CRISPR/Cas9-mediated targeted mutagenesis in Nicotiana tabacum

Abstract

Genome editing is one of the most powerful tools for revealing gene function and improving crop plants. Recently, RNA-guided genome editing using the type II clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein (Cas) system has been used as a powerful and efficient tool for genome editing in various organisms. Here, we report genome editing in tobacco (Nicotiana tabacum) mediated by the CRISPR/Cas9 system. Two genes, NtPDS and NtPDR6, were used for targeted mutagenesis. First, we examined the transient genome editing activity of this system in tobacco protoplasts, insertion and deletion (indel) mutations were observed with frequencies of 16.2-20.3 % after transfecting guide RNA (gRNA) and the nuclease Cas9 in tobacco protoplasts. The two genes were also mutated using multiplexing gRNA at a time. Additionally, targeted deletions and inversions of a 1.8-kb fragment between two target sites in the NtPDS locus were demonstrated, while indel mutations were also detected at both the sites. Second, we obtained transgenic tobacco plants with NtPDS and NtPDR6 mutations induced by Cas9/gRNA. The mutation percentage was 81.8 % for NtPDS gRNA4 and 87.5 % for NtPDR6 gRNA2. Obvious phenotypes were observed, etiolated leaves for the psd mutant and more branches for the pdr6 mutant, indicating that highly efficient biallelic mutations occurred in both transgenic lines. No significant off-target mutations were obtained. Our results show that the CRISPR/Cas9 system is a useful tool for targeted mutagenesis of the tobacco genome.

Full text

1 3
Plant Mol Biol (2015) 87:99–110
DOI 10.1007/s11103-014-0263-0
CRISPR/Cas9‑mediated targeted mutagenesis in Nicotiana
tabacum
Junping Gao · Genhong Wang · Sanyuan Ma ·
Xiaodong Xie · Xiangwei Wu · Xingtan Zhang ·
Yuqian Wu · Ping Zhao · Qingyou Xia
Received: 7 September 2014 / Accepted: 17 October 2014 / Published online: 26 October 2014
© Springer Science+Business Media Dordrecht 2014
percentage was 81.8 % for NtPDS gRNA4 and 87.5 % for
NtPDR6 gRNA2. Obvious phenotypes were observed, etio-
lated leaves for the psd mutant and more branches for the
pdr6 mutant, indicating that highly efficient biallelic muta-
tions occurred in both transgenic lines. No significant off-
target mutations were obtained. Our results show that the
CRISPR/Cas9 system is a useful tool for targeted mutagen-
esis of the tobacco genome.
Keywords CRISPR/Cas9 system · Nicotiana tabacum ·
Targeted mutagenesis · Genome editing
Introduction
Genome editing of model plants and major crops is used
to study gene function and improve crop disease resist-
ance (Li et al. 2012). Several new tools of genome engi-
neering have been introduced in recent years, including
zinc finger nucleases (ZFNs), transcription activator-like
effector nucleases (TALENs) and clustered regularly inter-
spersed short palindromic repeats (CRISPR)/Cas9 system,
for targeted mutagenesis and other genome modifications
in different cell types and organisms (Doyon et al. 2008;
Mali et al. 2013; Schornack et al. 2013; Zhang et al.
2010). These sequence-specific nucleases can recognize
and cleave the specific sequence at target loci to gener-
ate double-strand breaks (DSBs), which are then repaired
via two primary mechanisms: homologous recombination
(HR) and non-homologous end joining (NHEJ) (Puchta
and Fauser 2014). The repair of DSBs by the NHEJ path-
way often leads to various modifications of the targeted
sequence, such as small deletions or insertions. If the DSBs
occur in the coding region of a gene, deletions or inser-
tions can result in a shift in the open reading frame and this
Abstract Genome editing is one of the most power-
ful tools for revealing gene function and improving crop
plants. Recently, RNA-guided genome editing using the
type II clustered regularly interspaced short palindro-
mic repeats (CRISPR)-associated protein (Cas) system
has been used as a powerful and efficient tool for genome
editing in various organisms. Here, we report genome
editing in tobacco (Nicotiana tabacum) mediated by the
CRISPR/Cas9 system. Two genes, NtPDS and NtPDR6,
were used for targeted mutagenesis. First, we examined the
transient genome editing activity of this system in tobacco
protoplasts, insertion and deletion (indel) mutations were
observed with frequencies of 16.2–20.3 % after transfect-
ing guide RNA (gRNA) and the nuclease Cas9 in tobacco
protoplasts. The two genes were also mutated using mul-
tiplexing gRNA at a time. Additionally, targeted deletions
and inversions of a 1.8-kb fragment between two target
sites in the NtPDS locus were demonstrated, while indel
mutations were also detected at both the sites. Second,
we obtained transgenic tobacco plants with NtPDS and
NtPDR6 mutations induced by Cas9/gRNA. The mutation
Junping Gao and Genhong Wang have contributed equally to this
work.
Electronic supplementary material The online version of this
article (doi:10.1007/s11103-014-0263-0) contains supplementary
material, which is available to authorized users.
J. Gao · G. Wang · S. Ma · X. Wu · P. Zhao · Q. Xia (*)
State Key Laboratory of Silkworm Genome Biology, Southwest
University, Chongqing 400715, China
e-mail: xiaqy@swu.edu.cn
X. Xie · X. Zhang · Y. Wu
School of Life Science, Chongqing University,
Chongqing 400030, China

100 Plant Mol Biol (2015) 87:99–110
1 3
often leads to gene loss-of-function. Existing genes can
be replaced or corrected through the HR pathway when a
DNA segment with a strong homologous sequence to the
targeted gene is present.
Among these sequence-specific nucleases, engineered
ZFNs were the first used to recognize and cleave targeted
sequences (Beerli and Barbas 2002; Bibikova et al. 2002;
Kim et al. 1996). Each zinc finger (ZF) can recognize and
bind to a three specific nucleotides. A typical ZFN com-
prises three or four tandem arrays of ZFs which can bind
to 9–12 bp target sites and non-specific cleavage domains
of the FokI restriction enzyme, which functions as a dimer
(Mani et al. 2005). A pair of ZFNs are designed to bind
two target sequences at a distance of 5–7 bp from each
other, and FokI forms a dimer to cleave the unique DNA
sequence region separating the two ZFNs resulting in
DSBs (Kim et al. 1996). So far, ZFNs have been success-
fully applied as an efficient genome editing tool to modify
the genome of Arabidopsis thaliana (De Pater et al. 2009;
Lloyd et al. 2005; Osakabe et al. 2010; Tovkach et al. 2009;
Zhang et al. 2010), tobacco (Cai et al. 2009; Marton et al.
2010; Petolino et al. 2010; Townsend et al. 2009; Wright
et al. 2005), soybean (Curtin et al. 2011), cotton (D’Halluin
et al. 2013) and maize (Shukla et al. 2009). Another type
of sequence-specific nucleases are TALENs with the DNA
binding domain (TALE) derived from proteins produced
by plant bacterial pathogens of the genus Xanthomonas
and DNA cleavage domain of FokI functioning via the
formation dimer (Bogdanove and Voytas 2011). TALENs
typically consist of 13–28 tandem arrays of 34 amino acid
repeats. The amino acid sequences of each repeat are simi-
lar except for the amino acids at positions 12 and 13, known
as repeat variable di-residues (RVDs), which can recognize
a single base through different amino acid combinations
(Deng et al. 2012). The binding of the two TALENs to the
target site results in formation of a dimer of FokI so that the
endonuclease domain of the enzyme is activated and able to
cleave the target sequence, which leads to introducing the
targeted DSBs. TALENs are becoming widely used in the
genome modification of plants, such as Arabidopsis (Cer-
mak et al. 2011; Christian et al. 2013), tobacco (Mahfouz
et al. 2011; Zhang et al. 2013), rice (Chen et al. 2014; Li
et al. 2012; Shan et al. 2013a), maize (Liang et al. 2014),
Brassica oleracea (Sun et al. 2013), Brachypodium (Shan
et al. 2013a) and barley (Wendt et al. 2013).
More recently, clustered regularly interspaced short
palindromic repeats (CRISPR)-associated protein (Cas)
systems are a new tool in the genome-editing toolbox and
provide a versatile and efficient genome modification tech-
nology (Cong et al. 2013; Mali et al. 2013). CRISPR-Cas
systems provide a defense mechanism to prevent bacteria
and archaea from invading plasmids and viruses (Sorek
et al. 2013). There are three CRISPR-Cas systems identi-
fied according to their components and modes of action.
One of them, the CRISPR/Cas9 system from Streptococcus
pyogenes, involves two short RNAs called CRISPR RNA
(crRNA) and trans-activating CRISPR RNA (tracrRNA)
and one Cas9 protein. When the foreign plasmids and
viruses invade bacteria, crRNA and tracrRNA transcribed
from the CRISPR locus form a complex which guides Cas9
protease to recognize and cleave a target site of foreign
DNA from plasmids or viruses infecting the bacteria (Gasi-
unas et al. 2012). The crRNA and tracrRNA can be fused
to form one chimeric RNA, known as guide RNA (gRNA),
and the gRNA contains 20 nucleotides that bind to specific
sequences (Jinek et al. 2012; Mali et al. 2013). A conserved
sequence motif (NGG) called proto-spacer adjacent motif
(PAM) at 3ʹ downstream of target sequence is essential for
gRNA-guided Cas9 to recognize and cleave the target site
(Gasiunas et al. 2012). The CRISPR/Cas9 system has been
developed as an efficient genome editing tool to apply to
modify genomes of numerous plant including Arabidop-
sis thaliana (Feng et al. 2014; Jiang et al. 2013b, 2014; Li
et al. 2013), rice (Feng et al. 2013; Mao et al. 2013; Shan
et al. 2013b; Xie and Yang 2013; Xu et al. 2014), maize
(Liang et al. 2014), sorghum (Jiang et al. 2013b), citrus (Jia
and Wang 2014) and wheat (Shan et al. 2013b; Upadhyay
et al. 2013). The CRISPR/Cas9 system is a simple, time-
saving and effective genome-editing technology in compar-
ison with ZFNs and TALENs.
As an important model plant species, the genome of
Nicotiana benthamiana was also subjected to targeted
mutagenesis using the CRISPR/Cas9 system. The frequen-
cies of targeted PDS mutagenesis were in the range of
1.9–53.6 % after agroinfiltration of gRNA and Cas9 in N.
benthamiana (Jiang et al. 2013b; Li et al. 2013; Nekrasov
et al. 2013; Upadhyay et al. 2013). Highly efficient targeted
mutagenesis was found in N. benthamiana protoplasts
co-expressing gRNA and Cas9, which was in the range
of 37.7–38.5 % (Li et al. 2013). Additionally, individual
plants were regenerated from N. benthamiana leaf cells
that had been edited using the CRISPR/Cas9 system and
the genetically transformed plants were obtained (Nekrasov
et al. 2013). Common tobacco (Nicotiana tabacum) is an
allotetraploid and the genome size is 4.5 G with a high
(>70 %) content of repetitive DNA (Sierro et al. 2014). N.
tabacum has become an extremely important model plant
species for the study of fundamental biological processes.
However, there are few reports of genome modifications
of common tobacco (N. tabacum) using this technology of
RNA-guided genome editing.
In this study, we describe the application of CRISPR/Cas9-
mediated targeted mutagenesis in N. tabacum. Targeted
mutagenesis in phytoene desaturase (PDS) and PDR-type

101Plant Mol Biol (2015) 87:99–110
1 3
transporter (PDR6, an ABC transporter involved in strigol-
actone transport) genes were achieved by transient or stable
transformation. With multiplexed gRNA designed two tar-
get sites in PDS, a large deletion and inversion of genomic
structure were detected in tobacco protoplasts. In addition, we
obtained obvious phenotypes of targeted mutagenesis of PDS
and PDR6 via a stable Agrobacterium-mediated transforma-
tion system at the T0 generation.
Materials and methods
Growth of tobacco plants
Steriled tobacco (N. tabacum cv HongHuaDaJinYuan)
plants were grown from surface-sterilized seeds on the
germination medium comprising Murashige and Skoog
(MS) salts (PhytoTech), 30 g/L sucrose and 8 g/L agar
(pH = 5.6). In general, tobacco seeds were incubated for
30 s in 1 mL of 75 % alcohol, then for 10 min in 1 mL
of 10 % sodium hypochlorite in a 1.5-mL microfuge tube,
washed three times with sterile distilled water, followed
by placing on the surface of MS medium (Murashige and
Skoog 1962) at 25 °C under long-day conditions (16 h
light/8 h dark).
Vector and gene constructs for targeted gene mutation
The Cas9 gene sequence of codon-optimized for tobacco
and the sequence of the Arabidopsis U6-26 promoter with
gRNA scaffolds was synthesized from GenScript (Nan-
jing). The 2 × 35S promoter adding SpeI and SacI and
Nos terminator adding SmaI and SalI were amplified from
vector pCXSN and inserted into the both ends of the Cas9
sequence (Chen et al. 2009). Then the Cas9 expression cas-
sette with HindIII and EcoRI was subcloned into the Agro-
bacterium tumefaciens binary vector pORE O4 (Coutu
et al. 2007).
We targeted the NtPDS and NtPDR6 genes to prove the
CRISPR/Cas9 system for genome editing in tobacco. The
full coding sequence of NtPDS and partial gene sequence
of NtPDR6 were amplified from genomic DNA of wild-
type tobacco. Each target sequence of 20 nucleotides fol-
lowed the criteria described earlier (Mali et al. 2013). The
NGG trinucleotide known as protospacer adjacent motif
(PAM) at the 3ʹ-end of the target region was essential to
select the target site. To generate gRNA for the target site,
we employed the method of overlapping PCR as described
previously (Li et al. 2013). The gRNA expression cassette
digested with NotI and EcoRI was inserted into the same
digested pORE–Cas9 binary vector. Thus, Cas9 and gRNA
could be co-expressed in one vector.
Tobacco protoplasts preparation and transformation
Tobacco protoplasts were isolated from 1-month-old young
seedlings of tobacco after germination in MS medium fol-
lowing the same procedure as described earlier (Li et al.
2013; Yoo et al. 2007). Briefly, young leaves were cut into
1-mm strips with scissors and were digested in 10 mL of
enzyme solution (1.5 % Cellulase R10, 0.4 % Macerozyme
R10, 20 mM MES, pH 5.7, 20 mM KCl, 10 mM CaCl2,
0.1 % BSA and 0.45 mM Mannitol) at 25 °C and 45 rpm
for 12 h. After adding 10 ml of W5 solution (2 mM MES,
154 mM NaCl, 125 mM CaCl2 and 5 mM KCl, pH 5.7) and
filtering through a 40-μm cell filter, the protoplasts were
collected by centrifugation at 100×g for 5 min. The pro-
toplasts were then resuspended in 10 mL of W5 solution
and incubated on ice for 30 min. After removing the W5
solution by centrifugation at 100×g for 5 min, the proto-
plasts were resuspended in MMG solution (0.6 M Manni-
tol, 4 mM MES and 15 mM MgCl2) at a concentration of
2 × 105/mL. For transformation, 20 μL DNA (25–30 μg)
was gently mixed with 200 μL protoplasts and 220 μL
PEG solution (0.2 M Mannitol, 0.1 M CaCl2 and 40 %
PEG4000) and incubated for 10 min at room temperature.
After stopped adding 800 μl W5 solution, transfected pro-
toplasts were then collected by centrifugation at 100×g for
2 min and resuspended by adding 1 mL WI solution (4 mM
MES pH5.7, 20 mM KCl and 0.5 M Mannitol). The trans-
formed protoplasts were cultured in six-well plates in dark-
ness at room temperature for 36 h. They were then collected
by centrifugation and prepared to extract genomic DNA.
Generation of stable transgenic tobacco plants
The pORE vectors, containing the Cas9 and the gRNA
expression cassette, were introduced into Agrobacterium
tumefaciens LBA4404 by the freeze–thaw method for
transformation of tobacco. Leaf discs from 6-week-old
tobacco plants were infected by A. tumefaciens LBA4404
harboring the pORE vectors and were then plated onto
regeneration medium (4.4 g MS medium, 30 g sucrose, 8 g
agar, 2 mg/L 6-Benzylaminopurine, and 0.5 mg/L 1-Naph-
thaleneacetic acid, pH 5.6) containing 250 mg/L carbeni-
cillin sodium and 50 mg/L kanamycin sulfate. The drug-
resistant seedlings were obtained and prepared for analysis.
Mutation analysis
The genomic DNA of the transformed protoplasts and
stable transgenic tobacco plants from kanamycin selec-
tion and wild-type plants was extracted using the DNeasy
Plant Mini Kit (Qiagen, CA) to visualize targeted mutagen-
esis using PCR amplification, restriction enzyme assay

102 Plant Mol Biol (2015) 87:99–110
1 3
and Sanger sequencing. The DNA fragments spanning
the Cas9/gRNA target sequences were amplified by PCR
(primer sequences in Online Resource 1) using Phusion
high-fidelity NDA polymerase (New England Biolabs).
After purification, the PCR product was digested with the
corresponding restriction enzyme which identifies the wild-
type target sequences. The digested product was analyzed
by electrophoresis in 1 % agarose gel. The digest-resistant
bands were purified and cloned to the pEASY-Blunt Zero
vector by TA cloning (Transgene, China) and the single
colonies were sequenced to detect the types of mutation.
To measure the frequencies of Cas9/gRNA-induced
mutations in the PDR6 target sites, the intensity of
uncleaved-bands were used to estimate the mutation rates
using ImageJ software as described earlier (Nekrasov et al.
2013). The mutation rate was calculated by dividing the
intensity of the digest-resistant band by the total intensity
of all bands. To measure the frequencies of Cas9/gRNA-
induced mutations in the PDS target sites, PCR products
were cloned to the pEASY-Blunt Zero vector. Plasmid
DNA was extracted from randomly selected colonies and
was used for Sanger sequencing. The mutation rate was
calculated based on the ratio of mutated clonal amplicons
versus total sequenced clonal amplicons (Li et al. 2013).
Detection of targeted deletion and inversion
Targeted deletion and inversion between the NtPDS gRNA2
and gRNA4 target loci were confirmed by the PCR ampli-
fication of the two target sites using the specific primers
listed in Online Resource 1. The forward primer of gRNA2
target and the reverse primer of gRNA4 target were used
to amplify and detect the targeted deletion. The forward
primers of gRNA2 and gRNA4 targets or the reverse prim-
ers of gRNA2 and gRNA4 targets were used to amplify and
detect the targeted inversion. All PCR products were puri-
fied and cloned into the pEASY-Blunt Zero vector. Random
colonies were sequenced and analyzed.
Off-target analysis
We searched the N. tabacum genome (unpublished) data-
base using local BLASTN tool against the gRNA sequence
of the second exon for PDR6 to discover potential off-tar-
get sites. We selected one potential off-target site to test the
indels with the criteria matching perfectly the 12-bp seed
sequence of target sequence at the upstream of the PAM
NGG sequence and having 18-bp out of 20-bp identity with
the target sequence, and the presence of a BstNI site with
the sequence. The potential off-target was amplified using
specific primers listed in Online Resource 1. The PCR
products were digested with BstNI and then analyzed by
electrophoresis in 1 % agarose gel.
Results
An optimized CRISPR/Cas9 system for tobacco genome
editing and target selection
The Cas9 gene was optimized to edit the genome of various
organisms. We also optimized the Cas9 codons for genome
editing of tobacco. Nuclear localization signals (NLSs)
and a Flag tag added at the amino and carboxyl termini
of Cas9 were used for localization of Cas9 in the nucleus
and allowed the identification of protein expression under
CaMV 35S promoter (Fig. 1a). We designed a vector that
harbored chimeric guide RNA (gRNA) of the fused crRNA
and tracrRNA backbone driven by the AtU6-26 promoter
in Arabidopsis, and the gRNA was sufficient to guide Cas9
to bind the specific sequence and cleave genome DNA to
generate DSBs (Jinek et al. 2012) (Fig. 1b).
We selected the two endogenous genes of tobacco for
targeted mutagenesis using the CRISPR/Cas9 system,
NtPDS and NtPDR6 (Fig. 1c). The four target sites of PDS
and two target sites of PDR6 were designed (Fig. 1c). The
20-bp target sequences of the gene exon (the first nucleo-
tide is G), were designed at the upstream of the PAM, NGG
(Fig. 1c). The gRNA of each target site generated by the
method of overlapping PCR and Cas9 were subcloned into
a single expression vector (Li et al. 2013).
Cas9-induced mutagenesis of NtPDS and NtPDR6
in tobacco protoplasts
We used the protoplast transient expression system to test
the targeted mutagenesis of the tobacco genome using the
CRISPR/Cas9 system. The Cas9 and gRNA expression cas-
sette in one expression vector (pORE O4) were transformed
into tobacco protoplasts. To determine the rate of mutagen-
esis, we digested, cloned and sequenced the genomic PCR
production amplified at the target region using the total
genome extracted from transfected protoplasts as a template.
We observed that there were 16 mutated NtPDS gRNA1 tar-
gets among 79 randomly sequenced clones, and 17 mutated
NtPDS gRNA3 targets among 86 randomly sequenced
clones, with an approximate mutagenesis frequency of 20.3
and 19.8 %, respectively (Fig. 2a, b). For the NtPDR6 gene,
PCR/restriction enzyme (PCR/RE) assays were used to esti-
mate the frequency of mutation and detect mutations in the
gRNA2 target site. Undigested bands were found in the target
site and indel frequencies of 16.2 % were estimated by band
intensities (Fig. 2c). The uncleaved bands were purified and
sequenced, and the results revealed that the mutation of the
target sequence destroyed the RE site by deleting the nucle-
otides (Fig. 2d). We also randomly cloned and sequenced
clones from the amplification of genomic DNA extracted
from protoplasts infected by the gRNA2 of NtPDR6. The

103Plant Mol Biol (2015) 87:99–110
1 3
mutagenesis frequency with indel frequencies of 16.8 % for
random sequencing was similar to that for PCR/RE assays
(Online Resource 2). This method of PCR/RE assay can be
used to estimate the mutagenesis efficiency. These results
suggested that the CRISPR/Cas9 system would be efficient in
inducing targeted mutagenesis in tobacco cells.
Multiple genome modifications using the
CRISPR/Cas9 system
To test the potential of gRNA/Cas9-induced targeted
mutagenesis for more than one gene at a time, the gRNA
expression cassettes of the NtPDS gRNA4 target site and
the NtPDR6 gRNA1 target site were cloned into the same
vector containing the Cas9 expression cassette (Fig. 3a).
Tobacco protoplasts were transfected with this vector and
we then amplified both target genomic DNAs from trans-
formed cells using the specific primer (Online Resource 1).
The PCR amplicons were randomly cloned and sequenced.
The results showed that there were mutations of targeted
PDS and PDR6 at the both target sites. However, the dif-
ferent indel frequencies were detected at 6.5 % in PDS and
9.5 % in PDR6 (Fig. 3b, c). Thus, the CRISPR/Cas9 sys-
tem can be used to edit more than one gene simultaneously.
Targeted deletion and inversion at NtPDS locus mediated
by the CRISPR/Cas9 system
To test whether the developed CRISPR/Cas9 system
could be used to target two sites of one gene simultane-
ously, we designed pairs of gRNA targeting the PDS
gene and they were transfected into tobacco protoplasts
(Fig. 4a). The indels of both sites were detected with
mutation frequencies of 6.0–7.7 % (Online Resource 4).
However, the efficiency of indel mutations by the duplex
gRNA was low compared to the individual gRNA. We
also examined whether targeted large genomic deletions
and inversions occurred at the two target sites of PDS
at a distance of approximately 1.8 kb in tobacco cells
(Fig. 4a). We used four different locus specific primers
to amplify and sequence the fragments of deletion and
inversion (Fig. 4b). The short DNA fragment (approxi-
mately 500 bp) was amplified using the E2S and E4A
primers and then sequenced (Fig. 4c). The chromosomal
region between the two target sites was detected to be
deleted with expression of gRNA and Cas9 in protoplasts
(Fig. 4d). We also found that there were two new potential
junctions of the inversion of the same chromosome region
between the two target sites, which were confirmed by
NNNNCNNNNNNNNNNNNNNNNNNNNCCNNNNNNNNNNNNNNNNNNN...5’
NNNNGNNNNNNNNNNNNNNNNNNNNGGNNNNNNNNNNNNNNNNNNN...3’
GUUUUAGAGCUA
UAGC UUAAAAU
AAGGCUAGUCCGUUAUCAA
CUUGAAAAAGUGGCACCCA
UCGGUGC
G
3’-UUUU
AAG
G
A A
A
.
3’...
5’...
.
PAM
GNNNNNNNNNNNNNNNNNNN
Cas9
gRNA
5’-
Target Sequence
3×FLAG
2×35S Cas9 Nos
NLS NLS
AtU6-26 Target gRNA scaffold TTTTTT
(A) (B)
(C)
Exon1 Exon2 Exon3 Exon4
ATG
GCCGTTAATTTGAGAGTCCAAGG
GAGATTGTTATTGCTGGTGCAGG
GCTGCATGGAAAGATGATGATGG
gRNA1 target
gRNA2 target
gRNA4 target
NtPDS ATG
NtPDR6
Exon1 Exon2
Exon3
GTAGATGCAGAAGCTAGAGTTGG
GTGGAATCATCAAACCAGGAAGG
gRNA1 target
gRNA2 target
GAGGCAAGAGATGTCCTAGGTGG
gRNA3 target
Fig. 1 Schematic of the vector and target constructs. a Schemat-
ics of the cassette expressing Cas9 driven by the Cauliflower mosaic
virus 35S promoter and the target and scaffold sequence of the
gRNA driven by the U6-26 pol III promoter of Arabidopsis. NLS,
nuclear localization signal. b Schematic illustration of the interac-
tion between gRNA:Cas9 complex and its genomic target. The gRNA
containing the target site (green) and scaffold (blue) sequence binds
to the complementary sequence of target site. The PAM sequence
(NGG; red) is the essential requirement for the Cas9 nuclease activ-
ity. c The structure of NtPDS and NtPDR6 and the CRISPR/Cas9 tar-
get sites. Each target region is shown in green letters followed by red
PAM

104 Plant Mol Biol (2015) 87:99–110
1 3
amplification using E2S and E4S or E2A and E4A primers
and sequencing (Fig. 4e, f). Thus, the deletions and inver-
sions of genomes can be created using the CRISPR/Cas9
system expressing Cas9 enzyme and gRNA of two target
sites.
Phenotypes of gene mutation induced by the CRISPR/Cas9
system
To test whether gene mutations can be induced by the
CRISPR/Cas9 system in tobacco plants, we created gRNA
TATTGCTGGAGGCAAGAGATGTCCT-AGGTGGAAAGGTGAAGAA
TATTGCTGGAGGCAAGAGATGTCCTTAGGTGGAAAGGTGAAGAA +1
TATTGCTGGAGGCAAGAGATGTCCT-TA-TGGAAAGGTGAAGAA -3/+2
TATTGCTGGAGGCAAGAGATGTCC--AGGTGGAAAGGTGAAGAA -1(×3)
TATTGCTGGAGGCAAGAGATGT--T-AGGTGGAAAGGTGAAGAA -2
TATTGCTGGAGGCAAGAGATGT----AGGTGGAAAGGTGAAGAA -3(×2)
TATTGCTGGAGGCAAGAGATG-----AGGTGGAAAGGTGAAGAA -4
TATTGCTGGAGGCAAGAGAT------AGGTGGAAAGGTGAAGAA -5(×2)
TATTGCTGGAGGCAAGAGA-------AGGTGGAAAGGTGAAGAA -6(×2)
TATTGCTGGAGGCAAGAG----------GTGGAAAGGTGAAGAA -9
TATTGCTGGAGGCAAGAGATATCCT-AGGTGGAAAGGTGAAGAA -1/+1
TATTGCTGGAGGCAAGAGATGTCCT-ATGTGGAAAGGTGAAGAA -1/+1
TATTGCTGGAGGCAAGAAATGTCCT-AAGTGGAAAGGTGAAGAA -2/+2
PAM
NtPDS gRNA3
750
500
250
100
bp
Cas9
gRNA
-+
-+-
-
BstNI-digested Non-digested
ATGAAGTCAGTGGAATCATCAAACCAGGAAGGTGAGAAAAAACA WT
ATGAAGTCAGTGGAATCATCAAACC-GGAAGGTGAGAAAAAACA -1
ATGAAGTCAGTGGAATCATCAAACCA-GAAGGTGAGAAAAAACA -1
ATGAAGTCAGTGGAATCATCAAAC--GGAAGGTGAGAAAAAACA -2
ATGAAGTCAGTGGAATCATCAAACC--GAAGGTGAGAAAAAACA -2
ATGAAGTCAGTGGAATCATCAAACC-----GGTGAGAAAAAACA -5
ATGAAGTCAGTGGAATCATCAAA-----AAGGTGAGAAAAAACA -5
ATGAAGTCAGTGGAATCATC------GGAAGGTGAGAAAAAACA -6
ATGAAGTCAGTGGAATCATCAAA------AGGTGAGAAAAAACA -6
PAM
BstNI
NtPDR6 gRNA 2
(A)
19.8% (17/86) mutated
123
Mutation rate: 16.2%
TGTTTCTGCCGTTAATTTGAGAGTCCAAGGTAATTCAGCTTAT WT
TGTTTCTGCCGTTAATTTGAGA-TCCAAGGTAATTCAGCTTAT -1(×2)
TGTTTCTGCCGTTAATTTGAG--TCCAAGGTAATTCAGCTTAT -2(×4)
TGTTTCTGCCGTTAATTTGAGAG--CAAGGTAATTCAGCTTAT -2(×3)
TGTTTCTGCCGTTAATTTGAG----CAAGGTAATTCAGCTTAT -4(×2)
TGTTTCTGCCGTTAATTTG-----CCAAGGTAATTCAGCTTAT -5(×2)
TGTTTCTGCCGTTAATTTGA-----CAAGGTAATTCAGCTTAT -5
TGTTTCTGCCGTTAATT------TCCAAGGTAATTCAGCTTAT -6(×2)
GCCGTTAATTTGAGAGTCCA
GCCGTTAATTTGAGAGTCCA
PAM
NtPDS gRNA1 20.3% (16/79) mutated
(B)
(C)
(D)
Fig. 2 Targeted mutagenesis of tobacco genome using the
CRISPR/Cas9 system in protoplasts. a, b Targeted genome editing
on NtPDS with gRNA1(a) and gRNA3(b). c PCR/RE assay to detect
the mutations with gRNA:Cas9-induced on NtPDR6 with gRNA2.
The uncleaved band of Lane 2 is used for quantification. The muta-
tion frequency is measured by band intensities. d DNA sequences
of the uncleaved band. The mutation rate in a and b was calculated
based on the ratio of mutated clonal amplicons versus total randomly
sequenced clonal amplicons. In a, b and d, green shadows mark the
target sequence. PAM, the protospacer adjacent motif. DNA inser-
tions, point mutations and deletions are shown in red letters and
dashes
3×FLAG
2×35S Cas9 Nos
NLS NLS
LB
AtU6-26
PDS gRNA 4
gRNA scaffold TTTTTT
AtU6-26 PDR6 gRNA 1 gRNA scaffold TTTTTT RB
CTTTTAGGTAGCTGCATGGAAAGATGATGATGGAGATTGGTAT WT
CTTTTAGGTAGCTGCATGGAAAGATGATGGTGGAGATTGGTAT -1/+1
CTTTTAGGTAGCTGCATGGAAAGATGA-GATGGAGATTGGTAT -1
CTTTTAGGTAGCTGCATGGAAAGATG-TGATGGAGATTGGTAT -1(×2)
CTTTTAGGTAGCTGCATGGAAAGATGA--ATGGAGATTGGTAT -2
CTTTTAGGTAGCTGCATGGAAAGATGA--------ATTGGTAT -8
PAM
NtPDS gRNA4 6.5% (6/92) mutated
CATGTGAGTGTAGATGCAGAAGCTAG-AGTTGGTAGTAGAGCTCTACCTACAATA WT
CATGTGAGTGTAGATGCAGAAGCTAGAAGTTGGTAGTAGAGCTCTACCTACAATA +1
CATGTGAGTGTAGATGCAGAAGCTAG-AGTTGGTGGTAGAGCTCTACCTACAATA -1/+1
CATGTGAGTGTAGATGCAGAGGCTAG-AGTTGGTAGTAGAGCTCTACCTACAATA -1/+1
CATGTGAGTGTAGATGCAGAAGCTAG-AGATGGTAGTAGAGCTCTACCTACAATA -1/+1
CATGTGAGTGTAGATGCAGAAGCTA--AGTTGGTAGTAGAGCTCTACCTACAATA -1
CATGTGAGTGTAGATGCAGAAGCT---AGTTGGTAGTAGAGCTCTACCTACAATA -2
CATGTGAGTGTAGATGCAGAAGCTAG---TTGGTAGTAGAGCTCTACCTACAATA -2
CATGTGAGTGTAGATGCAGAA------AGTTGGTAGTAGAGCTCTACCTACAATA -5
CATGTGAGTGTAGATGCAGAAGCTA---------------------CCTACAATA -20
NtPDR6 gRNA1 9.5% (9/95) mutated PAM
(A)
(B) (C)
Fig. 3 Multiple gene targeting with different Cas9/gRNA. a Plasmid
constructs for genome editing of PDS and PDR6 by transfecting the
protoplasts. b, c targeted genome modification on PDS and PDR6.
Green shadows mark the target sequence. PAM, the protospacer adja-
cent motif. DNA insertions, point mutations and deletions are shown
in red letters and dashes

105Plant Mol Biol (2015) 87:99–110
1 3
targeting either the fourth exon of PDS or the second exon
of PDR6, and transformed them into tobacco using Agro-
bacterium-mediated transformation method. Transformed
seedlings with kanamycin selecting were obtained and
their genomic DNA extracted for analysis. The seedlings
with disrupted PDS, loss-of-function mutants, exhibited
an albino leaf phenotype that was easily observed, whereas
seedlings with mutated PDR6 had more branches. Thus, the
phenotype of both mutated genes could be observed at an
early development stage. We obtained 11 lines for the PDS
gRNA4 target and 16 lines for the PDR6 gRNA2 target
(Table 1). We designed gene-specific primers to amplify
the target regions and sequenced to detect the mutant plants
with pds. We used the PCR/RE assay to identify the tar-
geted PDR6 mutagenesis in transgenic plants. Mutations
in PDS were identified in 9 of 11 independent transgenic
plants with the percentage of 81.8 %, and mutations in
PDR6 in 14 of 16 transgenic plants with the percentage
of 87.5 % (Table 1). We found that four of nine trans-
genic plants of targeted PDS mutation displayed etiolated
leaves (Fig. 5a). We then sequenced the PCR products of
genomic DNA from etiolated leaves to determine whether
GAGATTGTTATTGCTGGTGCAGGTGATTTTTTCCAGTCATCTATA GCTGCATGGAAAGATGATGATGGAGATTGGTATGAGAC
gRNA2 target gRNA4 target
Exon2 Exon4
1.8 kb
NtPDS
E2S E4S
E2A E4A
E2S
E4A
E2S
E4S
E2A
E4A
WT deletion inversion
TATAGATGACTGGAAAAAATCACCTGCACC.......AGATGATGATGGAGATTGGTATGAGAC
TATAGATGACTGGAAAAAAT----------------------------GAGATTGGTATGAGAC
TATAGATGACTGGAAAAAATCACCTGC---------------ATGATGGAGATTGGTATGAGAC
TATAGATGACTGGAAAAAATCACCTGCA----------------GATGGAGATTGGTATGAGAC
TATAGATGACTGGAAAAAATCACCTGCAC--------------TGATGGAGATTGGTATGAGAC
TATAGATGACTGGAAAAAATCACCTGCAC-------------ATGATGGAGATTGGTATGAGAC
TATAGATGACTGGAAAAAATCACCTGC-----------------GATGGAGATTGGTATGAGAC
GAGATTGTTATTGCTGGTGCAGGTGA.......TCTCCATCATCATCTTTCCATGCAGC
GAGATTGTTATTGCTGGT-------------------------CATCTTTCCATGCAGC
GAGATTGTTATTGC----------------------------TCATCTTTCCATGCAGC
GAGATTGTTATTGCTGG--------------------------CATCTTTCCATGCAGC
GAGATTGTTATTGCT----------------------------CATCTTTCCATGCAGC
GAGATTGTTATTGCTGGT--------------------------ATCTTTCCATGCAGC
GAGATTGTTATTGCTGGT-------------------------------TCCATGCAGC
GAGATTGTTATTGCTGGTGCAGGTGATTTTTTCCAGTCATCTATA
...1.8k...GCTGCATGGAAAGATGATGATGGAGATTGGTATGAGAC
GAGATTGTTATTGCTGG-------------------------------TGATGGAGATTGGTATGAGAC
GAGATTGTTATTGCTGG--------------------------------GATGGAGATTGGTATGAGAC
GAGATTGTTATTGCT-------------------------------------GGAGATTGGTATGAGAC
GAGATTGTTA--------------------------------------TGATGGAGATTGGTATGAGAC
GAGATTGTTATTGCTGGTGATGGAGATT-----------------TGGTGATGGAGATTGGTATGAGAC
GAGATTGTTATTGCTGATGGAG-----------------------TGCTGATGGAGATTGGTATGAGAC
Reference :
Deletion E2S and E4A
Reference :
Reference :
Inversion E2S and E4S
Inversion E2A and E4A
bp
750
500
250
100
1000
E2S and E4A
1 2
bp
750
500
250
100
1000
E2S and E4S E2A and E4A
(A)
(B)
(C) (D)
(F)
(G)
(E)
1 2
Fig. 4 Targeted deletion and inversion in the PDS locus mediated
by Cas9 and gRNA pairs. a The structure of tobacco PDS gene and
the locations and sequences of the Cas9/gRNA target sites. The dis-
tance between the two sites is 1.8 kb. The target sequences of the
Cas9/gRNA are highlighted with different colors and underlined.
The PAM sequence is shown in red. b Schematic diagrams of the tar-
geted deletion and inversion. The primers (E2S, E2A, E4S and E4A)
are used to detect the deletion and inversion. c, e PCR results of the
genomic DNA from tobacco protoplasts transfected with the plas-
mid expressing the two Cas9/gRNA2 and Cas9/gRNA4. The targeted
deletion was detected by primers E2S and E4A (c, lanes 1 and 2). The
targeted inversion was detected by primers E2S and E4S (e, lane 1)
and by primers E2A and E4A (e, lane 2). d, f, g Sequences of tar-
geted deletion and inversion. PCR products (c, e) were subcloned
and sequenced. Targeted large genomic deletion (d) and inversion
(f, g) were detected between the two Cas9/gRNA of the PDS locus.
The expected junctions of the targeted deletion and inversion are
highlighted by four different colors and the target sequences of the
Cas9/gRNA are underlined. DNA deletions are shown in dashes

106 Plant Mol Biol (2015) 87:99–110
1 3
the mutations occurred in the target region of PDS. There
were more different mutated alleles with deletions and a
maximum of 26-bp deletion was detected (Fig. 5b). For the
PDR6 gRNA2 target, PCR products of the genomic DNA
from the 16 independent transgenic plants were digested
with BstNI and the undigested bands were observed using
the PCR/RE assay (Fig. 5c). One transgenic line for PDR6
gRNA2 showed only mutated alleles and no wild-type
allele. In addition, this transgenic plant with targeted PDR6
mutation had more branches (Fig. 5d, e). This obvious
Table 1 Mutation percentage of T0 plants in the target sequence
Target gene Guide RNA No. of plants were
examined
No. of plants with
mutations
Mutations
rate (%)
Biallelic mutations
Number %
NtPDS gRNA4 11 9 81.8 4 36.4
NtPDR6 gRNA2 16 14 87.5 1 6.25
(A)
transgenic plant 1
WT
CTTTTAGGTAGCTGCATGGAAAGATGATGATGGAGATTGGTATGAGA WT
PAM
(B)
ATGAAGTCAGTGGAATCATCAAACCAGGAAGGTGAGAAAAAACA WT
PAM
transgenic plant 14
(C)
(F)
ATGAAGTCAGTGGAATCATCAAACC-GGAAGGTGAGAAAAAACA -1
ATGAAGTCAGTGGAATCATCAAAC--GGAAGGTGAGAAAAAACA -2
ATGAAGTCAGTGGAATCATCAAA-------GGTGAGAAAAAACA -7
CTTTTAGGTAGCTGCATGGAAAGATGA-GATGGAGATTGGTATGAGA -1
CTTTTAGGTAGCTGCATGGAA-----ATGATGGAGATTGGTATGAGA -5
CTTTTAGGTAGCTGCATGGA------ATGATGGAGATTGGTATGAGA -6
CTTTTAGGTAGCTGCATGG--------TGATGGAGATTGGTATGAGA -8
CTTTTAGGTAGCTGCATG---------TGATGGAGATTGGTATGAGA -9
CTTTTAGGTAGCTGC-----------ATGATGGAGATTGGTATGAGA -11
CTTTTAGGTAGCTGC------------TGATGGAGATTGGTATGAGA -12
CTTTTAGGTAGCTG----------------T----A-T-G---G-GA -26
CTTTTAGGTAGCTG--------------------------TATGAGA -26
transgenic plant 1
transgenic plant 14 WT
(D) (E)
Fig. 5 Targeted gene editing in tobacco plants using the CRISPR/Cas9
system. a Phenotypes of the pds mutant. The left one is a T0 plant of
nontransgenic wild-type tobacco, while the right one is a transgenic
plant with PDS mutated. b Targeted mutagenesis of PDS. Sequencing
results of PDS mutant plant (a) are aligned to the reference genome
sequence. c PCR/RE assay to detect Cas9/gRNA-induced PDR6
mutations in 16 T0 transgenic tobacco plants. The PCR products were
digested with BstNI. WT, wild-type tobacco. d Phenotypes of the pdr6
mutant correspond to #14 sample after 8 weeks of growth. The left one
is a T0 plant with nontransgenic wild-type tobacco, while the right one
is a transgenic plant with PDR6 mutated. e The partial enlarged draw-
ing are the pdr6 mutant (d). f Targeted mutagenesis of PDR6. Sequenc-
ing results of PDR6 mutant plant (d) are aligned to the reference
genome sequence. In b and f, the target sequences of the Cas9/gRNA
are highlighted with green. PAM, the protospacer adjacent motif. The
indels are shown in red letters and dashes. The scale bars equal to 1 cm
(a) and 20 cm (d)

107Plant Mol Biol (2015) 87:99–110
1 3
phenotype was due to biallelic mutations of both genes
identified by sequencing, showing that PDS and PDR6 had
been disrupted (Fig. 5b, f). Other transgenic plants with tar-
geted mutagenesis appeared to carry the wild-type sequence
and their phenotypes were similar to wild-type. Thus, they
could be either mosaic or monoallelic mutants. Notably, the
efficient mutations were generated in the PDS and PDR6
loci of transgenic plants with indel rates of 81.8–87.5 % at
T0 generation. These results showed that the CRISPR/Cas9
system could be used to modify genome and have high effi-
ciency for targeted mutagenesis in tobacco.
Potential off-targets were analyzed at the PDR6 locus
To assess the potential off-targets induced by the
CRISPR/Cas9 system in our mutant lines, we searched
other sites in the genome that could potentially be targeted
by the second exon target site for PDR6. Previous research
showed that the 12 nucleotides in the target at the upstream
of PAM are essential to cleave the target sequence specifi-
cally by Cas9, which could be known as a ‘seed sequence’
(Jiang et al. 2013a). We searched the tobacco genome for
candidate off-target sites with the form (N)12 NGG and
identified one candidate site, which had 18-bp out of 20-bp
identity and perfectly matched the 12-bp sequence with
the AGG PAM in the targeted PDR6 sequence (Online
Resource 4). The BstNI recognition site existed in the
selected site and the position of this endonuclease would be
cleaved by Cas9. Consequently, we could use the RE/PCR
assay to test the off-target effect. The PCR products ampli-
fied from the genomic regions containing the potential off-
target site were digested by BstNI restriction endonuclease
and an uncleaved-band was not observed (Online Resource
5). To check the result, the PCR products were also cloned
and sequenced and no indels were detected. These results
suggested that the CRISPR/Cas9 system was highly spe-
cific for targeted mutagenesis in tobacco.
Discussion
In the present study, we achieved the targeted mutagenesis
of the tobacco genome using the CRISPR/Cas9 system.
The CRISPR/Cas9 system has previously been used for
genome editing of N. benthamiana (Jiang et al. 2013b; Li
et al. 2013; Nekrasov et al. 2013). Common tobacco with
its larger and more complicated genome, is an allotetra-
ploid and its genome is about 4.5 Gb (Sierro et al. 2014).
Although the SurA and SurB loci of tobacco were also
targeted for modification by Cas9-induced mutations, the
main purpose of this study was the creation of a high rep-
licon system of Cas9 and gRNA based geminivirus (Baltes
et al. 2014). We chose N. tabacum to systematically test the
efficiency of genome modification using the CRISPR/Cas9
system.
Due to their obvious phenotypes with mutation or down-
expression, we selected two genes PDS and PDR6 as the
CRISPR/Cas9 targets (Wang et al. 2009; Xie et al. 2014).
We demonstrated that the targeted mutagenesis of both
genes was achieved using the CRISPR/Cas9 guided genome
editing tool in tobacco protoplasts (Fig. 2). The indels of
one or two target sites in PDS and PDR6 were generated
with the various rates of mutation. Compared with single
gRNA, the efficiency of mutation induced by the expres-
sion of the duplex gRNA and Cas9 in the same expres-
sion cassette was lower (Fig. 3 and Online Resource 3).
This may be due to the limited Cas9 binding competitively
with two gRNA, and this mechanism should be investigated
in the future. The genome editing at specific sites of multiple
genes will accelerate functional characterization of tobacco
genes, especially for the homologous genes with the same
function and family genes.
Targeted genomic structure variations (GSVs), including
chromosomal deletions, duplications, inversions and trans-
locations, have been achieved using ZFNs and TALENs
in human cells, tobacco, silkworm and zebrafish (Gupta
et al. 2013; Lee et al. 2010; Ma et al. 2014; Petolino et al.
2010). Targeted deletions and inversions were also detected
using the CRISPR/Cas9 system in some organisms, includ-
ing Arabidopsis, wheat, silkworm and zebrafish (Li et al.
2013; Liu et al. 2014; Upadhyay et al. 2013; Xiao et al.
2013). We explored the possibility of targeted GSV using
the CRISPR/Cas9 system, and demonstrated that targeted
deletions and inversions of a gene fragment could be
achieved by simultaneous cleavage at two sites within the
second and fourth exons of PDS in tobacco cells (Fig. 4
and Online Resource 4). However, targeted chromosomal
duplications were not detected. The deletion of longer frag-
ments should be tested, and the ability to generate large
segmental deletions would provide an avenue for studying
the function of noncoding elements, such as intronic cis-
regulatory modules, miRNA clusters, or lncRNAs. Taken
together, our results show that manipulation the of genome
can be achieved at the chromosomal level using two pairs
of gRNA/Cas9.
We obtained 11 and 16 independent transgenic lines for
the targeted PDS and PDR6 by Agrobacterium-mediated
transformation of N. tabacum, respectively. The percentage
of the independent T0 transgenic tobacco generated muta-
tions in PDS and PDR6 was about 81.8 and 87.5 %, respec-
tively (Table 1). Moreover, four transgenic lines of PDS and
one transgenic line of PDR6 were found to harbor biallelic
mutations and showed obvious phenotypes: albino leaves
for pds mutant and more branches for pdr6 mutant (Fig. 5).
Four albino lines had various mutations, including dele-
tion and insertion, and the indels were similar among these

108 Plant Mol Biol (2015) 87:99–110
1 3
lines, and may have regenerated from the same callus. One
branch grew at the base of the stem in the biallelic mutation
of PDR6 at an early development stage (Online Resource 6).
However, more than one branch appeared after 8 weeks of
growth. The normal growth of tobacco was influenced when
PDR6 was disrupted. High efficiency for targeted mutagen-
esis of PDS and PDR6 could be achieved in transgenic lines.
The delivery method of the CRISPR/Cas9 system would
affect the efficiency of mutation. The efficiency of targeted
mutagenesis in N. benthamiana using Agrobacterium-medi-
ated leaf infiltration method is lower than the efficiency
obtained in this study (Nekrasov et al. 2013). N. tabacum
was stably transformed using Agrobacterium-mediated leaf
discs. The Cas9 and gRNA integrated into tobacco genome,
and their expression levels were continuous. The insertion of
multiple copies in transgenic plants would lead to the higher
expression levels of Cas9 and gRNA, and the efficiency of
gene editing may improve. It has been reported that the sin-
gle nucleotide polymorphism (SNP) in the target sequence
may influence gRNA efficiency (Fu et al. 2013). In our
study, the SNP was not detected in selected targets. In com-
parison with the ZFNs and TALENs method, DNA methyla-
tion can not affect the Cas9-mediated cleavage (Hsu et al.
2013). The targeted gene modification by the CRISPR/Cas9
system occurred mostly in somatic cells and the mutations
were heritable in T1, T2 and T3 plants in Arabidopsis and rice
(Feng et al. 2014; Zhang et al. 2014). Whether the targeted
gene mutagenesis using the CRISPR/Cas9 system passes to
the next generations in tobacco requires further study.
Off-targeting is noticed for both the ZFN and TALEN
technologies in genome editing (Mussolino et al. 2011;
Pattanayak et al. 2011). It has been reported that the off-
target effect of CRISPR/Cas-induced mutagenesis occurred
in human cells, medaka, zebrafish and rice (Ansai and
Kinoshita 2014; Fu et al. 2013; Hruscha et al. 2013; Lin
et al. 2014; Xie and Yang 2013). In this study, we also
analyzed the potential off-target genome modification in
tobacco. We searched the tobacco genome with the form
(N)12 NGG sequence and selected one candidate site, which
had 18-bp out of 20-bp identity and perfectly matched the
12-bp sequence with the AGG PAM. Compared with other
candidate off-target sites, this is the most likely cleavage
site of Cas9. We did not detect any mutations in the site by
RE/PCR and sequencing assay (Online Resource 5). How-
ever, this was not a systematic assessment of the specificity
for targeted genome modification using the CRISPR/Cas9
system in tobacco, and more candidate off-target sites need
to analyze and evaluate the off-target effect in the future.
It has been reported that the highest GC contents (83 %)
of gRNA might enhance the interaction between gRNA
and the target site and more easily generate the off-target
effect (Jao et al. 2013). We did not observe mutations in
the selected candidate off-target sites and this may be due
to the low GC contents of gRNA (38.8 %). Hence, the GC
contents of gRNA should be considered in the design of
target sequences and to avoid off-target mutations.
In this study, we demonstrated that targeted mutagen-
esis using RNA-guided genome editing technology
occurred in tobacco. Various mutations, including dele-
tion and insertion, were observed at all tested target sites
of PDS and PDR6. The targeted deletions and inversions
of the genome induced by the CRISPR/Cas9 system also
occurred together with indel mutations in protoplasts. The
targeted mutations of PDS and PDR6 showed obvious
phenotypes and no off-target mutation was observed. The
CRISPR/Cas-induced mutations were highly efficient and
specific in editing the genome of tobacco. Consequently,
the CRISPR/Cas9 system can be used to study the func-
tion of plant genes and as a powerful genome editing tool
to modify the genome of crops.
Acknowledgments This work was supported by grants from the
following sources: the National Basic Research Program of China
(No. 2012CB114600), the National Hi-Tech Research and Devel-
opment Program of China (No. 2011AA100306), Fundamental
Research Funds for the Central Universities (No. XDJK2013C043)
and the Doctoral Fund of Southwest University (SWU112061).
References
Ansai S, Kinoshita M (2014) Targeted mutagenesis using
CRISPR/Cas system in medaka. Biol Open: BIO20148177
Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF (2014)
DNA replicons for plant genome engineering. Plant Cell Online
26:151–163
Beerli RR, Barbas CF (2002) Engineering polydactyl zinc-finger tran-
scription factors. Nat Biotechnol 20:135–141
Bibikova M, Golic M, Golic KG, Carroll D (2002) Targeted chromo-
somal cleavage and mutagenesis in Drosophila using zinc-finger
nucleases. Genetics 161:1169–1175
Bogdanove AJ, Voytas DF (2011) TAL effectors: customizable pro-
teins for DNA targeting. Science 333:1843–1846
Cai CQ, Doyon Y, Ainley WM, Miller JC, DeKelver RC, Moehle EA,
Rock JM, Lee Y-L, Garrison R, Schulenberg L (2009) Targeted
transgene integration in plant cells using designed zinc finger
nucleases. Plant Mol Biol 69:699–709
Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C,
Baller JA, Somia NV, Bogdanove AJ, Voytas DF (2011) Efficient
design and assembly of custom TALEN and other TAL effector-
based constructs for DNA targeting. Nucleic Acids Res 39:e82
Chen S, Songkumarn P, Liu J, Wang G-L (2009) A versatile zero
background T-vector system for gene cloning and functional
genomics. Plant Physiol 150:1111–1121
Chen K, Shan Q, Gao C (2014) An efficient TALEN mutagenesis sys-
tem in rice. Methods 69:2–8
Christian M, Qi Y, Zhang Y, Voytas DF (2013) Targeted mutagenesis
of Arabidopsis thaliana using engineered TAL effector nucle-
ases. G3-Genes Genomes Genet 3:1697–1705. doi:10.1534/
g3.113.007104
Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu
X, Jiang W, Marraffini LA (2013) Multiplex genome engineering
using CRISPR/Cas systems. Science 339:819–823

109Plant Mol Biol (2015) 87:99–110
1 3
Coutu C, Brandle J, Brown D, Brown K, Miki B, Simmonds J, Hege-
dus DD (2007) pORE: a modular binary vector series suited for
both monocot and dicot plant transformation. Transgenic Res
16:771–781
Curtin SJ, Zhang F, Sander JD, Haun WJ, Starker C, Baltes NJ, Reyon
D, Dahlborg EJ, Goodwin MJ, Coffman AP (2011) Targeted
mutagenesis of duplicated genes in soybean with zinc-finger
nucleases. Plant Physiol 156:466–473
De Pater S, Neuteboom LW, Pinas JE, Hooykaas PJ, Van Der Zaal BJ
(2009) ZFN-induced mutagenesis and gene-targeting in Arabi-
dopsis through Agrobacterium-mediated floral dip transforma-
tion. Plant Biotechnol J 7:821–835
Deng D, Yan C, Pan X, Mahfouz M, Wang J, Zhu J-K, Shi Y, Yan N
(2012) Structural basis for sequence-specific recognition of DNA
by TAL effectors. Science 335:720–723
D’Halluin K, Vanderstraeten C, Hulle J, Rosolowska J, Den Brande
I, Pennewaert A, D’Hont K, Bossut M, Jantz D, Ruiter R (2013)
Targeted molecular trait stacking in cotton through targeted dou-
ble-strand break induction. Plant Biotechnol J 11:933–941
Doyon Y, McCammon JM, Miller JC, Faraji F, Ngo C, Katibah GE,
Amora R, Hocking TD, Zhang L, Rebar EJ (2008) Heritable
targeted gene disruption in zebrafish using designed zinc-finger
nucleases. Nat Biotechnol 26:702–708
Feng Z, Zhang B, Ding W, Liu X, Yang D-L, Wei P, Cao F, Zhu S,
Zhang F, Mao Y (2013) Efficient genome editing in plants using a
CRISPR/Cas system. Cell Res 23:1229
Feng Z, Mao Y, Xu N, Zhang B, Wei P, Yang D-L, Wang Z, Zhang
Z, Zheng R, Yang L (2014) Multigeneration analysis reveals the
inheritance, specificity, and patterns of CRISPR/Cas-induced gene
modifications in Arabidopsis. Proc Natl Acad Sci 111:4632–4637
Fu Y, Foden JA, Khayter C, Maeder ML, Reyon D, Joung JK, Sander
JD (2013) High-frequency off-target mutagenesis induced
by CRISPR-Cas nucleases in human cells. Nat Biotechnol
31:822–826
Gasiunas G, Barrangou R, Horvath P, Siksnys V (2012) Cas9-
crRNA ribonucleoprotein complex mediates specific DNA
cleavage for adaptive immunity in bacteria. Proc Natl Acad Sci
109:E2579–E2586
Gupta A, Hall VL, Kok FO, Shin M, McNulty JC, Lawson ND, Wolfe
SA (2013) Targeted chromosomal deletions and inversions in
zebrafish. Genome Res 23:1008–1017
Hruscha A, Krawitz P, Rechenberg A, Heinrich V, Hecht J, Haass C,
Schmid B (2013) Efficient CRISPR/Cas9 genome editing with
low off-target effects in zebrafish. Development 140:4982–4987
Hsu PD, Scott DA, Weinstein JA, Ran FA, Konermann S, Agarwala V,
Li Y, Fine EJ, Wu X, Shalem O (2013) DNA targeting specificity
of RNA-guided Cas9 nucleases. Nat Biotechnol 31:827–832
Jao L-E, Wente SR, Chen W (2013) Efficient multiplex biallelic
zebrafish genome editing using a CRISPR nuclease system. Proc
Natl Acad Sci 110:13904–13909
Jia H, Wang N (2014) Targeted genome editing of sweet orange using
Cas9/sgRNA. PLoS One 9:e93806
Jiang W, Bikard D, Cox D, Zhang F, Marraffini LA (2013a) RNA-
guided editing of bacterial genomes using CRISPR-Cas systems.
Nat Biotechnol 31:233–239
Jiang W, Zhou H, Bi H, Fromm M, Yang B, Weeks DP (2013b) Dem-
onstration of CRISPR/Cas9/sgRNA-mediated targeted gene
modification in Arabidopsis, tobacco, sorghum and rice. Nucleic
Acids Res 41. doi:10.1093/nar/gkt780
Jiang W, Yang B, Weeks DP (2014) Efficient CRISPR/Cas9-mediated
gene editing in Arabidopsis thaliana and inheritance of modified
genes in the T2 and T3 generations. PLoS One 9:e99225
Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E
(2012) A programmable dual-RNA-guided DNA endonuclease in
adaptive bacterial immunity. Science 337:816–821
Kim Y-G, Cha J, Chandrasegaran S (1996) Hybrid restriction
enzymes: zinc finger fusions to Fok I cleavage domain. Proc Natl
Acad Sci 93:1156–1160
Lee HJ, Kim E, Kim J-S (2010) Targeted chromosomal deletions in
human cells using zinc finger nucleases. Genome Res 20:81–89
Li T, Liu B, Spalding MH, Weeks DP, Yang B (2012) High-efficiency
TALEN-based gene editing produces disease-resistant rice. Nat
Biotechnol 30:390–392
Li J-F, Norville JE, Aach J, McCormack M, Zhang D, Bush J, Church
GM, Sheen J (2013) Multiplex and homologous recombination-
mediated genome editing in Arabidopsis and Nicotiana bentha-
miana using guide RNA and Cas9. Nat Biotechnol 31:688–691
Liang Z, Zhang K, Chen K, Gao C (2014) Targeted Mutagenesis in
Zea mays using TALENs and the CRISPR/Cas System. J Genet
Genomics 41:63–68
Lin Y, Cradick TJ, Brown MT, Deshmukh H, Ranjan P, Sarode N,
Wile BM, Vertino PM, Stewart FJ, Bao G (2014) CRISPR/Cas9
systems have off-target activity with insertions or deletions
between target DNA and guide RNA sequences. Nucleic Acids
Res 42:7473–7485
Liu Y, Ma S, Wang X, Chang J, Gao J, Shi R, Zhang J, Lu W, Liu
Y, Zhao P (2014) Highly efficient multiplex targeted mutagen-
esis and genomic structure variation in Bombyx mori cells using
CRISPR/Cas9. Insect Biochem Mol Biol 49:35–42
Lloyd A, Plaisier CL, Carroll D, Drews GN (2005) Targeted mutagen-
esis using zinc-finger nucleases in Arabidopsis. Proc Natl Acad
Sci USA 102:2232–2237
Ma S, Wang X, Liu Y, Gao J, Zhang S, Shi R, Chang J, Zhao P, Xia
Q (2014) Multiplex genomic structure variation mediated by
TALEN and ssODN. BMC Genom 15:41
Mahfouz MM, Li L, Shamimuzzaman M, Wibowo A, Fang X, Zhu
J-K (2011) De novo-engineered transcription activator-like effec-
tor (TALE) hybrid nuclease with novel DNA binding specificity
creates double-strand breaks. Proc Natl Acad Sci 108:2623–2628
Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE,
Church GM (2013) RNA-guided human genome engineering via
Cas9. Science 339:823–826
Mani M, Kandavelou K, Dy FJ, Durai S, Chandrasegaran S (2005)
Design, engineering, and characterization of zinc finger nucle-
ases. Biochem Biophys Res Commun 335:447–457
Mao Y, Zhang H, Xu N, Zhang B, Gou F, Zhu J-K (2013) Application
of the CRISPR-Cas system for efficient genome engineering in
plants. Mol Plant 6:2008–2011
Marton I, Zuker A, Shklarman E, Zeevi V, Tovkach A, Roffe S,
Ovadis M, Tzfira T, Vainstein A (2010) Nontransgenic genome
modification in plant cells. Plant Physiol 154:1079–1087
Murashige T, Skoog F (1962) A revised medium for rapid growth and
bio assays with tobacco tissue cultures. Physiol Plant 15:473–497
Mussolino C, Morbitzer R, Lütge F, Dannemann N, Lahaye T, Cath-
omen T (2011) A novel TALE nuclease scaffold enables high
genome editing activity in combination with low toxicity. Nucleic
Acids Res 39:9283–9293
Nekrasov V, Staskawicz B, Weigel D, Jones JD, Kamoun S (2013)
Targeted mutagenesis in the model plant Nicotiana benthami-
ana using Cas9 RNA-guided endonuclease. Nat Biotechnol
31:691–693
Osakabe K, Osakabe Y, Toki S (2010) Site-directed mutagenesis in
Arabidopsis using custom-designed zinc finger nucleases. Proc
Natl Acad Sci 107:12034–12039
Pattanayak V, Ramirez CL, Joung JK, Liu DR (2011) Revealing off-
target cleavage specificities of zinc-finger nucleases by in vitro
selection. Nat Methods 8:765–770
Petolino JF, Worden A, Curlee K, Connell J, Moynahan TLS, Larsen
C, Russell S (2010) Zinc finger nuclease-mediated transgene
deletion. Plant Mol Biol 73:617–628

110 Plant Mol Biol (2015) 87:99–110
1 3
Puchta H, Fauser F (2014) Synthetic nucleases for genome engineer-
ing in plants: prospects for a bright future. Plant J 78:727–741
Schornack S, Moscou MJ, Ward ER, Horvath DM (2013) Engineering
plant disease resistance based on TAL effectors. Annu Rev Phyto-
pathol 51:383–406
Shan Q, Wang Y, Chen K, Liang Z, Li J, Zhang Y, Zhang K, Liu J,
Voytas DF, Zheng X (2013a) Rapid and efficient gene modi-
fication in rice and Brachypodium using TALENs. Mol Plant
6:1365–1368
Shan Q, Wang Y, Li J, Zhang Y, Chen K, Liang Z, Zhang K, Liu J, Xi
JJ, Qiu J-L (2013b) Targeted genome modification of crop plants
using a CRISPR-Cas system. Nat Biotechnol 31:686–688
Shukla VK, Doyon Y, Miller JC, DeKelver RC, Moehle EA, Worden
SE, Mitchell JC, Arnold NL, Gopalan S, Meng X (2009) Precise
genome modification in the crop species Zea mays using zinc-
finger nucleases. Nature 459:437–441
Sierro N, Battey JN, Ouadi S, Bakaher N, Bovet L, Willig A, Goepfert
S, Peitsch MC, Ivanov NV (2014) The tobacco genome sequence
and its comparison with those of tomato and potato. Nature Com-
mun 5:3833
Sorek R, Lawrence CM, Wiedenheft B (2013) CRISPR-mediated
adaptive immune systems in bacteria and archaea. Annu Rev Bio-
chem 82:237–266
Sun Z, Li N, Huang G, Xu J, Pan Y, Wang Z, Tang Q, Song M, Wang
X (2013) Site-specific gene targeting using transcription activa-
tor-like effector (TALE)-based nuclease in Brassica oleracea. J
Integr Plant Biol 55:1092–1103
Tovkach A, Zeevi V, Tzfira T (2009) A toolbox and procedural notes
for characterizing novel zinc finger nucleases for genome editing
in plant cells. Plant J 57:747–757
Townsend JA, Wright DA, Winfrey RJ, Fu F, Maeder ML, Joung JK,
Voytas DF (2009) High-frequency modification of plant genes
using engineered zinc-finger nucleases. Nature 459:442–445
Upadhyay SK, Kumar J, Alok A, Tuli R (2013) RNA-guided genome
editing for target gene mutations in wheat. G3-Genes Genomes
Genet 3:2233–2238
Wang M, Wang G, Ji J, Wang J (2009) The effect of pds gene silenc-
ing on chloroplast pigment composition, thylakoid membrane
structure and photosynthesis efficiency in tobacco plants. Plant
Sci 177:222–226
Wendt T, Holm PB, Starker CG, Christian M, Voytas DF, Brinch-Ped-
ersen H, Holme IB (2013) TAL effector nucleases induce muta-
tions at a pre-selected location in the genome of primary barley
transformants. Plant Mol Biol 83:279–285
Wright DA, Townsend JA, Winfrey RJ, Irwin PA, Rajagopal J, Lon-
osky PM, Hall BD, Jondle MD, Voytas DF (2005) High-fre-
quency homologous recombination in plants mediated by zinc-
finger nucleases. Plant J 44:693–705
Xiao A, Wang Z, Hu Y, Wu Y, Luo Z, Yang Z, Zu Y, Li W, Huang P,
Tong X (2013) Chromosomal deletions and inversions medi-
ated by TALENs and CRISPR/Cas in zebrafish. Nucleic Acids
Res 41:e141
Xie K, Yang Y (2013) RNA-guided genome editing in plants using a
CRISPR-Cas system. Mol Plant 6:1975–1983
Xie X, Wang G, Yang L, Cheng T, Gao J, Wu Y, Xia Q (2014)
Cloning and characterization of a novel Nicotiana tabacum
ABC transporter involved in shoot branching. Physiol Plant.
doi:10.1111/ppl.12267
Xu R, Li H, Qin R, Wang L, Li L, Wei P, Yang J (2014) Gene target-
ing using the Agrobacterium tumefaciens-mediated CRISPR-Cas
system in rice. Rice 7:5
Yoo S-D, Cho Y-H, Sheen J (2007) Arabidopsis mesophyll proto-
plasts: a versatile cell system for transient gene expression analy-
sis. Nat Protoc 2:1565–1572
Zhang F, Maeder ML, Unger-Wallace E, Hoshaw JP, Reyon D, Chris-
tian M, Li X, Pierick CJ, Dobbs D, Peterson T (2010) High fre-
quency targeted mutagenesis in Arabidopsis thaliana using zinc
finger nucleases. Proc Natl Acad Sci 107:12028–12033
Zhang Y, Zhang F, Li X, Baller JA, Qi Y, Starker CG, Bogdanove AJ,
Voytas DF (2013) Transcription activator-like effector nucle-
ases enable efficient plant genome engineering. Plant Physiol
161:20–27
Zhang H, Zhang J, Wei P, Zhang B, Gou F, Feng Z, Mao Y, Yang L,
Zhang H, Xu N (2014) The CRISPR/Cas9 system produces spe-
cific and homozygous targeted gene editing in rice in one genera-
tion. Plant Biotechnol J 12:797–807