full-text · Article · Aug 2012 · Acta Crystallographica Section E Structure Reports Online
  • [Show abstract] [Hide abstract] ABSTRACT: ABSTRACT Mantle cell lymphoma (MCL) characterized by the t(11;14)(q13;q32) translocation, resulting in cyclin D1 overexpression, is one of the most challenging lymphomas to treat. Iron chelators, like deferasirox, have previously been shown to exhibit anti-proliferative properties; however, their effect on MCL cells has never been investigated. We showed that deferasirox exhibited antitumoral activity against the MCL cell lines; HBL-2, Granta-519 and Jeko-1, with IC(50) values of 7.99±2.46μM, 8.93±2.25μM and 31.86±7.26μM, respectively. deferasirox induced apoptosis mediated through caspase-3 activation and decreased cyclin D1 protein levels resulting from increased proteasomal degradation. We also demonstrated downregulation of phosphor-Rb (Ser780) expression which resulted in increasing levels of the E2F/Rb complex and G(1)/S arrest. Finally, we showed that deferasirox activity was dependent on its iron chelating ability. The present data indicate that deferasirox, by downregulating cyclin D1 and inhibiting its related signals, may constitute a promising adjuvant therapeutic molecule in the strategy for MCL treatment.
    No preview · Article · Sep 2012 · Leukemia & lymphoma
Show more