ArticlePDF Available

Huntingtin promotes mTORC1 signaling in the pathogenesis of Huntington's disease

Authors:
  • The Scripps Research Institute Jupiter, Florida, USA

Abstract and Figures

In patients with Huntington's disease (HD), the protein huntingtin (Htt) has an expanded polyglutamine (poly-Q) tract. HD results in early loss of medium spiny neurons in the striatum, which impairs motor and cognitive functions. Identifying the physiological role and molecular functions of Htt may yield insight into HD pathogenesis. We found that Htt promotes signaling by mTORC1 [mechanistic target of rapamycin (mTOR) complex 1] and that this signaling is potentiated by poly-Q-expanded Htt. Knocking out Htt in mouse embryonic stem cells or human embryonic kidney cells attenuated amino acid-induced mTORC1 activity, whereas overexpressing wild-type or poly-Q-expanded Htt in striatal neuronal cells increased basal mTOR activity. Striatal cells expressing endogenous poly-Q-expanded Htt showed an increase in the number and size of mTOR puncta on the perinuclear regions compared to cells expressing wild-type Htt. Pull-down experiments indicated that amino acids stimulated the interaction of Htt and the guanosine triphosphatase (GTPase) Rheb (a protein that stimulates mTOR activity), and that Htt forms a ternary complex with Rheb and mTOR. Pharmacologically inhibiting PI3K (phosphatidylinositol 3-kinase) or knocking down Rheb abrogated mTORC1 activity induced by expression of a poly-Q-expanded amino-terminal Htt fragment. Moreover, striatum-specific deletion of TSC1, encoding tuberous sclerosis 1, a negative regulator of mTORC1, accelerated the onset of motor coordination abnormalities and caused premature death in an HD mouse model. Together, our findings demonstrate that mutant Htt contributes to the pathogenesis of HD by enhancing mTORC1 activity.
Content may be subject to copyright.
NEURODEGENERATION
Huntingtin promotes mTORC1 signaling in the
pathogenesis of Huntingtons disease
William M. Pryor,
1
Marta Biagioli,
2
Neelam Shahani,
1
Supriya Swarnkar,
1
Wen-Chin Huang,
1
Damon T. Page,
1
Marcy E. MacDonald,
2
Srinivasa Subramaniam
1
*
In patients with Huntingtons disease (HD), the protein huntingtin (Htt) has an expanded polyglutamine (poly-Q)
tract. HD results in early loss of medium spiny neurons in the striatum, which impairs motor and cognitive
functions. Identifying the physiological role and molecular functions of Htt may yield insight into HD patho-
genesis. We found that Htt promotes signaling by mTORC1 [mechanistic target of rapamycin (mTOR)
complex 1] and that this signaling is potentiated by poly-Qexpanded Htt. Knocking out Htt in mouse embry-
onic stem cells or human embryonic kidney cells attenuated amino acidinduced mTORC1 activity, whereas
overexpressing wild-type or poly-Qexpanded Htt in striatal neuronal cells increased basal mTOR activity.
Striatal cells expressing endogenous poly-Qexpanded Htt showed an increase in the number and size of
mTOR puncta on the perinuclear regions compared to cells expressing wild-type Htt. Pull-down experiments
indicated that amino acids stimulated the interaction of Htt and the guanosine triphosphatase (GTPase) Rheb
(a protein that stimulates mTOR activity), and that Htt forms a ternary complex with Rheb and mTOR. Pharma-
cologically inhibiting PI3K (phosphatidylinositol 3-kinase) or knocking down Rheb abrogated mTORC1 activity
induced by expression of a poly-Qexpanded amino-terminal Htt fragment. Moreover, striatum-specific deletion
of TSC1, encoding tuberous sclerosis 1, a negative regulator of mTORC1, accelerated the onset of motor co-
ordination abnormalities and caused premature death in an HD mouse model. Together, our findings dem-
onstrate that mutant Htt contributes to the pathogenesis of HD by enhancing mTORC1 activity.
INTRODUCTION
Huntingtons disease (HD) is associated with an expansion of cytosine-
adenine-guanine (CAG) trinucleotide repeats (>36) in exon 1 of the ITI5
gene, causing long N-terminal polyglutamine (poly-Q) tracts in the encoded
protein huntingtin (Htt) (1). An N-terminal exon 1 fragment of Htt with
expanded poly-Q elicits HD-related motor deficits and pathological pheno-
types in mouse models (24). Except for prominent HEAT repeats, Htt has
no homology with other proteins (5). Deletion of Htt causes embryonic le-
thality in mice at around embryonic day (E) 8.5 (6) and impairs vesicular
transport and posttranscriptional RNA-mediated silencing (79). Previous-
ly, we demonstrated a role for the striatal-enriched guanosine triphosphatase
(GTPase) Rhes, an activator of the Ser/Thr kinase mechanistic target of
rapamycin(mTOR), in HD (10,11). Rhes, which binds to an N-terminal frag-
ment of poly-Qexpanded Htt, promotes striatal cell toxicity in multiple cell
culture and mouse models of HD (10,1217). Aside from protection offered
by mTOR inhibitors against the motor abnormalities in mice and flies
expressing the poly-Q Htt fragment (18,19), it is of interest to delineate
the exact role of mTOR signaling in the consequences of poly-Qexpanded
Htt and, in turn, whether or how Htt modulates mTOR activity.
Amino acids activate mTOR and, in association with raptor and other
proteins, form mTOR complex 1 (mTORC1), which phosphorylates targets
S6 kinase (S6K) and eukaryotic translation initiation factor 4E (eIF4E)
binding protein 1 (4EBP1) at multiple sites (20). The Rag family of small
GTPases is implicated in this process, in which they sense amino acids and
translocate mTOR to perinuclear locations in close proximity with the small
GTPase Rheb, a major activator of mTORC1 (21,22). Growth factor
induced signaling, which requires amino acidinduced signaling for full ac-
tivationofmTORC1(23), also converges on Rheb, presumably through the
phosphatidylinositol 3-kinase (PI3K)Akt pathway, which inactivates tu-
berous sclerosis proteins 1 and 2 (TSC1/2), a Rheb GTPaseactivating pro-
tein (24). Consistent with this, the PI3K-Akt pathway inhibitor wortmannin
suppresses amino acidmediated mTORC1 signaling in mammalian cells
(25), implying that TSC1/2 may inactivate Rheb to reduce mTORC1
signaling. However, experiments in TSC1/2
/
mouse and human cells in-
dicate that guanosine triphosphate (GTP)loaded Rheb alone is not suffi-
cient, and some other wortmannin-sensitive factors, acting independently of
the classical PI3K-Akt pathway, may cooperate with Rheb to induce
mTORC1 activity (2527). Here, we investigated how Htt regulates
mTORC1 signaling and the relevance of this mechanism to behavioral def-
icits in HD.
RESULTS
Htt promotes amino acidinduced mTORC1 activity in
the regulation of cell size
Htt, like mTOR, is a ubiquitously expressed protein. To determine the
effects of Htt on mTORC1 activity, we used three lines of cultured cells:
human embryonic kidney (HEK) 293 cells, mouse embryonic stem (ES)
cells, and mouse striatal cells. Knocking down endogenous Htt in
HEK293 cells with three different short hairpin RNAs (shRNAs) caused
a marked loss of steady-state mTORC1 activity, as measured by phospho-
rylation of S6K at Thr
389
(pS6K) (Fig. 1A). Because amino acids, such as
leucine, robustly activate mTORC1, we tested whether Htt modulates amino
acidinduced activation of mTORC1, using ES cells that either had or
lacked endogenous Htt. Leucine had a lesser effect on mTORC1 activity
in Htt knockout (Htt
/
)thaninwild-type(Htt
+/+
) ES cells (Fig. 1B). On
the basis of these data, we hypothesized that ectopic overexpression of
Htt should potentiate mTORC1. As predicted, expression of full-length
1
Department of Neuroscience, The Scripps Research Institute Florida, Jupiter, FL
33458, USA.
2
Center for Human Genetic Research, Massachus etts General Hos-
pital,Boston,MA02114,USA.
*Corresponding author. E-mail: ssubrama@scripps.edu
RESEARCH ARTICLE
www.SCIENCESIGNALING.org 28 October 2014 Vol 7 Issue 349 ra103 1
on January 2, 2015http://stke.sciencemag.org/Downloaded from
mTOR
Leu:
N171-82Q
(myc)
300 µM
3 mM
1 mM
300 µM
3 mM
1 mM
myc (control) N171-82Q
C
E
S6
myc (control)
Leu:
N171-82Q
Ataxin-82Q
S6K
4EBP1
Ataxin 82Q
(GFP)
N171-82Q
(myc)
mTOR
G
50K0 250K200K150K100K
Count
Htt N171-82Q
Control
FSC-H
40K
50K
60K
70K
80K
Mean FSC-H
***
H
S6K
S6
(high exposure)
(high exposure)
4EBP1
+ +
+
N171-
82Q
myc
(control)
I
S6K
S6
mTOR
myc (control)
myc HTT FL23Q
myc HTT FL86Q
Leu: – + – +
– +
mHTT
WT HTT
0
4
8
12
0
2
4
6
8
pS6K (a.u.)
pS6 (a.u.)
*
*
**
**
HTT
0
1
2
3
4
0
10
20
30
N171-82Q
myc
***
***
myc (control)
N171-82Q
Leu:
mTOR
S6K
N171-82Q
(myc)
pS6
S6
pS6
(high exposure)
p4EBP1
4EBP1
+
+
+
+
+ +
0
2
4
6
8
Htt N171 82Q
myc
0
10
20
***
**
– + – +
mTOR
S6K
S6
myc (control)
N171 82Q
Leu: + +
4EBP1
N171-82Q
(myc) Leu:
F
**
**
*
***
*
*
pS6K (a.u.)
pS6 (a.u.)
– + – +
Leu:
pS6K (a.u.)
pS6 (a.u.)
pS6K
pS6K
pS6
pS6
p4EBP1
pS6K
pS6
p4EBP1
pS6K
pS6
p4EBP1
pS6K
FL23Q
myc FL86Q
Leu: – + – +– +
Leu: – + – +– +
Leu:
Leu:
Striatal cells
Htt
S6K
0.2
0.6
1.0
1.4
B
Htt +/+
Htt –/–
Htt +/+
Htt –/–
Htt +/+
Htt –/–
Htt +/+
Htt –/–
pS6K (a.u.)
mTOR
**
**
**
pS6K
+
+ Leu
AA:
AA: +–
+Leu
ES cells
HTT
mTOR
S6K
HTT
0
0.4
0.8
1.2
HTT (a.u.)
**
*
**
pS6K (a.u.)
0
0.4
0.8
1.2
**
***
Control
H3
H2
H1
A
pS6K
con
H3
H2
H1
con
H3
H2
H1
shRNA:
shRNA:
HEK293 cells
D
S6K
S6
STHdh
Q7/Q7
Htt
mTOR
STHdh
Q111/Q111
Leu: + +
Q7
Q111
1
3
5
7
0
10
20
30
STHdhQ111/Q111
STHdhQ7/Q7
**
**
+
+
+ +
**
**
pS6K (a.u.)
pS6 (a. u.)
Leu:
pS6
pS6K Leu:
Striatal cells Striatal cells HEK293 cells
HEK293 cells HEK293 cells
(ST )HdhQ7/Q7
(ST )HdhQ7/Q7
Fig. 1. Htt mediates amino acidinduced mTORC1 signaling.
(A) Western blotting of HEK293 cells transfected with one
of three human HTT shRNA (H1 to H3) and cultured for
48 hours in full Dulbeccos modified Eaglesmedium(DMEM).
(Bto F) Western blotting analysis of mTORC1 targets (pS6K-
Thr
389
, pS6-Ser
235/236
, or p4EBP1-Ser
65
) and others as in-
dicated in response to leucine in (B) serum-starved wild-type (Htt
+/+
)orHtt knockout (Htt
/
) mouse ES cells grown in F12 medium containing all amino
acids (AA) (+) or F12 medium lacking L-leucine, L-lysine, and L-methionine (), or F12 () stimulated with Leu (+Leu); (C) serum-starved STHdh
Q7/Q7
cells
transfected with normal (FL23Q) or poly-Qexpanded (FL86Q) myc-tagged full-length humanHTT (1 mg), grown in F12 () or stimulated with Leu (+); (D)
STHdh
Q7/Q7
or STHdh
Q111/Q111
cells treated as in (C); (E) STHdh
Q7/Q7
cells transfected with human N171-82Q (1 mg), stimulated with Leu as in (C); or (F)
HEK293 cellstransfected with N171-82Q(0.6 mg) and stimulated with Leu as in (C). Dataare means ± SEM from three independent experiments. *P<0.05,
**P<0.01,***P< 0.001 compared to control, Studentsttest. (Gand H) Western blotting of HEK293 cells transfected with (G) N171-82Q (0.6 mg) or (H)
poly-Qexpanded ataxin-1 (Ataxin-82Q, 1 mg) and stimulated with leucine (3 mM or as indicated). (I) Cell size analysis in HEK293 cells transfected with
N171-82Q (0.6 mg), measured by forward scatter (FSC-H). Data are means ± SEM from three experiments. ***P< 0.001, Studentsttest. Blots are rep-
resentative of three independent experiments.
RESEARCH ARTICLE
www.SCIENCESIGNALING.org 28 October 2014 Vol 7 Issue 349 ra103 2
on January 2, 2015http://stke.sciencemag.org/Downloaded from
Htt containing 23 glutamines (FL-HTT-23Q) in striatal cells expressing en-
dogenous wild-type Htt with 7 glutamines [STHdh
Q7/Q7
(28)] markedly
increased leucine-induced mTORC1 activity, as assessed by the abundance
of pS6K and the phosphorylation of S6 at Ser
235/236
(pS6), which was fur-
ther increased by full-length Htt with an expanded poly-Q tract (FL-HTT-
86Q) (Fig. 1C). This effect was reproducible in HEK293 cells (fig. S1A).
Striatal cells expressing endogenous mutant Htt with 111 glutamines
[STHdh
Q111/Q111
(28)] also responded more robustly to leucine-induced
mTORC1 compared to STHdh
Q7/Q7
striatal cells (Fig. 1D).
The N-terminal portion of Htt with expanded poly-Q repeats can pro-
mote HD-related pathology. Therefore, we tested whether the N-terminal
mutant Htt containing 82 glutamines (N171-82Q), a fragment that elicits
HD pathology in mice (4), can promote mTORC1 activity. N171-82Q po-
tentiated leucine-induced pS6K and pS6, as well as the phosphorylation of
4EBP1 at Ser
65
(p4EBP1, another mTORC1 substrate), in both striatal cells
and HEK293 cells (Fig. 1, E and F), in a manner possibly influenced by the
concentration of both leucine (Fig. 1G) and N171-82Q (fig. S1B). This mu-
tant Htt fragmentmediated effect on mTORC1 appeared to be more potent
than that of full-length mutant Htt (fig. S1C). However, this could be due to
different transfection efficiencies of the two constructs.
Next, we tested whether ataxin, another poly-Qcontaining protein, pro-
motes mTORC1 similar to poly-Qexpanded Htt. Compared to Htt, an
overexpression of poly-Qexpanded ataxin (Ataxin-82Q) had a minimum
effect on leucine-induced mTORC1 activity in HEK293 cells (Fig. 1H). Be-
cause mTORC1 activation is known to promote cell size, we investigated
whether N171-82Q might affect the amino acid regulation of cell size (29).
We found that the average size of HEK293 cells in cultures expressing
N171-82Q was significantly larger than that of the control cells when
cultured in serum-free medium containing the full complement of amino
acids (Fig. 1I). This finding is consistent with the previous report demon-
strating a larger soma size of striatal neuronlike cells expressing FL-HTT-
140Q compared to cells expressing FL-HTT-7Q (30). Together, these data
indicate that Htt mediates amino acidinduced mTORC1 signaling, and that
the poly-Qexpanded fragment of Htt potentiates mTORC1 activity in an
expected cellular outcome (cell size).
Htt promotes mTORC1 activity in a
Rheb-dependent manner
To determine the potential mechanisms of how Htt may regulate mTORC1
activity, we used inhibitors of mitogen-activated protein kinase (MAPK)
and PI3K, two upstream regulators of mTORC1 (31). Whereas the MAPK
inhibitor U0126 was ineffective, the PI3K inhibitor wortmannin prevented
N171-82Qinduced mTORC1 activity in HEK293 cells to a similar extent
as did the mTOR inhibitor rapamycin (Fig. 2A). These effects were also
observed in STHdh
Q111/Q111
striatal cells (Fig. 2B). Like wortmannin, the
Akt inhibitor MK-2206 also blocked mutant Httinduced mTORC1 activity
in response to amino acid stimulation in HEK293 cells (fig. S2). This sug-
gests that the PI3K-Akt pathway, a well-established mTORC1 promoter
(25,32,33), is crucial for Htt-mediated mTORC1 activity. A direct effect
of Htt on the PI3K-Akt pathway is unlikely, because Htt neither apprecia-
bly altered the phosphorylation of mTOR at Ser
2448
, a target of PI3K-Akt
signaling (34,35), nor significantly increased the phosphorylation of Akt
at Thr
308
, a PI3K target phosphosite (figs. S2 and S3). Due toreasons that
are yet unclear, striatal cells expressing mutant Htt exhibited low Akt
phosphorylation under amino aciddeprived conditions, compared with
wild-type Htt expressing striatal cells (Fig. 2B).
Next, we wanted to determine the mechanism by which wortmannin and
MK-2206 block Htt-mTORC1 signaling. One possibility is that these inhib-
itors may be relieving PI3K-Aktmediated inhibitory restraints on TSC1/2,
thus inactivating Rheb GTPase, a major promoter of amino acidinduced
mTORC1 (27,36,37). Therefore, because Htt was unable to activate Akt
but wortmannin blocked Htt-mediated mTORC1, we hypothesized that Htt
might be acting downstream of PI3Kfor example, in association with
Rhebto increase mTORC1 signaling. If this hypothesis is correct, we rea-
soned that Rheb and Htt must synergistically activate mTORC1. In support
of this notion, we found a more potent activation of leucine-mediated
mTORC1 in cells overexpressing both N171-82Q and Rheb. This enhance-
ment is less effective with expression of Rheb D60K, a GTP binding
defective mutant (38), in both HEK293 cells and striatal cells (Fig. 2, C and
D). These data suggest that the poly-Qexpanded Htt fragment cooperates
with active Rheb to promote mTORC1 signaling. Consistent with this no-
tion, N171-82Q was defective in activating mTORC1 in Rheb-depleted
HEK293 cells (Fig. 2E), and Rheb was defective in activating mTORC1
in Htt shRNAtreated cells (Fig. 2F and fig. S4). Together, these data indi-
cate that Htt can promote mTORC1 signaling in cooperation with Rheb.
Htt alters the intracellular localization of mTOR and
enhances its interaction with Rheb in a ternary complex
To further dissect the mechanisms involved, we tested whether Htt and Rheb
interact. Because the commercial antibodies we used were less optimal in
our hands for endogenous coimmunoprecipitation, we used the glutathione
S-transferase (GST) affinity pull-down method (10). In HEK293 cells, full-
length wild-type Htt (FL-HTT-23Q) readily bound to GST-Rheb in the ab-
sence of amino acids, and this interaction increased about twofold in the
presence of amino acids (Fig. 3A). Immunocytochemical analysis revealed
that amino acids also stimulated the colocalization of Rheb and Htt in
HEK293 cells (Fig. 3B). The poly-Qexpanded Htt (FL-HTT-86Q) bound
more strongly to Rheb than did FL-HTT-23Q in the presence of amino acids
(fig. S5). FL-HTT-86Q and N171-82Q strongly interacted with Rheb under
amino aciddeprived conditions, and neither was further enhanced by the
addition of amino acids (Fig. 3, C and D). Similarly, there appeared to be
less induction of the interaction between Htt and Rheb after amino acid stim-
ulation in mouse striatal cells expressing mutant Htt (STHdh
Q111/Q111
)thanin
those expressing wild-type Htt (STHdh
Q7/Q7
) (Fig. 3E and fig. S6). This in-
dicates that whereas wild-type Htt binds to Rheb in an amino aciddependent
manner, poly-Qexpanded Htt or N-terminal poly-Qexpanded Htt frag-
ments appear to have a strong affinity for Rheb regardless of amino acid
conditions. Although the mechanisms are unclear, the poly-Q expansion of
Htt is known to confer additional binding affinities, possibly because of
altered conformations as demonstrated for other proteins (10,39,40).
Next, we investigated whether Htt, which normally resides at multiple
intracellular locations (similar to mTOR) (41,42), changes its localization
when stimulated with amino acids. In HEK293 cells deprived of amino
acids, we found that endogenous Htt and mTOR were dispersed throughout
the cytoplasm as granular structures with sparse colocalization (Fig. 3F).
When stimulated with amino acids, mTOR formed perinuclear punctate
structures, consistent with previous reports (43,44), whereas Htt also
formed a rapid perinuclear accumulation with enhanced colocalization with
mTOR (Fig. 3F). Although mTOR is localized to multiple compartments, it
is evident that mTOR aggregates are enriched with lysosomal markers, such
as LAMP1 or LAMP2, when stimulated with amino acids (22,45). We
tested whether Htt [which is also known to be associated with lysosomes
(4649)] also displayed colocalization with LAMP1-positive vesicles.
LAMP1 was present throughout the cells, consistent with previous reports
(22,50), and we found enhanced colocalization of Htt with LAMP1 in the
perinuclear region in cells upon stimulation with amino acids (fig. S7). Be-
cause proper intracellular localization of mTOR is crucial for its activity
(42), and Htt regulates intracellular protein trafficking (51,52), we
wondered whether Htt might alter the intracellular localization of mTOR
upon amino acid stimulation. In concordance with previous reports
RESEARCH ARTICLE
www.SCIENCESIGNALING.org 28 October 2014 Vol 7 Issue 349 ra103 3
on January 2, 2015http://stke.sciencemag.org/Downloaded from
S6
Rheb
Control shRNA Rheb shRNA
myc-N171-82Q
S6K
mTOR
A
S6
HTT
Control shRNA HTT shRNA
myc-Rheb
S6K
mTOR
N171-82Q:
Vehicle
Rapamycin
U0126
Wortmannin
pERK1/2
pAkt
Akt
ERK1/2
myc:
myc
myc
+ + + +
+ + + +
mTOR
N171-82Q
(myc)
pS6K
pS6
S6K
S6
N171-82Q
(myc)
Rheb
(myc)
pS6
pS6
pS6K
pS6K
B
mTOR
+ – + – + – +
Vehicle
Rapamycin
UO126
Wortmannin
S6
S6K
pERK1/2
Akt
ERK1/2
+
Vehicle
STHdhQ111/Q111
STHdhQ7/Q7
Htt
0
2
4
6
8
STHdhQ7/Q7
STHdhQ111/Q111
10
12
0
2
4
6
8
+
+
+
+
+
10
Vehicle
Rapamycin
UO126
Wortmannin
Vehicle
Vehicle
Rapamycin
UO126
Wortmannin
Vehicle
*
**
## ##
##
##
C
F
+
Rheb D60K
N171-82Q
Rheb WT
+
+ + + + +
+
+++++
+
++
++++
mTOR
S6
S6K
N171-82Q
(myc)
Rheb
(myc)
2
6
10
14
*
*
#
##
##
##
#
#
**
**
**
N171-82Q
Rheb
N171-82Q + Rheb
Rheb D60K
myc
N171-82Q + Rheb D60K
5
15
25
##
##
**
**
**
mTOR
S6K
S6
+
Rheb D60K
N171-82Q
Rheb WT
+–
+
+ + + +
+
+++++
+
++–
++++
0
2
4
6
8
10
0
2
4
6
8
10
**
*
*
**
**
#
## ##
##
##
##
##
##
D
E
N171-82Q
Rheb
N171-82Q + Rheb
Rheb D60K
myc
N171-82Q + Rheb D60K
HEK293 cells
Striatal cells (STHdhQ7/Q7)
HEK293 cells Striatal cells
HEK293 cells
HEK293 cells
pAkt
Leu:
Leu:
Leu:
Leu:
Leu:
Leu:
Leu:
Leu:
Leu:
pS6K
pS6
pS6K
pS6
pS6K
pS6
+
+
+
+
+
pS6K (a.u.)
pS6 (a.u.)
pS6K (a.u.)
pS6 (a.u.)
pS6K (a.u.)
pS6 (a.u.)
N171-82Q
(myc)
Rheb
(myc)
+ + + + + +
+ + + + + +
AA: +– +–+–––
Leu: +++
+ + + + + +
+ + + + + +
AA: +– +–+–––
Leu: +++
Fig. 2. The Htt-mediated mTORC1 pathway is wortmannin-sensitive
and Rheb-dependent. (A) Western blotting analysis of mTORC1 targets
(pS6K-Thr
389
or pS6-Ser
235/236
) and others as indicated in HEK293
cells transfected with myc or myc-tagged N171-82Q cultured in F12+
medium containing all amino acids (AA) and treated with vehicle (0.01% dimethyl sulfoxide), rapamycin (100 nM), U0126 (10 mM), or wortmannin (100 nM) for
2hours.(B) Western blotting of serum-starved STHdh
Q7/Q7
cells grown in F12 () medium lacking L-leucine, L-lysine, and L-methionine and treated with
vehicle, or STHdh
Q111/Q111
cells treated with vehicle, rapamycin, U0126, or wortmannin for 2 hours and then stimulated with leucine (3 mM, 10 min). Data
are means ± SEM from three experiments. *P<0.05,**P< 0.01 against vehicle-treated STHdh
Q7/Q7
cells;
#
P<0.05,
##
P< 0.01 against vehicle-treated
STHdh
Q111/Q111
cells, Studentsttest. (Cand D) Western blotting of (C) HEK293 or (D) STHdh
Q7/Q7
cells transfected with myc or myc-tagged wild-type
(WT) or mutant (D60K) Rheb (0.25 mg) in the presence or absence of N171-82Q (0.5 mg) in F12 () medium and stimulated with leucine (3 mM, 10 min).
Data are means ± SEM from three experiments. *P<0.05,**P< 0.01 against Leu-stimulated cells;
#
P< 0.05,
##
P< 0.01 against starved cells. (Eand F)
Western blotting of HEK293 cells transfected as indicated for 48 hours, cultured in either F12+ or F12medium for 1 hour, and then stimulated with leucin e. In
(F), HTT shRNA was the H1 construct. Blots are representative of at least three independent experiments.
RESEARCH ARTICLE
www.SCIENCESIGNALING.org 28 October 2014 Vol 7 Issue 349 ra103 4
on January 2, 2015http://stke.sciencemag.org/Downloaded from
pulldown
F
AA
GST
GST-Rheb
myc-FL-HTT-86Q +
++
+
++
+
GST
GST-Rheb
GST-
pulldown
Input
C
Bound HTT
(a.u)
HTT
(myc)
E
HTT
(myc)
AA
GST
GST-Rheb
FL-HTT-23Q +
++
+
++
++
GST
GST-Rheb
GST-
Input
A
Bound HTT
(a.u)
HTT
(myc)
HTT
(myc)
GST
GST-Rheb
HTT
AA
GST
GST-Rheb
+
++
+
++
++
+
+
HTT
GST-
pulldown
Input
AA
GST
GST-Rheb
myc-N171-82Q +++
+
++
++
GST-
pulldown
Input
GST
GST-Rheb
Bound HTT
(a.u)
HTT
(myc)
HTT
(myc)
D
+
STHdhQ111/Q111
STHdhQ7/Q7
Striatal cells
B
+
+
0
2
4
6
**
0
2
4
6
0
2
4
6
ns ns
**
** **
AA-stimulated (–/+) AA-starved (–)
myc-
FL-HTT-23QHA-Rheb OverlayDAPI
0
0.2
0.4
0.6
0.8
1 ***
Pearson’s r
AA-starved
(–)
HA-Rheb
myc-HTT-23Q myc-HTT-23Q
AA-stimulated
(–/+)
HA-Rheb
––/+
Inset
AA:
DAPI mTOR HTT Overlay
0
0.2
0.4
0.6
–/+
Pearson’s
r
***
AA:
AA-stimulated (–/+) AA-starved (–)
Inset
HTT
mTOR
HTT
mTOR
AA-starved (–) AA-stimulated (–/+)
GST GST-Rheb
AA ++
GST GST-Rheb
AA ++
GST GST-Rheb
++ Fig. 3. Htt binds and colocalizes
tomTORandRhebinanamino
aciddependent manner. (A) Pull-
down analysis of the Rheb-HTT
interaction in HEK293 cells trans-
fected as indicated, deprived of
amino acids in Krebs buffer for
1hour(), and then stimulated with
1× essential amino acids (AA)
for 10 min (+). **P< 0.01, Students
ttest. (B) Colocalization of Rheb and Htt in
HEK293 cells expressing hemagglutinin
(HA)Rheb or myc-FL-HTT-23Q, in ()or
(+) amino acids as described in (A). The
Pearsonsrcorrelation was calculated from
the average of 30 to 40 cells per group from
three experiments. ***P< 0.001, Studentst
test. Scale bar, 20 mm. DAPI, 4,6-diamidino-2-
phenylindole. (Cand D) Pull-down analysis of the interaction of Rheb with poly-Qexpanded full-length (C) or N-terminal fragment of (D) HTT in HEK293 cells trans-
fected as indicated, in () or (+) amino acids as described in (A). ns, not significant. **P<0.01, Studentsttest. (E) Western blotting of glutathione binding assay in striatal
cells (STHdh
Q7/Q7
,STHdh
Q111/Q111
) expressing GST or GST-Rheb in () or (+) of amino acids as described in (A). (F) Immunofluorescence analysis of endogenous Htt
and mTOR in HEK293 cells in () or (+) amino acids as described in (A). The Pearsonsrcorrelation was calculated from the average of 30 to 40 cells per group from
three experiments. ***P< 0.001, Studentsttest. Scale bar, 20 mm. Blots are representative of three experiments. Data are means ± SD from three experiments.
RESEARCH ARTICLE
www.SCIENCESIGNALING.org 28 October 2014 Vol 7 Issue 349 ra103 5
on January 2, 2015http://stke.sciencemag.org/Downloaded from
(43,44), mTOR was dispersed similarly
throughout the cytoplasm in wild-type
and Htt
/
ES cells (Fig. 4A). Upon stim-
ulation of cells with amino acids, mTOR
rapidly formed puncta in wild-type ES
cells but displayed a markedly reduced
tendency to form such puncta in Htt
/
ES cells (Fig. 4A). Because of technical
limitations, we were unable to co-stain
for LAMP1, but our data suggest that the
amino acidinduced movement of mTOR
is hindered in Htt-deficient cells. Because
mutant Htt potentiates mTORC1 activity,
we tested whether or how it modulates
mTOR puncta formation in striatal cells.
Both the number and the size of amino
acidinduced mTOR puncta were signifi-
cantly increased in mutant Httexpressing
striatal cells compared with those in wild-
type striatal cells (Fig. 4B). Together, these
data indicate that Htt alters the amino
acidinduced intracellular movement of
mTOR.
Next, we wondered how this movement
of mTOR by Htt contributes to mTORC1
activity. One mechanism would be that Htt
might bring mTOR in close proximity to
Rheb, analogous to the function of Rag
GTPase (43). Previous work indicates that
Rheb binds mTOR in an amino acid
dependent manner (53). We tested whether
and how Htt influences the interaction be-
tween mTOR and Rheb. Using the GST
pull-down assay, we found that overexpres-
sion of wild-type Htt (FL-HTT-23Q) mark-
edly increased the binding of mTOR to
Rheb (Fig. 4C), indicating that Htt promotes
the mTOR-Rheb interaction. Consistent
with this, a two-step coprecipitation assay re-
vealed a ternary complex formation among
transfected Htt, mTOR, and Rheb (Fig. 4D).
Together, these data suggest that Htt (i)
forms amino aciddependent perinuclear
accumulation, (ii) facilitates the intracellular
movement of mTOR, (iii) binds to Rheb and
enhances its association with mTOR, and
(iv) forms a ternary complex with Rheb
and mTOR.
Depletion of TSC1 in an HD
mouse model increases
behavioral abnormalities and
causes premature death
Having established that a poly-Qexpanded
full-length or N-terminal fragment of Htt
potentiates mTORC1 activity, we aimed to
determine if this pathway contributes to
the in vivo progression of abnormalities
in the N171-82Q transgenic mouse model
of HD (herein called N171HD mice) (4).
A
mTOR
GST
mTOR
AA
GST
GST-Rheb
+
++
+
++
++
+
myc-mTOR
myc-FL-HTT-23Q ++
GST-
pulldown
Input
0
8
16
24
Bound mTOR
(a.u)
GST-Rheb
HTT
(myc)
HTT
(myc)
GST
GST-Rheb
myc-mTOR
myc-FL-HTT-23Q
+
+
+
+
+
GST
pulldown
mTOR
HTT IgG
GST
GST-Rheb
mTOR
HTT
mTOR
GST
GST-Rheb
IgG
Input (10%)
1st pull
down
2nd pull
down
GST-Rheb
C
Con IgG
+
++
AA
+
+
+
+
++
++
+
+
+
+
++
++
*
0
50
100
150
mTOR puncta/nucleus
STHdhQ7/Q7
0
50
100
150
200
250
Number of mTOR
puncta/cell
**
STHdhQ111/Q111
0
5
10
15
Size of mTOR
puncta
***
B
+/+ –/–Htt
D
HTT HTT
+/+ +/+–/–
Htt
DAPI
mTOR
–/–
–+
AA
STHdhQ7/Q7 STHdhQ111/Q111
DAPImTOR
––++
AA
Fig. 4. Htt regulates the intracellular movement of mTOR and forms a ternary complex with Rheb and mTOR.
(Aand B) Immunofluorescence analysis of mTOR in (A) WT (Htt
+/+
)orHtt knockout (Htt
/
) mouse ES cells
(scale bar, 8 mm) or (B) STHdh
Q7/Q7
,STHdh
Q111/Q111
mouse striatal cells (scale bar, 20 mm) cultured in Krebs
medium (AA), then stimulated with 1× essential amino acids (AA+) for 10 min. Data are mean numbers of
mTOR puncta from 200 cells in each of two independent experiments (A) or from 20 to 30 cells in each of
three independent experiments (B). *P< 0.05, **P< 0.01, ***P< 0.001, Studentsttest. (Cand D) Pull-
down assay (C) and two-step pull-down assay (D) in HEK293 cells transfected as indicated and cultured in
amino acidcontaining medium (F12+) for 1 hour to detect a ternary complex between Htt, Rheb, and
mTOR. Blots are representative of three experiments.
RESEARCH ARTICLE
www.SCIENCESIGNALING.org 28 October 2014 Vol 7 Issue 349 ra103 6
on January 2, 2015http://stke.sciencemag.org/Downloaded from
C
0810 14 18 20
Weeks
Body weight
Behavioral battery
Survival
Genotype
TSCflox/+/ N171HD
TSCflox/+/ WT
and
Microinjections
AAV-Cre
or AAV-GFP
Sacrifice
7-week-old
Unaffected
mTOR
Control
N171HD
A
1.5
1
0.5
0
Control N171HD
7-week-old
Unaffected
ns
Relative pS6K
Control
N171HD
16-week-old
HD-affected
Relative pS6K
Control
**
3
2
1
0
N171HD
B
16-week-old
HD-affected
S6
S6K
pS6K
pS6
mTOR
S6
S6K Rotarod
Open field
Open field
10 weeks18 weeks 14 weeks
F
0
500
1000
1500
2000
2500
3000
Distance moved
Distance (cm)
0
500
1000
1500
2000
2500
3000
Distance (cm)
0
500
1000
1500
2000
2500
3000
Distance (cm)
0
2
4
6
8
10
12
Velocity
Velocity (cm/s)
Distance moved
0
2
4
6
8
10
12
Velocity (cm/s)
Velocity
**
**
**
** **
**
*
**
** **
**
**
**
** **
**
**
** **
0
2
4
6
8
10
12
Velocity (cm/s)
**
**
*
** **
**
**
**
** **
Distance moved Velocity
TSCflox/+/ WT; AAV-Cre
TSCflox/+/ N171HD; AAV-Cre
TSCflox/+/ WT; AAV-GFP
TSCflox/+/ N171HD; AAV-GFP
Rotarod
D
Behavioral battery
E
** **
**
**
*
Composite score
0.2
0.6
1.0
1.4
1.8
Composite score
0.2
0.6
1.0
1.4
1.8
Composite score
0.2
0.6
1.0
1.4
1.8
** **
**
*
**
** **
**
*
**
10 weeks 14 weeks 18 weeks
Latency (s)
0
50
100
150
200
250
300
Latency (s)
0
50
100
150
200
250
300
Latency (s)
0
50
100
150
200
250
300
** ** *
**
*
10 weeks 14 weeks
** ** **
**
*
18 weeks
Survival (%)
Week after injection
0
20
40
60
80
100
12345678910
G
TSCflox/+/ WT; AAV-Cre
TSCflox/+/ N171HD; AAV-Cre
TSCflox/+/ WT; AAV-GFP
TSCflox/+/ N171HD; AAV-GFP
***P<0.001
pS6K
pS6
Fig. 5. Depletion of TSC1, an mTORC1 inhibitor, in the striatum of
N171HD transgenic mice exacerbates HD-associated behavioral
symptoms and causes premature death. (Aand B) Western blot-
ting analysis of mTORC1 targets (pS6K-Thr
389
or pS6-Ser
235/236
)
and others as indicated in lysates from the striatum of (A) asymptomatic or (B) symptomatic
N171HD mice. Data are means ± SEM from three mice in the nonsymptomatic group, six mice
in the symptomatic group, and a corresponding number of age-matched controls. ns, not sig-
nificant. **P< 0.01, Studentsttest. (C) Experimental timeline of striatal injections and behavioral
tests. (Dto F) Behavioral analysis of HD mice with striatal-specific knockout of TSC1. Data are means ± SEM of (D) rotarod performance in three trials per day
for 4 days, (E) composite performance on various motor tasks (walking on a ledge, clasping, gait, kyphosis, and tremor), and (F) the total distance and velocity
of movement in open field tests. *P< 0.05, **P< 0.01, Studentsttest. (G) Kaplan-Meier survival analysis and Wilcoxon rank test of Cre-injected TSC1
flox/+
/
N171HD mice. ***P< 0.001. The numbers of mice assessed in (D) to (G) were as follows: TSC1
flox/+
/WT;AAV-Cre, n=7;TSC1
flox/+
/WT;AAV-GFP, n=5;
TSC1
flox/+
/N171HD;AAV-Cre, n=7;andTSC1
flox/+
/N171HD;AAV-GFP, n=6.
RESEARCH ARTICLE
www.SCIENCESIGNALING.org 28 October 2014 Vol 7 Issue 349 ra103 7
on January 2, 2015http://stke.sciencemag.org/Downloaded from
These mice progress through an asymptomatic phase to a symptomatic
phase as they age, have a life span of 20 to 24 weeks, and exhibit abnor-
malities in the striatum that are representative of HD (4). Seven-week-old
asymptomatic N171HD mice had no apparent changes in mTORC1 activity
in the striatum (Fig. 5A), whereas mTORC1 activity was significantly
increased in the striatum of 16-week-old symptomatic N171HD mice
(Fig. 5B). To investigate whether or how mTORC1 promotes disease
progression in this model, we increased mTORC1 signaling in the stri-
atum of ~8-week-old asymptomatic N171HD mice. To do this, we first
crossed wild-type or N171HD mice with mice expressing floxed alleles
of TSC1, which encodes a protein that inhibits mTORC1 (54), generating
TSC1
flox/+
/N171HD mice and TSC1
flox/+
/wild-type littermate controls.
Then, using adeno-associated virus (AAV)Cre injections that covered
40 to 60% of the striatum (fig. S8), we depleted TSC1 selectively in the
striatum of these mice, which at 8 weeksold had no observable HD symp-
toms. As a control, we injected AAVgreen fluorescent protein (GFP) into
TSC1
flox/+
/N171HD mice and TSC1
flox/+
/wild-type littermate controls. In
a separate cohort of mice, we confirmed that AAV-Cre injection consist-
ently enhanced mTORC1 activity in the striatum of TSC1
flox/+
mice (fig. S9).
Two weeks after injection, we subjected the mice to a battery of behav-
ioral tests repeated three times with 4 weeks in between testing (Fig.5C).
AAV-Creinjected TSC1
flox/+
/N171HD mice had significant weight loss
(fig. S10) and significantly impaired motor coordination and associated
phenotypes, assessed by a rotarod test (Fig. 5D); a series of tests exam-
ining walking on a ledge, clasping, gait, kyphosis (spine curvature), and
tremor (Fig. 5E); and an open field test (Fig. 5F), compared to AAV-GFP
injected TSC1
flox/+
/N171HD mice. By 4 months of age (~10 weeks after
injection), 80% of the AAV-Creinjected TSC1
flox/+
/N171HD mice had
died from severe HD pathology (Fig. 5G), whereas the AAV-GFPinjected
TSC1
flox/+
/N171HD mice lived despite severe motor defects. Together, these
data indicate that activation of mTORC1 in
the striatum expedites HD-associated motor
phenotypes and death in N171HD mice.
DISCUSSION
We demonstrate a novel functional con-
nectivity between Htt and mTOR, two de-
velopmentally important genes that in
adult animals promote cell proliferation
and cell survival and can facilitate behavior-
al dysfunction. For instance, the embryos
of both mTOR knockout mice and Htt
knockout mice fail to survive beyond E7.5
to E8.5 because of impaired proliferation
(6,55). Whereas wild-type Htt promotes
neuronal survival in mice (56), abnormal
mTOR activity promotes neurodegeneration
in diverse disorders (57). Similarly, whereas
Htt promotes anxiety and depression-like
behaviors in mice (58), mTOR inhibition
with rapamycin blocks these behaviors
(59). Our finding that Htt potentiates the
mTORC1 pathway offers a new perspective
on the biological relationship between Htt
and mTOR in this evolutionarily conserved
nutrient signaling pathway. Our data assem-
ble a working model in which amino acids
stimulate the perinuclear accumulation of
Htt, its interaction with Rheb and mTOR,
and its enhancement of mTORC1 activity (Fig. 6). mTOR is activated by
multiple stimuli: growth factors (various), nutrients (amino acids, glucose,
lipids), and the intracellular energy status of cells (60). Our data indicate
that Htt responds to amino acidinduced mTORC1, but its role in other
stimulus-induced mTORC1 signaling requires further investigation. How-
ever, amino acids play a crucial role in growth factormediated mTORC1
signaling (32,61). Therefore, in physiological settings, where separation of
amino acids and other mTORC1 signaling is difficult, a possibility of Htt
orchestrating mTORC1 induced by other stimuli, including growth factors,
cannot be ruled out.
Mechanistically, our data also imply that Htt might be involved in the
intracellular trafficking of mTOR, which is crucial for mTORC1 activation
(42). How poly-Qexpanded Htt potentiates mTOR accumulation is as yet
obscure. A growing body of evidence indicates that Htt plays a crucial role
in intracellular vesicular trafficking (62). Previously, the Rag family of
GTPases has been shown to regulate mTORC1 activation upon amino acid
stimulation by altering the intracellular accumulation of mTOR in lyso-
somes (43,44,63). We speculate that Htt might associate with the Rag
family of GTPases in regulating the intracellular trafficking of mTOR. This
notion is supported by previous findings demonstrating that Htt regu-
lates Rab GTPase activity and its post-Golgi trafficking to lysosomes
(8,48). How does poly-Q Htt maintain sustained mTORC1 activity de-
spite amino acid deprivation? Our data suggest that this may be due to the
enhanced affinity of poly-Q Htt for the Rheb/mTOR complex (Fig. 6).
This is analogous to the findings by Sancak et al.(43) where Rag mu-
tants that constitutively recruit mTOR to perinuclear locations resist
amino acid deprivationinduced loss of mTORC1 activity. Because of con-
formational changes, poly-Qexpanded Htt binds certain proteins with
greater affinity than does wild-type Htt (10,39,40). Such altered binding
may have an important role in the poly-Q Httmediated striatal-specific
Htt
Amino acids
mTOR
Htt
Rheb
mTOR
Trafficking
?
p
o
l
y
-
Q
Htt Rheb
mTOR
Amino acids
p
o
l
y
-
Q
Htt Rheb
mTOR
p
o
l
y
-
Q
Htt
Htt
mTOR
?
Trafficking
Rheb
mTOR
“Off”
“On”
“On”
Htt
Htt
“Off”
Physiological condition Pathological condition
“On”
pS6K p4EBP1
pS6
Rheb
pS6K p4EBP1
pS6
Perinuclear
structures
Perinuclear
structures
PI3K
/Akt
TSC
Inhibitors
Physiological functions:
example, cell size regulation
Pathological functions:
example, dysregulation
of autophagy
PI3K
/Akt
TSC
Fig. 6. Model for Htt-mediated mTORC1 signaling. Our model predicts that WT huntingtin (Htt) in the pres-
ence of amino acids rapidly accumulates in the perinuclear structures, presumably lysosomes, and facili-
tates mTOR movement. The majority of HD patients are heterozygous for CAG mutation in Htt, which means
they harbor one WT copy of Htt and one copy of poly-Qexpanded Htt. In pathological conditions, the
poly-Qexpanded Htt has a conformational change that might sustain Rheb and mTOR in a ternary com-
plex that is further stabilized on perinuclear structures by amino acids signals, leading to sustained
mTORC1 activity, through PI3K-Akt-TSC signalingdependent mechanisms.
RESEARCH ARTICLE
www.SCIENCESIGNALING.org 28 October 2014 Vol 7 Issue 349 ra103 8
on January 2, 2015http://stke.sciencemag.org/Downloaded from
damage in HD pathology. It remains to be determined what structural
component in Htt, in addition to poly-Q, is required for mTORC1 activ-
ity in HD.
Our demonstration that striatum-specific deletion of TSC1, which en-
codes a protein that inhibits mTORC1, exacerbates behavioral deficits
and accelerates death in HD mice raises two important questions: Does
poly-Q HttmTORC1mediated cellular dysfunction also occur in parts
of the brain other than the striatum and in peripheral tissue? Or, if it is only
restricted to the striatum, what mechanisms contribute to this striatal selec-
tivity? HD is an age-dependent disorder. Patients born with the Htt mutation
develop normally, but the first appearance of symptoms, which is directly
proportional to the number of Htt poly-Q repeats, occurs between 30 and
50 years of age. The age-related factors that contribute to this delayed
onset of the disease are unclear, but pharmacological studies show that
mTORC1 signaling, a major regulator of mammalian life span (64), partic-
ipates in many neurodegenerative diseases (65). Moreover, expression of
hyperactive mTOR kinase in the forebrain can promote cortical neuro-
degeneration (66).
How might poly-Q HttmTORC1 circuitry contribute to the exten-
sive loss of medium spiny neurons in HD (67)? We speculate that
poly-Qexpanded Htt, like Rheb and mTOR, is ubiquitously present
and may regulate mTORC1 both in the brain and in other peripheral
tissues in HD. This notion is consistent with the high mTORC1 activity
seen both in the cortex and in the atrophied skeletal muscle of an HD
mouse model expressing poly-Qexpanded Htt (19,68). Yet, poly-Q
expanded Htt may also exert a tissue-specific increase in mTORC1
signaling, for example, by interacting with tissue-specif ic regulators
of mTOR. Previously, we showed that poly-Q Htt interacts with the
striatal-enriched SUMO-E3-GTPase Rhes, which SUMOylates poly-
Qexpanded Htt and increases its toxicity (10,17,6971). Because
Rhes also activates mTORC1 (11), we hypothesize that the interaction
of poly-Qexpanded Htt with Rhes may lead to abnormally high acti-
vation of mTORC1 in the striatum that may cause early and prominent
striatal dysfunction in HD (72). Sustained mTORC1 activity may con-
tribute to disease progression through its roles in protein translation,
autophagy, or de novo pyrimidine synthesis (73,74). We surmise that
poly-Qexpanded Httmediated enhancement of mTORC1 might
compromise autophagy, whose dysregulation is implicated in neurodegen-
eration (75). This notion is also supported by our previous findings showing
that poly-Qexpanded Htt blocks Rhes-induced autophagy (70). However,
whether this blockade results from enhanced poly-Qexpanded Htt/Rhes
mediated mTORC1 activation or from mutant Httmediated inhibition of
Rhes-induced Beclin 1and Bcl-2dependent (mTOR-independent) au-
tophagy (70) is currently unclear.
Overall, using a new genetic mouse model of HD, TSC1
flox/+
/N171HD,
we demonstrate for the first time that enhanced activation of mTORC1
signaling selectively in the striatum before the onset of the disease leads
to severe HD phenotype and premature death. Thus, interfering with the
mTORC1 pathway early in the disease process may have therapeutic
potential. Together, our data indicate that Htt promotes amino acid
mediated mTORC1 signaling and that the poly-Qexpanded HttmTORC1
circuitry may play an important role in the progression of HD.
MATERIALS AND METHODS
Reagents, plasmids, and antibodies
Unless otherwise noted, reagents were obtained from Sigma. Myc-tagged
full-length human (FL) HTT-23Q and FL-HTT-103Q were from CHDI
(Cure Huntingtons Disease Initiative) Foundation Inc. (Biobank at Coriell
Institute for Medical Research). FL-HTT-86Q and N171-82Q were sub-
cloned into pCMV-myc vector from FL-HTT 103Q and AAV-GFP-171-82Q
backbone, respectively, using a protocol described before (10). Myc-tagged
Rheb wild type and Rheb D60K were a gift from K.-L. Guan (University
of California, San Diego, San Diego, CA). Ataxin-82Q GFP-tagged construct
was from H. Zoghbi (Baylor College of Medicine, Houston, TX). Htt shRNA
sequences encoded by lentiviral vectors (NM_002111) were as follows: H1,
GCTGCTGACTTGTTTACGAAAC; H2, CCGTGCAGATAAGAATGC-
TATC; H3, GCACTCAAGAAGGACACAATAC. The scrambled or lenti-
viral control vectors were from Addgene. Antibodies for Rheb, GST, and
myc were obtained from Santa Cruz Biotechnology (130398, SC138, and
SC40, respectively). Antibodies against Htt (5656S), mTOR (2972S), pS6K
Thr
389
(9234S), pS6
Ser235/236
(4858S), p4EBP Ser
65
(9451S), pAkt Thr
308
(2965P), and p44/42 extracellular signalregulated kinase 1/2 (4695P) were
from Cell Signaling Technology Inc. Glutathione-Sepharose beads were
from Amersham Biosciences, and protein G/protein A agarose suspension
was obtained from Calbiochem. Rapamycin, U0126, and wortmannin were
from Selleckchem.
Cell culture, transfections, and amino acid treatments
HEK293 cells were grown in DMEM (Gibco 11965-092) with 10% fetal
bovine serum (FBS), 1% penicillin/streptomycin (pen/strep), and 5 mM glu-
tamine. Briefly, cells were seeded in 3.5- or 6-cm plates. After 24 hours, the
cells were transfected with complementary DNA (cDNA) constructs, using
PolyFect (Qiagen) as per the manufacturers instructions. For the amino acid
starvation/stimulation protocol, after 48 hours, the growth medium was re-
placed with either DMEM/F12 Ham with all amino acids and without FBS
(F12+; Sigma, D2906) or, for essential amino acid starvation, DMEM/F12
Ham devoid of L-leucine, L-lysine, and L-methionine without FBS (F12;
Sigma, D9785). Cells were kept in these media for 1 hour and then either
lysed or stimulated for 10 min with 3 mM L-leucine (+Leu) unless otherwise
noted. Wild-type and Htt knockout Hdh
ex4/5/ex4/5
mouse ES cells were de-
scribed previously (76,77) and cultured in KnockOut DMEM (Invitrogen)
containing 15% FBS, pen/strep (50 IU/ml, 50 mg/ml; Invitrogen), Gluta-
Max (0.2 mM, Invitrogen), MEM nonessential amino acids (0.1 mM,
Invitrogen), 2-mercaptoethanol (0.1 mM, Sigma), and leukemia inhibi-
tory factor (1000 U/ml, Millipore) at 37°C in 5% CO
2
either on feeder
layers of mitotically inactive, g-irradiated mouse embryonic fibroblasts
(Global Stem Sciences) or on 1% gelatin (Millipore). Before Western
blotting, the medium was replaced with F12medium for 1 hour, stimulated
with leucine, then lysed. Striatal cells (STHdh) expressing knock-in wild-
type Htt with 7 Glu (STHdh
Q7/Q7
) or expressing knock-in mutant Htt with
111 Glu (STHdh
Q111/Q111
)(28) were cultured in DMEM as previously
described (10). After 1 or 2 days in culture, the medium was replaced with
F12medium (lacking amino acids) for 1 hour, stimulated with leucine,
and lysed.
Immunoblotting, pull-down assay, and in vitro binding
For Western blotting, HEK293 cells were directly lysed in 2× NuPAGE LDS
sample buffer (Invitrogen) and sonicated. Brain tissue was snap-frozen and
then homogenized in radioimmunoprecipitation assay buffer [150 mM
NaCl, 1.0% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM
tris (pH 8.0)] with 1× complete protease inhibitor cocktail (Roche). For
pull-down assays, cells were grown to 70 to 80% confluency in 6- or 10-cm
dishes and transfected with the indicated plasmids (1 mg each), and after
48 hours, they were pelleted and lysed in immunoprecipitation (IP)
buffer [50 mM tris (pH 7.6), 1% CHAPS, 10% glycerol, 0.5 mM MgCl
2
,
and 0.5 mM CaCl
2
]. The lysates were run several times through a 26-gauge
needle in IP buffer and preincubated with glutathione beads for 1 hour to
minimize nonspecific binding. GST-tagged proteins were pulled down
RESEARCH ARTICLE
www.SCIENCESIGNALING.org 28 October 2014 Vol 7 Issue 349 ra103 9
on January 2, 2015http://stke.sciencemag.org/Downloaded from
with glutathione beads (60 ml/ml slurry) in IP buffer containing 0.5%
CHAPS with protease inhibitor cocktail. After 12 hours, the beads were
washed in IP buffer containing 0.5% CHAPS and 150 mM NaCl. Protein
concentration was measured with BCA (bicinchoninic acid) protein assay
reagent (Pierce). For ternary complex detection, a two-step pull-down assay
was performed. First, GST-Rheb was precipitated with glutathione beads.
Then, 10% of the precipitates was probed for Htt and mTOR, and the
remaining 90% was subjected to precipitation with control rabbit immu-
noglobulin G or Htt antibody to detect mTOR and GST-Rheb. Protein
lysates were loaded and separated by SDSpolyacrylamide gel electro-
phoresis on NuPAGE 4 to 12% bis-tris gels (Invitrogen), transferred onto
polyvinylidene difluoride membranes, and probed with previously men-
tioned antibodies. Secondary antibodies were horseradish peroxidase
(HRP)conjugated (Jackson ImmunoResearch Inc.). Chemiluminescence
was detected using WesternBright Quantum chemiluminescent HRP sub-
strate (Advansta).
Cell size measurements
After 24 hours of plating, HEK293 cells were transfected with wild-type
myc-Rheb (used as positive control), myc, or N171-82Q Htt. After 48 hours,
the medium was replaced with FBS-free medium containing amino acids
(F12+) for 12 hours. Cells were trypsinized, resuspended in F12+ medium,
andfilteredthrougha40-mm cell strainer to a f inal densityof 1 × 10
6
cells/ml.
Cell size was analyzed using a flow cytometer (LSR II, BD Biosciences)
measuring the forward scatter (FSC-H) of 20,000 events for each sample.
Events were gated according to forward scatter and side scatter to exclude
debris and aggregates. All scatter size gating criteria were used across all
samples. The mean FSC-H of the cell population was calculated and
displayed. Data were analyzed using FlowJo software (Tree Star). Each ex-
periment was performed in triplicate.
Immunostaining
HEK293 cells were grown on polylysine (0.1 mg/ml)coated glass cover-
slips in culture dishes containing full DMEM. After 48 hours of transfec-
tion, the medium was changed to Krebs buffer medium [20 mM Hepes,
glucose (4.5 g/liter), 118 mM NaCl, 4.6 mM KCl, 1 mM MgCl
2
,12mM
NaHCO
3
, 0.5 mM CaCl
2
, 0.2% (w/v) bovine serum albumin (BSA)] devoid
of serum and amino acids for 1 hour to simulate full starvation conditions.
For the stimulation conditions, cells were stimulated for 10 min with 1×
amino acid cocktail (Gibco 11130). Cells were washed with cold
phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde (PFA;
20 min), treated with 0.1 M glycine, and permeabilized with 0.1% (v/v)
Triton X-100 (5 min). After being incubated with blocking buffer [1%
normal donkey serum, 1% (w/v) BSA, and 0.1% (v/v) Tween 20 in PBS]
for 1 hour at room temperature, cells were stained overnight at 4°C with
antibodies against HA (for Rheb) (1:500, 631207, Clontech), myc (for
Htt) (1:500, sc-40, Santa Cruz Biotechnology), Htt (1:75, MAB2166, Milli-
pore), and mTOR (1:200, 2983S, Cell Signaling Technology). Alexa Fluor
488or Alexa Fluor 588conjugated secondary antibodies (Molecular
Probes) were incubated together with the nuclear stain DAPI for 1 hour at
room temperature. Glass coverslips were mounted with Vectashield mount-
ing medium (Vector Laboratories). Images were taken with a Leica TCS
SP8 confocal microscope.
ES cells were fixed in 4% PFA (Tousimis Research) for 10 min, followed
by two brief washes in PBS. Cells were then exposed to 0.1 M glycine in
PBS for 5 min and permeabilized with 0.1% Triton X-100 in PBS for an
additional 5 min. After three washes with PBS and incubation in blocking
solution (0.5% BSA, 1% normal goat serum, and 0.1% Triton X-100 in
PBS) for 15 min, cells were incubated overnight at 4°C with mTOR anti-
body (1:150 in blocking solution, 2983S). After being washed in PBS, cells
were labeled with Alexa Fluor 488conjugated secondary antibodies
(Invitrogen) for 60 min and DAPI (1 g/ml) for 5 min and mounted as de-
scribed for HEK293 cells. Images of 200 cells in seven different visual
fields were taken with a Leica SP5 confocal microscope (for ES cell exper-
iment). Images for analysis were selected randomly, and two investigators
blinded to the ESC genotypes manually quantified mTOR puncta on the
basis of signal intensity and size. The data are presented as the number of
puncta per nucleus.
Striatal cells were processed for immunochemistry as described for
HEK293 cells after 10 to 15 min in medium with 1× amino acids. Images
were analyzed for the number and size of mTOR puncta using Fiji software,
as described previously (78). Where indicated, Pearsonsrcolocalization
threshold was calculated using Fiji software.
Generation of TSC1
flox/+
/N171HD mice
Mouse protocols were carried out under the guidelines approved by the In-
stitutional Animal Care and Use Committee. Transgenic mice expressing an
N-terminally truncated human Htt cDNA that encodes 82 glutamines and
encompasses the first 171 amino acids (N171-82Q) [B6C3-Tg(HD82Gln)
81Dbo/J mice, herein called N171HD] were obtained from The Jackson
Laboratory. Mutant mice containing targeted floxed alleles of TSC1
(STOCK Tsc1tm1Djk/J mice) were also from The Jackson Laboratory.
Male N171HD mice were bred with homozygous TSC1-floxed females
to derive offspring that were heterozygous for TSC1-floxed allele and
N171-82Q Htt (TSC1
flox/+
/N171HD) or heterozygous for the TSC1-floxed
allele with normal Htt (TSC1
flox/+
/wild type). The genotypes were con-
firmed by Transnetyx Inc.
Stereotaxic surgeries
For all surgical procedures, 8-week-old mice were anesthetized with con-
stant delivery of isoflurane while mounted in a stereotaxic frame (David
Kopf Instruments). Microinjections of AAV-Cre (AAV1.hSynap.HI.eGFP-
Cre.WPRE.SV40) and AAV-GFP (AAV1.hSynap.eGFP.WPRE.bGH) (Vector
Core, University of Pennsylvania) were injected bilaterally into the striatum
according to the following coordinates: medial-lateral (ML) = ±1.50, anterior-
posterior (AP) = +1.2, dorsal-ventral (DV) = 3.25/3.75 and ML = ±2.25,
AP = 0, DV = 3.25/3.75 from bregma. Virus was injected in 0.5-mlvolumes
[5.9 × 10
12
vg (viral genomes)/ml] per injection site in each animal (4 ml
total volume). The animals were allowed to recover for 2 weeks before be-
havioral testing. The efficacy of the viral injections was determined by GFP
expression in the striatum.
Behavioral analysis
Behavioral testing was performed at 10 weeks of age (Fig. 4C), and the in-
vestigator was blinded to the animals genotype. All behavioral testing was
performed during the light phase of the light-dark cycle between 8:00 a.m.
and 12:00 p.m. For each week of behavioral testing, rotarod performance
was assessed on day 1, open field on day 2, and the battery of behavioral
tests on day 3. Rotarod testing was performed using a linear accelerating
rotation paradigm (Med Associates Inc.) in three trials separated by 20 min
for four consecutive days each month. The mice were placed on the apparatus
at 4 rpm and were subjected to increasing rpm, accelerating to 40 rpm over the
course of a maximum of 5 min. The overall latency to fall for each mouse was
calculated as the average of the three trials across 4 days. Open field activity
wasassessedinasingle30-minsessioninwhichamousewasplacedinthe
center of a square enclosure, and total distance moved and velocity were quan-
tified by EthoVision XT software (Noldus Information Technology). Behav-
ioral battery testing was adapted from a previous report (79). The battery of
tests, each performed in triplicate, measured ledge walking, clasping, gait,
kyphosis, and tremor. Individual measures were scored on a scale of 0
RESEARCH ARTICLE
www.SCIENCESIGNALING.org 28 October 2014 Vol 7 Issue 349 ra103 10
on January 2, 2015http://stke.sciencemag.org/Downloaded from
(absence of relevant phenotype) to 3 (most severe manifestation), as de-
scribed before (79) with the addition of testing for tremor. To determine
tremor, mice were placed in a clean cage and observed for 30 s. Each
mouse was scored as follows: 0, no signs of tremor; 1, present but mild
tremor; 2, severe intervals of tremor or constant moderate tremor; 3, out-
rageous chronic tremor. The composite score was generated as the mean
of all five behavioral battery tests. The Scripps Research Institute Florida
Institutional Animal Care and Use Committee approved all protocols.
Statistical analysis
Data are presented as means ± SD or SEM where indicated. All experiments
were performed at least in triplicate and repeated twice at minimum.
Pear so nsrwas calculated for immunocytochemistry colocalization.
Kaplan-Meier survival plot and Wilcoxon rank test were used for sur-
vival analysis. For most other data, statistical analysis was performed
using Studentsttest (MS Excel).
SUPPLEMENTARY MATERIALS
www.sciencesignaling.org/cgi/content/full/7/349/ra103/DC1
Fig. S1. Effect of normal and expanded poly-Q Htt on amino acidinduced mTORC1
activation.
Fig. S2. Expanded poly-Q Htt fragmentmediated mTORC1 is abrogated by an Akt inhibitor.
Fig. S3. Expanded poly-Q Htt fragment does not potentiate phosphorylation of mTOR at
Ser
2448
.
Fig. S4. Htt depletion inhibits Rheb-mediated mTORC1 activation.
Fig. S5. More FL-HTT-86Q than FL-HTT-23Q binds Rheb.
Fig. S6. Rheb binds Htt in striatal cells.
Fig. S7. Htt colocalizes with LAMP1.
Fig. S8. AAV-GFP expression in the striatum of a TSC1
flox/+
/HD mouse.
Fig. S9. Cre injection in TSC1
flox/+
/wild-type mice elicits mTORC1 activity.
Fig. S10. TSC1
flox/+
/HD mice injected with AAV-Cre show severe weight loss.
REFERENCES AND NOTES
1. The Huntingtons Disease Collaborative Research Group, A novel gene containing a
trinucleotide repeat that is expanded and unstable on Huntingtons disease chromo-
somes. Cell 72, 971983 (1993).
2. K. Sathasivam, A. Neueder, T. A. Gipson, C. Landles, A. C. Benjamin, M. K. Bondulich,
D. L. Smith, R. L. Faull, R. A. Roos, D. Howland, P. J. Detloff, D. E. Housman, G. P. Bates,
Aberrant splicing of HTT generates the pathogenic exon 1 protein in Huntington disease.
Proc. Natl. Acad. Sci. U.S.A. 110, 23662370 (2013).
3. Y. J. Kim, Y. Yi, E. Sapp, Y. Wang, B. Cuiffo, K. B. Kegel, Z. H. Qin, N. Aronin,
M. DiFiglia, Caspase 3-cleaved N-terminal fragments of wild-type and mutant huntingtin
are present in normal and Huntingtons disease brains, associate with membranes, and
undergo calpain-dependent proteolysis. Proc. Natl. Acad. Sci. U.S.A. 98, 1278412789
(2001).
4. G. Schilling, M. W. Becher, A. H. Sharp, H. A . Jinnah, K. Duan, J. A. Kotzuk, H. H. Slunt,
T.Ratovitski,J.K.Cooper,N.A.Jenkins,N.G.Copeland,D.L.Price,C.A.Ross,
D. R. Borchelt, Intranuclea r inclusions and neuritic aggr egates in transgenic mice
expressing a mutant N-terminal fragment of huntingtin. Hum. Mol. Genet. 8,397407
(1999).
5. M. A. Andrade, P. Bork, HEAT repeats in the Huntingtons disease protein. Nat. Genet.
11, 115116 (1995).
6. S. Zeitlin, J. P. Liu, D. L. Chapman, V. E. Papa ioannou, A. Efstratiadis, Increased
apoptosis and early embryonic lethality in mice nullizygous for the Huntingtons dis-
ease gene homologue. Nat. Genet. 11, 155163 (1995).
7. J. Velier, M. Kim, C. Schwarz, T. W. Kim, E. Sapp, K. Chase, N. Aronin, M. DiFiglia,
Wild-type and mutant huntingtins function in vesicle trafficking in the secretory and
endocytic pathways. Exp. Neurol. 152,3440 (1998).
8. X.Li,C.Standley,E.Sapp,A.Valencia,Z.H.Qin,K.B.Kegel,J.Yoder,L.A.Comer-Tierney,
M. Esteves, K. Chase, J. Alexander, N. Masso, L. Sobin, K. Bellve, R. Tuft, L. Lifshitz,
K. Fogarty, N. Aronin, M. DiFiglia, Mutant huntingtin impairs vesicle formation from re-
cycling endosomes by interfering with Rab11 activity. Mol. Cell. Biol. 29,61066116
(2009).
9. J. N. Savas, A. Makusky, S. Ot tosen, D. Baill at, F. Then, D. Kra inc, R. Shiekhattar,
S. P. Markey, N. Tanese, Huntingtons dis ease protein cont ributes to RNA-m ediated
gene silencing through associ ation with Argon aute and P bodie s. Proc. Natl. Acad .
Sci. U.S.A. 105,10820108 25 (2008).
10. S. Subramaniam, K. M. Sixt, R. Barrow, S. H. Snyder, Rhes, a striatal specific protein,
mediates mutant-huntingtin cytotoxicity. Science 324, 13271330 (2009).
11. S. Subramaniam, F. Napolitano, R. G. Mealer, S. Kim, F. Errico, R. Barrow, N. Shahani,
R. Tyagi, S. H. Snyder, A. Usiello, Rhes, a striatal-enriched small G protein, mediates
mTOR signaling and L-DOPAinduced dyskinesia. Nat. Neurosci. 15, 191193 (2011).
12. R. G. Mealer, S. Subramaniam, S. H. Snyder, Rhes deletion is neuroprotective in the
3-nitropropionic acid model of Huntingtons disease. J. Neurosci. 33, 42064210 (2013).
13. S. Okamoto, M. A. Pouladi, M. Talantova, D. Yao, P. Xia, D. E. Ehrnhoefer, R. Zaidi,
A. Clemente, M. Kaul, R. K. Graham, D. Zhang, H. S. Vincent Chen, G. Tong, M. R. Hayden,
S. A. Lipton, Balance between synaptic versus extrasynaptic NMDA receptor activity influ-
ences inclusions and neurotoxicity of mutant huntingtin. Nat. Med. 15,14071413 (2009).
14. T. Sereden ina, O. Gokce, R. Luthi- Carter, Decreased st riatal RGS2 expression is
neuroprotective in Huntingtons disease (HD) and exemplifies a compensatory aspect
of HD-induced gene regulation. PLOS One 6, e22231 (2011).
15. B. Lu, J. Palacino, A novel human embryonic stem cell-derived Huntingtons disease
neuronal model exhibits mutant huntin gtin (mHTT) aggregates and soluble mHTT-
dependent neurodegeneration. FASEB J. 27, 18201829 (2013).
16. B. A. Baiamonte, F. A. Lee, S. T. Brewer, D. Spano, G. J. LaHoste, Attenuation of
Rhes activity significantly delays the appearance of behavioral symptoms in a mouse
model of Huntingtons disease. PLOS One 8, e53606 (2013).
17. J. I. Sbodio, B. D. Paul, C. E. Machamer, S. H. Snyder, Golgi protein ACBD3 me-
diates neurotoxicity associated with Huntingtons disease. Cell Rep. 4,890897
(2013).
18. B. Ravikumar, C. Vacher, Z. Berger, J. E. Davies, S. Luo, L. G. Oroz, F. Scaravilli,
D. F. Easton, R. Duden, C. J. OKane, D. C. Rubinsztein, Inhibition of mTOR induces
autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of
Huntington disease. Nat. Genet. 36, 585595 (2004).
19. J. H. Fox, T. Connor, V. Chopra, K. Dorsey, J. A. Kama, D. Bleckmann, C. Betschart,
D. Hoyer, S. Frentzel, M. Difiglia, P. Paganetti, S. M. Hersch, The mTOR kinase in-
hibitor Everolimus decreases S6 kinase phosphorylation but fails to reduce mutant
huntingtin levels in brain and is not neuroprot ective in the R6/2 mouse model of
Huntingtonsdisease.Mol. Neurodegener. 5, 26 (2010).
20. M. Laplante, D. M. Sabatini, mTOR signaling in growth control and disease. Cell 149,
274293 (2012).
21. E. Kim, P. Goraksha-Hicks, L. Li, T. P. Neufeld, K. L. Guan, Regulation of TORC1 by
Rag GTPases in nutrient response. Nat. Cell Biol. 10, 935945 (2008).
22. Y . Sancak, L. Bar-Peled, R. Zoncu, A. L. Markhard, S. Nada, D. M. Sabatini, Ragulator-
Rag complex targets mTORC1 to the lysosomal surface and is necessary for its activa-
tion by amino acids. Cell 141, 290303 (2010).
23. M. D. Dennis, J. I. Baum, S. R. Kimball, L. S. Jefferson, Mechanisms involved in the
coordinate regulation of mTORC1 by insul in and amino acids. J. Biol. Chem. 286,
82878296 (2011).
24. K. Inoki, Y. Li, T. Xu, K. L. Guan, Rheb GTPase is a direct target of TSC2 GAP activity
and regulates mTOR signaling. Genes Dev. 17, 18291834 (2003).
25. T. Nobukuni , M. Joaquin, M. Rocc io, S. G. Dann, S. Y. Kim, P. Gu lati, M. P. Byfield ,
J. M. Backer, F. Na tt, J. L. Bos, F. J. Z wartkruis, G. T homas, Amino acid s mediate
mTOR/raptor signaling through activation of class 3 phosphatidylinositol 3OH-kinase.
Proc. Natl. Acad. Sci. U.S.A. 102, 1423814243 (2005).
26. M. P. Byfield, J. T. Murray, J. M. Backer, hVps34 is a nutrient-regulated lipid kinase
required for activation of p70 S6 kinase. J. Biol. Chem. 280, 3307633082 (2005).
27. M. Roccio, J. L. Bos, F. J. Zwartkruis, Regulation of the small GTPase Rheb by amino
acids. Oncogene 25, 657664 (2006).
28. F. Trettel, D. Rigamonti, P. Hilditch-Maguire, V. C. Wheeler, A. H. Sharp, F. Persichetti,
E. Cattaneo, M. E. MacDonald, Dominant phenotypes produced by the HD mutation in
STHdh
Q111
striatal cells. Hum. Mol. Genet. 9,27992809 (2000).
29. E. Kim, Mechanisms of amino acid sensing in mTOR signaling pathway. Nutr. Res.
Pract. 3,6471 (2009).
30. J. J. Ritch, A. Valencia, J. Alexander, E. Sapp, L. G atune, G. R. Sangre y, S. Sinha,
C. M. Scherber, S. Zeitlin, G. Sadri-Vakili, D. Irimia, M. Difiglia, K. B. Kegel, Multiple phe-
notypes in Huntington disease mouse neural stem cells. Mol. Cell. Neurosci. 50,7081
(2012).
31. M. C. Mendoza, E. E. Er, J. Blenis, The Ras-ERK and PI3K-mTOR pathways: Cross-
talk and compensation. Trends Biochem. Sci. 36, 320328 (2011).
32. K. Hara, K. Yonezawa, Q. P. Weng, M. T. Kozlowski, C. Belham, J. Avruch, Amino
acid sufficiency and mTOR regulate p70 S6 kinase and eIF-4E BP1 through a com-
mon effector mechanism. J. Biol. Chem. 273, 1448414494 (1998).
33. Y.Iiboshi,P.J.Papst,H.Kawasome,H.Hosoi,R.T.Abraham,P.J.Houghton,N.Terada,
Amino acid-dependent control of p70
s6k
. Involvement of tRNA aminoacylation in the reg-
ulation. J. Biol. Chem. 274, 10921099 (1999).
34. T. H. t. Reynolds, S. C. Bodine, J. C. Lawrence Jr., Control of Ser
2448
phosphorylation
in the mammalian target of rapamycin by insulin and skeletal muscle load. J. Biol.
Chem. 277, 1765717662 (2002).
35. M. Rosner, N. Siegel, A. Valli, C. Fuchs, M. Hengstschläger, mTOR phosphorylated
at S2448 binds to raptor and rictor. Amino Acids 38, 223228 (2010).
36. Y. Li, K. Ino ki, K. L. Guan, Biochemical an d functional chara cterizatio ns of small
GTPase Rheb and TSC2 GAP activity. Mol. Cell. Biol. 24, 79657975 (2004).
RESEARCH ARTICLE
www.SCIENCESIGNALING.org 28 October 2014 Vol 7 Issue 349 ra103 11
on January 2, 2015http://stke.sciencemag.org/Downloaded from
37. M. J. Groenewoud, S. M. Goorden, J. Kassies, W. Pellis-van Berkel, R. F. Lamb,
Y. Elg ersma, F. J. Zwartkruis, Mammalian target of rapamycin complex I (mTORC1)
activity in Ras homologue enriched in brain (Rheb)-deficient mouse embryonic fibro-
blasts. PLOS One 8, e81649 (2013).
38. X. Long, S. Ortiz-Vega, Y. Lin, J. Avruch, Rheb binding to mammalian target of rapamycin
(mTOR) is regulated by amino acid sufficiency. J. Biol. Chem. 280, 2343323436 (2005).
39. W. Song, J. Chen, A. Petrilli, G. Liot, E. Klinglmayr, Y. Zhou, P. Poquiz, J. Tjong,
M. A. Pouladi, M. R. Hayden, E. Masliah, M. Ellisman, I. Rouiller, R. Schwarzenbacher,
B. Bossy, G. Perkins, E. Bossy-Wetzel, Mutant huntingtin binds the mitochondrial fission
GTPase dynamin-related protein-1 and increases its enzymatic activity. Nat. Med. 17,
377382 (2011).
40. J. P. Miller, R. E. Hughes, Protein interactions and target discovery in Huntingtons
disease, in Neuro biology of Hunti ngtons Disease: Application s to Drug Discov ery,
D. C. Lo, R. E. Hugh es, Eds. (CRC Pres s, Boca Raton, 201 1).
41. J. P. Caviston, A. L. Zajac, M. Tokito, E. L. Holzbaur, Huntingtin coordinates the dynein-
mediated dynamic positioning of endosomes and lysosomes. Mol. Biol. Cell 22, 478492
(2011).
42. C . Betz, M. N. Hall, Where is mTOR and what is it doing there? J. Cell Biol. 203, 563574
(2013).
43. Y. Sancak, T. R. Peterson, Y. D. Shaul, R. A. Lindquist, C. C. Thoreen, L. Bar-Peled,
D. M. Sabatini, The Rag GTPases bind raptor and mediate amino acid signaling to
mTORC1. Science 320, 14961501 (2008).
44. C. Demetriades, N. Doumpas, A. A. Teleman, Regulation of TORC1 in response to
amino acid starvation via lysosomal recruitment of TSC2. Cell 156, 786799 (2014).
45. L. Yu, C. K. McPhee, L. Zheng, G. A. Mardones, Y. Rong, J. Peng, N. Mi, Y. Zhao, Z. Liu,
F. Wan, D. W. Hailey, V. Oorschot, J. Klumperman, E. H. Baehrecke, M. J. Lenardo,
Termination of autophagy and reformation of lysosomes regulated by mTOR. Nature
465, 942946 (2010).
46. K. B. Kegel, M. Kim, E. Sap p, C. McIntyre, J. G. Cast año, N. Aronin, M. DiFig lia,
Huntingtin expression stimulates endo somallysosomal activity, endo some tubula-
tion, and autophagy. J. Neurosci. 20, 72687278 (2000).
47. E. Sapp, C. Schwarz, K. Chase, P. G. Bhide, A. B. Young, J. Penney, J. P. Vonsattel,
N. Aronin, M. DiFiglia, Huntingt in localization in brains of normal an d Huntingtons
disease patients. Ann. Neurol. 42, 604612 (1997).
48. D. del Toro, J. Alberch, F. Lázaro-Diéguez, R. Martín-Ibáñez, X. Xifró, G. Egea, J. M. Canals,
Mutant huntingtin impairs post-Golgi trafficking to lysosomes by delocalizing optineurin/
Rab8 complex from the Golgi apparatus. Mol. Biol. Cell 20, 14781492 (2009).
49. L. Qi, X. D. Zhang, J. C. Wu, F. Lin, J. Wang, M. DiFiglia, Z. H. Qin, The role of chaperone-
mediated autophagy in huntingtin degradation. PLOS One 7, e46834 (2012).
50. A. D. Balgi, G. H. Diering, E. Donohue, K. K. Lam, B. D. Fonseca, C. Zimmerman, M. Numata,
M. Roberge, Regulation of mTORC1 signaling by pH. PLOS One 6, e21549 (2011).
51. L. R. Gauthier, B. C. Charrin, M. Borrell-Pagès, J. P. Dompierre, H. Rangone,
F. P. Cordelières, J. De Mey, M. E. MacDonald, V. Lessmann, S. Humbert, F. Saudou,
Huntingtin controls neurotrophic support and survival of neurons by enhancing BDNF
vesicular transport along microtubules. Cell 118, 127138 (2004).
52. J. P. Caviston, J. L. Ross, S. M. Antony, M. Tokito, E. L. Holzbaur, Huntingtin facil-
itates dynein/dynactin-mediated vesicle transport. Proc. Natl. Acad. Sci. U.S.A. 104,
1004510050 (2007).
53. X. Long, Y. Lin, S. Ortiz-Vega, K. Yonezawa, J. Avruch, Rheb binds and regulates the
mTOR kinase. Curr. Biol. 15, 702713 (2005).
54. D. J. Kwiatkowski, H. Zhang, J. L. Bandura, K. M. Heiberger, M. Glogauer, N. el-Hashemite,
H. Onda, A mouse model of TSC1 reveals sex-dependent lethality from liver hemangiomas,
and up-regulation of p70S6 kinase activity in Tsc1 null cells. Hum. Mol. Genet. 11, 525534
(2002).
55. M. Mur akami, T. Ichisaka, M. Maeda, N. O shiro, K. Hara, F. Edenhofer, H. Kiya ma,
K. Yonezawa, S. Yamanaka, mTOR is essenti al for growth and proli feration in early
mouse embryos and embryonic stem cells. Mol. Cell. Biol. 24, 67106718 (2004).
56. J. K. White, W. Auerbach, M. P. Duyao, J. P. Vonsatte l, J. F. Gusella, A. L. J oyner,
M. E. MacDonald, Hunti ngtin is required for neurogenesis and is not impaired by the
Huntingtons di sease CAG expansio n. Nat. Genet. 17,404410 (1997).
57. E. Dazert, M. N. Hall, mTOR signaling in disease. Curr. Opin. Cell Biol. 23,744755 (2011).
58. K. Ben MBarek, P. Pla, S . Orvoen, C. Benstaali, J. D. Godin, A. M. Gardier, F. Saudou,
D. J. David, S. Humbert, Huntingtin mediates anxiety/depression-related behaviors and
hippocampal neurogenesis. J. Neurosci. 33, 86088620 (2013).
59. X. Zhou, T. Ikenoue, X. Chen, L. Li, K. Inoki, K. L. Guan, Rheb controls misfolded
protein metabol ism by inhibitin g aggresome forma tion and autophagy. Proc. Natl.
Acad. Sci. U.S.A. 106, 89238928 (2009).
60. M . Shimobayashi, M. N. Hall, Making new contacts: The mTOR network in metabolism
and signalling crosstalk. Nat. Rev. Mol. Cell Biol. 15, 155162 (2014).
61. E. F. Blommaart, J. J. Luiken, P. J. Blommaart, G. M. va n Woerkom, A. J. Meijer,
Phosphorylation of ribosomal protein S6 is inhibitory for autophagy in isolated rat he-
patocytes. J. Biol. Chem. 270, 23202326 (1995).
62. J. P. Caviston, E. L. Holzbaur, Huntingtin as an essential integrator of intracellular
vesicular trafficking. Trends Cell Biol. 19, 147155 (2009).
63. L. Li, E. Kim , H. Yuan, K. Inoki, P. Goraksha-Hic ks, R. L. Schiesher, T. P. Neufeld,
K. L. Guan, Regula tion of mTORC1 by th e Rab and Arf GTPases . J. Biol. Chem.
285, 197051970 9 (2010).
64. S. C. Johnson, P. S. Rabinovitch, M. Kaeberlein, mTOR is a key modulator of ageing
and age-related disease. Nature 493, 338345 (2013).
65. J. Bové, M. Martínez-Vicente, M. Vila, Fighting neurodegeneration with rapamycin:
Mechanistic insights. Nat. Rev. Neurosci. 12, 437452 (2011).
66. H. Kassai, Y. Sugaya, S. Noda , K. Nakao, T. Maeda, M. Kano, A. Aiba, Selective
activation of mTORC1 signaling recapitulates microcephaly, tuberous sclerosis, and
neurodegenerative diseases. Cell Rep. 7, 16261639 (2014).
67. J. P. Vonsattel, R. H. Myers, T. J. Stevens, R. J. Ferrante, E. D. Bird, E. P. Richardson Jr.,
Neuropathological classification of Huntingtons disease. J. Neuropathol. Exp. Neurol.
44, 559577 (1985).
68. P. She, Z. Zhang, D. Marchionini, W. C. Diaz, T. J. Jetton, S. R. Kimball, T. C. Vary, C. H. Lang,
C. J. Lynch, Molecular characterization of skeletal muscle atrophy in the R6/2 mouse
model of Huntingtons disease. Am. J. Physiol. Endocrinol. Metab. 301,E49E61 (2011).
69. S. Subramaniam, R. G. Mealer, K. M. Sixt, R. K. Barrow, A. Usiello, S. H. Snyder,
Rhes, a physiologic regulator of sumoylation, enhances cross-sumoylation between the
basic sumoylation enzymes E1 and Ubc9. J. Biol. Chem. 285, 2042820432 (2010).
70. R . G. Mealer, A. J. Murray, N. Shahani, S. Subramaniam, S. H. Snyder, Rhes, a striatal-
selective protein implicated in Huntington disease, binds beclin-1 and activates autoph-
agy. J. Biol. Chem. 289, 35473554 (2014).
71. J. G. ORo urke, J. R. Gareau, J. Ochaba, W. Song, T. Raskó, D. Reverter, J. Lee,
A. M. Monteys, J. Pallos, L. Mee, M. Vashishtha, B. L. Apostol, T. P. Nicholson, K. Illes,
Y. Z. Zhu, M. Dasso, G. P. Bates, M. Difiglia, B. Davidson, E. E. Wanker, J. L. Marsh,
C. D. Lima, J. S. Steffan, L. M. Thompson, SUMO-2 and PIAS1 modulate insoluble
mutant huntingtin protein accumulation. Cell Rep. 4, 362375 (2013).
72. S . Subramaniam, S. H. Snyder, Huntingtons disease is a disorder of the corpus striatum:
Focus on Rhes (Ras homologue enriched in the striatum). Neuropharmacology 60,
11871192 (2011).
73. I. Ben-Sahra, J. J. Howell, J. M. Asara, B. D. Manning, Stimulation of de novo pyrimidine
synthesis by growth signaling through mTOR and S6K1. Science 339,13231328 (2013).
74. L. Bar-Peled, D. M. Sabat ini, Regulation of mTORC1 by amino acids. Trends Cell
Biol. 24, 400406 (2014).
75. M. Komatsu, S . Waguri, T. Chiba, S. M urata, J. Iwata, I. T anida, T. Ueno, M. Ko ike,
Y. Uchiyama, E. Kominami, K. Tanaka, Loss of autophagy in the central nervous system
causes neurodegeneration in mice. Nature 441, 880884 (2006).
76. M. P. Duyao, A. B. Auerbach, A. Ryan, F. Persichetti, G. T. Barnes, S. M. McNeil, P. Ge,
J.-P. Vonsattel, J. F. Gusella, A. L. Joyner, M. E. MacDonald, Inactivation of the mouse
Huntingtons disease gene homolog Hdh.Science 269, 407410 (1995).
77. J. C. Jacobsen, G. C. Gregory, J. M. Woda, M. N. Thompson, K. R. Coser, V. Murthy,
I. S. Kohane, J. F. Gusella, I. S. Seong, M. E. MacDonald, T. Shioda, J. M. Lee, HD
CAG-correlated gene expression changes support a simple dominant gain of function.
Hum. Mol. Genet. 20, 28462860 (2011).
78. N. Shahani, W. Pryor, S. Swarnkar, N. Kholodilov, G. Thinakaran, R. E. Burke,
S. Subramaniam, Rheb GTPase regulates b-secretase levels and amyloid bgeneration.
J. Biol. Chem. 289, 57995808 (2014).
79. S . J. Guyenet, S. A. Furrer, V. M. Damian, T. D. Baughan, A. R. La Spada, G. A. Garden,
A simple composite phenotype scoring system for evaluating mouse models of cerebellar
ataxia. J. Vis. Exp., e1787 (2010).
Acknowledgments: We thank M. Benil ous, N. Norton, and T. Miles for admini strative
support. We are gra teful to the people in The Sc ripps Research In stitute, Florid a, Jupiter,
especially in the Department of Neur oscience, for th eir continuous support in setting u p
the laboratory an d providing technical support whene ver needed. We tha nk M. Bolton of
The Max Planck Florida Institute, Jupiter, for the continued interest and support in this project.
Funding: This work was supported by Scripps startup funds (to S. Subramaniam) and
OKeeffe Neuroscience Scholar Award (to W.M.P.). Author contributions: W.M.P. designed
the study and carried out most of the Western blotting and mouse behavioral work. N.S. per-
formed immunofluorescence staining and analysis, and S. Swarnkar maintained cells, per-
formed Western blotting, and maintained the mouse colony. W.-C.H. and D.T.P. prepared
the striatal injections images and provided technical support for the analysis of behavioral data.
M.B. and M.E.M. performed the ES cell work and its analysis. W.M.P. and S. Subramaniam
performed binding experiments and contributed to data analysis. S. Subramaniam provided
conceptual input and wrote the paper with input from all co-authors. Competing interests:
The authors declare that they have no competing interests.
Submitted 25 June 2014
Accepted 10 October 2014
Final Publication 28 October 2014
10.1126/scisignal.2005633
Citation: W. M. Pryor, M. Biagioli, N. Shahani, S. Swarnkar, W.-C. Huang, D. T. Page,
M. E. MacDonald, S. Subramaniam, Huntingtin promotes mTORC1 signaling in the
pathogenesis of Huntingtons disease. Sci. Signal. 7, ra103 (2014).
RESEARCH ARTICLE
www.SCIENCESIGNALING.org 28 October 2014 Vol 7 Issue 349 ra103 12
on January 2, 2015http://stke.sciencemag.org/Downloaded from
(349), ra103. [doi: 10.1126/scisignal.2005633]7Science Signaling
and Srinivasa Subramaniam (October 28, 2014) MacDonaldSwarnkar, Wen-Chin Huang, Damon T. Page, Marcy E.
William M. Pryor, Marta Biagioli, Neelam Shahani, Supriya
Huntington's disease
Huntingtin promotes mTORC1 signaling in the pathogenesis of
This information is current as of January 2, 2015.
The following resources related to this article are available online at http://stke.sciencemag.org.
Article Tools
http://stke.sciencemag.org/content/7/349/ra103
article tools:
Visit the online version of this article to access the personalization and
Materials
Supplemental http://stke.sciencemag.org/content/suppl/2014/10/24/7.349.ra103.DC1.html
"Supplementary Materials"
Related Content
http://stke.sciencemag.org/content
http://www.sciencemag.org/content/sci/346/6209/596.6.full.html
http://www.sciencemag.org/content/sci/346/6209/566.full.html
http://stke.sciencemag.org/content/sigtrans/7/349/eg4.full.html
http://stke.sciencemag.org/content/sigtrans/2/65/pe21.full.html
http://stke.sciencemag.org/content/sigtrans/2/93/re8.full.html
http://stke.sciencemag.org/content/sigtrans/2/80/eg9.full.html
http://stke.sciencemag.org/content/sigtrans/3/112/re3.full.html
http://stke.sciencemag.org/cgi/content/full/sigtrans;2/65/pe21
http://stke.sciencemag.org/content/sigtrans/7/334/ra67.full.html
http://stke.sciencemag.org/content/sigtrans/7/349/re10.full.html
http://stke.sciencemag.org/content/sigtrans/7/349/pc29.full.html
's sites:ScienceThe editors suggest related resources on
References http://stke.sciencemag.org/content/7/349/ra103#BIBL
This article cites 78 articles, 37 of which you can access for free at:
Glossary http://stke.sciencemag.org/cgi/glossarylookup
Look up definitions for abbreviations and terms found in this article:
Permissions http://www.sciencemag.org/about/permissions.dtl
Obtain information about reproducing this article:
reserved.
DC 20005. Copyright 2015 by the American Association for the Advancement of Science; all rights
American Association for the Advancement of Science, 1200 New York Avenue, NW, Washington,
(ISSN 1937-9145) is published weekly, except the last December, by theScience Signaling
on January 2, 2015http://stke.sciencemag.org/Downloaded from
... Rhes can bind and activate mTOR in cell culture through increased phosphorylation of S6K, S6RP and 4EBP1, and can promote L-DOPA-mediated mTORC1 activation in the striatum of hemiparkinsonian mice [20,21]. Rhes resembles Rheb, a known activator of mTOR [22] and in a cell culture model mHTT can promote nutrient-induced mTORC1 activity via Rheb [23], raising the possibility that dysregulation of striatal mTORC1 signaling via Rhes and Rheb could affect HD [24]. ...
... Since mHTT can promote mTORC1 activation via Rheb in cell culture and Rhes activates striatal mTORC1 signaling by L-DOPA in the striatum [20,21,23], we examined the effect of Rhes on mTOR signaling in Q175 mouse striatum. However, it is unclear whether the mTOR pathway is dysregulated in HD [10,23,[48][49][50][51]. mTOR activity is commonly measured by phosphorylation of mTOR substrates and the data is often variable, which may explain why there is disagreement between studies. ...
... Since mHTT can promote mTORC1 activation via Rheb in cell culture and Rhes activates striatal mTORC1 signaling by L-DOPA in the striatum [20,21,23], we examined the effect of Rhes on mTOR signaling in Q175 mouse striatum. However, it is unclear whether the mTOR pathway is dysregulated in HD [10,23,[48][49][50][51]. mTOR activity is commonly measured by phosphorylation of mTOR substrates and the data is often variable, which may explain why there is disagreement between studies. ...
Article
Full-text available
Huntington’s disease (HD) results from an expansion mutation in the polyglutamine tract in huntingtin. Although huntingtin is ubiquitously expressed in the body, the striatum suffers the most severe pathology. Rhes is a Ras-related small GTP-binding protein highly expressed in the striatum that has been reported to modulate mTOR and sumoylation of mutant huntingtin to alter HD mouse model pathogenesis. Reports have varied on whether Rhes reduction is desirable for HD. Here we characterize multiple behavioral and molecular endpoints in the Q175 HD mouse model with genetic Rhes knockout (KO). Genetic RhesKO in the Q175 female mouse resulted in both subtle attenuation of Q175 phenotypic features, and detrimental effects on other kinematic features. The Q175 females exhibited measurable pathogenic deficits, as measured by MRI, MRS and DARPP32, however, RhesKO had no effect on these readouts. Additionally, RhesKO in Q175 mixed gender mice deficits did not affect mTOR signaling, autophagy or mutant huntingtin levels. We conclude that global RhesKO does not substantially ameliorate or exacerbate HD mouse phenotypes in Q175 mice.
... Hyperactive mTORC1 is observed in HD by independent studies [53][54][55] , but its role in influencing HD remains controversial. For example, while rapamycin prevented HD phenotype [55] , the overexpression of Rheb, an activator of mTORC1, improved HD-like symptoms in mice [52] . ...
... Hyperactive mTORC1 is observed in HD by independent studies [53][54][55] , but its role in influencing HD remains controversial. For example, while rapamycin prevented HD phenotype [55] , the overexpression of Rheb, an activator of mTORC1, improved HD-like symptoms in mice [52] . In contrast, Rheb overexpression in Drosophila worsened HD-like phenotype [56] . ...
... In contrast, Rheb overexpression in Drosophila worsened HD-like phenotype [56] . We found depleting TSC1 exacerbated mTORC1 in the striatum and worsened HD-like phenotype in mice [55] . Thus, mTORC1 differentially affects HD, depending upon HD models and assays used to interpret the phenotype. ...
Preprint
Full-text available
Huntington disease (HD) is a neurodegenerative disease caused by a CAG trinucleotide repeat expansion in the huntingtin (mHTT) protein. This expansion is thought to promote striatal atrophy by a combination of cell- and non-cell-autonomous processes, but the mechanisms are unclear. Previous evidence suggests that the striatal-enriched SUMO E3-like protein Rhes could play a pathological role in HD. Rhes interacts with, and SUMOylates, mHTT and promotes toxicity and Rhes deletion ameliorates the HD phenotype in cell and severe mouse models of HD. However, the effect of Rhes on less severe knock-in models of HD remains obscure. Here, we report that a Hdh(CAG)150 knock-in murine model of HD showed diminished body weight but no changes in locomotor coordination or activity at 80 and 100 weeks of age. Conversely, Rhes deletion did not impact the body weight or behaviors but caused a significant reduction of gait, clasping, and tremor behaviors in Hdh150Q/150Q mice. Rhes deletion did not affect the loss of striatal DARPP-32 protein levels but abrogated the hyper ribosomal protein S6 kinase beta-1 (S6K) phosphorylation, which is a substrate for a mechanistic target of rapamycin complex 1 (mTORC1) signaling, in Hdh(CAG)150 mice. Interestingly, striatal Rhes protein levels were downregulated in the striatum of Hdh(CAG)150 mice, indicating a potential compensatory mechanisms at work. Thus, Rhes deletion prevents age-dependent behavioral deficits and diminishes hyperactive mTORC1-S6K signaling in Hdh(CAG)150 knock-in mice HD striatum.
... 75 According to a number of investigations, the mHtt is involved in HD pathogenesis by increasing the mTORC1 activity ( Figure 3). 55 Consistent with this hypothesis, the mTORC1 activation could be beneficial in the amelioration of HD symptoms via inhibiting the mHTT-associated metabolic phenotypes and reversing neuronal death. 56 This is why the balancing of mTORC1 activity is a vital process in decreasing the number of affected neurons in HD. ...
Article
Traumatic brain injury (TBI) is one of the most concerning health issues in which normal brain function may be disrupted as a result of a blow, bump, or jolt to the head. Loss of consciousness, amnesia, focal neurological defects, alteration in mental state, and destructive diseases of the nervous system such as cognitive impairment, Parkinson's, and Alzheimer's disease. Parkinson's disease is a chronic progressive neurodegenerative disorder, characterized by the early loss of striatal dopaminergic neurons. TBI is a major risk factor for Parkinson's disease. Existing therapeutic approaches have not been often effective, indicating the necessity of discovering more efficient therapeutic targets. The mammalian target of rapamycin (mTOR) signaling pathway responds to different environmental cues to modulate a large number of cellular processes such as cell proliferation, survival, protein synthesis, autophagy, and cell metabolism. Moreover, mTOR has been reported to affect the regeneration of the injured nerves throughout the central nervous system (CNS). In this context, recent evaluations have revealed that mTOR inhibitors could be potential targets to defeat a group of neurological disorders, and thus, a number of clinical trials are investigating their efficacy in treating dementia, autism, epilepsy, stroke, and brain injury, as irritating neurological defects. The current review describes the interplay between mTOR signaling and major CNS-related disorders (esp. neurodegenerative diseases), as well as the mTOR signaling–TBI relationship. It also aims to discuss the promising therapeutic capacities of mTOR inhibitors during the TBI.
... We also employed a battery of behavioral tests to quantify the neurological dysfunction. These tests include walking on a ledge, clasping, gait, kyphosis (spine curvature), and tremor, which can be averaged as a "composite" score (32). Behavioral battery tests revealed that Q175DN mice performed worst on ledge, clasping, gait, kyphosis, and tremor testing, but the performance on these tasks was significantly better in Q175DN-SUMO1KO mice in both individual tests and composite scores (Fig. 1 F and G). ...
Article
The CAG expansion of huntingtin (mHTT) associated with Huntington disease (HD) is a ubiquitously expressed gene, yet it prominently damages the striatum and cortex, followed by widespread peripheral defects as the disease progresses. However, the underlying mechanisms of neuronal vulnerability are unclear. Previous studies have shown that SUMO1 (small ubiquitin-like modifier-1) modification of mHtt promotes cellular toxicity, but the in vivo role and functions of SUMO1 in HD pathogenesis are unclear. Here, we report that SUMO1 deletion in Q175DN HD-het knockin mice (HD mice) prevented age-dependent HD-like motor and neurological impairments and suppressed the striatal atrophy and inflammatory response. SUMO1 deletion caused a drastic reduction in soluble mHtt levels and nuclear and extracellular mHtt inclusions while increasing cytoplasmic mHtt inclusions in the striatum of HD mice. SUMO1 deletion promoted autophagic activity, characterized by augmented interactions between mHtt inclusions and a lysosomal marker (LAMP1), increased LC3B- and LAMP1 interaction, and decreased interaction of sequestosome-1 (p62) and LAMP1 in DARPP-32–positive medium spiny neurons in HD mice. Depletion of SUMO1 in an HD cell model also diminished the mHtt levels and enhanced autophagy flux. In addition, the SUMOylation inhibitor ginkgolic acid strongly enhanced autophagy and diminished mHTT levels in human HD fibroblasts. These results indicate that SUMO is a critical therapeutic target in HD and that blocking SUMO may ameliorate HD pathogenesis by regulating autophagy activities.
... Note that the TSC1/2 complex in the non-phosphorylated state inhibits RHEB [19]. Studies have reported that mTORC1 is implicated in the development of diverse disorders such as cancers, metabolic disease, etc. [19][20][21]. MTORC1 is a signaling pathway that tightly regulates autophagy. It increases cell growth by promoting lipids, proteins, and nucleotides synthetic pathways [22]. ...
Article
Full-text available
Background The autophagy pathway is used by eukaryotic cells to maintain metabolic homeostasis. Autophagy has two functions in cancerous cells which could inhibit tumorigenesis or lead to cancer progression by increasing cell survival and proliferation. Methods and results In this review article, Web of Science, PubMed, Scopus, and Google Scholar were searched and summarized published studies to explore the relationship between DAPK1 and mTORC1 signaling association on autophagy in cancer. Autophagy is managed through various proteins including the mTOR, which is two separated structural and functional complexes known as mTORC1 and mTORC2. MTORC1 is an important component of the regulatory pathway affecting numerous cellular functions including proliferation, migration, invasion, and survival. This protein plays a key role in human cancers. The activity level of mTORC1 is regulated by the death-associated protein kinases (DAPks) family, especially DAPK1. In many cancers, DAPK1 acts as a tumor suppressor which can be attributed to its ability to suppress cellular transformation and to inhibit metastasis. Conclusions A deep investigation not only will reveal more about the function of DAPK1 but also might provide insights into novel therapies aimed to modulate the autophagy pathway in cancer and to achieve better cancer therapy.
... Dysregulation of mTOR signaling found in neurological disease has been previously studied and reviewed [181][182][183][184]; for example, several studies have found that mTOR signaling is hyperactive in AD, which may suppress autophagy and lysosomal degradation of b-amyloid [185][186][187][188][189]. In HD, mTOR dysregulation is complex [190] and may depend on the stage of disease. Mutant HTT may promote mTOR signaling [191], and the mTOR inhibitor Rapamycin has been found to have therapeutic potential in models of HD [192]. An mTOR activating GTPase expressed specifically in the striatum, Rhes [193], binds to mutant HTT and induces its SUMOylation, which causes cytotoxicity [194,195], again suggesting that upregulation of mTOR signaling may contribute to disease. ...
Article
Full-text available
Cellular adhesive connections directed by the extracellular matrix (ECM) and maintenance of cellular homeostasis by autophagy are seemingly disparate functions that are molecularly intertwined, each regulating the other. This is an emerging field in the brain where the interplay between adhesion and autophagy functions at the intersection of neuroprotection and neurodegeneration. The ECM and adhesion proteins regulate autophagic responses to direct protein clearance and guide regenerative programs that go awry in brain disorders. Concomitantly, autophagic flux acts to regulate adhesion dynamics to mediate neurite outgrowth and synaptic plasticity with functional disruption contributed by neurodegenerative disease. This review highlights the cooperative exchange between cellular adhesion and autophagy in the brain during health and disease. As the mechanistic alliance between adhesion and autophagy has been leveraged therapeutically for metastatic disease, understanding overlapping molecular functions that direct the interplay between adhesion and autophagy might uncover therapeutic strategies to correct or compensate for neurodegeneration.
... Intrastriatal surgery for AAV/lentivirus infusion was carried out using the stereotaxic coordinates as described in our previous studies (11,108). Briefly, adult (8-10 weeks old) male and female mice were injected with the virus according to the designed experiment. ...
Preprint
Full-text available
Rhes (RASD2) is a thyroid hormone-induced gene that regulates striatal motor activity and promotes neurodegeneration in Huntington disease (HD) and tauopathy. Previously, we showed that Rhes moves between cultured striatal neurons and transports the HD protein, polyglutamine-expanded huntingtin (mHTT) via tunneling nanotube (TNT)-like membranous protrusions. However, similar intercellular Rhes transport has not yet been demonstrated in the intact brain. Here, we report that Rhes induces TNT-like protrusions in the striatal medium spiny neurons (MSNs) and transported between dopamine-1 receptor (D1R)-MSNs and D2R-MSNs of intact striatum and organotypic brain slices. Notably, mHTT is robustly transported within the striatum and from the striatum to the cortical areas in the brain, and Rhes deletion diminishes such transport. Moreover, we also found transport of Rhes to the cortical regions following restricted expression in the MSNs of the striatum. Thus, Rhes is a first striatum-enriched protein demonstrated to move and transport mHTT between neurons and brain regions, providing new insights on interneuronal protein transport in the brain.
... The role of mTOR signaling in the pathogenicity of Huntington's disease is still controversial as both upregulation [53] and inhibition of mTOR activity [33] have been associated with the formation of mHtt aggregates. Rapamycin has been used to reverse the adverse effects of mHtt in clinical models of disease. ...
Article
Full-text available
Protein aggregate accumulation is a pathological hallmark of several neurodegenerative disorders. Autophagy is critical for clearance of aggregate-prone proteins. In this study, we identify a novel role of the multifunctional glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in clearance of intracellular protein aggregates. Previously, it has been reported that though clearance of wild-type huntingtin protein is mediated by chaperone-mediated autophagy (CMA), however, degradation of mutant huntingtin (mHtt with numerous poly Q repeats) remains impaired by this route as mutant Htt binds with high affinity to Hsc70 and LAMP-2A. This delays delivery of misfolded protein to lysosomes and results in accumulation of intracellular aggregates which are degraded only by macroautophagy. Earlier investigations also suggest that mHtt causes inactivation of mTOR signaling, causing upregulation of autophagy. GAPDH had earlier been reported to interact with mHtt resulting in cellular toxicity. Utilizing a cell culture model of mHtt aggregates coupled with modulation of GAPDH expression, we analyzed the formation of intracellular aggregates and correlated this with autophagy induction. We observed that GAPDH knockdown cells transfected with N-terminal mutant huntingtin (103 poly Q residues) aggregate-prone protein exhibit diminished autophagy. GAPDH was found to regulate autophagy via the mTOR pathway. Significantly more and larger-sized huntingtin protein aggregates were observed in GAPDH knockdown cells compared to empty vector–transfected control cells. This correlated with the observed decrease in autophagy. Overexpression of GAPDH had a protective effect on cells resulting in a decreased load of aggregates. Our results demonstrate that GAPDH assists in the clearance of protein aggregates by autophagy induction. These findings provide a new insight in understanding the mechanism of mutant huntingtin aggregate clearance. By studying the molecular mechanism of protein aggregate clearance via GAPDH, we hope to provide a new approach in targeting and understanding several neurodegenerative disorders.
... In a polyQ htt mouse model, deletion of TSC1 led to activation of mTORC1, accelerated motor incoordination and premature death. In striatal cells overexpressing the same mutation, mTORC1 activation was induced which then could be abrogated by knocking down Rheb [301]. The authors conclude that enhanced mTOR is pathogenic in HD. ...
Article
Full-text available
Novel targets to arrest neurodegeneration in several dementing conditions involving misfolded protein accumulations may be found in the diverse signaling pathways of the Mammalian/mechanistic target of rapamycin (mTOR). As a nutrient sensor, mTOR has important homeostatic functions to regulate energy metabolism and support neuronal growth and plasticity. However, in Alzheimer’s disease (AD), mTOR alternately plays important pathogenic roles by inhibiting both insulin signaling and autophagic removal of β-amyloid (Aβ) and phospho-tau (ptau) aggregates. It also plays a role in the cerebrovascular dysfunction of AD. mTOR is a serine/threonine kinase residing at the core in either of two multiprotein complexes termed mTORC1 and mTORC2. Recent data suggest that their balanced actions also have implications for Parkinson's disease (PD) and Huntington's disease (HD), Frontotemporal dementia (FTD) and Amyotrophic Lateral Sclerosis (ALS). Beyond rapamycin; an mTOR inhibitor, there are rapalogs having greater tolerability and micro delivery modes, that hold promise in arresting these age dependent conditions.
Article
Full-text available
Spinocerebellar ataxia type 7 (SCA7) is an autosomal dominant neurodegenerative disorder caused by a CAG repeat expansion in the coding region of the ataxin-7 gene. Infantile-onset SCA7 patients display extremely large repeat expansions (>200 CAGs) and exhibit progressive ataxia, dysarthria, dysphagia and retinal degeneration. Severe hypotonia, aspiration pneumonia and respiratory failure often contribute to death in affected infants. To better understand the features of respiratory and upper airway dysfunction in SCA7, we examined breathing and putative phrenic and hypoglossal neuropathology in a knock-in mouse model of early-onset SCA7 carrying an expanded allele with 266 CAG repeats. Whole-body plethysmography was used to measure awake, spontaneous breathing at baseline in normoxia and during a hypercapnic/hypoxic respiratory challenge at 4 and 8 weeks, before and after onset of disease. Postmortem studies included quantification of putative phrenic and hypoglossal motor neurons and microglia and analysis of ataxin-7 aggregation at end stage. SCA7-266Q mice have profound breathing deficits during a respiratory challenge, exhibiting reduced respiratory output and a greater percentage of time in apnea. Histologically, putative phrenic and hypoglossal motor neurons of SCA7 mice exhibit a reduction in number accompanied by increased microglial activation, indicating neurodegeneration and neuroinflammation. Furthermore, intranuclear ataxin-7 accumulation is observed in cells neighboring putative phrenic and hypoglossal motor neurons in SCA7 mice. These findings reveal the importance of phrenic and hypoglossal motor neuron pathology associated with respiratory failure and upper airway dysfunction, which are observed in infantile-onset SCA7 patients and likely contribute to their early death.
Article
Full-text available
Mammalian target of rapamycin (mTOR) has been implicated in human neurological diseases such as tuberous sclerosis complex (TSC), neurodegeneration, and autism. However, little is known about when and how mTOR is involved in the pathogenesis of these diseases, due to a lack of animal models that directly increase mTOR activity. Here, we generated transgenic mice expressing a gain-of-function mutant of mTOR in the forebrain in a temporally controlled manner. Selective activation of mTORC1 in embryonic stages induced cortical atrophy caused by prominent apoptosis of neuronal progenitors, associated with upregulation of HIF-1α. In striking contrast, activation of the mTORC1 pathway in adulthood resulted in cortical hypertrophy with fatal epileptic seizures, recapitulating human TSC. Activated mTORC1 in the adult cortex also promoted rapid accumulation of cytoplasmic inclusions and activation of microglial cells, indicative of progressive neurodegeneration. Our findings demonstrate that mTORC1 plays different roles in developmental and adult stages and contributes to human neurological diseases.
Article
Full-text available
Target of rapamycin (TOR) forms two conserved, structurally distinct kinase complexes termed TOR complex 1 (TORC1) and TORC2. Each complex phosphorylates a different set of substrates to regulate cell growth. In mammals, mTOR is stimulated by nutrients and growth factors and inhibited by stress to ensure that cells grow only during favorable conditions. Studies in different organisms have reported localization of TOR to several distinct subcellular compartments. Notably, the finding that mTORC1 is localized to the lysosome has significantly enhanced our understanding of mTORC1 regulation. Subcellular localization may be a general principle used by TOR to enact precise spatial and temporal control of cell growth.
Article
Full-text available
The β-site amyloid precursor protein (APP)-cleaving enzyme 1 (β-secretase, BACE1) initiates amyloidogenic processing of APP to generate amyloid β (Aβ), which is a hallmark of Alzheimer disease (AD) pathology. Cerebral levels of BACE1 are elevated in individuals with AD, but the molecular mechanisms are not completely understood. We demonstrate that Rheb GTPase (Ras homolog enriched in brain), which induces mammalian target of rapamycin (mTOR) activity, is a physiological regulator of BACE1 stability and activity. Rheb overexpression depletes BACE1 protein levels and reduces Aβ generation, whereas the RNAi knockdown of endogenous Rheb promotes BACE1 accumulation, and this effect by Rheb is independent of its mTOR signaling. Moreover, GTP-bound Rheb interacts with BACE1 and degrades it through proteasomal and lysosomal pathways. Finally, we demonstrate that Rheb levels are down-regulated in the AD brain, which is consistent with an increased BACE1 expression. Altogether, our study defines Rheb as a novel physiological regulator of BACE1 levels and Aβ generation, and the Rheb-BACE1 circuitry may have a role in brain biology and disease.
Article
Full-text available
The protein mutated in Huntington disease (HD), mutant huntingtin (mHtt), is expressed throughout the brain and body. However, the pathology of HD is characterized by early and dramatic destruction selectively of the striatum. We previously reported that the striatal-specific protein Rhes binds mHtt and enhances its cytotoxicity. Moreover, Rhes-deleted mice are dramatically protected from neurodegeneration and motor dysfunction in mouse models of HD. We now report a function of Rhes in autophagy, a lysosomal degradation pathway implicated in aging and HD neurodegeneration. In PC12 cells, deletion of endogenous Rhes decreases autophagy, while Rhes overexpression activates autophagy. These effects are independent of mTOR and opposite in the direction predicted by- the known activation of mTOR by Rhes. Rhes robustly binds the autophagy-regulator Beclin-1, decreasing its inhibitory interaction with Bcl-2 independent of JNK-1 signaling. Finally, co-expression of mHtt blocks Rhes-induced autophagy activation. Thus, the isolated pathology and delayed onset of HD may reflect the striatal-selective expression and changes in autophagic activity of Rhes.
Article
Full-text available
The Ras-like GTPase Rheb has been identified as a crucial activator of mTORC1. Activation most likely requires a direct interaction between Rheb and mTOR, but the exact mechanism remains unclear. Using a panel of Rheb-deficient mouse embryonic fibroblasts (MEFs), we show that Rheb is indeed essential for the rapid increase of mTORC1 activity following stimulation with insulin or amino acids. However, mTORC1 activity is less severely reduced in Rheb-deficient MEFs in the continuous presence of serum or upon stimulation with serum. This remaining mTORC1 activity is blocked by depleting the cells for amino acids or imposing energy stress. In addition, MEK inhibitors and the RSK-inhibitor BI-D1870 interfere in mTORC1 activity, suggesting that RSK acts as a bypass for Rheb in activating mTORC1. Finally, we show that this rapamycin-sensitive, Rheb-independent mTORC1 activity is important for cell cycle progression. In conclusion, whereas rapid adaptation in mTORC1 activity requires Rheb, a second Rheb-independent activation mechanism exists that contributes to cell cycle progression.
Article
Full-text available
Huntington's disease (HD) is an autosomal-dominant neurodegenerative disease caused by the expansion of polyglutamine repeats in the gene for huntingtin (Htt). In HD, the corpus striatum selectively degenerates despite the uniform expression of mutant huntingtin (mHtt) throughout the brain and body. Striatal selectivity reflects the binding of the striatal-selective protein Rhes to mHtt to augment cytotoxicity, but molecular mechanisms underlying the toxicity have been elusive. Here, we report that the Golgi protein acyl-CoA binding domain containing 3 (ACBD3) mediates mHtt cytotoxicity via a Rhes/mHtt/ACBD3 complex. ACBD3 levels are markedly elevated in the striatum of HD patients, in a striatal cell line harboring polyglutamine repeats, and in the brains of HD mice. Moreover, ACBD3 deletion abolishes HD neurotoxicity, which is increased by ACBD3 overexpression. Enhanced levels of ACBD3 elicited by endoplasmic reticulum, mitochondrial, and Golgi stresses may account for HD-associated augmentation of ACBD3 and neurodegeneration.
Article
Full-text available
A key feature in Huntington disease (HD) is the accumulation of mutant Huntingtin (HTT) protein, which may be regulated by posttranslational modifications. Here, we define the primary sites of SUMO modification in the amino-terminal domain of HTT, show modification downstream of this domain, and demonstrate that HTT is modified by the stress-inducible SUMO-2. A systematic study of E3 SUMO ligases demonstrates that PIAS1 is an E3 SUMO ligase for both HTT SUMO-1 and SUMO-2 modification and that reduction of dPIAS in a mutant HTT Drosophila model is protective. SUMO-2 modification regulates accumulation of insoluble HTT in HeLa cells in a manner that mimics proteasome inhibition and can be modulated by overexpression and acute knockdown of PIAS1. Finally, the accumulation of SUMO-2-modified proteins in the insoluble fraction of HD postmortem striata implicates SUMO-2 modification in the age-related pathogenic accumulation of mutant HTT and other cellular proteins that occurs during HD progression.
Article
The mechanistic target of rapamycin complex I (mTORC1) is a central regulator of cellular and organismal growth, and hyperactivation of this pathway is implicated in the pathogenesis of many human diseases including cancer and diabetes. mTORC1 promotes growth in response to the availability of nutrients, such as amino acids, which drive mTORC1 to the lysosomal surface, its site of activation. How amino acid levels are communicated to mTORC1 is only recently coming to light by the discovery of a lysosome-based signaling system composed of Rags (Ras-related GTPases) and Ragulator v-ATPase, GATOR (GAP activity towards Rags), and folliculin (FLCN) complexes. Increased understanding of this pathway will not only provide insight into growth control but also into the human pathologies triggered by its deregulation.
Article
More than 20 years after its discovery, our understanding of target of rapamycin (TOR) signalling continues to grow. Recent global 'omics' studies have revealed physiological roles of mammalian TOR (mTOR) in protein, nucleotide and lipid synthesis. Furthermore, emerging evidence provides new insight into the control of mTOR by other pathways such as Hippo, WNT and Notch signalling. Together, this progress has expanded the list of downstream effectors and upstream regulators of mTOR signalling.
Article
TOR complex 1 (TORC1) is a potent anabolic regulator of cellular growth and metabolism. When cells have sufficient amino acids, TORC1 is active due to its lysosomal localization mediated via the Rag GTPases. Upon amino acid removal, the Rag GTPases release TORC1, causing it to become cytoplasmic and inactive. We show here that, upon amino acid removal, the Rag GTPases also recruit TSC2 to the lysosome, where it can act on Rheb. Only when both the Rag GTPases and Rheb are inactive is TORC1 fully released from the lysosome. Upon amino acid withdrawal, cells lacking TSC2 fail to completely release TORC1 from the lysosome, fail to completely inactivate TORC1, and fail to adjust physiologically to amino acid starvation. These data suggest that regulation of TSC2 subcellular localization may be a general mechanism to control its activity and place TSC2 in the amino-acid-sensing pathway to TORC1.