Article (PDF Available)

Tristetraprolin regulates expression of VEGF and tumorigenesis in human colon cancer

Department of Biological Sciences, University of Ulsan, Ulsan 682-060, Korea.
International Journal of Cancer (Impact Factor: 5.09). 01/2009; 126(8):1817-27. DOI: 10.1002/ijc.24847
Source: PubMed

ABSTRACT

Tristetraprolin (TTP) is an AU-rich element-binding protein that regulates mRNA stability. Here, we report that TTP suppress the growth of human colon cancer cells both in vivo and in vitro by regulating of the expression of vascular endothelial growth factor (VEGF). TTP protein expression in human colonic tissues was markedly decreased in colonic adenocarcinoma compared with in normal mucosa and adenoma. VEGF expression was higher in colonic adenocarcinoma than in normal mucosa and adenoma. Specific inhibition of TTP expression by RNA-interference increased the expression of VEGF in cultured human colon cancer cells, and TTP overexpression markedly decreased it. In addition, elevated expression of TTP decreased the expression level of luciferase linked to a 3' terminal AU-rich element (ARE) of VEGF mRNA. Colo320/TTP cells overexpressing TTP grew slowly in vitro and became tumors small in size when xenografted s.c into nude mice. These findings demonstrate that TTP acts as a negative regulator of VEGF gene expression in colon cancer cells, suggesting that it can be used as novel therapeutic agent to treat colon cancer.

Full-text (PDF)

Available from: Young Joo Min, Dec 23, 2014
Tristetraprolin regulates expression of VEGF and tumorigenesis
in human colon cancer
Hyun Hee Lee
1
, Young Joon Son
1
, Won Hyeok Lee
1
, Young Woo Park
2
, Seoung Wan Chae
3
, Wha Ja Cho
4
, Young Min Kim
5
,
Hye-Jeong Choi
5
, Dae Hwa Choi
6
, Seok Won Jung
7
, Young Joo Min
4,7
, Soon Eun Park
8
, Byung Ju Lee
1,4
, Hee Jeong Cha
5
and Jeong Woo Park
1,4
1
Department of Biological Sciences, University of Ulsan, Ulsan, Korea
2
Therapeutic Antibody Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejon, Korea
3
Department of Pathology, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, Seoul, Korea
4
Biomedical Research Center, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan, Korea
5
Department of Pathology, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan, Korea
6
Department of Surgery, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan, Korea
7
Department of Internal Medicine, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan, Korea
8
Department of Anesthesia and Pain Medicine, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan, Korea
Tristetraprolin (TTP) is an AU-rich element-binding protein that regulates mRNA stability. Here, we report that TTP suppress
the growth of human colon cancer cells both in vivo and in vitro by regulating of the expression of vascular endothelial
growth factor (VEGF). TTP protein expression in human colonic tissues was markedly decreased in colonic adenocarcinoma
compared with in normal mucosa and adenoma. VEGF expression was higher in colonic adenocarcinoma than in normal
mucosa and adenoma. Specific inhibition of TTP expression by RNA-interference increased the expression of VEGF in cultured
human colon cancer cells, and TTP overexpression markedly decreased it. In addition, elevated expression of TTP decreased
the expression level of luciferase linked to a 3
0
terminal AU-rich element (ARE) of VEGF mRNA. Colo320/TTP cells
overexpressing TTP grew slowly in vitro and became tumors small in size when xenografted s.c into nude mice. These findings
demonstrate that TTP acts as a negative regulator of VEGF gene expression in colon cancer cells, suggesting that it can be
used as novel therapeutic agent to treat colon cancer.
Tumor growth requires angiogenesis, the formation of new
blood vessels. Vascular endothelial growth factor (VEGF) is
the most potent mitogen for vascular endothelial cells
1
and
has emerged as the most important regulator of angiogene-
sis.
2
VEGF expression correlates strongly with tumor angio-
genesis in a variety of human cancers including colon can-
cer.
1,3,4
In addition, molecular and chemical inhibition of
VEGF or VEGF receptor was shown to inhibit angiogenesis
and tumor growth in humans.
5,6
Expression of VEGF is regulated through both transcrip-
tional and posttranscriptional mechanisms.
7
VEGF transcrip-
tion is activated by hypoxia
8,9
and growth factors.
10
However,
the induction of VEGF is transient and returns to baseline
levels through post-transcriptional regulation. VEGF tran-
scripts possess AU-rich elements (AREs) within their 3
0
untranslated regions (3
0
UTR) that determine mRNA stabil-
ity.
11
Posttranscriptional regulation mediated by the ARE is
facilitated by trans-acting ARE-binding proteins, several of
which have been identified.
12
These regulatory proteins form
stable complexes with the 3
0
UTR and regulate the mRNA
stability of VEGF.
13–15
Thus, the relative abundance of these
ARE-binding proteins can determine the levels of VEGF tran-
script. For example, the HuR protein promotes the stabiliza-
tion of VEGF mRNA and overexpression of HuR results in
increased expression levels of VEGF.
13,16
In contrast, BRF1
and Tristetraprolin (TTP) proteins destabilize VEGF mRNA
and decrease expression of the VEGF gene product.
14,15,17
In
particular, recent studies have shown that TTP destabilizes
VEGF
14
and inhibits the growth of tumor cells by degrada-
tion of VEGF mRNAs.
17,18
Recently, Carrick and Blackshear
19
reported that colon
cancer cell lines express lower levels of TTP transcript than
normal colon. This raises the possibility that TTP may be
involved in human colon carcinogenesis through regulation
Key words: colon cancer, tristetraprolin, VEGF, tumor growth,
angiogenesis
Grant sponsor: Korea Research Foundation; Grant number: KRF-
2007-J00301; Grant sponsor: Ulsan University Hospital (Biomedical
Research Center Promotion Fund); Grant number: UUH-2006-2,
2007-1; Grant sponsor: Ministry of Health & Welfare, Republic of
Korea; Grant number: A050742
DOI: 10.1002/ijc.24847
History: Received 21 Jan 2009; Accepted 13 Aug 2009; Online 20
Aug 2009
Correspondence to: Jeong Woo Park, Department of Biological
Sciences, University of Ulsan, Ulsan 680-749, Korea,
E-mail: jwpark@ulsan.ac.kr; Hee Jeong Cha, Department of
Pathology, Ulsan University Hospital, University of Ulsan College of
Medicine, Ulsan 682-060, Korea, E-mail: heej0124@medimail.co.kr
Cancer Cell Biology
Int. J. Cancer: 126, 1817–1827 (2010)
V
C
2009 UICC
International Journal of Cancer
IJC
Page 1
of VEGF mRNA stability. To assess the relationship between
VEGF and TTP expression in colon cancer, we determined
the protein expression levels of VEGF and TTP in human co-
lon cancer by immunohistochemistry. In addition, we estab-
lished an animal model of colon cancer to investigate the
ability of TTP to regulate growth of colon cancer. We show
here that expression of TTP is significantly reduced and neg-
atively correlates with VEGF expression in human colon can-
cer. In addition, TTP overexpression promotes the degrada-
tion of VEGF mRNA and inhibits tumor growth and
angiogenesis of human colon cancer xenografts in nude mice.
Material and Methods
Cells
Four human colorectal cancer cell lines, Colo320HSR,
KM12C, HT-29 and SW620 were purchased from the Korean
Cell Line Bank (Seoul, Korea) and were maintained in
RPMI1640 supplemented with 10% fetal bovine serum
(GibcoBRL). They were cultured at 37
C in a humidified
chamber containing 5% CO
2
. For MTS cell proliferation
assay, cells were plated in triplicate at 1.2 10
4
cells/well in
96-well culture plates in RPMI1640. At the indicated times,
CellTiter 96
V
R
Aq
ueous
One Solution Reagent (Promega) was
added to each well according to the manufacturer’s instruc-
tions and absorbance at 490 nm (OD
490
) was determined for
each well using a Wallac Vector 1420 Multilabel Counter
(EG&G Wallac, Turku, Finland).
Patients
The Local Ethical committee of Ulsan University Hospital
provided institutional review board approval for this study.
We obtained informed consent for this study from all partici-
pants. The study group was composed of 44 patients with co-
lonic adenocarcinoma and 35 patients with colonic adenoma
who underwent surgical treatment at the Department of Sur-
gery, Ulsan University Hospital, in the 2-year period from
2006 to 2007. The pathology reports and clinical histories at
the time of surgery were reviewed to determine tumor stage.
Tissue specimens were obtained at surgery. Colonic adeno-
carcinoma samples were harvested from necrosis-free tissue;
44 cases of normal colonic mucosa were taken from corre-
sponding tissue distant from the tumors. Colonic adenoma
samples were obtained by polypectomy or from surgically
resected cancer tissue. All obtained tissues were bisected; one
section was placed in embedding medium (Tissue-Tek O.C.T
compound, Tokyo, Japan), frozen in 2-methylbutane (isopen-
tane, SIGMA, St. Louis, MO), immersed in liquid nitrogen
for 2 min, and stored at 80
C for later cryosectioning and
the other section was fixed with 10% neutral formalin for
routine pathological evaluation.
Immunohistochemistry
For TTP immunostaining, cryosections (6 lm) of tissue were
fixed at room temperature in acetone for 5 min and incu-
bated with a 1:100 dilution of anti-human TTP monoclonal
antibody (sc-14030, Santa Cruz, CA). Immunostaining for
VEGF was performed with deparaffinized tissue sections;
these were incubated with 1:200 diluted anti-human VEGF
monoclonal antibody (sc-152, Santa Cruz). Primary antibod-
ies were detected using EnVision
TM
þ/HRP kits (DAKO, Car-
pinteria, CA). Peroxidase activity was visualized with
3-amino-9-ethyl carbazole (Sigma). The sections were coun-
terstained with Mayer’s hematoxylin. Negative controls, in
which the primary antibody incubation step was omitted,
were also included for each staining. The expression of TTP
and VEGF was scored semiquantitatively based on the stain-
ing intensity and proportion of staining.
20
Staining intensity
was subclassified as 0, negative; 1, weak; 2, moderate and 3,
strong and the proportion of staining wa s scored as 0–25%,
1; 26–50%, 2; 51–75%, 3 and 76–100%, 4. Staining scores
were obtained by multiplying the staining intensity by the
proportion of staining. Two pathologists, who did not have
any prior clinical or pathological information, scored the
expression at 100 magnification under light microscopy. All
available areas in the section were evaluated.
Semi-quantitative RT-PCR
Five lg of DNase I-treated total RNA was reverse transcribed
using oligo-dT and Superscript II reverse transcriptase (Invi-
trogen) according to the manufacturer’s instructions. Semi-
quantitative RT-PCR was performed using Taq polymerase
(Sun Genetics, Daejeon, Korea) and appropriate primers.
PCR primer pairs were as follows: TTP: CGCTACAAGACT
GAGCTAT, GAGGTAGAACTTG TGACAGA; VEGF: CGA
AGTGGTGAAGTTCATGGATGT, TCACCGCCTCGGCTT
GTC; cMyc: ACCACCAGCAGCGACTCTGA, TCCAGCAG
AAGGTGATCCAGACT; FOS: ACGCAGACTACGAGGCG
TCA, TTCACAACGCCAGCCCTGGA; cyclin D: CAAAAT
GCCAGAGGCGGAG, CTTGATCACTCTGGAGAG; GAPDH:
ACATCAAGAAGGTGGTGAAG, CTGTTGCTGTAGCCAA
ATTC; VEGFR1: CAAGTGGCCAGAGGCATGGAGTT, GA
TGTAGTCTTTACCATCCTGTTG; VEGFR2: GAGGGCCT
CTCATGGTGATTGT, TGCCAGCAGTCCAGCATGGTCTG;
Neuropilin-1: AGGACAGAGACTGCAAGTATGAC, AACATT
CAGGACCTCTCTTGA; Neuropilin-2: AGCACTAATGGAG
AGGACTG-3, CCGTTTAGGCTGTAGGAGAC.
Plasmid construction and transfection
Colo320 cells that overexpressed human TTP were generated
by using the pcDNA4.1 vector (Invitrogen). Full-length
human cDNA of TTP was cloned by RT-PCR from the RNA
of KM12C cells using the forward primer 5
0
-CCG TGA ATT
CAT GGA TCT GAC TGC CAT-3
0
and the reverse primer
5
0
-CAC TCT CGA GCT CAG AAA CAG AGA TGC-3
0
, and
the product was subcloned into the pcDNA4.1 vector. About
1.5 10
7
cells were electrophorated with 20 lg of pcDNA-
TTP at 500 V, 975 lF with a Gene Pulser electroporator II
(Bio-Rad). After transfection, Colo320/TTP cells stably trans-
fected with human TTP were selected by adding Zeocin
(450 lg of Zeocin/ml; Invitrogen) 3 days after transfection.
Cancer Cell Biology
1818 TTP regulates expression of VEGF and tumorigenesis
Int. J. Cancer: 126, 1817–1827 (2010)
V
C
2009 UICC
Page 2
Stable polyclonal transfectants were maintained in bulk cul-
ture without further clonal purification. Stable polyclonal
transfectants were tested for overexpression of human TTP 1
by RT -PCR and Western blots using anti-human TTP poly-
clonal antibody (ab36558, Abcam). A control cell line,
Colo320/pcDNA was generated by transfection with the
pcDNA 4.1 vector.
Colo320 was transfected with TTP-siRNA (sc-36761,
Santa Cruz) or control siRNA-A (sc-37007, Santa Cruz) using
Lipofectamine
TM
RNAiMAX (Invitrogen). Cells were seeded
in six-well plates at a concentration of 3 10
5
cells/ml. The
concentration of siTNA was 100 nM. Cells were harvested 24
hr after transfection. Typically, cells were analyzed for the
loss of TTP mRNA and protein expression 24 hr after trans-
fection using either RT-PCR or immunoblotting.
To generate pGL3-VEGF 3
0
UTR, complimentary oligonu-
cleotides that contain the 3
0
UTR of human VEGF was
annealed. The sequences of the oligonucleotides are the fol-
lowing: wtVEGF-UP, 5
0
-CTAGAGGTACTTATTTAATAGC
CCTTTTTAATTAGAAATTAAAACAGTTAATTTAATTAA
AGAGTAGGGTTTTTTCAGTAT-3
0
; wtVEGF-DOWN, 5
0
-
CTAGATACTGAAAAAACCCTACTCTTTAATTAAATTAA
CTGTTTTAATTTCTAATTAAAAAGGGCTATTAAATAAG
TACCT-3
0
. Mutant oligonucleotides in which two ATTTA
pentamers were substituted with AGGTA were used as a neg-
ative control. The annealed oligonucleotides were ligated into
the XbaI site of pGL3-control (Promega), immediately down-
stream of the luciferase open reading frame, to generate
pGL3-VEGF 3
0
UTR. KM12C, Colo320, Colo320/TTP and
Colo320/pcDNA cells were transiently transfected with
pGL3-VEGF 3
0
UTR or empty pGL3-control vector using
Lipofectamine. Transfected cells were lysed with lysis buffer
(Promega) and mixed with luciferase assay reagent (Promega)
and the chemiluminescent signal was measured in a Wallac
Vector 1420 Multilabel Counter (EG&G Wallac, Turku,
Finland).
RNA kinetics
For RNA kinetic analysis, we used actinomycin D and assessed
VEGF mRNA expression by quantitative PCR. Quantitative
PCR was performed by monitoring in real-time the increase in
fluorescence of the SYBR Green dye (QIAGEN, Hilden, Ger-
many) on a DNA Engine Opticon Continuous Fluorescence
Detection System (MJ Research) according to the manufac-
turer’s instructions. Specificities of each primer pair were con-
firmed by melting curve analysis and agarose-gel electrophore-
sis. PCR primer pairs were as follows: qVEGF-UP, ATC
TTCAAGCCATCCTGTGTGC; qVEGF-DN, TGCGCTTGT
CACATTTTTCTTG.
RNA electromobility shift assay and super-shift assays
The biotinylated RNA probes for wild type (wtVEGF-EMSA,
5
0
-GGUACUUAUUUAAUAGCCCUUUUUAAUUAGAAAU
UAAAACAGUUAAUUUAAUUAA-3
0
) and mutant (mut-
VEGF-EMSA, 5
0
-GGUACUUAGGUAAUAGCCCUUUUUA
AUUAGAAAUUAAAACAGUUAAGGUAAUUAA-3
0
) were
synthesized by Samchully Pharm. Co. (Seoul, Korea). Mutant
RNA probe in which two AUUUA pentamers were substi-
tuted with AGGUA was used as a negative control. Cytoplas-
mic extracts were prepared using NE-PER
V
R
Nuclear and
Cytoplasmic extraction Reagent (Thermo Pierce Biotechnol-
ogy Scientific). RNA EMSA was conducted using Lightshift
V
R
Chemoluminescent EMSA Kit (Pierce) according to the man-
ufacturer’s instructions. Briefly, 20 fmol of biotinylated RNA
was combined with 5 lg of cytoplasmic protein of Colo320/
TTP cells in a binding buffer. For super-shift assays, the anti-
TTP antibody (ab36558, Abcam) or control antibody (I-5381,
Sigma) were added to the reaction mixtures. After the addi-
tion of antibodies, reaction mixtures were overnight incu-
bated on ice. The reaction mixtures were resolved on 5%
native polyacrylamide gels in 0.5 Tris borate-EDTA (TBE)
buffer. Gels were transferred to nylon N
þ
membranes in
0.5 TBE at 400 mA and 4
C for 1 hr. The RNAs were
cross-linked to the membranes and detected by using strepta-
vidin-horseradish peroxidase binding and chemiluminescent
detection.
SDS-PAGE analysis and immunoblotting
Proteins were resolved by SDS-PAGE, transferred onto
Hybond-P membranes (Amersham Biosciences), and probed
with appropriate dilutions of rabbit antihuman TTP polyclo-
nal antibody (ab3 6558, Abcam) or antihuman VEGF mono-
clonal antibody (sc-152, Santa Cruz Biotechnology). Immu-
noreactivity was detected using the ECL detection system
(Amersham Biosciences). The films were exposed at multiple
time points to ensure that the images were not saturated.
Exposure to the rVEGF or anti-VEGF antibody
Cells were incubated cells in 100 or 150 ng/ml of human
recombinant VEGF (BD Biosciences) or in 0.5 or 1 lg/ml of
anti-VEGF antibody (R&D Systems) for 48 hr.
Detection of VEGF in the supernatants
Cells were plated at a density of 3 10
4
/cm
2
in 75 cm
2
tis-
sue culture flasks. After 48 hr, the supernatants from the cells
were collected and analyzed for VEGF. One milliliter of the
supernatants was submitted for ELISA analysis for VEGF.
Results were normalized for the total cellular proteins ana-
lyzed using a BCA
TM
Protein Assay Kit (Thermo Scientific,
Rockford, IL). Two milliliters of the supernatants was con-
centrated to 40 ll by using Centricon centrifugal filter devi-
ces containing Ultracel YM-10 membrane (Millipore) accord-
ing to the manufacturer’s instructions. The amount of VEGF
in the concentrates was determined by Western blot using
antihuman VEGF monoclonal antibody (sc-152, Santa Cruz).
Generation and analysis of tumors
Either Colo320/pcDNA or Colo320/TTP (2 10
7
cells) was
injected into the flank of 6-week-old nude (nu/nu) mice (Korea
Charles River, Seoul, Korea). The resulting tumors were
Cancer Cell Biology
Lee et al. 1819
Int. J. Cancer: 126, 1817–1827 (2010)
V
C
2009 UICC
Page 3
measured with digital calipers. Tumor volumes were calculated
as follows: volume ¼ length width
2
0.52. Samples of each
tumor were either frozen for cryostat sections and western blot
analysis or fixed immediately in Bouin’s fixative for 2–3 hr. Im-
munostains for TTP and VEGF were performed with cryosec-
tions and deparaffinized sections of tissues, respectively, using
antihuman TTP monoclonal antibody (sc-14030, Santa Cruz)
and antihum an VEGF monoclonal antibody (sc-152, Santa
Cruz). Vessels were stained with anti-PECAM-1 monoclonal
antibody (1D2-1A5, Abnova Corporation, Jhongli, Taiwan).
All mouse experiments were approved by the Animal Care and
Use Committee of the University of Ulsan.
Statistical analysis
Differences in the expression of TTP and VEGF among the
clinicopathological groups were evaluated by Student’s t-test
or one-way ANOVA. The correlation between TTP protein
expression and VEGF protein expression was analyzed by lin-
ear regression. A p value <0.05 was considered to indicate
statistical significance.
Results
TTP expression is reduced in colonic adenocarcinoma
We examined TTP expression levels by immunohistochemi-
cal staining in 44 cases of surgically resected primary colo-
rectal tumors and 35 cases of colonic adenoma. Normal colo-
nic mucosa distant from the surgically resected cancer
specimens was used as a normal control. We found statisti-
cally significant differences in TTP expression levels between
normal colonic mucosa, colonic adenoma and colonic adeno-
carcinoma (Table 1, Figs. 1a and 1b).
The TTP staining was dramatically decreased in colonic
adenocarcinoma (mean staining score, 2.27 6 0.32) com-
pared with in the normal colonic mucosa (mean staining
score, 8.5 6 0.4) and colonic adenoma (mean staining score,
5.51 6 0.43) (p < 0.0001) (Figs. 1a and 1b, Table 1). How-
ever, there were no significant differences in TTP expression
according to age, sex or TNM stage (Table 1). Collectively,
these results suggest that TTP expression is reduced in tissues
of human colon cancer.
TTP expression is inversely correlated with VEGF
expression in colonic adenocarcinoma
As VEGF plays an important role in tumorigen esis
21,22
and
its expression can be regulated by TTP,
14,17
we analyzed the
levels of VEGF expression by immunohistochemical staining
and investigated the correlation between TTP and VEGF
expression in colonic adenocarcinoma. VEGF expression was
extremely low in normal colonic mucosa (mean staining
score, 2.25 6 0.24), intermediate in colonic adenoma (mean
staining score, 4.42 6 0.53), and high in colonic adenocarci-
noma (mean staining score, 9.36 6 0.42) (p < 0.0001) (Figs.
1a and 1b, Table 1). These results show that VEGF expres-
sion is closely correlated with colon tumorigenesis.
TTP expression is inversely correlated with VEGF
expression in human colon cancer cell lines
To determine if TTP expression is inversely correlated with
VEGF expression in human colon cancer cell lines, we analyzed
the expression of TTP and VEGF in four human colon cancer
cell lines. Although cell lines with high TTP expression levels
Table 1. TTP and VEGF expression and clinicopathologic features of patients with colonic adenocarcinoma
n
TTP VEGF
Staining score
1
p value Staining score
1
p value
Disease index
Adenocarcinoma 44 2.27 6 0.32 <0.0001 9.36 6 0.42 <0.0001
Adenoma 35 5.51 6 0.43 4.42 6 0.53
Normal mucosa 44 8.50 6 0.40 2.25 6 0.24
Age (years)
38–49 6 3.33 6 0.88 0.078 8.83 6 1.23 0.583
50–69 24 2.00 6 0.46 9.29 6 0.54
70–82 14 2.28 6 0.51 9.71 6 0.83
Sex
Female 19 2.26 6 0.51 0.399 9.21 6 0.73 0.607
Male 25 2.28 6 0.43 9.48 6 0.50
Tumor stage
I 6 3.33 6 1.31 0.306 8.66 6 0.80 0.594
II 14 1.85 6 0.44 9.92 6 0.87
III 16 2.12 6 0.56 9.18 6 0.74
IV 8 2.50 6 0.66 9.25 6 0.84
1
Mean 6 S.E.M.
Cancer Cell Biology
1820 TTP regulates expression of VEGF and tumorigenesis
Int. J. Cancer: 126, 1817–1827 (2010)
V
C
2009 UICC
Page 4
(KM12C and HT29) showed low expression levels of VEGF,
those with low TTP expression levels (Colo320 and SW620)
showed a relatively high level of expression of VEGF (Fig. 2a),
suggesting an inverse correlation between TTP expression and
VEGF expression in human colon cancer cell lines.
TTP overexpression decreases VEGF expression in human
colon cancer cells
We next examined whether overexpression of TTP could
reduce VEGF expression in huma n colon cancer cells. For
this purpose, a TTP expression vector (pcDNA4.1-TTP) was
transfected into Colo320 cells to establish a stable transfec-
tant derivative of Colo320, Colo320/TTP. As a negative con-
trol, Colo320/pcDNA cells stably transfected with empty vec-
tor were included. Overexpression of TTP in Colo320/TTP
cells was confirmed by RT-PCR (Fig. 2b) and western blot
(Fig. 2c). TTP expression in Colo320/pcDNA cells was
slightly increased compared with that of Colo320 cells (Figs.
2b and 2c), which may be explained by the nonspecific effects
of vectors. Western blot and RT-PCR analysis showed a sig-
nificant decrease in VEGF expression in Colo320/TTP cells
compared with Colo320 cells. No significant change in VEGF
expression was observed with Colo320/pcDNA (Figs. 2b and
2c).
TTP siRNA increases the VEGF expression in human colon
cancer cells
To test if down-regulation of TTP affects VEGF expression
in KM12C cells, we used siRNA against TTP to significantly
reduce the expression level of TTP in KM12C cells (Figs. 2b
and 2c). Down-regulation of TTP by treatment with siRNA
significantly increased the expression level of VEGF (Figs. 2b
and 2c). However, treatment with scrambled siRNA did not
decrease the expression level of endogenous TTP and also
did not induce a change in VEGF expression. These results
indicate that the expression of TTP is directly associated with
the decrease in VEGF expression observed in human colon
cancer cells.
TTP overexpression decreases the levels of luciferase
mRNA containing the VEGF 3
0
UTR
VEGF mRNA possesses AREs within the 3
0
UTR and TTP
proteins form stable complexes with the 3
0
UTR and regulate
the mRNA stability of VEGF.
14,15,17
To determine whether
down regulation of VEGF expression by TTP is mediated
through a VEGF ARE, we made use of a luciferase reporter
gene linked to the wild type VEGF ARE (wt VEGF ARE) or
mutant VEGF ARE (mut VEGF ARE) in the plasmid pGL 3-
control. The pGL3-control was used as a control. When
Colo320 cells were transfected to overexpress TT P in
Colo320/TTP, the expression of luciferase containing wt
VEGF ARE was inhibited (Fig. 2d). However, the expression
of luciferase with mut VEGF ARE or without VEGF ARE
was not inhibited by TTP overexpression in Colo320 cells
(Fig. 2d).
TTP destabilizes VEGF mRNA
To determine whether decreased expression of VEGF resulted
from changes in the stability of VEGF mRNA, the half life of
this mRNA was measured in actinomycin D-treated Colo320/
TTP and Colo320/pcDNA cells by quantitative real-time
PCR. In Colo320/pcDNA cells, VEGF mRNA was stable until
1 hr after actinomycin treatment. However, in Colo320/TTP
cells, the half-life was reduced to less than 1 hr (Fig. 2e). Col-
lectively, the results indicate that the elevated expression of
Figure 1. Inverse correlation between TTP and VEGF expression in
human normal colonic mucosa, colonic adenoma and colonic
adenocarcinoma. (a) Representative TTP and VEGF
immunohistochemical staining in normal colonic mucosa, colonic
adenoma and colonic adenocarcinoma. (b) The normal colonic
mucosa showed strong immunoreactivity for TTP, where as the
colonic adenocarcinoma showed strong positive staining for VEGF
(***p < 0.001 vs. normal colonic mucosa). Bars indicate S.E.M.
Cancer Cell Biology
Lee et al. 1821
Int. J. Cancer: 126, 1817–1827 (2010)
V
C
2009 UICC
Page 5
Figure 2. TTP inhibits VEGF expression in human colon cancer cells. (a) Levels of TTP and VEGF expression in four human colon cancer cell
lines were determined by RT-PCR. KM12C cells with high TTP expression and low VEGF expression and Colo320 cells with low TTP
expression and high VEGF expression were selected for further studies. (b, c) Expression of VEGF in parental KM12C and Colo320 cells, TTP
siRNA-treated or sc siRNA-treated KM12C cells, and Colo320 derivatives stably transfected with pcDNA-TTP, Colo320/TTP or empty vector
pcDNA3.1, Colo320/pcDNA. VEGF expression was determined by semiquantitative RT-PCR (b) and Western-blot analysis (c). GAPDH and b-
actin were used as internal controls for semiquantitative RT-PCR and Western blot analysis, respectively. (d ) Expression of a luciferase
reporter construct in human colon cancer cells. Luciferase-reporter gene expression constructs containing the wild type (wt VEGF-ARE),
mutant (mut VEGF-ARE) or no VEGF ARE (pGL3-control) were transfected in Colo320, Colo320/pcDNA and Colo320/TTP cells. Luciferase
activity was normalized to b-galactosidase activity and the luciferase units in pGL3-control were set to 1. Results shown on the graph
represent means 6 SD of three independent experiments (**p < 0.05 vs. Colo320). (e) Kinetics of VEGF mRNA in Colo320/TTP and
Colo320/pcDNA cells. Expression of VEGF mRNA in cells was determined by quantitative PCR after the addition of 5 lg/ml actinomycin D.
Results shown on the graph represent means 6 SD of three independent experiments (***p < 0.001). (f ) Association of TTP with VEGF
ARE. An RNA EMSA was performed by mixing cytoplasmic extracts containing 5 lg of total protein from Colo320/TTP cells with 20 fmol of
biotinylated wild type (wt) (lane 1, 3, and 4) or mutant VEGF ARE probe (mut) (lane 2). The anti-TTP antibody (lane 3) or control antibody
(lane 4) were added to the reaction mixtures. The binding reactions were then separated by electrophoresis on a 5% polyacrylamide gel
under non-denaturing conditions. The position of the TTP-containing band (TTP) and free probe are indicated. The bands between TTP and
free probe correspond to complexes between probes and cellular proteins unrelated to TTP.
Cancer Cell Biology
1822 TTP regulates expression of VEGF and tumorigenesis
Int. J. Cancer: 126, 1817–1827 (2010)
V
C
2009 UICC
Page 6
TTP contributes to a decrease in VEGF levels through desta-
bilization of VEGF mRNA.
TTP interacts with the VEGF mRNA ARE
The change in VEGF mRNA stability in TTP-transfected
Colo320 cells might be a direct or indirect effect of TTP. To
address this question, we tested whether TTP could interact
with the target RNA by RNA EMSA. Cytoplasmic extracts
from Colo320/TTP cells were incubated with a biotinylated
RNA probe containing the wild type or mutant VEGF ARE.
When RNA EMSA was performed using wild type VEGF
ARE, a dominant shifted complex was observed (Fig. 2f, lane
1). This dominant complex contained TTP because it was
super-shifted by an anti-TTP antibody but was not super-
shifted by control antibody (Fig. 2f, lanes 3 and 4). This
dominant complex was dramatically reduced when the RNA
EMSA was conducted using mutant VEGF ARE in which
two AUUUA pentamers were substituted with AGGUA (Fig.
2f, lane 2). Taken together, these data strongly suggested that
repression of VEGF occurred through direct interaction of
TTP with the mRNA.
TTP inhibits growth of colon cancer cells in vitro
We next examined whether TTP overexpression affects the
proliferation of colon cancer cells in vitro. The growth of
Colo320/TTP cells was compared with that of Colo320 and
Colo320/pcDNA cells. The results show that overexpression
of TTP decreases the proliferation rate of the cells (Fig. 3a).
TTP expression can suppress cell growth through destabiliza-
tion of Fos, Myc and Cyclin D1 mRNA.
23,24
To determine
whether TTP suppresses the growth of Colo320 cells through
modulation of the expression of these genes, we tested the
changes in the expression levels of these genes in colon can-
cer cells by R T-PCR. No differences in expression of these
genes were observed among Colo320, Colo320/pcDNA and
Colo320/TTP cells (Fig. 3b). To determ ine if the observed
Figure 3. TTP suppresses the growth of human colon cancer cells in vitro through inhibition of VEGF expression. (a) in vitro proliferation of
Colo320, Colo320/pcDNA and Colo320/TTP cells. Cells were seeded at 1.2 10
4
cells per well in 96-well plates. Cell viability was
performed at the indicated times using a MTS cell proliferation assay. The data represent the mean 6 SD of three different experiments
(***p < 0.05 vs. Colo320). (b) Expression of Myc, Fos, Cyclin D, VEGFR1, VEGFR2, neuropilin-1 and neuropilin-2 in Colo320, Colo320/
pcDNA and Colo320/TTP cells was determined by semiquantitative RT-PCR. (c, d) Analysis of VEGF in the medium of Colo320/pcDNA and
Colo320/TTP cells by ELISA (***p < 0.05 vs. Colo320/pcDNA) (c) and Western blot (d ). VEGF secretion was measured by growing cells for
48 hr. (e) rVEGF abrogates the suppressive effect of TTP expression in Colo320/TTP cells and VEGF neutralizing antibody reduces
proliferation of Colo320/pcDNA cells. Cells were seeded as earlier and were treated with rhVEGF or VEGF neutralizing antibody. After 48 hr,
cell viability was measured using a MTS cell proliferation assay. The data represent the mean 6 S.E.M of five different experiments.
***p < 0.0001; *p < 0.05.
Cancer Cell Biology
Lee et al. 1823
Int. J. Cancer: 126, 1817–1827 (2010)
V
C
2009 UICC
Page 7
differences in cell growth characteristics correlated with the
secreted VEGF levels, VEGF in the supernatant of Colo320,
Colo320/pcDNA and Colo320/TTP cells was measured by
ELISA and Western blot analyses. All cells secreted VEGF
protein, with Colo320/TTP cell secreting 70% of the VEGF
of Colo320/pcDNA cells in the supernatants of 2-day-old cul-
tures (Figs. 3c and 3d).
To test whether mitogenic responses in vitro are mediated
by VEGF, we used an anti-mouse-VEGF antibody that specif-
ically blocks VEGF activity. As shown in Figure 3e, anti-
VEGF antibody dose-dependently reduced the growth of the
Colo320/pcDNA, and the addition of 1 lg/ml neutralizing
anti-VEGF monoclonal antibody reduced the growth of
Colo320/pcDNA to 96% of that of Colo320/TTP. To deter-
mine whether VEGF restores the growth of Colo320/TTP
cells, cells were incubated in the presence of recombinant
human VEGF (rVEGF). The addition of rVEGF resulted in a
dose-dependent increase in the growth of Colo320/TTP, and
the addition of 150 ng/ml rVEGF increased the growth of
Colo320/TTP to 98% of that of Colo320 (Fig. 3e). These
results show that VEGF, a well-characterized me diator of
physiological and pathological angiogenesis, also controls the
proliferation of human Colo320 cells. VEGF exerts its prolif-
erative role through its binding to the VEGF receptor. Thus,
we performed RT-PCR with RNA from Colo320 cells and, as
shown in Figure 3b, Colo320 cells express the VEGF recep-
tors such as VEGFR1, VEGFR2, neuropilin-1 and neuropilin-
2. These results show that TTP expression suppresses the
growth of colon cancer cells in vitro through down regulation
of VEGF.
TTP overexpression decreases growth of colon cancer
cells in vivo
To test whether TTP overexpression affects tumor growth in
vivo, groups of 8–10 nude mice were injected subcutaneously
with equal numbers of Colo320/pcDNA or Colo320/TTP
cells and the growth and morphology of the tumo rs were
monitored over 36 days. Colo320/TTP cells produced tumors
with a decreased growth rate compared with tumors pro-
duced by Colo320/pcDNA cells (Figs. 4a and 4 b). After 36
days of tumor growth, Colo320/pcDNA cells yielded highly
vascular tumors that were three times larger than those
derived from Colo320/TTP cell implants (Fig. 4b). Immuno -
histochemical and RT-PCR analyses revealed the increased
expression of TTP and the reduced expression of VEGF in
Colo320/TTP tumors (Figs. 4c and 4d). Immunohistological
analysis for PECAM-1 demonstrated that PECAM-1
þ
vessels
in Colo320/TTP tumors (mean staining score, 2.2 6 1.304)
Figure 4. Expression of TTP suppresses tumor growth in vivo.(a) Photographs of mice taken 28 days after injection with Colo320/pcDNA or
Colo320/TTP. (b) Measurement of subcutaneous tumors in nude mouse (n ¼ 8–10). The mean tumor volumes in mm
3
6 S.E.M. for tumors
generated with Colo320/pcDNA and Colo320/TTP cells are presented as a function of times (in days). (c ) RT-PCR analysis of Colo320/
pcDNA and Colo320/TTP tumor tissues for the expression of TTP and VEGF. (d ) Immunohistochemical staining of tumor tissues with anti-
human TTP, anti-human VEGF and anti-human PECAM-1 monoclonal antibodies.
Cancer Cell Biology
1824 TTP regulates expression of VEGF and tumorigenesis
Int. J. Cancer: 126, 1817–1827 (2010)
V
C
2009 UICC
Page 8
were significantly reduced compared with those in Colo320/
pcDNA tumors (mean staining score, 9.6 6 2.509) (p ¼
0.0004), consistent with VEGF being a potent angioge nic fac-
tor and an inducer of vascular permeability (Fig. 4d ). These
results indicate that TTP can suppress the growth of tumors
through down-regulation of angiogenic factor VEGF expres-
sion in vivo.
Discussion
In this study, we report that TTP expres sion is significantly
reduced in specimens of surgically resected colonic adenocar-
cinoma and that overexpression of TTP suppresss the growth
of human colon cancer cells xenografted into nude mice
in vivo. An inverse correlation was noted between the expres-
sion levels of T TP and VEGF mRNA in tissues of colonic ad-
enocarcinoma, and elevated levels of T TP were associated
with reduced levels of VEGF mRNA in human colon cancer
cells. Overexpression of TTP decreased VEGF expression
and, vice versa, suppression of TTP expression using siRNA
increased it in human colon cancer cells. VEGF mRNA con-
tains an ARE and it has been reported that TTP modulates
the expression levels of VEGF gene through destabilization of
VEGF mRNA.
14,15,17
We showed a direct interaction between
TTP and VEGF 3
0
UTR and we demonstrated that the expres-
sion of a luciferase reporter gene containing VEGF 3
0
UTR
was inhibited when TTP was overexpressed. This suggests
that the expression of TTP decreases the accumulation of
VEGF mRNA, which then leads to reduced growth of colon
cancer cells.
VEGF binds VEGF receptors on the surface of endothelial
cells thereby inducing tumor angiogenesis to support tumor
growth.
25
Thus, reduced expression of VEGF as a result of
TTP expression is likely to decrease angiogenesis and reduce
tumor growth of colon cancer cells in vivo. Our study pro-
vides evidence that the overexpression of TTP suppresses
both the angiogenesis and the growth of tumors induced by
Colo320 cells xenografted into nude mice. However, an unex-
pected finding was that overexpression of TTP also sup-
presses the growth of colon cancer cells in vitro. It has been
reported that TTP is able to alter cell growth through modu-
lation of Fos, Myc and Cyclin D1 mRNA.
23,24
However, in
Colo320 cells, TTP expression did not affe ct the expression
levels of these genes. AREs are grouped into three classes
based on the number and the distribution of AUUUA pen-
tamers.
26
According to this classification, VEGF mRNA con-
tains class II ARE but mRNAs of Fos , Myc and Cyclin D1
contain class I AREs.
27
Even though the binding specificity of
TTP is reported to be restricted to mRNAs containing Class
II AREs,
27
it is not clear whether TTP destabilizes only
mRNAs containing Class II ARE in Colo320 cells. Further
study of the TTP target genes with different classes of AREs
may provide insight into the spectrum of TTP target genes.
An analysis of the human ARE-containing mRNA database
suggests that the proportion of mRNA with AREs could be
as high as 8%,
28
and a series of regulators that are relevant
for oncogenic growth, including cyclins, growth factors and
proto-oncogenes, contain AREs.
26
Thus, it is possible that
TTP regulates the expression levels of genes other than Fos,
Myc and Cyc lin D1 and the changes in their expression level
may affect the growth of colon cancer cells. This is consistent
with an observation demonstrating that TTP regulates the
expression of COX-2 in colon cancer and decrease expression
of TTP promotes COX-2 overexpression and contributes to
colon tumorigenesis.
29
However, even though we did not
detect a change in the expression levels of all genes contain-
ing ARE and their roles in the growth of Colo320 cells,
VEGF seems to be a key growth factor for Colo320 cells of
which activity is modulated by TTP in vitro. This conclusion
is based on our results showing that addition of VEGF
restored the growth of Colo320/TTP cells and treatment with
a neutralizing antibody against VEGF suppressed the growth
of Colo320 cells.
How does VEGF control the growth of cancer cells in
vitro? VEGF acts through bindin g to its receptors, VEGFR-1,
VEGFR-2, neuropilin-1 and neuropilin-2. VEGFR-2 is re-
sponsible for mitogenic signaling,
30
whereas VEGFR-1 partic-
ipates in cell migration.
31
VEGFRs are specifically expressed
in endothelial cells.
32,33
However, recent findings have shown
that VEGF and its receptors are expressed widely in tumor
cells and that VEGF can directly stimulate VEGFR-positive
tumor cell growth.
25,34,35
Neuropilins originally thought to be
limited to neurons have been identified on tumor cells.
25
Recently, neuropilin-2 has been reported to be involved in
survival signaling in cancer cells.
36
Our results show that
Colo320 cells express VEGFR2 and neuropilin-2 on their sur-
face and that the addition of VEGF restores the growth of
Colo320/TTP cells. These data suggest that VEGF produced
by colon cancer cells can also act as an autocrine growth fac-
tor to induce their proliferation in vitro by binding to
VEGFR2 and/or neuropilin-2 on the cell surface.
Even though we provided evidences that VEGF produced
by cancer cells can act as an autocrine growth factor and
control the growth of colon cancer cells in vitro, the effect of
VEGF on the growth of colon cancer cells in vitro was mod-
est compared with that on the tumor growth in vivo. This
suggests that the direct effect of VEGF on the growth of co-
lon cancer cells may not be the sole factor for the tumor
growth in vivo. Instead, both autocrine growth factor and
angiogenic factor activities of VEGF seem to play roles in the
in vivo tumor growth of colon cancer cells.
We have shown that TTP expression is down-regulated in
human colon cancer and that overexpression of TTP can sup-
press the growth of human colon cancer cells both in vivo and
in vitro through destabilization of VEGF mRNA. These data are
in accordance with the recent finding that TTP expression
inhibits the growth of mouse ras-dependent tumor cells by deg-
radation of VEGF mRNA.
17
In addition, These findings, coupled
with recent evidence demonstrating the benefits of VEGF inhibi-
tion
5,6,37,38
in many cancer models, suggest that pharmacologic
activation of TTP and/or induction of TTP expression may limit
Cancer Cell Biology
Lee et al. 1825
Int. J. Cancer: 126, 1817–1827 (2010)
V
C
2009 UICC
Page 9
colon cancer growth. TTP has been reported to be induced in
fibroblasts in response to insulin, phorbol esters and serum
39–41
and in macrophages by lipopolysaccharides.
42
Although it is not
clear whether TTP expression in colon cancer cells is regulated
by the same mechanisms as in the fibroblasts and macrophages,
the TTP pathway represents a new therapeutic target in antian-
giogenesis against colon cancer. Specific induction of TTP, alone
or in combination with other angiogenesis inhibitors, provides
the exciting possibility of treating patients with tumors that are
resistant to anti-VEGF therapies.
Acknowledgements
Hyun Hee Lee and Won Hyuk Lee were partly supported by the BK21 pro-
gram of the Korean Research Foundation.
References
1. Plate KH, Breier G, Weich HA, Risau W.
Vascular endothelial growth factor in a
potential tumor angiogenesis factor in
human gliomas in vivo. Nature 1992;359:
845–8.
2. Ferrara N, Gerber HP, LeCouter J. The
biology of VEGF and its receptors. Nat
Med 2003;9:669–76.
3. Brown L, Berse B, Jackman R, Tognazzi K,
Guidi A, Dvorak H, Senger D, Connolly J,
Schnitt S. Expression of vascular
permeability factor (vascular endothelial
growth factor) and its receptors in breast
cancer. Hum Pathol 1995;26:86–91.
4. Ferrara N, Davis-Smyth T. The biology of
vascular endothelial growth factor. Endocr
Rev 1997;18:4–25.
5. Hurwitz H, Fehrenbacher L, Novotny W,
Cartwright T, Hainsworth J, Heim W,
Berlin J, Baron A, Griffing S, Holmgren E,
Ferrara N, Fyfe G, et al. Bevacizumab plus
irinotecan, fluorouracil, and leucovorin for
metastatic colorectal cancer. N Engl J Med
2004;350:2335–42.
6. Ellis LM, Takahashi Y, Liu W, Shaheen
RM. Vascular endothelial growth factor in
human colon cancer: biology and
therapeutic implications. Oncologist 2000;5:
11–15.
7. von Marschall Z, Cramer T, Ho
¨
cker M,
Finkenzeller G, Wiedenmann B, Rosewicz
S. Dual mechanism of vascular endothelial
growth factor upregulation by hypoxia in
human hepatocellular carcinoma. Gut
2001;48:87–96.
8. Forsythe JA, Jiang BH, Iyer NV, Agani F,
Leung SW, Koos RD, Semenza GL.
Activation of vascular endothelial growth
factor gene transcription by hypoxia-
inducible factor 1. Mol Cell Biol 1996;16:
4604–13.
9. Levy AP, Levy NS, Iliopoulos O, Jiang C,
Kaplin WG, Jr, Goldberg MA. Regulation
of vascular endothelial growth factor by
hypoxia and its modulation by the von
Hippel-Lindau tumor suppressor gene.
Kindey Int 1997;51:575–8.
10. Pages G, Pouyssegur J. Transcriptional
regulation of the vascular endothelial
growth factor gene: a concert of activating
factors. Cardiovasc Res 2005;65:564–73.
11. Claffey KP, Shih SC, Mullen A, Dziennis S,
Cusick JL, Abrams KR, Lee SW, Detmar
M. Identification of a human VPF/VEGF
3
0
untranslated region mediating hypoxia-
induced mRNA stability. Mol Biol Cell
1998;9:469–81.
12. Wilusz CJ, Wormington M, Peltz SW. The
cap-to-tail guide to mRNA turnover.
Nature Rev Mol Cell Biol 2001;2:237–46.
13. Levy NS, Chung S, Furneaux H, Levy AP.
Hypoxic stabilization of vascular
endothelial growth factor mRNA by the
RNA-binding protein HuR. J Biol Chem
1998;273:6417–23.
14. Ciais D, Cherradi N, Bailly S, Grenier E,
Berra E, Pouyssegur J, Lamarre J, Feige JJ.
Destabilization of vascular endothelial
growth factor mRNA by the zinc-finger
protein TIS11b. Oncogene 2004;23:
8673–80.
15. Cherradi N, Lejczak C, Desroches-Castan
A, Feige JJ. Antagonistic functions of
tetradecanoyl Phorbol Acetate-inducible-
squence 11b and HuR in the hormonal
regulation of vascular endothelial growth
factor messenger ribonucleic acid stability
by adrenocorticotropin. Mol Endocrinol
2006;20:916–30.
16. Goldberg-Cohen I, Furneauxb H, Levy AP.
A 40-bp RNA element that mediates
stabilization of vascular endothelial growth
factor mRNA by HuR. J Biol Chem 2002;
277:13635–40.
17. Essafi-Benkhadir K, Onesto C, Stebe E,
Monori C, Page G. Tristetraprolin inhibits
Ras-dependent tumor vascularization by
inducing VEGF mRNA degradation. Mol
Biol Cell 2007;18:4648–58.
18. Suswam E, Li Y, Zhang X, Gillespie GY, Li
X, Shacka JJ, Lu L, Zheng L, King PH.
Tristetraprolin down-regulates interleukin-
8 and vascular endothelial growth factor in
malignant glioma cells. Cancer Res 2008;68:
674–82.
19. Carrick DM, Blackshear PJ. Comparative
expression of tristetraprolin (TTP) family
member transcripts in normal human
tissues and cancer cell lines. Arch Biochem
Biophys 2007;462:278–85.
20. Sinicrope FA, Ruan SB, Cleary KR,
Stephens LC, Lee JJ, Levin B. bcl-2 and
p53 oncoprotein expression during
colorectal tumorigenesis. Cancer Res 1995;
55:237–41.
21. Takahashi Y, Kitadai Y, Bucana CD, Cleary
KR, Ellis LM. Expression of vascular
endothelial growth factor and its receptor.
KDR, correlates with vascularity,
metastasis, and proliferation of human
colon cancer. Cancer Res 1995;55:3964–8.
22. Cascinu S, Staccioli MP, Gasparini G,
Giordani P, Catalano V, Ghiselli R, Rossi
C, Baldelli AM, Graziano F, Saba V,
Muretto P, Catalano G. Expression of
vascular endothelial growth factor can
predict event-free survival in stage II colon
cancer. Clin Cancer Res 2000;6:2803–7.
23. Marderosian M, Sharma A, Funk AP,
Vartanian R, Masri J, Jo OD, Gera JF.
Tristetraprolin regulates cyclin D1 and
c-Myc mRNA stability in response to
rapamycin in an Akt-dependent manner
via p38 MAPK signaling. Oncogene 2006;
25:6277–90.
24. Hau HH, Walsh RJ, Ogilvie RL, Williams
DA, Reilly CS, Bohjanen PR.
Tristetraprolin recruits functional mRNA
decay complexes to ARE sequences. J Cell
Biochem 2007;100:1477–92.
25. Dallas NA, Fan F, Gray MJ, Van Buren G,
II, Lim SJ, Xia L, Ellis LM. Functional
significance of vascular endothelial growth
factor receptors on gastrointestinal cancer
cells. Cancer Metastasis Rev 2007;26:
433–41.
26. Chen C-YA, Shyu A-B. AU-rich elements:
characterization and importance in mRNA
degradation. Trends Biochem Sci 1995;20:
465–70.
27. Barreau C, Paillard L, Osborne HB. AU-
rich elements and associated factors: are
there unifying principles? Nucleic Acids Res
2006;33: 7138–50.
28. Bakheet T, Frevel M, Williams B, Greer W,
Khabar K. ARED: human AU-rich
element-containing mRNA database reveals
an unexpectedly diverse functional
repertoire of encoded proteins. Nucleic
Acids Res 2001;29:246–54.
29. Young LE, Sanduja S, Bemis-Standoli K,
Pena EA, Price RL, Dixon DA. The mRNA
binding proteins HuR and tristetraprolin
regulate cyclooxygenase 2 expression
during colon carcinogenesis.
Gastroenterology 2009;136:1669–79.
30. Waltenberger J, Claesson-Welsh L,
Siegbahn A, Shibuya M, Heldin CH.
Different signal transduction properties of
KDR and Flt1, two receptors for vascular
endothelial growth factor. J Biol Chem
1994;269:26988–95.
Cancer Cell Biology
1826 TTP regulates expression of VEGF and tumorigenesis
Int. J. Cancer: 126, 1817–1827 (2010)
V
C
2009 UICC
Page 10
31. Barleon B, Sozzani S, Zhou D, Weich HA,
Mantovani A, Marme
´
D. Migration of
human monocytes in response to vascular
endothelial growth factor (VEGF) is
mediated via the VEGF receptor flt-1.
Blood 1996;87:3336–43.
32. de Vries C, Escobedo JA, Ueno H, Houck
K, Ferrara N, Williams LT. The fms-like
tyrosine kinase, a receptor for vascular
endothelial growth factor. Science 1992;255:
989–91.
33. Soker S, Takashima S, Miao HQ, Neufeld
G, Klagsbrun M. Neuropilin-1 is expressed
by endothelial and tumor cells as an
isoform-specific receptor for vascular
endothelial growth factor. Cell 1998; 92:
735–45.
34. Boocock CA, Charnock-Jones DS, Sharkey
AM, McLaren J, Barker PJ, Wright KA,
Twentyman PR, Smith SK. Expression of
vascular endothelial growth factor and its
receptors flt and KDR in ovarian
carcinoma. J Natl Cancer Inst 1995;87:
506–16.
35. Masood R, Cai J, Zheng T, Smith DL,
Hinton DR, Gill PS. Vascular endothelial
growth factor (VEGF) is an autocrine
growth factor for VEGF receptor-positive
human tumors. Blood 2001;98:1904–13.
36. Dallas NA, Gray MJ, Xia L, Fan F, van
Buren G, II, Gaur P, Samuel S, Lim SJ,
Arumugam T, Ramachandran V, Wang H,
Ellis LM. Neuropilin-2-mediated tumor
growth and angiogenesis in pancreatic
adenocarcinoma. Clin Cancer Res 2008;14:
8052–60.
37. Kim KJ, Li B, Winer J, Armanini M, Gillett
N, Phillips HS, Ferrara N. Inhibition of
vascular endothelial growth factor-induced
angiogenesis suppresses tumor growth in
vivo. Nature 1993;362: 841–4.
38. Korsisaari N, Kasman IM, Forrest WF, Pal
N, Bai W, Fuh G, Peale FV, Smits R,
Ferrara N. Inhibition of VEGF-A prevents
the angiogenic switch and results in
increased survival of Apcþ/min mice. Proc
Natl Acad Sci U S A 2007;104:10625–30.
39. DuBois RN, McLane MW, Ryder K, Lau
LF, Nathans D. A growth factor-inducible
nuclear protein with a novel cysteine/
histidine repetitive sequence. J Biol Chem
1990;265:19185–91.
40. Lai WS, Stumpo DJ, Blackshear PJ. Rapid
insulin-stimulated accumulation of an
mRNA encoding a proline-rich protein. J
Biol Chem 1990;265:16556–63.
41. Varnum BC, Lim RW, Sukhatme VP,
Herschman HR. Nucleotide sequence of a
cDNA encoding TIS11, a message induced
in Swiss 3T3 cells by the tumor promoter
tetradecanoyl phorbol acetate. Oncogene
1989;4:119–20.
42. Carballo E, Lai WS, Blackshear PJ.
Feedback inhibition of macrophage tumor
necrosis factor-alpha production by
tristetraprolin. Science 1998;281:1001–5.
Cancer Cell Biology
Lee et al. 1827
Int. J. Cancer: 126, 1817–1827 (2010)
V
C
2009 UICC
Page 11
  • Source
    • "In addition, in contrast to the low level of endogenous expression of TTP, uPA and uPAR were expressed at higher levels in human glioma tissues compared with normal brain tissues (Fig. 1D ), indicating that TTP expression is inversely correlated with uPA and uPAR expression in human glioma tissues. TTP is an ARE-binding protein that induces decay of AREcontaining mRNAs (Lee et al., 2010a). Genes that contain AREs in their 3′UTR include growth factors and protooncogenes (c-fos, c-myc, and VEGF) (Bakheet et al., 2001) as well as invasion-associated genes (uPA, uPAR, and MMP-11) (Al-Souhibani et al., 2010). "
    [Show abstract] [Hide abstract] ABSTRACT: Urokinase plasminogen activator (uPA) and urokinase plasminogen activator receptor (uPAR) play a major role in the infiltrative growth of glioblastoma. Downregulatoion of the uPA and uPAR has been reported to inhibit the growth glioblastoma. Here, we demonstrate that tristetraprolin (TTP) inhibits the growth of U87MG human glioma cells through downregulation of uPA and uPAR. Our results show that expression level of TTP is inversely correlated with those of uPA and uPAR in human glioma cells and tissues. TTP binds to the AU-rich elements within the 3' untranslated regions of uPA and uPAR and overexpression of TTP decreased the expression of uPA and uPAR through enhancing the degradation of their mRNAs. In addition, overexpression of TTP inhibited the growth and invasion of U87MG cells. Our findings implicate that TTP can be used as a promising therapeutic target to treat human glioma.
    Full-text · Article · Dec 2014 · Moleculer Cells
  • Source
    • "Reduction in TTP compared to normal tissues has been observed in a number of tumours, including thyroid, lung, ovary, uterus, cervix, brain, head and neck and breast 17,33–35. We previously found that TTP restoration in MDA-MB-231 cells promotes the decay of uPA and uPAR, resulting in a decrease in the invasive capacity of these cells 1. TTP also has multiple important targets, including COX-2, HIF-1α, IL-8, IL-6, IL-8, and VEGF 34,36–40 and the oncogenic Ser/Th kinase Pim-1, which is overexpressed in several cancers and promotes cellular growth and apoptosis resistance 41,42. Thus, TTP appears to be a down-regulator of many cancer-related genes, which substantiates its anti-tumour role. "
    [Show abstract] [Hide abstract] ABSTRACT: The activities of RNA binding proteins are perturbed in several pathological conditions including cancer. These proteins include tristetraprolin (TTP, ZFP36) and HuR (ELAVL1) which respectively promote the decay or stability of AU-rich mRNAs. Here, we demonstrated that increased stabilization and subsequent over-expression of HuR mRNA were coupled to TTP deficiency. These findings were observed in breast cancer cell lines with an invasive phenotype and were further confirmed in ZFP36-knockout mouse fibroblasts. We show that TTP-HuR imbalance correlated with increased expression of ARE mRNAs that code for cancer invasion genes. The microRNA miR-29a was abundant in invasive breast cancer cells when compared to non-tumorigenic cell types. When normal breast cells were treated with miR-29a, HuR mRNA and protein expression were upregulated. MiR-29a recognized a seed target in the TTP 3'UTR and a cell-permeable miR-29a inhibitor increased TTP activity towards HuR 3'UTR. This led to HuR mRNA destabilization and restoration of the aberrant TTP-HuR axis. Subsequently, the cancer invasion factors, uPA, MMP-1 and MMP-13, and cell invasiveness were decreased. The TTP-HuR mRNA ratios were also perturbed in samples from invasive breast cancer patients when compared with normal tissues and were associated with invasion gene expression. This study demonstrates that an aberrant ARE-mediated pathway in invasive cancer can be normalized by targeting the aberrant and functionally coupled TTP-HuR axis, indicating a potential therapeutic approach.
    Full-text · Article · May 2013 · The Journal of Pathology
  • Source
    • "The pcDNA6/V5-TTP construct has been described previously [20]. Two oligonucleotides containing ATTTA motifs of the AHRR mRNA 3 0 UTR were synthesized at Integrated DNA Technologies (Coralville, IA). "
    [Show abstract] [Hide abstract] ABSTRACT: The aryl hydrocarbon receptor repressor (AHRR) inhibits the transcription of the aryl hydrocarbon receptor (AHR) by binding to XRE. We report that AHRR expression is inhibited by tristetraprolin (TTP), an AU-rich element (ARE)-binding protein. Overexpression of TTP decreased the mRNA stability and protein expression of AHRR, and TTP-overexpressing cells made smaller colonies than the control. Contrarily, inhibition of TTP by siRNA increased AHRR expression. Analyses of point mutants of the AREs demonstrated that AREs were responsible for the TTP-mediated destabilization of AHRR mRNA. RNA EMSA revealed that TTP directly binds to the AHRR 3'UTR. Taken together, we demonstrate that TTP acts as a negative regulator of AHRR and may affect tumor development through induction of tumor suppressor genes as observed in MDA-MB435.
    Full-text · Article · Apr 2013 · FEBS letters
Show more