Leptin Affects Intestinal Epithelial Cell Turnover in Correlation With Leptin Receptor Expression Along the Villus-Crypt Axis After Massive Small Bowel Resection in a Rat

Department Pediatric Surgery, Bnai Zion Medical Center, 47 Golomb St., P.O.B. 4940, Haifa 31048, Israel.
Pediatric Research (Impact Factor: 2.31). 10/2009; 66(6):648-53. DOI: 10.1203/PDR.0b013e3181be9f84
Source: PubMed
ABSTRACT
In this study, we examine the responsiveness of intestinal epithelial cell turnover to leptin (LEP) in correlation with leptin receptor (LEPr) expression along the villus-crypt axis in a rat with short bowel syndrome (SBS). Adult rats underwent either a 75% intestinal resection or a transection. SBS-LEP rats underwent bowel resection and were treated with LEP starting from the fourth postoperative day. Parameters of intestinal adaptation, enterocyte proliferation, and enterocyte apoptosis were determined at sacrifice. RT-PCR technique was used to determine Bax and Bcl-2 gene expression in ileal mucosa. Villus tips, lateral villi, and crypts were separated using laser capture microdissection. LEPr expression for each compartment was assessed by quantitative real-time PCR (Taqman). Treatment with LEP significantly stimulated all parameters of adaptation. LEPr expression in crypts significantly increased in SBS rats (vs Sham rats) and was accompanied by a significant increase in enterocyte proliferation and decreased apoptosis after LEP administration. A significant increase in LEPr expression at the tip of the villus in SBS rats was accompanied by decreased cell apoptosis. In conclusion LEP accelerated enterocyte turnover and stimulated intestinal adaptation. The effect of LEP on enterocyte proliferation and enterocyte apoptosis correlated with receptor expression along the villus-crypt axis.

Full-text

Available from: Jorge G Mogilner, Sep 18, 2014
Leptin Affects Intestinal Epithelial Cell Turnover in Correlation
With Leptin Receptor Expression Along the Villus-Crypt Axis
After Massive Small Bowel Resection in a Rat
IGOR SUKHOTNIK, ARNOLD G. CORAN, JORGE G. MOGILNER, BENHOOR SHAMIAN, RAHEL KARRY, MICHAEL LIEBER,
AND RON SHAOUL
Departments of Pediatric Surgery [I.S., J.G.M.] and Pediatrics [R.S.], Bnai Zion Medical Center, Haifa 31048, Israel; Laboratory of Intestinal
Adaptation and Recovery [I.S., B.S., R.K., M.L.], Technion-Israel Institute of Technology, The Ruth & Bruce Rappaport Faculty of Medicine,
Haifa 31096, Israel; Section of Pediatric Surgery [A.G.C.], University of Michigan Medical School, Ann Arbor, Michigan 48109
ABSTRACT: In this study, we examine the responsiveness of
intestinal epithelial cell turnover to leptin (LEP) in correlation with
leptin receptor (LEPr) expression along the villus-crypt axis in a rat
with short bowel syndrome (SBS). Adult rats underwent either a 75%
intestinal resection or a transection. SBS-LEP rats underwent bowel
resection and were treated with LEP starting from the fourth post-
operative day. Parameters of intestinal adaptation, enterocyte prolif-
eration, and enterocyte apoptosis were determined at sacrifice. RT-
PCR technique was used to determine Bax and Bcl-2 gene expression
in ileal mucosa. Villus tips, lateral villi, and crypts were separated
using laser capture microdissection. LEPr expression for each com-
partment was assessed by quantitative real-time PCR (Taqman).
Treatment with LEP significantly stimulated all parameters of adap-
tation. LEPr expression in crypts significantly increased in SBS rats
(vs Sham rats) and was accompanied by a significant increase in
enterocyte proliferation and decreased apoptosis after LEP adminis-
tration. A significant increase in LEPr expression at the tip of the
villus in SBS rats was accompanied by decreased cell apoptosis. In
conclusion LEP accelerated enterocyte turnover and stimulated in-
testinal adaptation. The effect of LEP on enterocyte proliferation and
enterocyte apoptosis correlated with receptor expression along the
villus-crypt axis. (Pediatr Res 66: 648–653, 2009)
E
xtensive studies in various experimental models of short
bowel syndrome (SBS) have established that enterocyte
apoptosis plays a crucial role during the process of postresec-
tion intestinal adaptation (1,2). Despite the need for intestinal
hyperplasia, the mitotic stimuli fail to suppress programmed
cell death (3). Many investigators have described increased
enterocyte apoptosis as a mechanism that counterbalances the
increased enterocyte proliferation to reach a new homeostatic
set during intestinal adaptation (4). Increased apoptosis pro-
motes disposal of genetically aberrant stem cells and prevents
tumorogenesis (3,4).
Under normal circumstances, renewal of the small intestinal
epithelium takes place continuously in anatomically distinct
crypt-villus units. Proliferation is restricted to mucosal invagi-
nations known as crypts of Lieberku¨hn. All epithelial cells in
each crypt are derived from an uncertain number of multipo-
tential stem cells located at or near the base of the crypt (5).
Stem cells in the small intestinal epithelium are known to
differentiate into columnar, mucous, enteroendocrine, and
Paneth cells as they move from a crypt up the adjacent villus
(6). It takes 2 to 5 d for members of these lineages to travel
from the crypt to the apex of the villus (7) where they are
removed by apoptosis and/or exfoliation. Apoptosis probably
accounts for the bulk of cell loss in the gut and is a central
feature of the regulation of cell number in the adult gastroin-
testinal tract (8). After exposure of cells to stimuli that trigger
programmed cell death, cytochrome c is rapidly released from
mitochondria into the cytoplasm, activating proteolytic mole-
cules known as caspases, which are crucial for the execution
of apoptosis. Augmented expression of Bcl-2 or the related
protein bcl-x
L
act in situ on mitochondria to prevent the
release of cytochrome c and thus caspase activation (9),
whereas Bax localizes to mitochondria and induces the release
of cytochrome c, activation of caspase-3, membrane blebbing,
nuclear fragmentation, and eventually cell death (10).
Intestinal adaptation after bowel resection results in in-
creased proliferation of intestinal epithelial cells, as well as
enhanced programmed cell death, suggesting accelerated cell
turnover. The result of these actions helps to reshape the
crypt-villus structures to more elongated and functionally
active units. The regulation of the balance between cell pro-
duction and cell loss through apoptosis after bowel resection is
complex and the precise factors that guide this adaptive
process remain unclear (11,12). In particular, it is not clear
where many of these trophic factors act along the crypt-villus
axis. Recent evidence suggests that several growth factors
such as keratinocyte growth factor (13) and epidermal growth
factor (14) are differentially expressed along the crypt-villus
axis. This suggests that different trophic factors may act on
different locations along this axis. We have shown recently
that TGF-alpha (TGF-
) simulates enterocyte turnover in
accordance to epidermal-growth factor receptor expression
along the villus-crypt axis (15).
Received May 4, 2009; accepted August 25, 2009.
Correspondence: Igor Sukhotnik, M.D., Department Pediatric Surgery, Bnai Zion
Medical Center, 47 Golomb St., P.O.B. 4940, Haifa 31048, Israel; e-mail: igor-dr@
internet-zahav.net
Supported by an Israel Science Foundation (ISF) and Albert Goodstein research
grants.
Abbreviations: LEP, leptin, SBS, short bowel syndrome
0031-3998/09/6606-0648
PEDIATRIC RESEARCH
Vol. 66, No. 6, 2009
Copyright © 2009 International Pediatric Research Foundation, Inc.
Printed in U.S.A.
648
Page 1
The obese gene protein product leptin (LEP) is secreted
from adipocytes and acts primarily on the hypothalamus reg-
ulating energy expenditure, food intake, and body weight (16).
Although the intestine is not a classic target tissue for LEP,
extensive studies in various experimental models have estab-
lished that LEP determines important physiologic effects on
intestinal growth, cell maturation, and differentiation (17,18).
In our previous work, we have shown that LEP stimulates
intestinal adaptation after massive small bowel resection in a
rat (19). However, the mechanisms of this positive effect
remain poorly understood.
The purpose of this study was to evaluate the effects of LEP
on enterocyte turnover (proliferation and apoptosis) in con-
junction with LEP receptor (LEPr) expression along the vil-
lus-crypt axis after massive small bowel resection in the rat.
MATERIALS AND METHODS
Animals. Rappaport Faculty of Medicine (Technion, Haifa, Israel) Insti-
tutional Animal Care and Use Committee approved the animal facilities and
protocols. Adult Sprague-Dawley male rats weighing 240 to 260 g were kept
in individual stainless steel cages at constant temperature and humidity, and
a 12-h light-dark cycle was maintained. Rats were put on fasts 12 h before the
experiment with free access to water. General anesthesia was induced with
ketamine (i.p. 90 mg/kg) and xylasine (IP 15 mg/kg).
Experimental design. Forty rats were randomly assigned to one of three
groups: group A, Sham rats underwent bowel transection (Sham, n 14);
group B, SBS animals underwent bowel resection (SBS, n 13); and group
C, SBS-LEP rats underwent bowel resection (SBS-LEP, n 13) and were
treated with LEP given i.p. at a dose of 50 mg/kg fromd4tod14.
Surgical procedure. Rats underwent one of two surgical procedures:
bowel transection followed by reanastomosis or 75% bowel resection. Using
sterile techniques, the abdomen was opened using a midline incision. In Sham
rats, the mid-small bowel was transected and reanastomosed without bowel
resection. In SBS animals, a 75% mid-small bowel resection was performed
similar to that previously described. This consisted of a resection of the bowel
between 5 cm distal to the ligament of Treitz and 10 cm proximal to the
ileocecal valve. Bowel continuity was restored by end-to-end anastomosis
using 6-0 absorbable suture (Vicryl, Ethicon Corporation, USA). For all
operations, the abdominal cavity was closed in two layers with a running
suture of 3/0 Vicryl (Ethicon Corporation, USA). Postoperative rats were
allowed ad libitum water and a liquid diet. The rats were killed on d 15 by i.p.
injection of pentobarbital (75 mg/kg).
Intestinal adaptation parameters. The small bowel was rapidly removed,
rinsed with cold isotonic saline, and divided into two segments: jejunum
proximal to anastomosis and terminal ileum. The intestine was split on the
antimesenteric border, washed with cold saline, dried, and each segment was
weighed. The mucosa was scraped from the underlying tissue using a spatula
(Sigma Chemical Co., Israel). Mucosal samples were homogenized with
TRIzol reagent. DNA and protein were extracted by Chomczynski method
(20) and were expressed as micrograms per centimeter of bowel per 100 g of
body weight.
Histologic examination. Histologic sections were prepared from the prox-
imal jejunum, distal ileum, and comparable sites in the control animals.
Segments of small bowel were fixed for 24 h in 10% formalin and processed
into standard paraffin blocks. Five-micron tissue slices were stained with
hematoxylin and eosin. The villus height and crypt depth were measured
using Image Pro Plus 4 image analysis software (Media Cybernetics, Balti-
more, MD). Ten villi and crypts in each section were measured, and the mean
reading was recorded in microns.
Laser-capture microdissection and RNA preparation. Fifteen-micron-
thick sections were mounted onto special RNase-free and UV-treated mem-
brane-covered slides (PALM Technologies, Bernried, Germany) and imme-
diately fixed in ice-cold 70% ethanol for 2 min. After incubation for 60 s in
1% cresyl violet acetate, the sections were then dehydrated in an ethanol
series (70 and 100% on ice) and left to air-dry briefly. Slides were stored at
80°C until microdissection. Sections were laser dissected within 3 d. Slides
were observed using a Zeiss Axiovert 200 M inverted laser-capture micro-
scope and visualized on a monitor using the PALM Robo-Software. Villus
tips, lateral villi, and crypts were separated using the laser. RNA was
extracted using the RNeasy Microkit (Qiagen) and microdissection protocol.
All samples were put at 80°C for long-term storage.
RT-PCR. The quality of RNA was evaluated using the Experion auto-
mated electrophoresis system (BioRad). Five micrograms RNA were reverse
transcribed to cDNA at 37°C using 200
M deoxynucleotides (Sigma Chem-
ical Co., St. Louis, MO), 5
M random hexamers (Amersham Pharmacia
Biotech, Piscataway, NJ), 20 U RNAguard (Amersham Pharmacia Biotech),
and 200 U/
L Moloney murine leukemia virus-reverse transcriptase (US
Biochemicals, Cleveland, OH). Thermal cycler settings were optimized to
ensure products were in the linear phase of production.
Real-time PCR. Expression of long form of the LEPr levels was deter-
mined by quantitative real-time PCR on the cDNA samples using TaqMan
assay-on demand kit (ABsolute Blue QPCR ROX Mix (ROX Dye) from
ABgene, Epsom, UK) with the ABI-PRISM 7000 (Applied Biosystems,
Foster City, CA). Single-exon primers (from PrimerDesing Ltd, UK) with
distance from 3UTR-1064 bp (sense primer, GCAGGGCTGTATGTCATT-
GTA; anti-sense primer, GAACATGGTCCCAAAACAACTT) were de-
signed to produce an amplicon 109 bp. 18S (5AGGAATTGACG-
GAAGGGCAC, 3GTGCAGCCCCGGACATCTAAG) was used to access
equal cDNA loading for each compartment. The primers are specific for the
long form of the LEPr and they do not reside in the same exon; otherwise,
amplification from contaminating DNA cannot be distinguished from ampli-
fication of cDNA.
Crypt cell proliferation and enterocyte apoptosis. Rats were injected with
standard 5-bromodeoxyuridine (5-BrdU) labeling reagent (Zymed Lab, Inc,
CA) at a dose of 1 mL per 100 g body weight, 2 h before sacrifice. Tissue
slices (5
m) were deparaffinized with xylene, rehydrated with graded
alcohol, and stained with a biotinylated monoclonal anti-BrdU antibody
system using BrdU Staining Kit (Zymed Lab, Inc, CA). An index of prolif-
eration was determined as the ratio of crypt cells staining positively for BrdU
per 10 crypts.
Additional 5-
m thick sections were prepared to establish the degree of
enterocyte apoptosis. Immunohistochemistry for Caspase-3 (Caspase-3
cleaved concentrated polyclonal antibody; dilution 1:100; Biocare Medical,
Walnut Creek, CA) was performed to identify apoptotic cells using a com-
bination of streptovidin-biotin-peroxidase method according to manufactur-
ers’ protocols. Expression of epithelial cell apoptosis is expressed as the total
number of apoptotic cells along this axis per 10 villi and 100 crypts. In some
cases, a more detailed analysis of the location of apoptosis was performed
using previously established techniques (21). For this, apoptosis along the
villi were differentiated between the lower one-third of the villi (lateral villi)
and upper one-third of the villi (villi tips). Apoptosis was recorded as the
number of apoptotic cells per 10 villi. A qualified pathologist blinded as to the
source of intestinal tissue performed all measurements.
Expression of Bax and Bcl-2 genes. Total RNA was isolated from frozen
mucosal samples (proximal jejunum and distal ileum) using TRIzol reagent
(GIBCO BRL, USA), as described by Chomczynski (20). A portion of total
RNA (2
g in a total volume of 25
L) was reverse transcribed using
Moloney murine leukemia virus (MMLV) First strand cDNA Synthesis Kit
(Gene Choice, Inc. Frederick, MD). After PCR, the amplified product (5
L)
was run on a 2% agarose gel stained with ethidium bromide and photo-
graphed. The level of Bax and Bcl-2 gene expression was expressed as the
ratio of the gray density of the objective gene over the gray density of 18S at
densitometry. The sequences for the specific genes were as follows: Bax 5
ATGGACGGGTCCGGGGAGCA, 3ATGGACGGGTCCGGGGAGCA,
Bcl-2 5TGAGGCCCTGTCTGCTTCTG, 3AGGCTCCCGGGGCAGT-
CATGA (all primers were purchased from Sigma Chemical Co., Sigma
Chemical Co.-Aldrich Biotechnology LP). Because 18S RNA is expressed at
much higher levels than most mRNAs, the 18S rRNA primers was diluted
1:10 to bring the RT-PCR products within the same exponential range of
amplification.
Statistical analysis. The data are expressed as the mean SEM. A
one-way ANOVA test followed by Bonferroni post hoc test was used for
statistical analysis with p value 0.05 considered statistically significant.
RESULTS
Parameters of intestinal adaptation. Massive small bowel
resection resulted in a significant decrease in body weight.
SBS rats (group B) had a significantly lower final body weight
compared with Sham rats (p 0.001, Table 1). Treatment
with LEP resulted in a small but significant increase in final
body weight compared with SBS rats (p 0.05). SBS rats
(group B) demonstrated a significant increase in overall bowel
649LEPTIN AND ENTEROCYTE TURNOVER IN SBS
Page 2
and mucosal weight in jejunum (5-fold increase; p 0.001)
and in ileum (3-fold and 2-fold increase, respectively; p
0.001); mucosal DNA and protein in jejunum (4-fold and
3-fold, respectively; p 0.05) and in ileum (27% and 2-fold,
respectively; p 0.05,), villus height in jejunum (42%, p
0.05) and in ileum (23%, p 0.05); and crypt depth in
jejunum (30%, p 0.05) compared with Sham rats (group A)
(Table 1). Treatment with LEP resulted in additional bowel
growth. SBS-LEP rats (group C) demonstrated an additional
increase in overall bowel weight in jejunum (10%, p 0.05)
and mucosal weight in jejunum and ileum (16 and 24%, p
0.05 and p 0.001, respectively), mucosal DNA and protein
in ileum (10 and 52%, p 0.05, respectively), villus height
and crypt depth in ileum (35 and 16%, respectively, p 0.05)
compared with SBS-untreated animals (group B).
Enterocyte proliferation and apoptosis in jejunum. SBS
rats (group B) demonstrated a significant increase in cell
proliferation rate in jejunum (22%, p 0.005) and concom-
itant increase in cell apoptosis (62%, p 0.05) compared with
Sham rats (group A). Treatment with LEP (group C) resulted
in an additional increase in cell proliferation rate in jejunum
(31%, p 0.005) and in a significant decrease in cell apo-
ptosis (43%, p 0.05) compared with SBS rats (group B).
Long form of the LEPr expression and enterocyte turn-
over in ileal crypts. Bowel resection (group B) resulted in a
significant increase in enterocyte proliferation (16%, p
0.005) and concomitant increase in cell apoptosis (4-fold
increase, p 0.05) in ileum compared with Sham rats (group
A). Adaptation of residual bowel in the resected group (group
B) was manifested by a 3-fold increase in LEPr mRNA
expression within crypt cell population (vs Sham rats) (Fig. 1).
This increase of the long form of LEPr expression coincided
with increased cell proliferation (36%, p 0.05) and de-
creased cell apoptosis (3-fold decrease, p 0.05) after LEP
administration (group C).
Long form of the LEPr expression and enterocyte apopto-
sis in ileal villi. SBS rats demonstrated a significant increase
in cell apoptotic rates in villus tips in the ileum (65%, p
0.05) compared with Sham rats (group A). Similar to the crypt
compartment, LEPr expression was up-regulated in villus tips
of SBS rats (group B) compared with Sham rats (Fig. 2). This
increase in LEPr expression coincided with decreased cell
apoptosis in villus tips (39%, p 0.05) after LEP adminis-
tration (group C). Cell apoptosis did not change significantly
in lateral villi in SBS rats compared with Sham rats. In
contrast to crypts and villus tips, long form of the LEPr
expression remained unchanged in lateral villi in resected rats
compared with Sham rats. In relation to LEPr expression, cell
apoptosis remain unchanged in this compartment after LEP
administration (Fig. 2).
Expression of apoptosis related genes. A significant in-
crease in cell apoptosis in SBS rats (group B) compared with
Figure 1. Relationship between leptin receptor mRNA expression (B) and
enterocyte proliferation (A) and apoptosis (C) in crypts after massive small
bowel resection and treatment with leptin. Values are mean SEM. Magni-
fication 1:100. *p 0.05, SBS vs Sham rats; §p 0.05, SBS-LEP vs SBS
rats.
Table 1. Parameters of intestinal adaptation
Parameters Sham (group A, n 14) SBS (group B, n 13) SBS-LEP (group C, n 13)
Body weight (%preoperative) 114 1 102 2* 106 2*†
Bowel weight (mg/cm/100 g)
Jejunum 19 1 106 5* 117 4*†
Ileum 23 254 7* 57 4*
Mucosal weight (mg/cm/100 g)
Jejunum 7.3 0.4 36.5 2.5* 42.4 2.3*†
Ileum 8.18 0.5 17.6 1.7* 21.8 0.8*†
Mucosal DNA (
g/cm/100 g)
Jejunum 85 15 328 58* 361 29*
Ileum 145 29 184 20* 229 12*†
Mucosal protein (
g/cm/100 g)
Jejunum 825 85 2883 204* 4376 1008*
Ileum 739 148 1478 147* 2244 347*†
Villus height (
m)
Jejunum 239 21 340 18* 386 25*†
Ileum 178 18 219 12* 295 32*†
Crypt depth (
m)
Jejunum 89 7 116 4* 119 7*
Ileum 85 698 8 144 2*†
Values are mean SEM.
* p 0.05 SBS vs Sham rats.
p 0.05 SBS-LEP vs SBS rats.
650 SUKHOTNIK ET AL.
Page 3
Sham rats (group A) was accompanied by a significant in-
crease in proapoptotic Bax gene expression in the ileum (p
0.05) and a concomitant decrease in Bcl-2 gene expression in
jejunum (36%, p 0.05) and the ileum (2-fold decrease, p
0.05) compared with Sham rats (group A) (Fig. 3). Treatment
with LEP (group C) did not significantly change Bcl-2 gene
expression but led to significant down-regulation in Bax
mRNA expression in ileum compared with SBS animals (p
0.05).
DISCUSSION
Although intestinal transplantation has emerged as a feasi-
ble alternative in the treatment of children with SBS in the last
two decades, the single most important factor contributing to
individual outcome in these patients is the capacity of the
intestinal remnants to undergo an adaptation process. Intesti-
nal adaptation is defined as a process of progressive recovery
from intestinal failure after bowel resection and includes
morphologic and functional changes (11,12)
.
Morphologic
changes include lengthening of the villi and deepening of the
crypts, increased enterocyte proliferation, and increased mi-
gration of enterocytes along the villi. Functional adaptation
results in the enhanced absorption of nutrients by isolated
enterocytes (21–23).
LEP is a nutritionally regulated 16-kD cytokine that is
secreted from adipocytes and is found to highly correlate with
body mass index in rodents, and in lean and obese humans
(16). LEP regulates food intake and energy expenditure by
providing afferent signals to the thalamus. LEP controls feed-
ing and neuroendocrine function and regulates adiposity
through activation of a long form receptor. In addition to
adipose tissue, both the LEP and LEPr have also been found
in many other tissues, which suggests possible important
peripheral actions in rodent and humans (23). The fact that
LEP is present in human milk, that gastrointestinal mucosa is
capable of producing this growth factor (24), and that LEPrs
are expressed in both basolateral and brush border membranes
of the enterocytes (23) suggests its potential role in small
intestinal growth and development. We have recently shown
that parenteral LEP induces intestinal regrowth, stimulates cell
proliferation, and inhibits enterocyte apoptosis in rat models
of SBS (19). However, the mechanisms of this positive effect
remain poorly understood. In particular, it is not clear where
this factor acts along the crypt-villus axis and whether it acts
on different locations along this axis in correlation with the
LEPr, which may be differentially expressed along the axis.
The purpose of this study was to investigate the effects of
LEP on intestinal mucosal homeostasis in conjunction with
long form of the LEPr expression along the villus-crypt axis
after bowel resection in rats. Cell proliferation and apoptosis
were measured in crypts of the remnant ileum to characterize
enterocyte turnover, and enterocyte apoptosis was determined
in villus tips and lateral villi. Similar to our previous experi-
ment (15,19), this study showed that massive intestinal resec-
tion results in significant structural adaptation characterized
by increased bowel and mucosal weights and increased mu-
cosal DNA and protein. Increase in DNA and protein content
in our model suggests that hyperplasia was the predominant
adaptive response. Increased crypt depth in both jejunum and
ileum suggests increased cell proliferation and was correlated
with an increased enterocyte proliferation index. Administra-
tion of LEP significantly enhanced structural intestinal adap-
tation. The observed changes in weight loss, and particularly
the lower degree of weight loss in the SBS-LEP group, may
suggest an improvement in SBS adaptation in the LEP treated
group, although specific absorption studies would need to be
performed in future research to prove this. LEP-treated rats
demonstrated an additional increase in bowel and mucosal
weight, mucosal DNA and protein in jejunum. Increased villus
height and crypt depth are the result of increased proliferation
and accelerated migration along the villus and are a marker for
Figure 2. Effect of bowel resection and treatment with leptin on enterocyte
apoptosis (B) in correlation with leptin receptor expression (A) in villus tips
and in lateral villi. Values are mean SEM. Magnification 1:100. *p 0.05,
SBS vs Sham rats; §p 0.05, SBS-LEP vs SBS rats.
Figure 3. Effect of bowel resection and treatment with leptin on expression
of Bax and Bcl-2 in ileal mucosal samples. Values are mean SEM. *p
0.05, SBS vs Sham rats; §p 0.05 SBS- LEP vs SBS rats.
651LEPTIN AND ENTEROCYTE TURNOVER IN SBS
Page 4
an increased absorptive surface area. Like our previous reports
(15,19), apoptosis in remaining bowel segments increased
significantly after massive small bowel resection in both jeju-
num and ileum compared with Sham rats. We have also shown
a significant increase in proapoptotic Bax gene expression and
down-regulation of antiapoptotic gene Bcl-2, which may be
responsible for enhanced cell apoptosis. Together with in-
creased enterocyte proliferation, enhanced programmed cell
death suggests accelerated cell turnover and is considered by
many investigators as a mechanism that counterbalances the
increased enterocyte mass to reach a new homeostatic set, to
promote disposal of genetically aberrant stem cells, and to pre-
vent tumorogenesis (3,4). Administration of the LEP to SBS
rats reversed the increase in enterocyte apoptosis observed
with SBS alone, bringing levels to that of Sham rats. Interest-
ingly, this observed LEP-associated decline in cell apoptosis
was predominately in the crypt region and was reflected
morphologically in a significant increase in crypt depth. This
also suggests that LEP may play a key role in the remodeling
of the crypt during the early phases of SBS adaptation. Our
observations are consistent with the data of other investiga-
tors. Pearson et al. (25) have demonstrated that LEP enhances
small intestine carbohydrate absorption beyond the normal
adaptive response after massive small bowel resection in a rat.
Alavi et al. have shown that systemic LEP administration
enhances mucosal mass and absorptive function in normal rat
intestine. The authors conclude that LEP seems to be a growth
factor for normal small intestine and may play a role in patients
who acquire intestinal dysfunction (26).
In this study, we investigated the effects of exogenous LEP
on enterocyte turnover (proliferation and apoptosis) in con-
junction with long form of the LEPr expression along the
villus-crypt axis. Several experimental studies have demon-
strated that crypt cell apoptosis progresses quite differently
compared with apoptosis along the villi. It should be empha-
sized that many trophic factors act differentially along the
crypt-villus axis in accordance with differential expressions of
their receptor (13,14). In a recent study, we have shown that
the TGF-
inhibits cell apoptosis in crypts, but it enhances cell
apoptosis in villus tips and correlates with different epidermal-
growth factor receptor expressions along the villus-crypt axis
(15). In the current experiment, we have shown that the
proliferative and anti-apoptotic effect of LEP on enterocyte
turnover is strongly correlated with long form of the LEPr
expression along the villus-crypt axis. In the crypt compart-
ment, expression of the long form of LEPr increased signifi-
cantly after bowel resection compared with control animals.
Although LEP stimulates proliferation and inhibits apoptosis
of epithelial cells, this increase in LEPr expression in crypt
cells coincided with increased cell proliferation and decreased
cell apoptosis after LEP administration. Both increased cell
production and decreased cell death may help to augment SBS
adaptation, although future work to confirm this will be
needed. This also suggests that LEP may play a key role in the
remodeling of the crypt during the early phases of SBS
adaptation. In villus tips and lateral villi, cell apoptosis was
up-regulated in resected rats compared with Sham rats. Grow-
ing evidence suggests that intestinal epithelium, like other
rapidly renewing tissues, may process a feedback control
whereby cell division in the precursor compartment (the
crypts) is regulated by the number of cells in the functional
compartment (the villus). It should be emphasized that adap-
tive stimuli, sufficient to increase significantly the villus cell
count, may activate cell death pathways in villus tips and
lateral villi. Similar to the crypt compartment, in our experi-
ment long form of the LEPr expression was up-regulated in
villus tips in resected rats compared with Sham rats. Because
LEP exerts antiapoptotic effects, this increase in LEPr coin-
cides with decreased cell apoptosis in villus tips after LEP
administration. Morphologically, this decline in cell apoptosis
was reflected in a significant increase in total villus length,
suggesting increased surface area. A decrease in enterocyte
apoptosis corresponded with the decreased expression of Bax
gene expression while Bcl-2 gene expression remained un-
changed.
The major flaw of the study is that only the mRNA levels of
the long form of the LEPr are analyzed. Further experiments
are required to evaluate the expression of the other forms of
the LEPr known to exist in various rat tissues.
In conclusion, treatment with LEP stimulates gut growth in
rat models of SBS. An increased LEPr mRNA expression
along the villus-crypt axis may suggest a relevant role of LEP
in the modulation of enterocyte apoptosis within the gastro-
intestinal mucosa. The effect of LEP on enterocyte turnover is
strongly correlated with long form of the LEPr expression
along the villus-crypt axis.
REFERENCES
1. Helmrath MA, Erwin CR, Shin CE, Warner BW 1998 Enterocyte apoptosis is
increased following massive small bowel resection. J Gastrointest Surg 2:44 49
2. Thompson JS, Barent B 1999 Effects of intestinal resection on intestinal apoptosis.
J Gastrointest Surg 3:672– 677
3. Stern LE, Falcone RA, Kemp CJ, Stuart LA, Erwin CR, Warner BW 2000 Effect of
massive small bowel resection on the Bax/Bcl-w ratio and enterocyte apoptosis.
J Gastrointest Surg 4:93–100
4. Falcone RA Jr, Stern LE, Kemp CJ, Shin CE, Erwin CR, Warner BW 1999
Apoptosis and the pattern of DNase I expression following massive small bowel
resection. J Surg Res 84:218 –222
5. Bjerknes M, Cheng H 1981 The stem cell zone of the small intestinal epithelium. III.
Evidence from columnar, enteroendocrine, and mucus cells in the adult mouse. Am J
Anat 160:77–91
6. Bjerknes M, Cheng H 1981 The stem cell zone of the small intestinal epithelium. I.
Evidence from Paneth cells in the adult mouse. Am J Anat 160:51– 63
7. Cheng H, Leblond CP 1974 Origin, differentiation and renewal of the four main
epithelial cell types in the mouse small intestine. V. Unitarian theory of the origin of
the four epithelial cell types. Am J Anat 141:537–561
8. Hall PA, Coates PJ, Ansari B, Hopwood D 1994 Regulation of cell number in the
mammalian gastrointestinal tract: the importance of apoptosis. J Cell Sci 107:3569
3577
9. Kluck RM, Bossy WE, Green DR, Newmeyer DD 1997 The release of cytochrome
c from mitochondria: a primary site for Bcl-2 regulation of apoptosis. Science
275:1132–1136
10. Rosse T, Olivier R, Monney L, Rager M, Conus S, Fellay I, Jansen B, Borner C 1998
Bcl-2 prolongs cell survival after Bax-induced release of cytochrome c. Nature
391:496 499
11. Welters CF, Dejong CH, Deutz NE, Heineman E 2002 Intestinal adaptation in short
bowel syndrome. ANZ J Surg 72:229 –236
12. Westergaard H 2002 Short bowel syndrome. Semin Gastrointest Dis 13:210 –220
13. Yang H, Antony PA, Wildhaber BE, Teitelbaym DH 2004 Intestinal intraepithelial
lymphocyte gamma delta-T cell-derived keratinocyte growth factor modulates epi-
thelial growth in the mouse. J Immunol 172:4151– 4158
14. Warner BW, VanderKolk WE, Can G, Helmrath MA, Shin CF, Erwin CR 1997
Epidermal growth factor receptor expression following small bowel resection. J Surg
Res 70:171–177
15. Sukhotnik I, Mogilner JG, Shaoul R, Karry R, Lieber M, Suss-Toby E, Ure BM,
Coran AG 2008 Responsiveness of intestinal epithelial cell turnover to TGF-
after
bowel resection in a rat is correlated with EGF receptor expression along the
villus-crypt axis. Pediatr Surg Int 24:21–28
652 SUKHOTNIK ET AL.
Page 5
16. Bell-Anderson KS, Bryson JM 2004 Leptin as a potential treatment for obesity:
progress to date. Treat Endocrinol 3:11–18
17. Badman MK, Flier JS 2005 The gut and energy balance: visceral allies in the obesity
wars. Science 307:1909 –1914
18. Chaudhary M, Mandir N, FitzGerald AJ, Howard JK, Lord GM, Ghatei MA, Bloom
SR, Goodlad RA 2000 Starvation, leptin and epithelial cell proliferation in the
gastrointestinal tract of the mouse. Digestion 61:223–229
19. Sukhotnik I, Vadasz Z, Coran AG, Lurie M, Shiloni E, Hatoum OA, Mogilner JG
2006 Effect of leptin on intestinal re-growth following massive small bowel resection
in rat. Pediatr Surg Int 22:9 –15
20. Chomczynski P 1993 A reagent for the single-step simultaneous isolation of RNA,
DNA and proteins from cell and tissue samples. Biotechniques 15:532–534:536 –537
21. Whang EE, Dunn JC, Jof fe H, Mahanty H, Zinner MJ, McFadden DW, Ashley SW 1996
Enterocyte functional adaptation following intestinal resection. J Surg Res 60:370 –374
22. Hines OJ, Bilchik AJ, Zinner MJ, Skotzko MJ, Moser AJ, McFadden DW, Ashley
SW 1994 Adaptation of the Na/glucose cotransporter following intestinal resection.
J Surg Res 57:22–27
23. Barrenetxe J, Villaro AC, Guembe L, Pascual I, Mun˜oz-Navas M, Barber A, Lostao
MP 2002 Distribution of the long leptin receptor isoform in brush border, basolateral
membrane, and cytoplasm of enterocytes. Gut 50:797– 802
24. Cammisotto PG, Renaud C, Gingras D, Delvin E, Levy E, Bendayan M 2005
Endocrine and exocrine secretion of leptin by the gastric mucosa. J Histochem
Cytochem 53:851– 860
25. Pearson PY, O’Connor DM, Schwartz MZ 2001 Novel effect of leptin on small
intestine adaptation. J Surg Res 97:192–195
26. Alavi K, Schwartz MZ, Prasad R, O’connor D, Funanage V 2002 Leptin: a new
growth factor for the small intestine. J Pediatr Surg 37:327–330
653LEPTIN AND ENTEROCYTE TURNOVER IN SBS
Page 6
  • Source
    • "Leptin-deficient ob/ob mice demonstrated decreased cellular proliferation and increased apoptosis in intestinal cells after massive small bowel resection [43]. This study and a study reported by Lin et al. [44] suggested that leptin increases apoptosis in intestinal cells, in contrast to the decrease in apoptosis observed by other investigators [42]. The mitogenic and antiapoptotic effects of leptin make it a potential tumorigenic factor. "
    [Show abstract] [Hide abstract] ABSTRACT: Leptin was discovered in 1994 as a hormone produced by adipose tissue with a modulatory effect on feeding behavior and weight control. Recently, the stomach has been identified as an important source of leptin and growing evidence has shown diverse functions for leptin in the gastrointestinal tract. Using leptin as a keyword in PubMed, more than 17 000 articles were identified, of which more than 500 articles were related to the role of leptin in the gastrointestinal tract. Available abstracts were reviewed and more than 200 original articles were reviewed in detail. The available literature demonstrated that leptin can modulate several important functions of the gastrointestinal tract. Leptin interacts with the vagus nerve and cholecystokinin to delay gastric emptying and has a complex effect on motility of the small bowel. Leptin modulates absorption of macronutrients in the gastrointestinal tract differentially in physiologic and pathologic states. In physiologic states, exogenous leptin has been shown to decrease carbohydrate absorption and to increase the absorption of small peptides by the PepT1 di-/tripeptide transporter. In certain pathologic states, leptin has been shown to increase absorption of carbohydrates, proteins, and fat. Leptin has been shown to be upregulated in the colonic mucosa in patients with inflammatory bowel disease. Leptin stimulates gut mucosal cell proliferation and inhibits apoptosis. These functions have led to speculation about the role of leptin in tumorigenesis in the gastrointestinal tract, which is complicated by the multiple immunoregulatory effects of leptin. Leptin is an important modulator of major aspects of gastrointestinal tract functions, independent of its more well-described roles in appetite regulation and obesity.
    Full-text · Article · Oct 2010 · Nutrition
  • Source
    [Show abstract] [Hide abstract] ABSTRACT: Semiconductor devices have limited power handling capabilities at high frequencies, particularly at millimeter-wave frequencies. A method is presented for overcoming this problem by combining the outputs of several devices quasi-optically in a resonator cavity. This method has been applied to a number of solid-state devices, including Gunn diodes and MESFETs. The devices do not require an external locking signal because they lock to a mode of the resonator cavity. Effective radiated powers of 22 W for a 4×4 array of Gunn diodes and 25 W for a 10×10 array of MESFETs have been achieved
    Full-text · Conference Paper · Jun 1990
  • Source
    [Show abstract] [Hide abstract] ABSTRACT: Malnutrition substantially increases susceptibility to Entamoeba histolytica in children. Leptin is a hormone produced by adipocytes that inhibits food intake, influences the immune system, and is suppressed in malnourished children. Therefore we hypothesized that diminished leptin function may increase susceptibility to E. histolytica infection. We prospectively observed a cohort of children, beginning at preschool age, for infection by the parasite E. histolytica every other day over 9 years and evaluated them for genetic variants in leptin (LEP) and the leptin receptor (LEPR). We found increased susceptibility to intestinal infection by this parasite associated with an amino acid substitution in the cytokine receptor homology domain 1 of LEPR. Children carrying the allele for arginine (223R) were nearly 4 times more likely to have an infection compared with those homozygous for the ancestral glutamine allele (223Q). An association of this allele with amebic liver abscess was also determined in an independent cohort of adult patients. In addition, mice carrying at least 1 copy of the R allele of Lepr were more susceptible to infection and exhibited greater levels of mucosal destruction and intestinal epithelial apoptosis after amebic infection. These findings suggest that leptin signaling is important in mucosal defense against amebiasis and that polymorphisms in the leptin receptor explain differences in susceptibility of children in the Bangladesh cohort to amebiasis.
    Full-text · Article · Feb 2011 · The Journal of clinical investigation
Show more