MGMT methylation is associated primarily with the germline C>T SNP (rs16906252) in colorectal cancer and normal colonic mucosa

Article (PDF Available)inModern Pathology 22(12):1588-99 · October 2009with44 Reads
DOI: 10.1038/modpathol.2009.130 · Source: PubMed
Abstract
O(6)-methylguanine DNA methyltransferase (MGMT) is a DNA repair protein that restores mutagenic O(6)-methylguanine to guanine. MGMT methylation is frequently observed in sporadic colorectal cancer and was recently correlated with the C>T allele at SNP rs16906252, within the transcriptional enhancer element of the promoter. MGMT methylation has also been associated with KRAS mutations, particularly G>A transitions. We studied 1123 colorectal carcinoma to define the molecular and clinicopathological profiles associated with MGMT methylation. Furthermore, we assessed factors contributing to MGMT methylation in the development of colorectal cancer by studying the allelic pattern of MGMT methylation using SNP rs16906252, and the methylation status of neighbouring genes within 10q26 in selected tumours and matched normal colonic mucosa. MGMT methylation was detected by combined bisulphite restriction analysis in 28% of tumours and was associated with a number of characteristics, including CDKN2A methylation, absent lymphovascular space invasion and KRAS mutations (but not specifically with KRAS G>A transitions). In a multivariate analysis adjusted for age and sex, MGMT methylation was associated with the T allele of SNP rs16906252 (P<0.0001, OR 5.5, 95% CI 3.8-7.9). Low-level methylation was detected by quantitative methylation-specific PCR in the normal colonic mucosa of cases, particularly those with a correspondingly methylated tumour, as well as controls without neoplasia, and this was also associated with the C>T SNP. We show that the T allele at SNP rs16906252 is a key determinant in the onset of MGMT methylation in colorectal cancer, whereas the association of methylation at MGMT and CDKN2A suggests that these loci may be targets of a common mechanism of epigenetic dysregulation.
MGMT methylation is associated primarily
with the germline C4T SNP (rs16906252) in
colorectal cancer and normal colonic mucosa
Nicholas J Hawkins
1,
*, James H-F Lee
2,
*, Justin J-L Wong
1,3
, Chau-To Kwok
2,3
,
Robyn L Ward
2,3
and Megan P Hitchins
2,3
1
School of Medical Sciences, University of NSW, Sydney, Australia;
2
Prince of Wales Clinical School,
University of NSW, Sydney, Australia and
3
Integrated Cancer Research Group, Lowy Cancer Research Centre,
University of NSW, Sydney, Australia
O
6
-methylguanine DNA methyltransferase (MGMT) is a DNA repair protein that restores mutagenic
O
6
-methylguanine to guanine. MGMT methylation is frequently observed in sporadic colorectal cancer and
was recently correlated with the C4T allele at SNP rs16906252, within the transcriptional enhancer element of
the promoter. MGMT methylation has also been associated with KRAS mutations, particularly G4A transitions.
We studied 1123 colorectal carcinoma to define the molecular and clinicopathological profiles associated with
MGMT methylation. Furthermore, we assessed factors contributing to MGMT methylation in the development of
colorectal cancer by studying the allelic pattern of MGMT methylation using SNP rs16906252, and the
methylation status of neighbouring genes within 10q26 in selected tumours and matched normal colonic
mucosa. MGMT methylation was detected by combined bisulphite restriction analysis in 28% of tumours and
was associated with a number of characteristics, including CDKN2A methylation, absent lymphovascular space
invasion and KRAS mutations (but not specifically with KRAS G4A transitions). In a multivariate analysis
adjusted for age and sex, MGMT methylation was associated with the T allele of SNP rs16906252 (Po0.0001, OR
5.5, 95% CI 3.8–7.9). Low-level methylation was detected by quantitative methylation-specific PCR in the normal
colonic mucosa of cases, particularly those with a correspondingly methylated tumour, as well as controls
without neoplasia, and this was also associated with the C4T SNP. We show that the T allele at SNP rs16906252
is a key determinant in the onset of MGMT methylation in colorectal cancer, whereas the association of
methylation at MGMT and CDKN2A suggests that these loci may be targets of a common mechanism of
epigenetic dysregulation.
Modern Pathology (2009) 22, 1588–1599; doi:10.1038/modpathol.2009.130; published online 4 September 2009
Keywords:
MGMT; methylation; colorectal cancer; SNP
Epigenetic inactivation of tumour-suppressor and
DNA repair genes through aberrant methylation of
the CpG island promoter is a frequent occurrence in
sporadic colorectal cancer.
1
Specific patterns of gene
methylation have been reported in particular sub-
sets of colorectal cancer. These include the CpG
island methylator phenotype (CIMP), in which
numerous genes scattered throughout the genome
are simultaneously methylated,
2,3
and long-range
epigenetic silencing, in which multiple genes with-
in a large (41 Mb) contiguous chromosomal region
are concomitantly methylated, as described for
chromosomes 2q14
4
and 3p22 encompassing the
DNA mismatch repair gene MLH1.
5
Particular sub-
sets of colorectal cancer are characterised by the
concurrence of genetic and epigenetic alterations.
This phenomenon is most clearly exemplified by the
strong concordance between MLH1 methylation,
microsatellite instabil ity (MSI), the BRAF V600E
mutation and CIMP.
3,6
Furthermore, specific molecu-
Received 1 April 2009; revised 19 July 2009; accepted 20 July
2009; published online 4 September 2009
Correspondence: Dr MP Hitchins, PhD, Integrated Cancer Research
Group, Lowy Cancer Research Centre, University of NSW, Randwick,
Sydney, NSW 2052, Australia.
E-mail: M.Hitchins@unsw.edu.au
*These authors contributed equally to this paper.
Modern Pathology (20 09) 22, 15881599
1588 & 2009 USCAP, Inc. All rights reserved 0893-3952/09 $32.00
www.modernpathology.org
lar subtypes of colorectal cancer have been associated
with distinct clinicopathological features, including
differences in natural history and response rates to
particular chemotherapeutic agents .
6,7
Therefore,
the identification of distinct molecular profiles and
associated clinicopathological features, as well as
molecular susceptibility factors, is important not
only in the recognition of different colorectal cancer
phenotypes, but also has the potential to signifi-
cantly influence targeted treatment regimes.
8
Loss of expression of the O
6
-methylguanine DNA
methyltransferase (MGMT) protein is a frequent
occurrence in many types of cancer, including
30–46% of sporadic colorectal cancers.
9–13
This is
almost invariably associated with methylation of
the MGMT promoter.
9
MGMT is a ubiquitously
expressed DNA repair protein that protects against
mutagenesis by repairing mutagenic O
6
-methylgua-
nines within DNA. By direct cleavage of the methyl
adducts, the enzyme can restore the affected
guanine nucleotides to normal.
14
If this fails to
occur, O
6
-methylguanines can pair erroneously with
thymine during DNA replication, resulting in
G:C4A:T transitions in the DNA, which can be
important in neoplastic transformation.
14
MGMT methylation or loss of MGMT protein
expression is reportedly associated with an increa-
sed frequency of mutations in the KRAS oncogene
and P53 tumour-suppressor gene in colorectal
cancer, particu larly G4A transitions, consistent
with a causative function of G4A mutagenesis in
tumourigenesis.
11,12,15–18
However, other studies
have found no specific associations with this
sequence change,
19,20
or only a weak association
with the presence of a G4A mutation within one of
the four cancer-associated genes KRAS, P53, APC
and b-catenin.
21
Association studies between MGMT methylation,
CIMP and microsatellite stability (MSS) status in
colorectal cancer have also reported inconsistent
findings. MGMT methylation has been correlated
with MSS and low-level MSI,
17,20
though the exis-
tence of low-level MSI as an entity distinct from MSS
remains controversial. Although MGMT methyl-
ation was initially included as one of the panel of
markers to predict CIMP in some studies,
22–25
it has
since been shown to be a poor marker for this epi-
genetic phenotype and may be independent of CIMP
status altogether.
26,27
Yet in one recent study, MGMT
methylation was associated with CIMP in combina-
tion with MSS/low-level MSI,
20
whereas in another,
it correlated with the newly proposed low-level
CIMP phenotype in combination with low-level
MSI.
10
Thus, tumours showing MGMT methylation
have not as yet been classified consistently into any
distinct subtype of colorectal cancer with a clearly
defined and universally accepted molecular profile.
However, cancers in which MGMT is absent are more
sensitive to treatment with alkylating agents,
28
and
thus MGMT methylation may be a predictive marker
for drug responsiveness in colorectal cancer.
MGMT methylation has been identified in ea rly
neoplastic lesions including aberrant crypt foci,
indicating that it is an early event in colorectal
carcinogenesis.
29,30
It is seen frequently in serrated
polyps and ad enomas with a villous component,
suggesting an involvement in the serrated neoplasia
pathway.
23–25,31,32
Low levels of MGMT methylation
have also been detected in the normal-appearing
colonic mucosae of individuals with MGMT-methy-
lated colorectal cancers as well as individuals
without neoplasia.
12,30,33
This led to the suggestion
that MGMT methylation may precede and predis-
pose to malignant transformation through Slaugh-
ter’s concept of ‘field cancerisation’, whereby the
accrual of molecular alterations in patches of
preneoplastic cells underlies the development of
locally recurrent epithelial cancers.
34
Recently,
MGMT methylation was found to be closely asso-
ciated with the C4 T SNP (rs16906252) within the
first exon of MGMT in colorectal cancer.
35
This SNP
is located 56 bp upstre am of the translation start site,
within a 59-bp cis-acting enhancer element that
spans the first exon–intron bounda ry and is required
for efficient promoter activity (Figure 1a).
36
At this point, therefore, the relationship between
MGMT methylation, MGMT protein loss and parti-
cular genetic and epigenetic lesions requires further
clarification. To this end, we determined the
frequency of MGMT methylation and protein loss
in a large Australian series of sporadic colorectal
carcinoma and sought correlations with other
molecular events and clinicopathological features.
Furthermore, we aimed to identify the key determi-
nants of MGMT methylation in the de velopment of
colorectal cancer. To address this, we investigated
whether MGMT methylation status correlated with
long-range epigenetic silencing of the chromosome
region 10q26 surrou nding MGMT, the CIMP pheno-
type or the genotype of the germline MGMT exon 1
SNP rs16906252. The presence of low levels of
MGMT methylation in the normal colonic mucosa of
individuals with colorectal cancer and withou t
neoplasia was also studied in conjunction with the
SNP genotype.
Materials and methods
Clinical Specimens
A total of 1249 colorectal carcinoma specimens and
matching normal colonic mucosa were drawn from a
prospective series of 1178 patients who had under-
gone complete surgical resection of a primary color-
ectal cancer at St Vincents Hospital Sydney from
March 1993 to November 2007. In the 61 individuals
with two or more tumours, one cancer was selected
at random for inclusion in this study. A further 50
individuals were excluded, as there was either
insufficient tumour sample for methylation analysis
or no result was obtained. The cohort for which
MGMT methylation results were obtained, therefore,
MGMT methylation linked to germline SNP
NJ Hawkins et al 1589
Modern Pathology
(2009) 22, 15881599
included 1123 individuals (505 females and 618
males) with a mean age at diagnosis of 69
±
12 years
(range 25–99 years). The distribution of tumour
TNM stages was 229 (20%) stage I, 391 (35%) stage
II, 355 (32%) stage III and 148 (13%) stage IV.
The normal colonic mucosa from 20 individuals
(7 females and 13 males) of mean age 60
±
18 years
(range 33–91 years) who had undergone colonic
resection for clinical indications other than color-
ectal cancer were included as controls without
neoplasia. This study was approved by the St
Vincent’s Campus Human Research Committee
(approval numbers H02/022 and H07/002) and all
individuals provided their informed consent. In-
dividuals with a known germline mutation in the
mismatch repair genes, MYH or APC were excluded
from this study. The clinical and pathological
characteristics of the majority of cases in this patient
cohort have been documented earlier.
37,38
The
microsatellite status of each tumour was assessed
at the Bat 25, Bat 26, Bat 40, D5S346, D2S123 and
D17S250 loci as described earlier.
37
Tumours with
instability at two or more markers were classified as
MSI, whereas a ll others were designated as MSS.
The identification of KRAS mutat ions within the
codon 12 and 13 hotspot, as well as the BRAF V600E
mutation, was determined by pyrosequenci ng.
39
SNP (rs16906252) Genotyping
For germline genotyping, DNA derived from normal
colonic mucosa was amplified using primers
TGCAGGACCACTCGAGGCTGCCA and CCCGGA
TATGCTGGGACAGCCC flanking the C4T SNP
(rs16906252) with annealing at 681C. The 167-bp
amplification fragments were digested with HhaI
(New England Biolabs) and resolved by agarose gel
electrophoresis. Presence of the G allele resulted in
digestion to fragments of 97 and 70 bp, whereas the
A allele remained undigested. A subset of tumours
from heterozygous cases was also studied to confirm
retention of both alleles before allelic bisulphite
sequencing.
Methylation Analyses
Genomic DNA derived from the peripheral blood
mononuclear cells of a healthy volunteer were used
as an unmethylated control. The same DNA was
treated with M.Sss1 methyltransferase (New Eng-
land Biolabs) to generate an in vitro methylated
control. Up to 2 mg of DNA from tumours and the
methylated and unmethylated controls were con-
verted with sodium bisulphite using the EZ Methy-
lation-Gold kit (Zymo Research, Oran ge, CA, USA).
Methylation analyses were performed using 100 ng
bisulphite-converted DNA as PCR template. A map
of the MGMT CpG island and assays used to assess
the methylation status at the MGMT promoter is
given in Figure 1a.
Combined Bisulphite Restriction Analysis
Combined bisulphite restriction analyses (COBRA)
within the CpG island spanning the MGMT promo-
ter and six other CpG-island-associated genes within
chromosome 10q26 were performed using primers
specific for bisulphite-converted DNA and unbiased
with respect to the methylation status of the temp-
lates. Primers, amplification conditions and restric-
tion enzymes used for the detection of methylation
are listed in Supplementary Table 1. A CpG din-
ucleotide and restriction map for the MG MT COBRA
assay is given in Figure 1 and for the other 10q26
genes in Supplementary Figure 1. After gel electro-
phoresis, the degree of methylation was estimated
visually by the relative intensities of the digested
and undigested fragments. On this basis, the
samples were independently classified as methy-
lated or unmethylated by two observers who were
blinded with respect to the results of other analyses.
For MGMT, methylation was detected by the
presence of the digested bands of 100 and 62 bp
(Figure 1a and b). There was complete concordance
in the interpretation of MGMT methylation status for
1123 tumours between the two observers. Samples
for which no reliable methylation result was
obtained, or the two observers failed to agree, were
excluded from further analysis.
Allelic Bisulphite Sequencing
Allelic MGMT methylation patterns were deter-
mined in tumours heterozygous for the C4T SNP
(rs16906252) using primers GTTTGTAGGATTATT
YGAGGTTGTTAT and CCCCRAATATACTAAAACA
ACCC to amplify a 171-bp fragment containing the
SNP and 18 CpG sites. These primers were specific
to bisulphite-converted templates from the anti-
sense strand, such that the C/T SNP was detected
as the complementary bases G/A. The PCRs were
conducted using cycling conditions that preferen-
tially amplified methylated templates to reduce the
number of unmethylated alleles amplified, as a
proportion of the tumour specimens had relatively
low levels of methylation as detected by COBRA.
The first seven cycles were performed with anneal-
ing at 721C in the first cycle, then at 11C for each
subsequent cycle, followed by 30 cycles with
annealing at 651C. PCR products were cloned using
the pGEMTeasy PCR cloning system (Promega) and
12–20 colonies picked. Plasmid inserts were se-
quenced using the SP6 vector primer by fluorescent
dideoxy-sequencing on an ABI PRISM 3700 DNA
Sequencer.
Quantitative Real-Time Methylation-Specific PCR
with Temperature Dissociation
Quantitative real-time methylation-specific PCR
was carried out for MGMT using primers (5
0
-3
0
)
MGMT methylation linked to germline SNP
1590 NJ Hawkins et al
Modern Pathology (2009) 22, 15881599
TCGTTCGGTTTGTATTGGTC and TCTACGCATCCT
CGCTAAAC. MyoD was used as a control for DNA
input and integrity.
40
Amplifications were con-
ducted in triplicate in 20 ml volumes using 0.3 mM
primers and 1 iQ SYBR-Green Supermix (BioRad)
on the MyiQ single-colour PCR detection system
(BioRad). Cycle threshold (C
T
) values were obtained
using MyiQ software version 5.0 (BioRad). Anneal-
ing was at 621C and a fourth step at 81 1C was
included in each cycle during which the fluores-
cence output was measured to avoid any non-
specific signal from primer dimers. The number of
methylated fragments was calculated at the C
T
against a standard curve of serially diluted plasmids
containing 25, 50 and 10
2
–10
6
copies of the target
sequence for MGMT and MyoD. Percentage methyla-
tion reference (PMR) values were calculated with
reference to the Human CpGenome Universal
Methylated DNA (Chemicon) control, as described
earlier.
41
After amplification, a melt curve was
performed from 72 to 951C with fluorescence
measurements at 0.51C intervals to determine the
melting temperature of the amplicons. Uniform
dissociation of ampli fication products at the correct
temperature ensured product spe cificity. This assay
was capable of detecting methylation at PMR levels
of 0.01 in the presence of 42.5 10
4
copies of the
MyoD control gene (approximately 200 ng input
DNA), which was achieved for each sample tested.
CpG Island Methylator Phenotype
The CIMP status of tumours was assessed by
MethyLight at the CACNA1G, RUNX3, IGF2, NEU-
ROG1 and SOCS1 loci, as described earlier.
3
Tumours were classified as CIMP positive (CIMP þ )
in which Z3 loci showed methylation levels at a
PMR value 44.
27
MGMT Expression Analyses
Semi-quantitative real-time RT–PCR
Total RNA was extracted from fresh-frozen color-
ectal cancer and matched normal colonic mucosa
specimens using the Midi-Mini RNA extraction kit
(Invitrogen). RNA samples were treated with DNase
I and cDNAs were prepared from 2 mg total RNA
using the First Strand Superscript III cDNA synth-
esis kit with oligo-dT
20
primers (Invitrogen). A
control with reverse transcriptase omitted was
performed for each sample. PCR amplification was
conducted across the final two exons of MGMT
using primers (5
0
-3
0
) GAGGAGCAATGAGAGGCA
ATCCT and CATCCGATGCAGTGTTACA CGT, and
the HPRT housekeeping gene using primers AATTA
TGGACAGGACTGAACGTC and GGCGATGTCAAT
AGGACTCCAGATG. Amplifications were performed
in triplicate using 200 ng cDNA or RT minus control
as template with annealing at 591ContheMyiQ.
Quantitation of the relative levels of MGMT expression
in tumour versus paired normal colonic mucosa was
performed using the C
T
values according to the Pfaffl
method.
42
Immunohistochemistry
Tissue microarrays were constructed using dupli-
cate cores from formalin-fixed paraffin-embedded
tumour tissues. A measure of 4 mM sections were
dewaxed and rehydrated on silane-coated slides
before antigen retrieval and blocking with 3%
hydrogen peroxidise and 2% skimmed milk. Sec-
tions were incubated with a 1:50 dilution of
monoclonal mouse anti-human MGMT antibody
(Clone MT3.1, Santa Cruz) for 1 h at room tempera-
ture and bound antibody was detected with horse-
radish peroxidise conjugated polymer antibody
(Novocastra). Sections were counterstained with
haematoxylin. A negative staining control with the
primary antibody omitted was included. Slides were
visualised under white light at 10 magnification
and interpreted by a pa thologist (NJH) blinded to
methylation status. Staining was considered asses-
sable in which nuclear staining of MGMT was
visible in either stromal or germinal follicle lym-
phocyte cells, or in normal colonic epithelial cells at
the margins of the tumour. Tumours were consid-
ered negative for MGMT expression in which
nuclear staining for MGMT in tumour cells was
either entirely absent or significantly reduced in
comparison to adjacent normal cells.
Statistical Analyses
The methylation status of the MGMT promoter was
analysed as a categorical variable. Analyses to detect
any differences in frequency between categorical
variables were performed using the w
2
test. An
independent t-test was used to test whether MGMT
methylation correlated with age. The Mann–Whitney
U-test was use d to assess wheth er non-normally
distributed values (methylation, mRNA expression
levels) differed between groups. Multivariate analysis
using the binary logistic regression model was
performed to determine independent factors among
covariates that had shown significant associations.
The Spearman and Pearson tests were used to
determine whether the levels of methylation in normal
colonic mucosa were associated with age, and if this
was linear. All reported probability (P) values were
two sided and a value of r0.05 was considered
significant. The SPSS v17.0 statistical package (SPSS
Chicago, IL, USA) was used for all statistical analyses.
Results
Frequency and Allelic Pattern of MGMT Promoter
Methylation in Colorectal Cancer
The frequency of MGMT promoter methylation in
this series of colorectal carcinoma was 28% (312 of
MGMT methylation linked to germline SNP
NJ Hawkins et al 1591
Modern Pathology
(2009) 22, 15881599
1123 tumours), as detected by COBR A. However, it
was notable that there was considerable variability
in the degree of methylation between tumours
(Figure 1b). Clearly, some tumours displayed quite
low levels of MGMT methylation, whereas in others,
high levels of methylation were detected consistent
with biallelic methylation. To determine whether
indeed both alleles were affected, allelic bisulphite
sequence analysis was performed across a prom-
oter fragment containing the exon 1 C4T SNP
(rs16906252) site and a number of flanking CpG
dinucleotides in heterozygous tumours with vari-
able levels of methylation as assessed by COBRA
(Figure 1a). Allelic bisulphite sequencing was
performed from the antisen se strand of MGMT on
which the polymorphic content of the SNP was
preserved as G/A after sodium bisulphite conver-
sion (Figure 1a). Of the 18 MGMT-methylated
tumours studied, eight (with methylation levels
estimated by COBRA to be between 10 and 80%)
showed biallelic methylation (Figure 1c; Supple-
mentary Figure 2). How ever, 10 (methylat ed at levels
of 10–50% by COBRA) showed monoallelic methy-
lation. Interestingly, methylation in each of these 10
tumours was specific to the T:A allele (Figure 1c;
Supplementary Figure 3). One heterozygous tumour
that was unmethylated by COBRA was confirmed to
be unmethylated by allelic bisulphite sequencing
(Supplementary Figure 2).
Correlation with Transcriptional Repression and Loss
of Protein Expression
The levels of MGMT transcription were compared
between 14 primary colorectal carcinoma with
either confirmed biallelic methylation or high levels
of promoter methylation (Z50% by COBRA) and 16
unmethylated tumours, with respect to their
matched normal colonic mucosa, using semi-quan-
titative real-time RT–PCR. MGMT expression was
significantly reduced in the methylated tumours
compared with unmethylated tumours, confirming
that methylation results in transcriptional repres-
sion (Figure 1d).
To examine the relationship between MGMT
methylation and protein expression, immunoperox-
idase staining was performed on a subset of 402
tumours of which 120 (30%) displayed methylation
of the MGMT promoter. As expected, MGMT protein
loss was highly concordant with promoter methyla-
tion (w
2
Po0.0001). In tumours showing immuno-
histochemical loss of MGMT expression (n ¼ 62), 48
(77%) were methylated, consistent with earlier
findings that methylation of this gene repres ents a
major cause of protein loss in colorectal cancer.
9
However, methylation was also found in 72 (21%) of
the 340 tumours with normal staining. Immunohis-
tochemistry results were available for nine of the
tumours that were monoallelically methylated (Sup-
plementary Figure 3), and protein expression was
retained in six of these. Expression of MGMT was
presumably derived from the unmethylated allele in
these six tumours. This contrasted to the complete
loss of MGMT protein in the five biallelically
methylated tumours for which immunohistochem-
istry data was available (Supplementary Figure 3).
MGMT Methylation Occurs as a Localised Event
within Chromosome Region 10q26
To determine whether methylation of MGMT
occurred as an isolated event or was subject to
long-range epigenetic silencing in tumourigenesis,
we sought evidence of concomitant promoter
methylation of MGMT and neighbouring genes
within 10q26. The methylation status of six gene-
associated CpG islands flanking MGMT and span-
ning a 2.3 Mb region of 10q26 was examined by
COBRA in 40 pairs of primary colorectal carcinoma
and their matched normal colonic mucosae, of
which 20 tumours had Z50% MGMT methylation
and 20 were unmethylated at MGMT (Figure 2). The
FOXI2 gene, over 1.5 Mb upstream of MGMT, was
methylated at high levels in all tumours irrespective
of the MGMT methylation status, and at lower levels
in the majority of normal colonic mucosae. FOXI2
methylation is thus independent of MGMT and may
occur in a tissue-dependent manner, consistent with
the lack of expression of the en coded Foxi2 trans-
cription factor in the colon.
43
The EBF3 gene,
situated approximately 500 kb downstream of
MGMT and expressed from the opposite strand,
was more frequently methylated in tumours that
were also methylated at MGMT (Mann–Whitney U:
P ¼ 0.00015, Figure 2). No other genes in the 2.3 Mb
region studi ed were found by COBRA to be
methylated in tumours or normal colonic mucosa.
Although MGMT and the neighbouring EBF3 gene
may frequently be concomitantly methylated in
colorectal cancer, this is distinct from earlier
observations of long-range epigenetic silencing, in
which multiple genes within large contiguous
regions spanning 41 Mb were co-ordinately methy-
lated.
4,5
Correlations of MGMT Methylation with
Clinicopathological and Molecular Features of
Colorectal Cancer
MGMT methylation correlated with increased age,
female gender, mucinous histology, conspicuous
intraepithelial lymphocytes and absence of lympho-
vascular space invasion (Table 1). In addition, a
number of molecular factors including MSI and
MLH1 methylation, CIMP þ, KRAS and BRAF
V600E mutations, and methylation of CDKN2A also
correlated with MGMT methylation (Table 1). Tu-
mour stage, grade and location did not show a
relationship with MGMT methylation (data not
shown). In univariate analysis, the strongest asso-
MGMT methylation linked to germline SNP
1592 NJ Hawkins et al
Modern Pathology (2009) 22, 15881599
Tumors
C+
C-
162 bp
100 bp
62 bp
12 4 5 910 -12 15 1676831814--
MGMT promoter CpG map
COBRA
12 4 5 910 -12 15 1676831814--
Biallelic methylation
Monoallelic meth
y
lation of T:A allele
AG
SNP rs16906252:
Allelic sequencing
TaqI
62bp 100bp
G>A
171bp
Exon 1
qMSP
134bp
COBRA
Allelic sequencing
rs16906252
C>T
Enhancer
Minimal promoter
MGMT transcription in colorectal
cancers by methylation status
Unmethylated
(n-16)
Methylated
(n=14)
0.0
1.0
2.0
3.0
P=0.029
20% methylated tumor
80% methylated tumor
MMM MMUU
L
+1
-169-302
-220-381
+151
-20
+54
Relative level of expression
Figure 1 Methylation of the CpG island spanning the MGMT promoter in colorectal carcinoma. (a)CpGmapoftheMGMT promoter region
and assays used to determine methylation status in bisulphite-converted DNA. The region shown consists of 507bp of the CpG island
affected by methylation in colorectal cancer , spanning the minimal promoter region, first exon and 59 bp enhancer element, as labelled. The
MGMT transcription start site, denoted by the grey arrow, is at position þ 1. The C4T SNP (rs16906252) is located at þ 54 bp within exon 1
and the enhancer. Vertical lines show the positions of CpG dinucleotides. Horizontal bars indicate PCR amplification fragments for
methylation assays, with horizontal arrows showing primer positions, with fragment sizes in base pairs shown, and numbers ( þ /)their
position with respect to the transcription start site. COBRA was used to determine the methylation status and levels in colorectal carcinoma,
with TaqI digestion indicating the presence of methylation at the CpG site indicated by a downward arrow. qMSP assay was used to detect
and measure methylation levels in normal colonic mucosa. Allelic sequencing was performed from the antisense strand on which the C4T
SNP was detected as G4A. (b) Representative examples of COBRA in tumours to determine methylation status. L, pUC19/MSpI DNA ladder,
C þ , M.SssI in vitro methylated control DNA, C, unmethylated control DNA from peripheral blood, M, methylated tumour, U,
unmethylated tumour. (c) Representative patterns of allelic bisulphite sequencing of two colorectal carcinoma. Horizontal lines indicate
individual alleles, circles denote individual CpG dinucleotides with black indicating a methylated CpG and white indicating an
unmethylated CpG. Above, a tumour that is methylated on both genetic alleles of the MGMT promoter. Below, a tumour that is methylated
specifically on the A:T allele of SNP rs16906252. (d) Box plot showing the pooled relative levels of MGMT transcription between
unmethylated and methylated tumours with respect to their matched normal colonic mucosa and normalised to HPRT.ThelevelofMGMT
transcription was significantly reduced in the methylated tumours (median 0.047) compared with the unmethylated tumours (median 0.34).
Low levels of MGMT expression detected in the methylated tumours may be derived from normal cells within the tumour tissue.
MGMT methylation linked to germline SNP
NJ Hawkins et al 1593
Modern Pathology
(2009) 22, 15881599
ciations with MGMT methylation were found with
CDKN2A methylation (OR 2.3, 95% CI 1.7–3.0,
Po0.0001), KRAS mutations (OR 2.1, 95% CI 1.6–
2.7, Po0.0001), CIMP þ (OR 1.8, 95% CI 1.2–2.5,
P ¼ 0.002), absent lymphovascular space invasion
(OR 1.7, 95% CI 1.3–2.2, Po0.0001) and female
gender (OR 1.6, 95% CI 1.2–2.0, Po0.0001). When
variables significant in univariate analysis were
included in a multivariate analysis, only female
gender (OR 1.5, 95% CI 1.2–2.0, P ¼ 0.001), CDKN2A
methylation (OR 2.0, 95% CI 1.5–2.7, Po0.0001),
absent lymphovascular space invasion (OR 1.6, 95%
CI 1.2–2.1, P ¼ 0.003) and presence of KRAS mutations
(OR 1.9, 95% CI 1.5–2.6, Po0.000 l) remained sig-
nificant. As reported earlier ,
26,44
there was a strong
association between CDKN2A methylation, CIMP þ
(OR 9.4, 95% CI 5.9–15.1, Po0.0001) and MLH1
methylation (OR 5.7, 95% CI 3.6–8.9, Po0.0001),
respective ly.
Relationship of KRAS G4A Transitions and MGMT
Methylation
Activating mutations within codons 12 and 13 of
KRAS were found in 32% of cancers in this series
and 60% of the mutations were G4A transitions
(Table 2).
39
As stated above, MGMT methylation had a
close and independent correlation with the presence
of a KRAS mutation. However, on classification of
the KRAS mutant cancers by mutation type, no
association was found between MGMT methylation
and G4A mutations compared with non-G4A
mutations, and in fact frequency of methylated and
unmethylated tumours was approximately equal for
each mutation category (Table 2). Furthermore, no
association was found between loss of MGMT
protein express ion and presence of a KRAS muta-
tion (P ¼ 0.09), nor G4A transitions (P ¼ 0.2).
Close Association Between MGMT Methylation and
Germline C4T SNP (rs16906252)
Of the cohort of 1123 cases, constitutional DNA was
available for 1039 cases and these were genotyped
for the germline C4T SNP (rs16906252). The
frequency of the T allele in this cohort was 8%
(two cases homozygous T/T, 151 heterozygous C/T,
886 homozygous C/C, conforming to Hardy–Wein-
berg equilibrium) (Table 1). In a univariate analysis,
the presence of the T allele (C/T and T/T genotypes
combined) was strongly associated with MGMT
methylation (OR 5.5, 95% CI 3.8–7.9, Po0.0001)
and these results were unaltered in a multivariate
analysis, which adjusted for age and sex.
Low-Level MGMT Methylation in Normal-Appearing
Colonic Mucosa
The possibility that methylation of MGMT might
precede and predispose to the development of
colorectal cancer was assessed by screening the
normal colonic mucosa from 100 cases with color-
ectal cancer and 20 individuals without neoplasia
for low levels of promoter methylation using a
sensitive real-time methylation-specific PCR assay
followed by a temperature dissociation curve to
verify any positive signals (qMSP) (Figure 1a). The
results were obtained for 50 cases with a methylated
tumour selected at random from the cohort and 47
1 Mb
FOXI2
PTPRE
MK167
MGMT
EBF3
AKO94118
GLRX3
MGMT methylated
MGMT unmethylated
CpG island map of 10q26.2-q26.3
FOXI2
PTPRE
MK167
MGMT
EBF3
AKO94118
GLRX3
FOXI2
PTPRE
MK167
MGMT
EBF3
AKO94118
GLRX3
Paired normal colonic mucosa
x16
x4
x17
x3
Methylation status across 10q26.2-q26.3
Primary colorectal carcinoma
Figure 2 Chromosome region 10q26 methylation status in color-
ectal carcinomas. (a) Map of genes associated with CpG islands
within chromosome region 10q26.2–q26.3 flanking the MGMT
gene. Genes are depicted as grey boxes, with those above the
horizontal line expressed from the sense strand and those below
the line transcribed from the antisense strand. CpG islands
spanning the promoters of the genes are indicated by lollipops. (b)
Methylation status of the CpG islands spanning the 10q26 genes
as determined by COBRA in 20 primary colorectal carcinoma with
MGMT promoter methylation at Z50% and 20 tumours un-
methylated at MGMT and their paired normal colonic mucosa.
Each circle represents the CpG island of a gene, as labelled above.
Black circles indicate methylation at levels of 410%, grey circles
indicate methylation at r10% and white circles indicate absence
of methylation. Each line linking the circles represents an
individual specimen, or multiples thereof showing the same
methylation profile, as indicated.
MGMT methylation linked to germline SNP
1594 NJ Hawkins et al
Modern Pathology (2009) 22, 15881599
age-matched (
±
5 years) cases with an unmethylated
tumour. The age (mean 68
±
12 years) and gender (44
females and 53 males) of these cases was represen-
tative of the cohort. MGMT methylation was de-
tected in the normal colonic mucosa of 53/97 (55%)
patients with colorectal cancer (PMR ran ge 0–9.7)
and 9/20 (45%) individuals without neoplasia (PMR
range 0–1.8), but there was no significant difference
between the two groups (Figure 3a), indicating that
presence of MGMT methylation in normal colonic
mucosa was not associated with colorectal cancer
per se. However, when the cases were stra tified by
the MGMT methylation status of their matched
tumours, methylation was significantly increa sed
in the normal colonic mucosa of patients whose
tumours were correspondingly methylated (Figure
3b). When the normal colonic mucosa samples of
colorectal cancer cases were classified according to
the genotype of the MGMT C4T SNP (rs16906252),
irrespective of the methylation status of the matched
tumour, MG MT methylation was significantly in-
creased in those harbouring the T allele (Figure 3c).
Table 1 Statistical comparisons of the clinicopathological and molecular features of patients by methylation status of the MGMT
promoter
Valid cases, tumours (%) MGMT Meth (%) MGMT Unmeth (%) P-value
Clinicopathological tumour features
Mean age, years (
±
1 s.d.) 68.9
±
12.2 70.4 (
±
12.6) 68.3 (
±
12.0) 0.012*
Gender 1123 (100)
Female 505 (45.0) 167 (33.1) 338 (66.9) 0.000
Male 618 (55.0) 145 (23.5) 473 (76.5)
Mucinous histology 1119 (99.6)
Mucinous 230 (20.5) 78 (33.9) 152 (66.1) 0.033
Non-mucinous 889 (79.2) 234 (26.3) 655 (73.7)
IELs 1122 (99.9)
Conspicuous 176 (15.7) 64 (36.4) 112 (63.6) 0.018
Inconspicuous 946 (84.2) 248 (26.2) 698 (73.8)
Lymphovascular space invasion 1113 (99.1)
Absent 669 (59.6) 213 (31.8) 456 (68.2) 0.001
Present 444 (39.5) 96 (21.6) 348 (78.4)
Molecular features of tumour
Microsatellite status 1121 (99.8)
MSI 146 (13.0) 53 (36.3) 93 (63.7) 0.037
MSS 975 (86.8) 258 (26.5) 717 (73.5)
CIMP status 1120 (99.8)
Positive 156 (13.9) 60 (38.5) 96 (61.5) 0.003
Negative 964 (85.8) 252 (26.1) 712 (73.9)
BRAF mutation status 1119 (99.6)
V600E Mutant 138 (12.3) 49 (35.5) 89 (64.5) 0.047
Wild type 981 (87.4) 263 (26.8) 718 (73.2)
KRAS mutation status 1121 (99.9)
Mutant 358 (31.9) 137 (38.3) 221 (61.7) 0.000
Wild type 763 (68.0) 175 (22.9) 588 (77.1)
MLH1 methylation 1101 (98.1)
Methylated 127(11.3) 49 (38.6) 78 (61.4) 0.003
Unmethylated 974 (86.8) 261 (26.8) 713 (73.2)
CDKN2A methylation 1075 (95.7)
Methylated 481 (42.8) 182 (37.8) 299 (62.2) 0.000
Unmethylated 594 (52.9) 126 (21.2) 468 (78.8)
Patient genotype
SNP rs16906252 1039 (92.5)
CT 151 (13.4) 91 (60.3) 60 (39.7)
TT 2 (0.2) 2 (100) 0 (0) 0.000
CC 886 (78.9) 195 (22.0) 691 (78.0)
The number of cases (tumours) for which data was available is listed for each parameter tested. The percentages provided in the third and fourth
columns are with respect to the group against which MGMT methylation status is being tested. All P-values were performed using w
2
test, except
for a comparison of age in which a Student’s t-test was used. Meth, methylated; Unmeth, unmethylated; IELs, intraepithelial lymphocytes.
Table 2 Relationship of KRAS G4A transitions and MGMT promoter methylation
Molecular feature Valid cases (%) MGMT Meth (%) MGMT Unmeth (%) P-value, w
2
KRAS mutation type 358 (100)
G4A transitions 213 (59.5) 81 (59.1) 132 (59.7) P ¼ 0.91
Other mutations 145 (40.5) 56 (40.9) 89 (40.3)
MGMT methylation linked to germline SNP
NJ Hawkins et al 1595
Modern Pathology
(2009) 22, 15881599
In the individuals without neoplasia, of whom 15
were homozygous CC and five were heterozygous C/
T (conforming to Hardy–Weinberg equilibri um),
methylation was also associated with the T allele
(Figure 3d). There was a non-linear association
between age and the level of MGMT methylation
detected in normal colonic mucosa, both for colo-
rectal cancer cases (Spearman correlation r ¼ 0.36,
P ¼ 0.0004) and for individuals without neoplasia
(Spearman correlation r ¼ 0.3, P ¼ 0.036). There was
no associ ation between gender and methylation
levels in normal colonic mucosa.
Discussion
This investigation used a large colorectal cancer
cohort to determine the frequency of MGMT pro-
moter methylation in sporadic colorectal cancer, as
well as associated clinicopathological and molecu-
Cancer cases by methylation status
No-neoplasia by SNP genotypeCancer cases by SNP genotype
CC
(n=52)
CT/TT
(n=45)
0.0
2.5
5.0
7.5
10.0
P<0.0001
0.00
0.60
Paired Tumour
PMR
P<0.0001
Unmethylated
(n=47)
Methylated
(n=50)
0.0
2.5
5.0
7.5
10.0
0.0
0.38
CC
(n=15)
CT
(n=5)
0.0
0.5
1.0
1.5
P=0.015
0.00
0.35
Cancer presence
No neoplesia
(n=20)
Cases
(n=97)
0.0
2.5
5.0
7.5
10.0
0.04
0.00
P=0.2
No-neoplasia versus cases
MGMT SNP rs16906252 MGMT SNP rs16906252
Normal colonic mucosa in colorectal cancer cases and no-neoplasia controls:
PMR
PMR
PMR
Figure 3 MGMT promoter methylation in normal colonic mucosa. Plots showing the degree of MGMT methylation expressed as the PMR
detected by quantitative real-time methylation-specific PCR in normal colonic mucosa. Methylation levels were compared between
groups of normal colonic mucosa using the Mann–Whitney U-test and the P-values are indicated for each of the groups tested. (a) MGMT
methylation levels in the normal colonic mucosa of individuals without neoplasia and paired normal colonic mucosa of colorectal cancer
cases were not significantly different. (b) Paired normal colonic mucosa from colorectal cancer cases as divided by the MGMT
methylation status of the paired tumour showed that methylation levels were higher in the normal colonic mucosa of cases with a
correspondingly methylated tumour. (c) Paired normal colonic mucosa of cases with colorectal cancer and (d) normal colonic mucosa
from individuals without neoplasia, each divided according to genotype at the germline C/T SNP (rs16906252) within the MGMT
transcriptional enhancer. MGMT methylation levels were significantly higher in the normal colonic mucosa of both cases and no-
neoplasia controls harbouring the T allele of the SNP.
MGMT methylation linked to germline SNP
1596 NJ Hawkins et al
Modern Pathology (2009) 22, 15881599
lar features. MGMT methylation was identified in
28% of tumours. This is a slightly lower prevalence
than the generally reported range, perhaps reflecting
the analytical sensitivities of the various methyl-
ation assays.
9–13
The strong but incomplete concor-
dance between MGMT methylation, transcriptional
repression and protein loss is well established,
9–11
and our findings confirm that promoter methylation
is the predomi nant cause of MGMT loss in sporadic
colorectal cancer.
Our study has provided new insight into the
mechanisms underpinning MGMT methylation in
colorectal cancer. We found no evidence for a
mechanism of long-r ange epigenetic silencing oper-
ating within the vicinity of MGMT. Rather, the
localised methylation of MGMT and the adjacent
EBF3 gene are most likely attributable to epigenet ic
dysregulation confined to one or both closely linked
genes. Consistent with the involvement of a cis-
acting factor, presence of the T allele of the linked
C/T germline SNP within the transcriptional
enhancer element of MGMT was a key predictor of
MGMT promoter methylation in colorectal cancer.
This finding confirms an earlier report in another
colorectal cancer population.
35
Furthermore, we
showed that the T allele is preferentially methylated
in colorectal cancer through the observation of
monoallelic methy lation of this allele in a subset
of tumours from heterozygous patients. Some of
these cancers retained MGMT protein expression
(data not shown), presumably through translation of
transcripts from the unmethylated allele. Certainly,
this provides a plausible explanation for the occur-
rence of methylation in tumours with normal
MGMT expression, as assessed by immunohisto-
chemistry. In other cancers with monoallelic methy-
lation, protein expression was lost, possibly because
of disruption of the unmethylated allele by genetic
mechanisms.
21
In addition, we found that the
T allele was associated with detectable levels of
MGMT methylation in the paired normal co lonic
mucosa of cases with colorectal cancer, particularly
those cases in which the tumour was correspond-
ingly methylated, indicating that methylation may
indeed be a precursor to neoplasic development.
Other studies have also shown that MGMT methyla-
tion occurs in the normal colonic mucosa in a
proportion of colorectal cancer cases, and it has
been proposed that this may serve as a field defect
predisposing to the development of cancer.
12,30,33
However, others and we found similar levels of
MGMT methylation in the normal colonic mucosa of
individuals without neoplasia as well,
12,33
which we
additionally show is associated with the T allele of
SNP rs16906252. This provides strong evidence that
the T allele predisposes to MGMT methylation in
normal colonic mucosa. The relatively low fre-
quency (28%) of MGMT methylation identified
may reflect the reduced frequency (8%) of the
C4T allele of the SNP in this colorectal cancer
cohort (compared with 35% methylation in colo-
rectal cancers with a C4T allele frequency of 9.2%
in the study cohort by Ogino et al),
35
as opposed to
any technical idiosyncrasy in the method used for
methylation detection.
The precise mechanism by which the C4 T
polymorphism renders the promoter susceptible to
methylation remains to be clarified. Functional
studies have shown that delet ion of the 59-bp
enhancer element, within which this SNP is located,
reduces transcriptional activity of the MGMT pro-
moter by 95%.
36
A minimal protein binding motif of
9 bp located just 24–33 bp downstream of the SNP
site has been shown to bind a 45 kDa transcriptional
activator termed as the MG MT enhancer-binding
protein.
45
Yet, enhancer activity increased with the
incorporation of additional sequences flanking this
motif, suggesting that nearby sequences also con-
tribute to transcriptional activity.
45
Thus, it is
possible that the C4T change results in down-
regulation of transcription with resultant accrual of
methylation. Definitive evidence to show that the T
allele incurs methylation of the MGMT promoter
and that this in turn directly precedes and predis-
poses to neoplastic development, would require
further functional assessment, as well as prospective
and population-based cohort studies. If proven to be
the case, this germline SNP may serve as a genetic
risk marker for colorectal cancer, as well as other
types of cancer in whic h MGMT methylation is
frequently observed.
We found a strong association between MGMT
methylation and methylation of CDKN2A and
MLH1, as well as CIMP þ in our cohort, consistent
with earlier studies.
26,44
The independent associ a-
tion we identified between MGMT and CDKN2A
methylation on multivariate analysis suggests that
these two loci may be targets of a common mechan-
ism of epigenetic dysregulation that also underlies
the interrelated features of MLH1 methylation and
CIMP þ. Thus, while the C4T SNP is a key feature
in MGMT methylation, generalised epigenetic dis-
ruption that underpins the methylation of addi-
tional genes may also be a contributing factor.
The presence of MGMT methylation within
tumours also correlated with female gender and
age, consistent with some, but not other studies of
this gene.
10–12
There is a general trend evident at
other loci, for both women and the elderly, to show
more frequent aberrant methylation in tumours.
46,47
The frequency and level of MGMT methylation in
normal colonic mucosa was also age related, sug-
gesting that additional factors influence the accumu-
lation of methylation at the MGMT promoter.
Our study confirmed the earlier reported link
between MGMT methylation and presence of a
KRAS mutation, but found no specific preference
for G4A transitions, and no association with
MGMT protein loss and the presence or nature of
KRAS mutations. Our findings suggest that MGMT
methylation occurs in the context of a KRAS
mutation, but do not support a direct causal model
MGMT methylation linked to germline SNP
NJ Hawkins et al 1597
Modern Pathology
(2009) 22, 15881599
between MGMT inactivation and accrual of G4A
mutations. In a recent study of comparable size, an
increased rate of KRAS G4A mutations was found
in colorectal cancers with loss of the MGMT protein,
but not with promoter methylation of MGMT.
10
Thus, it is plausible that loss of MGMT precedes
and induces G4A transitions in a subset of color-
ectal cancers, irrespective of the mechanism of
MGMT loss. However, the results of our study
coupled with the lack of consistency in the findings
of other studies
11,12,15,17,19–21
argue against this direct
sequence of events as a generalised phenomenon in
the development of colorectal cancer. The concur-
rence of these epigenetic and genetic lesions in a
subset of colorectal cancers suggests a more complex
relationship between these events, perhaps akin to
the close association between MLH1 methylation
and the BRAF V600E mutation.
The various molecular and clinicopathological
associations with MGMT methylation have been
inconsistent between studies in different colorectal
cancer populations. This study represents the largest
and most comprehensive study undertaken of this
kind in a single colorectal cancer cohort, and thus may
help reconcile these outstanding controversies. The
frequency of the various features we tested for
associations were typical of other sporadic colorectal
cancer populations,
37–39
andsoitisunlikelythatour
study of a single consecutive series of colorectal
cancers incurred any significant selection bias. In
summary, our results suggest that the germline C4T
genotype represents a strong determinant of MGMT
methylation, and additional factors including female
gender and generalised epigenetic dysfunction are
also contributory factors. MGMT methylation is
strongly associated with KRAS mutation, but as
opposed to a causal link, this may represent an
interrelated occurrence of epigenetic and genetic
aberrations in this subset of colorectal cancers.
Acknowledgements
We thank Ms Sue Ku for technical assistance.
This work was funded by the Cancer Counci l NSW
and the Australian National Health and Medical
Research Council.
Disclosure/conflict of interest
The authors declare no conflict of interest.
References
1 Jones PA, Baylin SB. The epigenomics of cancer. Cell
2007;128:683–692.
2 Toyota M, Ahuja N, Ohe-Toyota M, et al. CpG island
methylator phenotype in colorectal cancer. Proc Natl
Acad Sci USA 1999;96:8681–8686.
3 Weisenberger DJ, Siegmund KD, Campan M, et al. CpG
island methylator phenotype underlies sporadic mi-
crosatellite instability and is tightly associated with
BRAF mutation in colorectal cancer. Nat Genet
2006;38:787–793.
4 Frigola J, Song J, Stirzaker C, et al. Epigenetic
remodeling in colorectal cancer results in coordinate
gene suppression across an entire chromosome band.
Nat Genet 2006;38:540–549.
5 Hitchins MP, Lin VA, Buckle A, et al. Epigenetic
inactivation of a cluster of genes flanking MLH1 in
microsatellite-unstable colorectal cancer. Cancer Res
2007;67:9107–9116.
6 Walther A, Houlston R, Tomlinson I. Association between
chromosomal instability and prognosis in colorectal
cancer: a meta-analysis. Gut 2008;57:941–950.
7 Spano JP, Milano G, Vignot S, et al. Potential predictive
markers of response to EGFR-targeted therapies in color-
ectal cancer. Crit Rev Oncol Hematol 2008;66:21–30.
8 Majer M, Akerley W, Kuwada SK. Oncologists’ current
opinion on the treatment of colon carcinoma. Antic-
ancer Agents Med Chem 2007;7:492–503.
9 Esteller M, Hamilton SR, Burger PC, et al. Inactivation
of the DNA repair gene O6-methylguanine-DNA
methyltransferase by promoter hypermethylation is a
common event in primary human neoplasia. Cancer
Res 1999;59:793–797.
10 Ogino S, Kawasaki T, Kirkner GJ, et al. Molecular
correlates with MGMT promoter methylation and silen-
cing support CpG island methylator phenotype-low
(CIMP-low) in colorectal cancer . Gut 2007;56:1564–1571.
11 Nagasaka T, Goel A, Notohara K, et al. Methylation
pattern of the O6-methylguanine-DNA methyltransfer-
ase gene in colon during progressive colorectal
tumorigenesis. Int J Cancer 2008;122:2429–2436.
12 Shen L, Kondo Y, Rosner GL, et al. MGMT promoter
methylation and field defect in sporadic colorectal
cancer. J Natl Cancer Inst 2005;97:1330–1338.
13 Fox EJ, Leahy DT, Geraghty R, et al. Mutually exclusive
promoter hypermethylation patterns of hMLH1 and
O6-methylguanine DNA methyltransferase in color-
ectal cancer. J Mol Diagn 2006;8:68–75.
14 Gerson SL. MGMT: its role in cancer aetiology and
cancer therapeutics. Nat Rev Cancer 2004;4:296–307.
15 Esteller M, Toyota M, Sanchez-Cespedes M, et al.
Inactivation of the DNA repair gene O6-methylguanine-
DNA methyltransferase by promoter hypermethylation is
associated with G to A mutations in K-ras in colorectal
tumorigenesis. Cancer Res 2000;60:2368–2371.
16 Esteller M, Risques RA, Toyota M, et al. Promoter
hypermethylation of the DNA repair gene O(6)-
methylguanine-DNA methyltransferase is associated
with the presence of G:C to A:T transition mutations in
p53 in human colorectal tumorigenesis. Cancer Res
2001;61:4689–4692.
17 Whitehall VL, Walsh MD, Young J, et al. Methylation
of O-6-methylguanine DNA methyltransferase charac-
terizes a subset of colorectal cancer with low-level
DNA microsatellite instability. Cancer Res 2001;
61:827–830.
18 Deng G, Kakar S, Tanaka H, et al. Proximal and distal
colorectal cancers show distinct gene-specific methy-
lation profiles and clinical and molecular character-
istics. Eur J Cancer 2008;44:1290–1301.
19 Laiho P, Launonen V, Lahermo P, et al. Low-level
microsatellite instability in most colorectal carcino-
mas. Cancer Res 2002;62:1166–1170.
MGMT methylation linked to germline SNP
1598 NJ Hawkins et al
Modern Pathology (2009) 22, 15881599
20 Suehiro Y, Wong CW, Chirieac LR, et al. Epigenetic-
genetic interactions in the APC/WNT, RAS/RAF, and
P53 pathways in colorectal carcinoma. Clin Cancer Res
2008;14:2560–2569.
21 Halford S, Rowan A, Sawyer E, et al. O(6)-methylgua-
nine methyltransferase in colorectal cancers: detection
of mutations, loss of expression, and weak association
with G:C4A:T transitions. Gut 2005;54:797–802.
22 Yamamoto H, Min Y, Itoh F, et al. Differential
involvement of the hypermethylator phenotype in
hereditary and sporadic colorectal cancers with high-
frequency microsatellite instability. Genes Chromo-
somes Cancer 2002;33:322–325.
23 O
0
Brien MJ, Yang S, Clebanoff JL, et al. Hyperplastic
(serrated) polyps of the colorectum: relationship of
CpG island methylator phenotype and K-ras mutation
to location and histologic subtype. Am J Surg Pathol
2004;28:423–434.
24 Kim HC, Roh SA, Ga IH, et al. CpG island methylation
as an early event during adenoma progression in
carcinogenesis of sporadic colorectal cancer. J Gastro-
enterol Hepatol 2005;20:1920–1926.
25 O
0
Brien MJ, Yang S, Mack C, et al. Comparison of
microsatellite instability, CpG island methylation
phenotype, BRAF and KRAS status in serrated polyps
and traditional adenomas indicates separate pathways
to distinct colorectal carcinoma end points. Am J Surg
Pathol 2006;30:1491–1501.
26 Ogino S, Cantor M, Kawasaki T, et al. CpG island
methylator phenotype (CIMP) of colorectal cancer is
best characterised by quantitative DNA methylation
analysis and prospective cohort studies. Gut
2006;55:1000–1006.
27 Ogino S, Kawasaki T, Kirkner GJ, et al. Evaluation of
markers for CpG island methylator phenotype (CIMP)
in colorectal cancer by a large population-based
sample. J Mol Diagn 2007;9:305–314.
28 Ranson M, Middleton MR, Bridgewater J, et al. Lomegua-
trib, a potent inhibitor of O6-alkylguanine-DNA-alkyl-
transferase: phase I safety, pharmacodynamic, and
pharmacokinetic trial and evaluation in combination
with temozolomide in patients with advanced solid
tumors. Clin Cancer Res 2006;12:1577–1584.
29 Chan AO, Broaddus RR, Houlihan PS, et al. CpG island
methylation in aberrant crypt foci of the colorectum.
Am J Pathol 2002;160:1823–1830.
30 Menigatti M, Pedroni M, Verrone AM, et al. O6-
methylguanine-DNA methyltransferase promoter hy-
permethylation in colorectal carcinogenesis. Oncol
Rep 2007;17:1421–1427.
31 Jass JR. Serrated adenoma of the colorectum and the
DNA-methylator phenotype. Nat Clin Pract Oncol
2005;2:398–405.
32 Kakar S, Deng G, Cun L, et al. CpG island methylation
is frequently present in tubulovillous and villous
adenomas and correlates with size, site, and villous
component. Hum Pathol 2008;39:30–36.
33 Ye C, Shrubsole MJ, Cai Q, et al. Promoter methylation
status of the MGMT, hMLH1, and CDKN2A/p16 genes
in non-neoplastic mucosa of patients with and without
colorectal adenomas. Oncol Rep 2006;16:429–435.
34 Slaughter DP, Southwick HW, Smejkal W. Field
cancerization in oral stratified squamous epithelium;
clinical implications of multicentric origin. Cancer
1953;6:963–968.
35 Ogino S, Hazra A, Tranah GJ, et al. MGMT germline
polymorphism is associated with somatic MGMT
promoter methylation and gene silencing in colorectal
cancer. Carcinogenesis 2007;28:1985–1990.
36 Harris LC, Remack JS, Brent TP. Identification of a 59
bp enhancer located at the first exon/intron boundary
of the human O6-methylguanine DNA methyltransfer-
ase gene. Nucleic Acids Res 1994;22:4614–4619.
37 Ward R, Meagher A, Tomlinson I, et al. Microsatellite
instability and the clinicopathological features of
sporadic colorectal cancer. Gut 2001;48:821–829.
38 Hawkins N, Norrie M, Cheong K, et al. CpG island
methylation in sporadic colorectal cancers and its
relationship to microsatellite instability. Gastroenter-
ology 2002;122:1376–1387.
39 Packham D, Ward RL, Lin V, et al. Implementation
of novel pyrosequencing assays to screen for
common mutations of BRAF and KRAS in a cohort of
sporadic colorectal cancers. Diagn Mol Pathol
2009;18:62–71.
40 Eads CA, Danenberg KD, Kawakami K, et al. Methy-
Light: a high-throughput assay to measure DNA
methylation. Nucleic Acids Res 2000;28:E32.
41 Trinh BN, Long TI, Laird PW. DNA methylation
analysis by MethyLight technology. Methods 2001;
25:456–462.
42 Pfaffl MW. A new mathematical model for relative
quantification in real-time RT-PCR. Nucleic Acids Res
2001;29:e45.
43 Wijchers PJ, Hoekman MF, Burbach JP, et al. Cloning
and analysis of the murine Foxi2 transcription factor.
Biochim Biophys Acta 2005;1731:133–138.
44 Samowitz WS, Albertsen H, Herrick J, et al. Evaluation
of a large, population-based sample supports a CpG
island methylator phenotype in colon cancer. Gastro-
enterology 2005;129:837–845.
45 Chen FY, Harris LC, Remack JS, et al. Cytoplasmic
sequestration of an O6-methylguanine-DNA methyl-
transferase enhancer binding protein in DNA repair-
deficient human cells. Proc Natl Acad Sci USA
1997;94:4348–4353.
46 Lind GE, Thorstensen L, Lovig T, et al. A CpG island
hypermethylation profile of primary colorectal carci-
nomas and colon cancer cell lines. Mol Cancer
2004;3:28.
47 Nosho K, Yamamoto H, Takahashi T, et al. Genetic and
epigenetic profiling in early colorectal tumors and
prediction of invasive potential in pT1 (early invasive)
colorectal cancers. Carcinogenesis 2007;28:1364–1370.
Supplementary Information accompanies the paper on Modern Pathology website (http://www.nature.com/
modpathol)
MGMT methylation linked to germline SNP
NJ Hawkins et al 1599
Modern Pathology
(2009) 22, 15881599
    • "For example, heritable cases of non-polyposis colorectal cancer caused by hypermethylation and gene silencing of MLH1 and MLH2 , have been associated with constitutional (germline) mutations and are also referred to as " epimutations " (Hitchins and Ward 2009 ; Chen et al. 2007 ). In colorectal cancer, an MGMT germline polymorphism (rs16906252 C>T) located within the transcriptional enhancer region was strongly associated with CpG island methylation and gene silencing in tumor tissue (Ogino et al. 2007 ; Hawkins et al. 2009 ). Epigenetic silencing and transcriptional suppression of the death associated protein kinase 1 gene ( DAPK1 ), a key underlying determinant in familial B cell chronic lymphatic leukemia, is associated with germline SNP (c.1-6531 A>G) located upstream from the DAPK1 promoter. "
    [Show abstract] [Hide abstract] ABSTRACT: Over the past decade, evidence has shown that epigenetic mechanisms play an important role in human disease susceptibility and cancer. Studies of potential human carcinogens have been expanded to include those that do not appear to damage DNA directly but rather alter gene expression patterns through epigenetic mechanisms such as alterations in DNA methylation, histone modifications/chromatin alterations, and microRNA. Given that almost 25 % of all human diseases are estimated to be caused by environmental exposures, here we review current studies of xenobiotic exposures for which there is growing mechanistic evidence for indirect DNA alteration through epigenetic mechanisms. Also described are common variations in genes that may modify epigenetic alterations in blood and tumor DNA. Epidemiological methods used to incorporate epigenetic alterations into studies of disease etiology as well as current methods used to apply and critically evaluate study results reporting associations between environmental exposure and disease are described.
    Full-text · Chapter · Jan 2015 · Frontiers in Oncology
    • "Moreover, we investigated the MGMT C-56 T SNP, because it is located in the enhancer region of the MGMT gene only 18 bp downstream from the analyzed MGMT CpG site. A significantly higher MGMT promoter methylation in carriers of the T allele has been described recently in glioblastoma [24], diffuse large B-cell lymphoma [37], colorectal carcinoma [25,26], pleural mesothelioma [27], and lung cancer [28]. In our patient cohort we could confirm a significant higher MGMT methylation level in patients with the T allele than in C-56C wildtype patients underlining a precise measurement of the MGMT promoter methylation level in our study. "
    [Show abstract] [Hide abstract] ABSTRACT: Resistance of the highly aggressive glioblastoma multiforme (GBM) to drug therapy is a major clinical problem resulting in a poor patient's prognosis. Beside promoter methylation of the O6-methylguanine-DNA-methyltransferase (MGMT) gene the efflux transporters ABCB1 and ABCG2 have been suggested as pivotal factors contributing to drug resistance, but the methylation of ABCB1 and ABCG2 has not been assessed before in GBM. Therefore, we evaluated the proportion and prognostic significance of promoter methylation of MGMT, ABCB1 and ABCG2 in 64 GBM patient samples using pyrosequencing technology. Further, the single nucleotide polymorphisms MGMT C-56 T (rs16906252), ABCB1 C3435T (rs1045642) and ABCG2 C421A (rs2231142) were determined using the restriction fragment length polymorphism method (RFLP). To study a correlation between promoter methylation and gene expression, we analyzed MGMT, ABCB1 and ABCG2 expression in 20 glioblastoma and 7 non-neoplastic brain samples. Despite a significantly increased MGMT and ABCB1 promoter methylation in GBM tissue, multivariate regression analysis revealed no significant association between overall survival of glioblastoma patients and MGMT or ABCB1 promoter methylation. However, a significant negative correlation between promoter methylation and expression could be identified for MGMT but not for ABCB1 and ABCG2. Furthermore, MGMT promoter methylation was significantly associated with the genotypes of the MGMT C-56 T polymorphism showing a higher methylation level in the T allele bearing GBM. In summary, the data of this study confirm the previous published relation of MGMT promoter methylation and gene expression, but argue for no pivotal role of MGMT, ABCB1 and ABCG2 promoter methylation in GBM patients' survival.
    Full-text · Article · Dec 2013
    • "In one the recent studies, Everhard et al. found six isolated CpG sites (CpGs −228, −186, +95, +113, +135, and +137) as well as two CpG regions (−186 to −172, and +93 to +153), each with a minimum of 81.5% of concordant results between methylation and expression (10). Furthermore, an association between MGMT methylation and the germline C to T SNP (rs16906252) within the first exon of MGMT is observed in colorectal cancer and normal colonic mucosa (11, 12). "
    [Show abstract] [Hide abstract] ABSTRACT: O(6)-methylguanine DNA methyltransferase (MGMT) is a DNA repair enzyme with the ability to protect cells from DNA mutations by removing alkyl groups from the O(6) position of guanine. Colon mucosa is exposed to the direct effects of environmental carcinogens and therefore maintaining a proficient DNA repair system is very important to stay protected against DNA mutagenesis. Loss of MGMT expression is almost exclusively associated with methylation of CpG islands in the MGMT gene promoter region which is found in approximately 40% of colorectal cancers. The role of MGMT loss in colorectal tumorigenesis is complex but numerous studies have documented methylation of this gene even in the normal appearing mucosa as well as in aberrant crypt foci, suggesting that MGMT methylation can be regarded as an early event or "field defect" in colon cancer neoplasia. The focus of this perspective is the role of MGMT in different pathways of colorectal carcinogenesis as well as the implication of this molecule in treatment decisions in colorectal cancer patients.
    Full-text · Article · Oct 2013
Show more