Conference PaperPDF Available

Study of Biocompatibility of Titanium Alloys for Biomedical Application

Authors:

Abstract

Objective: to evaluate the biocompatibility of porous samples of five kinds of titanium alloys on osteoblast activity. The modification in composition and porosity confection in samples aimed at reducing the elasticity, rendering it closer to the bone elasticity modulus. Method: Five groups of porous samples were manufactured by powder metallurgy: 1) control - commercially pure titanium (TiCP); 2) Ti-6Al-4V alloy (titanium-aluminium-vanadium); 3) Ti-13Nb-13Zr alloy (titanium-niobium-zirconium); 4) Ti-35Nb alloy (niobium); 5) Ti-35Nb-7Zr-5Ta alloy titanium-niobium-zirconium-tantalum). Samples were characterized by scanning electron microscopy (SEM) and energy dispersion spectrophotometry (EDS). They were evaluated for cytotoxicity on rat calvaria osteogenic cells after 3 and 10 days, and nodules formation and quantification of mineralization after 14 days. Cells were cultivated on 18 samples of each group. Data were analyzed by ANOVA one way, ANOVA two ways and Tukey tests (p<0.05). Result: EDS detected presence of specific ions for each alloy and MEV showed an interconnected porous structure, demonstrating the effectiveness of the powder metallurgy technique. In vitro tests revealed similar biocompatibility among different alloys. Alizarin red analysis showed mineralized matrix formation similar in TiCP, Ti-35Nb-7Zr-5Ta, Ti-35Nb, and Ti-13Nb-13Zr. Ti-6Al-4V showed the significant highest value in this analysis. MTT assay demonstrated significant interaction between time and alloy by ANOVA two ways. Tukey test revealed that Ti-6Al-4V, at 10 days, showed lower cell viability when compared to the other groups at 3 days and similar viability when compared to other groups at 10 days. The results indicate that the alloys did not show cytotoxicity under static culture conditions, comparing to the standard alloy Ti-6Al-4V. This cytocompatibility was correlated with nodules of mineralization in all groups. Conclusion: porous TiCP, Ti-35Nb-7Zr-5Ta, Ti-35Nb, Ti-13Nb-13 Zr and Ti-6Al-4V alloys specimens induce favorable cellular response with mineralized matrix formation. These alloys are biocompatible and have great potential for employment in biomedical implants.
TISSUE ENGINEERING CONSTRUCTS AND CELL SUBSTRATES Original Research
Porous titanium and Ti–35Nb alloy: effects on gene expression
of osteoblastic cells derived from human alveolar bone
Renata Falchete do Prado
1
Sylvia Bicalho Rabe
ˆlo
1
Dennia Perez de Andrade
1
Rodrigo Dias Nascimento
1
Vinicius Andre
´Rodrigues Henriques
2
Yasmin Rodarte Carvalho
1
Carlos Alberto Alves Cairo
2
Luana Marotta Reis de Vasconcellos
1
Received: 2 June 2015 / Accepted: 26 September 2015 / Published online: 8 October 2015
ÓSpringer Science+Business Media New York 2015
Abstract Tests on titanium alloys that possess low elastic
modulus, corrosion resistance and minimal potential
toxicity are ongoing. This study aimed to evaluate the
behavior of human osteoblastic cells cultured on dense and
porous Titanium (Ti) samples comparing to dense and
porous Ti35 Niobium (Ti–35Nb) samples, using gene
expression analysis. Scanning electronic microscopy con-
firmed surface porosity and pore interconnectivity and
X-ray diffraction showed titanium beta-phase stabilization
in Ti–35Nb alloy. There were no differences in expression
of transforming growth factor-b, integrin-b1, alkaline
phosphatase, osteopontin, macrophage colony stimulating
factor, prostaglandin E synthase, and apolipoprotein E
regarding the type of alloy, porosity and experimental
period. The experimental period was a significant factor for
the markers: bone sialoprotein II and interleukin 6, with
expression increasing over time. Porosity diminished Runt-
related transcription factor-2 (Runx-2) expression. Cells
adhering to the Ti–35Nb alloy showed statistically similar
expression to those adhering to commercially pure Ti grade
II, for all the markers tested. In conclusion, the molecular
mechanisms of interaction between human osteoblasts
and the Ti–35Nb alloy follow the principal routes of
osseointegration of commercially pure Ti grade II. Porosity
impaired the route of transcription factor Runx-2.
1 Introduction
Titanium is a key biomaterial, applied in medical science,
presenting good mechanical properties and excellent bone-
contact biocompatility. Although its elastic modulus (110
GPa) [1] can cause ‘‘stress shielding’’ or ‘‘blinding’’, a
phenomenon resulting from the charge transfer resistance
of an implant into the surrounding bone. The Ti–6Al–4V
alloy is the most widely used in the manufacture of
implants [2]. The elastic modulus of this alloy (110114
GPa) is higher than the elastic modulus of bone [3,4],
causing stress shielding.
This phenomenon can cause bone resorption around
the implant and its eventual failure. Thus, in addition to
being biocompatible, bone replacement materials must
also be mechanically compatible [2,5,6]. To address
this, corrosion resistant; low modulus alloys, possessing
no toxic potential, have been widely developed since the
1990s [6,7].
One of the properties that determine the elastic modulus
of a material is the structural phase of the metal. At room
temperature, titanium occurs in aphase, with a compact
hexagonal crystal structure, which can be allotropically
transformed into the bphase, a body-centered cubic
structure. The addition of chemical elements to produce an
alloy aims to maintain the aor bphase, but despite this,
many titanium alloys exhibit both phases [1].
Among inert metals, niobium is the main stabilizer of
the bphase of titanium and when alloyed to it, between 10
and 20 % or 35–50 % weight, the alloy presents inferior
elastic modulus (less than 85 GPa) [8,9].
&Renata Falchete do Prado
renatafalchete@hotmail.com
1
Institute of Science and Technology, Sa
˜o Paulo State
University, Av. Engenheiro Francisco Jose
´Longo, 777,
Sa
˜o Jose
´dos Campos, Sa
˜o Paulo 12245-000, Brazil
2
Material Division, Air and Space Institute, General
Command of Aerospace Technology, Sa
˜o Jose
´dos Campos,
Prac¸a Mal. do Ar Eduardo Gomes, 14, Sa
˜o Jose
´dos Campos,
Sa
˜o Paulo 12904-000, Brazil
123
J Mater Sci: Mater Med (2015) 26:259
DOI 10.1007/s10856-015-5594-0
The titanium35 niobium (Ti35Nb) shows predomi-
nance of bphase, elastic modulus of approximately 80 GPa
and tensile strength of 600 MPa [10]. These properties,
together with its high bone-contact biocompatibility and
resistance to corrosion, characterize it as a material with
potential biomedical applications [11].
Composition, surface energy, roughness and topography
control the events at the bone-implant interface during
osseointegration [12,13]. It is known that greater bone
fixation occurs when the implant surface is rough or porous
compared with a smooth surface [14,15]. The osseointe-
gration of porous titanium is due to bone growth into the
pores, denominated ‘‘bone ingrowth’’ [15]. This results in
greater surface contact at the bone-implant interface,
leading to improved osseointegration [16].
However, little is known about the effects of topography
on the differentiation of bone precursor cells [17].
Topography can enhance osteoblast differentiation by
regulating transcription activity or gene regulation of key
osteogenic factors. This probably occurs due to the change
in shape of osteoblasts when these cells interact with the
implant surface microtopography [18]. To understand why
porous titanium implants promote better osseointegration,
studies that evaluate in vitro osteoblast responses can be
used [19].
In the present study, a Ti–35Nb alloy porous scaffold
was prepared, by powder metallurgy, through a space
holder sintering method. This is an useful technology for
the production of complicated shape such as interconnec-
tivity pores [16,20,21]. Thus, the purpose of this study
was to evaluate the in vitro behavior of human osteoblastic
cells cultured on dense and porous titanium scaffolds and
compare with dense and porous scaffold of titanium35
niobium alloy (Ti35Nb) by analyzing the gene expression.
The characterization of samples was performed using
scanning electron microscopy (SEM), energy dispersive
spectroscopy (EDS) and X-ray diffraction (XRD). The
mechanical property was analyzed by Young elastic
modulus.
2 Materials and methods
2.1 Sample fabrication
Five groups were delineated, as follows: Group 1-calibrator
(polystyrene plate well); Group 2-dense pure titanium
grade II samples; Group 3-porous pure titanium grade II
samples; Group 4-dense Ti–35Nb alloy samples; and
Group 5-porous Ti–35Nb alloy samples.
Elemental metal powder of pure Ti grade II with (purity
C99.5 %), was prepared by hydrogenation and dehydro-
genation (HDDH), and Nb (purity 99 %) powder was
obtained using the same route. The characteristics of the
powders used in the Ti–35Nb alloy preparation (previously
described Santos et al. 2008) were: Ti mean particle size
(lm) 3.28, Nb mean particle size (lm) 10.22, for both,
particle morphology was angular, the process for powder
production was hydriding, wherein Ti melting point was
1670 °C; Nb 2468 °C, and Ti hydriding temperature was
500 °C and Nb 800 °C. The samples were prepared by
powder metallurgy, developed at the Materials Division of
the Aeronautics and Space Institute (IAE) of the General
Command of Aerospace Technology, Sa
˜o Jose
´dos Cam-
pos, SP, Brazil.
The Ti–35Nb alloy was fabricated using the element-
powder sintering technique, proposed by Santos [10]. Ti
and Nb powders were used in a hydrogenated state by
adding hydrogen during the process, in order to activate
sintering and to reduce costs. The precursor powders were
weighed on an analytical balance to adjust the stoichiom-
etry of the alloy. The mixture was placed in a rotary agi-
tator, encased with titanium plates and filled with titanium
balls, for 30 min.
The samples were disc-shaped scaffolds, fabricated
using a steel mold: 12 mm in diameter and 5 mm in height.
For dense samples, the pure Ti grade II or Ti–35Nb powder
was inserted into the mold and the unit was subjected to
compaction in a uniaxial press (Carver Laboratory Press
Wabash, England) at 0.7 tons, and then cold compaction in
an isostatic press (Paul Weber Maschinen, Apparaebau
Fuhrbachstrabe Remshalden Grunbach) at 200 MPa. Next,
they were sintered in a vacuum oven (Thermal Technology,
California, USA) at 7.10 torr, with a heating rate of 10 °C/
min, reaching a threshold of 1200 °C for 1 h.
Porous samples were obtained mixing pure Ti grade II
powder or Ti–35Nb with an organic additive: urea,
(NH
2
)
2
CO (JT Baker Phillipsburg, USA), used as a spacer
with particles ranging from 177 to 250 lm. Following, the
powders were mixed for 1 h by a mechanical V mixer
(Treu Rio de Janeiro, Brazil). The samples were compacted
as per the dense samples. To remove the urea, the samples
were incubated in a vacuum oven (Marconi, Piracicaba,
Sa
˜o Paulo, Brazil), at 200 °C for 2 h. The temperature of
200 °C, used for evaporation of urea was based in previous
thermogravimetric analysis.
To clean the samples, they were immersed in neutral
detergent, distilled water, acetone and distilled water, each
one during 20 min in ultrasound. Then, samples were dry
in incubator and sterilized prior to contact with the cell
culture.
2.2 Samples characterization
SEM (Carl Zeiss, Brazil; Microanalysis Group, Oxford,
England) equipped with energy-dispersive spectrometer
259 Page 2 of 11 J Mater Sci: Mater Med (2015) 26:259
123
(EDS) (Oxford with Detector Model 7059) were used to
characterize the microtopography (surface morphology,
pore size and interconnectivity of the pores in the porous
sample) and elements present in samples.
Five randomly distributed fields on the surface of five
samples of each group were photographed at 9100 mag-
nification (25 fields per group). Image J (NHI) was used for
the metallographic analysis of the porous size. Data were
submitted to statistic test.
The structure was determined by XRD. Angle profiles
were recorded at a scan speed of 0.42°/s, using a diffrac-
tometer (PANalytical, Xpert, Pro MPD 3060).
The porosity (fraction of the pore volume obtained by
gravimetric analysis) of the porous samples was deter-
mined by Eq. [1] where qand q
s
represent the apparent
density of the sintered porous sample and the theoretical
density of solid metal, respectively.
Dense samples were measured and weighed, and based
upon the formula density =mass divided by the volume,
theoretical density was obtained for titanium =4.4 g/cm
3
and Ti–35Nb alloy =4.9 g/cm
3
. The apparent density of
the porous sample was determined from its weight and
dimensional measurements.
p¼½1q=qsx 100 %ð1Þ
2.3 Measurement of mechanical properties
on porous Ti–35Nb
Compressive strength was obtained by unidirectional
compression in three dense and three porous cylindrical
samples, of each material, using universal testing equip-
ment (810 Material Test System MTS Systems Corporation
Eden Prairie, MN, USA) at cross-head speed of 0.5 mm/
min. This test was performed using ASTM E09-09 stan-
dard. Young modulus [E] was acquired using the following
formula: E=r/e, were ris tensile stress and eis exten-
sional strain. The compression strength and elastic modulus
of samples (different materials, dense and porous) were
analyzed and compared.
2.4 Isolation of human osteoblastic cell
and development of osteogenic cultures
This study was approved by the Human Research Ethics
Committee of the Institute of Science and Technology, Sa
˜o
Paulo State University (UNESP)—Univ Estadual Paulista,
(029/2010-PH/CEP) and was conducted after donors
signed a term of free informed consent. All work was
conducted using material provided by three normal donors
who were submitted to surgeries in which bone fragments
were naturally removed. Donors were two men and one
woman. Mean aged at 40 years. Two had interradicular
septum removed after tooth extraction because of dental
caries and one donor had ridge regularization for implant
protocol.
Osteogenic cells were isolated by sequential enzymatic
digestion of fragments of human alveolar bone tissue with
collagenase type II (Gibco-Life), as previously described
[22,23]. Next, the bone explants were maintained in a
culture flask containing alpha modified minimum essential
medium (a-MEM), supplemented with 10 % fetal bovine
serum, 50 lg/mL gentamicin, 0.3 lg/mL of fungizone,
10
-7
M dexamethasone (Sigma), 5 mg/mL ascorbic acid
and 7 mM beta-glycerophosphate (Sigma), in a CO
2
chamber at 37 °C.
The medium was changed every 72 h for approximately
15 days, when cell confluence occurred. On the day of
plating, cells were enzymatically removed with a solution
containing 0.25 % trypsin, collagenase II and 1 mM
EDTA; counted in a Neubauer chamber and plated on the
sterile samples enclosed in 24-well polystyrene plates at a
density of 2 910
4
cells/well with same supplemented
medium above.
2.5 Selection of genes for the relative quantification
by reverse-transcriptase PCR in real time
The expression of the following genes was evaluated at 7
and 14 days. Profile of genes involved in osteogenesis
namely alkaline phosphatase (ALP), type I collagen,
osteopontin, osteocalcin, osteonectin and bone sialoprotein
(BSP) was analyzed. The signaling activity of transforming
growth factor-bis frequently manifested by the transcrip-
tion factor Runx-2, while Osterix play a key role down-
stream of Runx-2, which is associated with differentiation
of osteoblasts. Thus, their expressions were accessed.
Integrin and its associated molecules play one of the most
important roles in the interaction of cells with any sub-
stratum, so integrin b1 was evaluated.
Interleukin is predominantly activated in the acute
reaction phase and its high levels suggest early transplan-
tation—related complications and Prostaglandin E2 syn-
thase is involve in inflammatory response. Macrophage
Colony stimulating factor is related to reabsorption phe-
nomenon and apolipoprotein E blocks osteoclasts differ-
entiation, apparently having antagonistic effects. These
markers may be involved in implant loss.
2.6 Total RNA isolation and purification
Total RNA extraction was performed on cells adhering to
the Ti and Ti–35Nb scaffolds using TRIzol reagent
Ò
(Ambion Life Technologies Corp., Van Allen Way,
Carlsbad, CA, USA), in accordance with the manufac-
turer’s instructions. The concentration and purity of the
J Mater Sci: Mater Med (2015) 26:259 Page 3 of 11 259
123
RNA samples were determined by optical density in a
Nano Drop 2000 spectrophotometer (Thermo Fisher Sci-
entific Inc., Wilmington, DE, USA). Next, the quality and
integrity of the RNA was assessed by agarose gel
electrophoresis.
The biological triplicate (three bone donors) that came
into contact with samples from each group was used to
create an RNA pool. Thus, following the union of the
corresponding experimental groups, the RNA was quanti-
fied again prior to the next step.
RNA was purified by Deoxyribonuclease I, Amplifica-
tion Grade (Invitrogen, Life Technologies Corp., Van
Allen Way, Carlsbad, CA, USA), in accordance with the
manufacturer’s instructions.
2.7 cDNA synthesis and RT-PCR
Complementary deoxyribonucleic acid (cDNA) was syn-
thesized using 500 ng RNA through a reverse transcription
reaction using a high-capacity cDNA reverse transcription
kit (SuperScript
Ò
III First-Strand Synthesis SuperMix—
Invitrogen), according to the instructions of manufacturer.
cDNA was stored at -20 °C.
The cDNA was used in the Line-Gene K Real-Time
PCR Detection System (Bioer Technology Hi-tech, Bin-
jiang District, Hangzhou, People’s Republic of China), and
stained with the Platinum
Ò
SYBR
Ò
Green qPCR Super-
Mix-UDG system (Invitrogen). Specific primers and 2 lL
of cDNA were used in each reaction. The reactions were
performed in triplicate and the primers used are listed in
Table 1. The RT-PCR conditions were standardized using
melting and efficiency curves based on the suggestions of
the manufacturer of the SYBR
Ò
Green, and primer melting
temperatures using a calibrator sample. Efficiencies
between 85 and 105 % and correlation coefficients of 0.995
or greater were accepted.
The samples were submitted to RT-PCR for beta-actin,
HPRT1 and GAPDH. The site http://www.leonxie.com/
referencegene.php?type=reference# was accessed and
determined beta-actin as preferred reference gene accord-
ing DC
t
method, Normfinder and Genorm. Relative quan-
tification was performed according to Livak & Schmittgen
[24].
2.8 Statistical analysis
Statistical comparison of the porosity obtained by the
geometric method and by metallography was performed
using the Student t test. Gene expression of the key
osteoblast markers was compared using ANOVA up to-
three-way (time and alloy and porosity), followed by
complementary Turkey’s multiple comparison test when
appropriated. A value of P\0.05 was considered
significant.
3 Results
3.1 Structural analysis
After a vacuum high temperature sintering, both titanium
and titanium-niobium formed a structure with a rough
surface. The addition of urea to powder resulted in porous
structure with rough surface. Pore morphology, distribution
and interconnectivity were demonstrated in images
obtained by SEM. Pores of varying sizes were detected and
three-dimensional connectivity was observed between
them. In addition to large pores (macropores), under higher
magnification, the SEM images revealed the existence of
many micropores on the rough surfaces of the scaffolds.
EDS data showed that the main element for the groups
made of commercially pure Ti grade II was titanium
(strongest signal at 4.5 keV) and the samples made with the
Ti–35Nb alloy presented niobium (strongest signal at
2.2 keV) and titanium as main components.
Figure 1shows the XRD spectra of the sintered pure
grade II-Ti and Ti–35Nb alloys. All the sintered Ti–35Nb
alloy samples were composed of a-phase and b-phase,
while, only analysis by XRD performed on the sample of
pure titanium showed only the a-phase. In the samples of
Ti–35Nb, the primary b-phase peak is superimposed on the
a-phase peak in 2hequal to 38.4
o
. The identification of b-
phase (obtained from the dissolution of the Nb particles)
was confirmed by the isolated peak in 2hequal to 55.5
o
.
The majority of pores measured between 300 and
100 lm (mean of 193.85 lm). A statistical analysis
revealed that the porous pure Ti ranged between 76.50 and
534.72 lm (mean 226.46 lm), and porous Ti–35Nb
showed pore size between 38.98 and 387.11 lm (mean
161.23 lm), been statistically difference. The porous Ti
and Ti–35Nb samples showed mean of porosity of
33.79 ±1.69 and 54.5 ±5.4 %, respectively.
The mean of Young modulus obtained in Ti dense
samples was 47.71(±7.18) GPa. Titanium porous speci-
mens demonstrated elastic modulus of 18.30 (±8.05) GPa.
The value of elastic modulus of the dense and porous
titanium-niobium alloy was of 25.82 (±11.03) GPa and
6.44 (±1.62) GPa respectively. Groups were statistically
different with P\0.05.
3.2 Cell analysis
SEM analysis of scaffold after 7 and 14 days in cell culture
showed adhering cells to Ti and Ti–35Nb surfaces,
259 Page 4 of 11 J Mater Sci: Mater Med (2015) 26:259
123
including entering in macropores, with long and numerous
filopodia assuming star shape aspect.
3.3 Real-time qPCR
The expression of TGF-b, integrin-b1, ALP, osteopontin,
M-CSF, prostaglandin E2 synthase and apolipoprotein E
showed no statistically significant difference between
groups, independently of composition, topography and
time (Figs. 2,3,4).
The factor composition was insignificant, since cells
adhering to the Ti–35Nb alloy showed similar gene
expression to pure Ti grade II for all genes (Figs. 2,3,4).
However, collagen 1, Osteonectin, Osteocalcin and Osterix
showed variable expression between experimental groups
(Ti and Ti–35Nb) when comparing to calibrator group:
cells plated on polystyrene well (Fig. 2,3).
The factor topography, after tested by ANOVA showed
that porous groups showed significant reduced expression
of Runx-2 when compared to dense groups (Fig. 3).
Table 1 Description of the primers
Gene Primers sense/antisense Primer melting
temperature (°C)
Base
pairs
FASTA
PUBMED
References
Beta-actina AAACTGGAACGGTGAAGGTG 55.4 206 NM_001101.3
GTGGACTTGGGAGAGGACTG 57.1
GAPDH GAGTCAACGGATTTGGTCGT 52.5 201 NM_002046.6
TGGGATTTCCATTGATGAAC 48.7
HPRT TGCTCGAGATGTTGATGA 46.5 192 NM_000192.2
TCCCCTGTTGACTGGTCATT 52.5
Alkaline phosphatase CCACGTCTTCACATTTGGTG 54.2 196 NM_000478.4
AGACTGCGCCTGGTAGTTGT 58.8
Osteocalcin AGCAGAGCGACACCCTAGAC 57.5 194 NM_001199662.1
GGCAGCGAGGTAGTGAAGAG 58.8
Osteopontin AGACACATATGATGGCCGAGG 56.7 154 NM_001251830.1
GGCCTTGTATGCACCATTCAA 55.9
Bone sialoprotein II GCAGTAGTGACTCATCCGAAGAA 56.4 121 NM_004967.3
GCCTCAGAGTCTTCATCTTCATTC 55.2
Osteonectin ACTGGCTCAAGAACGTCCTGGT 60.7 97 NM_003118.3
TCATGGATCTTCTTCACCCGC 57.1
Collagen-1 ACAGCCGCTTCACCTACAGC 60.1 85 NM_000088.3
GTTTTGTATTCAATCACTGTCTTGCC 55.0
Runx2 GAACTGGGCCCTTTTTCAGA 55.3 208 NM_001015051
CACTCTGGCTTTGGGAAGAG 55.6
Osterix GCCATTCTGGGCTTGGGTATC 58.3 129 NM_001173467.1
GAAGCCGGAGTGCAGGTATCA 59.2
Prostaglandin E2 synthase GAAGAAGGCCTTTGCCAA 53.2 200 NM_004878.4
GGAAGACCAGGAAGTGCA 54.6
TFG-BTTTGATGTCACCGGAGTTGTG 55.4 63 NM_000660.4
GCGAAAGCCCTCAATTTCC 54.6
Integrin B-1 TTCTTCCTGGACTATTGAAAT 48.9 100 NM_002211.3
AGAAACTCTCATCATGCTCATT 51.9
Interleukin 6 CAATAACCACCCCTGAC 49.8 84 NM_000600.3
TTGTCATGTCCTGCAGCCACT 59.3
M-CSF GAGCTGCTTCACCAAGGATTATG 55.9 92 NM_172211.3
TCTTGACCTTCTCCAGCAACTG 56.9
Apolipoprotein E CACTGTCTGAGCAGGTGCAG 58.2 112 NM_000041.2
TCCAGTTCCGATTTGTAGGC 54.8
Sense and antisense sequences, their melting temperatures, the size of the amplified, and reference
J Mater Sci: Mater Med (2015) 26:259 Page 5 of 11 259
123
The factor time (7 or 14 days) was significant for the
markers BSP II (BSP II—Fig. 2) and interleukin 6 (Fig. 4).
Their expression increased over time.
4 Discussion
Titanium and its alloys are accepted in medical application
because provide high strength to weight ratios, good fati-
gue strength and increased corrosion resistance compared
with other materials [3]. However, in applied biomaterials
the surface features such as: chemical composition,
roughness, internal pore size and porosity also must be
considered [25]. These characteristics have direct effects
on osteoblast migration, attachment, proliferation and
osteoblastic differentiation [26].
This study demonstrated that Ti–35Nb is a suitable ma-
terial for biomedical applications, since genic data, cov-
ering differentiation, adhesion, inflammatory and cellular
signaling functions, was similar to gold standard: pure
titanium. Besides that, Ti–35Nb revealed advantageous
mechanical properties with lower Young elastic modulus,
regardless of the topography. The porosity diminished
elastic modulus, been a positive modification indepen-
dently material composition.
Material Young elastic modulus is a critical property in
longevity of endosseous loading implants [27]. This
mechanical property may be changed according composi-
tion of material [28] or topography containing pores [29].
In this study, the porosity indeed improved alloy property,
since Ti–35Nb alloy exhibited the lowest elastic modulus,
in line with previous study [25]. In the present study, the
average of elastic modulus in porous and dense Ti–35Nb
samples were comparable to that found in natural bone
10–20GPa [30]; this aspect results in more favorable local
mechanical environment between bone and implants [16].
The influence of the chemical composition of the
material in the elastic modulus is related to the stabilization
of the bphase of titanium, which can be obtained by the
addition of various metal elements such as niobium, tan-
talum and zirconium [31]. This property of Nb was
detected by XRD analysis results of this study. Moreover,
Ti–Nb alloys are considered viable alternatives being less
toxic than traditional alloy Ti–6Al–4V [32] with biocom-
patibility similar to commercially pure titanium [33], result
also found in this study according genic expression.
The porosity aim to mimic the natural bone [34] and
additionally decrease elastic modulus [29]. In vivo, pro-
motes tissue ingrowth [16] and in vitro, osteoblastic dif-
ferentiation [26]. The architecture of the porous surface can
be composed of isolated pores obtained by chemical
treatments [35] and sandblasting [36] or interconnected,
made by specific techniques, including the powder metal-
lurgy [16,25,29]. In powder metallurgy the interconnected
macropores can be obtained by the decomposition of urea
particles which were used as spacer. On the other hand, the
micropores were obtained by partial sintering of the metal
powders, but it also help to interconnect pores. The inter-
connectivity facilitates distribution of nutrients by neo-
formed blood vessels.
Porosity and pore diameter are important parameters in
biological porous materials [25]. However, there is no
consensus for optimal pore size and porosity [37,38]. In
this study the pore size ([100 lm) and the porosity, that
Fig. 1 X-ray diffraction. XRD patterns of pure Ti scaffolds obtained
by powder metallurgy after sintering at 1400 °C for 1 h, in which
only a-phase was detected and XRD patterns of Ti–35Nb scaffolds
obtained by powder metallurgy after sintering at 1400 °C for 1 h in
which a-phase (Ta) and b-phase (Tb) were detected
259 Page 6 of 11 J Mater Sci: Mater Med (2015) 26:259
123
ranged between materials, complied with requirements for
porous biomaterials implants [29,38], since their average
are considered appropriated to promote cell proliferation
[39]. Then, the porosity and pore size of experimental
samples produced in this study may be hopeful for the
ingrowth of new bone in vivo.
Several studies use different cell lines, for example
MG63 immortalized human osteossarcoma cells [40],
MC3T3E1 osteoblast like cells [27,33], saos-2 [38]to
assess osteoblast behavior or differentiation in contact to
titanium, and, most of them, reported better results in
experimental groups [surfaces modifications or alloys].
According, Cooper et al. [41] there is an incomplete pattern
of osteoblastic differentiation in immortalized cell lines,
justifying some divergent results obtained in this study.
Since in the present study, it was used a cell culture model
from human explants of alveolar bone, and in most of
analysis, there was no significant difference among the
Fig. 2 Data of molecular
analysis. Relative quantification
of alkaline phosphatase (ALP),
collagen I (Col I), osteopontin,
osteocalcin, osteonectin and
bone sialoprotein II (BSP) after
7 and 14 days of contact with
each group. Tukey test results
are seen in superscript letters
when any factor was significant
after ANOVA-three way
analysis. Error bar represents
standard deviation
J Mater Sci: Mater Med (2015) 26:259 Page 7 of 11 259
123
experimental groups, independently of chemical composi-
tion or topography surface. In line with this observation,
previous researchers using primary or subcultured cell also
did not found improved osteoblastic activity in experi-
mental Ti modified surfaces [42,43].
The expression of genes and proteins involved in bone
growth and repair are valuable markers for demonstrating
the osteoblast phenotype in vitro. Studies of variable
composition and surface topographies of new developed
material investigate gene expression of osteoblasts to prove
their biocompatibility [33,35,37,44].
Osteoblasts express encoding genes of bone matrix
proteins, ALP and parathormone receptors. Type I collagen
comprises of approximately 90 % of bone organic matrix.
Noncollagenous bone proteins comprise osteocalcin,
osteopontin, osteonectin and BSP. Together, these proteins
orchestrate calcium binding by regulating the deposition of
hydroxyapatite crystals, their arrangement and the size of
crystals perceived in the mineralized bone matrix [45].
During osteoblast differentiation and maturation, collagen
type I production and ALP enzymatic activity are followed
by the secretion of RGD glycoproteins (involved in the
ability of the extracellular protein to bind to integrin cell
surface receptors), such as BSP and osteopontin. Finally
the most specific marker of mature osteoblasts is syn-
thetized: osteocalcin [46]. In this study, Col I, ALP, inte-
grin, OP, BSP, osterix and OC showed, mostly of analysis,
similar gene expression patterns, independently of chemi-
cal composition or topography samples. Corroborating to
these observations, Ferraz et al. [42] did not observed
positive effect of modify Ti surfaces in gene expression of
key osteoblast markers, unlike of previous study that have
demonstrated difference in expression in some of these
genes on surfaces with different topography or composition
[33].
Runx-2 and osterix are the major osteoblast transcription
factors involved in osteoblast differentiation and bone
formation [35]. The Runx-2 expression was lower in most
of porous groups, however, statistically significant only
when comparing pure Ti, similar to previous data from
Pereira et al. 2013 [47] at 7 days of experiment. Previous
study [35,47] found conflicting results of Runx-2 level.
Thus, it is necessary to investigate the role of surface
topography on the expression of Runx 2.
Fig. 3 Data of molecular
analysis. Relative quantification
of transforming growth factor-b
(TGF-b), runt-related
transcription factor-2 (Runx-2),
osterix and integrin-b1 after 7
and 14 days of contact with
each group. Tukey test results
are seen in superscript letters
when any factor was significant
after ANOVA-three way
analysis. Error bar represents
Standard Deviation
259 Page 8 of 11 J Mater Sci: Mater Med (2015) 26:259
123
Osterix has correlation with integrin expression, since
osterix is a transcription factor involved in the metabolic
pathway of cell adhesion through integrins, maintaining
continual osteogenic differentiation, in contrast with
chondrogenic differentiation [18]. This correlation was
observed in this study indicating osteoblastic differentia-
tion. Integrin-b1 expression was similar in all groups as
observed by Sista et al. 2013 [33]. Additionally osterix and
osteocalcin, which is a marker of fully matured osteoblasts
[46], exhibited similar patterns of expression, both upreg-
ulated on dense Ti–35Nb samples, but without statically
difference with others groups. Literature presents con-
flicting results on the osteocalcin expression values in
control and experimental surfaces [33,42,47].
Osteonectin, osteopontin and bone sialoprotin are
specific markers of extracellular matrix in the period of
mineralization [45]. We analyzed gene expression of these
osteogenic markers and, in some comparisons; they
exhibited higher values in Ti–35Nb samples. Osteonectin
expression was higher in cells adhered to porous Ti–35Nb
and dense pure Ti when compared with the others groups,
but not statistically different. These results are similar to
those previously reported [33], in which the niobium alloy
group presented higher levels of osteonectin. Osteopontin
expression was more favorable in both Ti–35Nb samples,
at 14 days, and suggests a more mature osteoblastic phe-
notype in this samples, as noticed in previous articles [33,
48].
Interesting, Pereira et al. [47] and Sista et al. [33], also
observed early expression osteopontin in short time in
some samples, as we verified the expression higher at
7 days for porous Ti–35Nb samples when compared at
14 days. Pereira et al. [47] suggested that this early
enhanced extracellular osteopontin is because an enhanced
adsorption of the protein, and not because of a higher
osteoblastic activity.
The expression BSP showed a significant increase in
expression over the 14 days of culture for all groups,
suggesting that bone cells initiated the extracellular matrix
production for all surfaces tested. At 14 days the single
group with higher expression, similar to calibrator group
was the porous Ti–35Nb sample. This increase in BSP
expression was also observed in other studies [35,47]. On
the other hand, Sista et al. [33] observed a decrease in the
Fig. 4 Data of molecular
analysis. Relative quantification
of interleukin 6, prostaglandin
E2 synthase, macrophage
colony stimulating factor (M-
CSF) and apolipoprotein, after 7
and 14 days of contact with
each group. Tukey test results
are seen in superscript letters
when any factor was significant
after ANOVA-three way
analysis. Error bar represents
standard deviation
J Mater Sci: Mater Med (2015) 26:259 Page 9 of 11 259
123
expression of BSP over time. One hypothesis to explain
this divergence, is the different in cultured cells, since this
study, did not used immortalized cells, differing from that
used by Sista et al. [33]: the MC3T3 lineage.
In addition, to the osteogenic genes markers, Interleukin
6, TGF-B1, prostaglandin E2 synthase, apolipoprotein E
and M-CSF were assessed, since they are important in bone
metabolism. IL-6, a potent osteoclast activator [49]
increased significantly in the all experimental groups at
14 days. It is proposed that there was a differentiation of
osteoblastic cells in this period, acquiring attraction activ-
ity to osteoclasts.
Evidently, Ti–Nb alloy shows important potential as a
biomaterial once molecular data proves that Ti–35Nb alloy is
similar to commercially pure titanium. The results for all
groups were statistically similar, but numerically higher
values were observed for most samples in the Ti–35Nb alloy
groups, demonstrating that the chemical composition of the
experimental alloy is good for use in biological material.
Additionally the architecture of the porous biomaterials may
provide a favorable environment for cell growth [26]. This
characteristics associated with the best modulus of elasticity
presented by the alloy, both in dense and porous samples,
became it a promising material to surgery clinic.
5 Conclusions
The molecular mechanisms of interaction between human
osteoblasts and the titanium–35 niobium alloy follow the
principal routes of osseointegration of commercially pure
titanium, and the expression of key markers of cell adhe-
sion and differentiation indicates that the induction of bone
matrix synthesis was similar for both. The mechanical
properties such as the elastic modulus decrease with
chemical composition and porosity of material.
Acknowledgment The authors thank FAPESP [Sa
˜o Paulo State
Research Foundation] for the scholarship [PROC 2010/02778-0].
Compliance with ethical standards
Conflict of interest The authors declare no conflict of interest.
References
1. Callister WD, Rethwisch DG. Mechanical properties of metals.
Materials science and engineering: an introduction. 8th ed. Dan-
vers: Wiley; 2010.
2. Ning C, Ding D, Dai K, Zhai W, Chen L. The effect of Zr content
on the microstructure, mechanical properties and cell attachment
of Ti-35Nb-xZr alloys. Biomed Mater. 2010;5(4):045006.
3. Niinomi M. Mechanical properties of biomedical titanium alloys.
Mater Sci Eng A. 1998;243(1–2):231–6.
4. Dewidar MM, Yoon HC, Lim JK. Mechanical properties of
metals for biomedical applications using powder metallurgy
process: a review. Metal Mater Int. 2006;12(3):193–206.
5. Sumner DR, Galante JO. Determinants of stress shielding: design
versus materials versus interface. Clin Orthop Relat Res. 1992;
274:202–12.
6. Long M, Rack HJ. Titanium alloys in total joint replacement—a
materials science perspective. Biomaterials. 1998;19(18):
1621–39.
7. Niinomi M. Mechanical biocompatibilities of titanium alloys for
biomedical applications. J Mech Behav Biomed Mater. 2008;1(1):
30–42.
8. Khan MA, Williams RL, Williams DF. The corrosion behaviour
of Ti-6Al-4V, Ti-6Al-7Nb and Ti-13Nb-13Zr in protein solu-
tions. Biomaterials. 1999;20(7):631–7.
9. Davidson JA, Kovacs P, Davidson JA, et al. Biocompatible low
modulus titanium alloy for medical implants. United States of
America. 1992.
10. Santos DR, Pereira MS, Cairo CAA, Graca MLA, Henriques
VAR. Isochronal sintering of the blended elemental Ti-35Nb
alloy. Mater Sci Eng A. 2008;472(1–2):193–7.
11. Xiong J, Li Y, Hodgson PD, Wen C. In vitro osteoblast-like cell
proliferation on nano-hydroxyapatite coatings with different mor-
phologies on a titanium-niobium shape memory alloy. J Biomed
Mater Res A. 2010;95A(3):766–73.
12. Boyan BD, Hummert TW, Dean DD, Schwartz Z. Role of
material surfaces in regulating bone and cartilage cell response.
Biomaterials. 1996;17(2):137–46.
13. Brunski JB. In vivo bone response to biomechanical loading at
the bone/dental-implant interface. Adv Dent Res. 1999;13:
99–119.
14. Pilliar RM, Deporter DA, Watson PA, Todescan R. The endopore
implant-enhanced osseointegration with a sintered porous-sur-
faced design. Oral Health. 1998;88(7):61–4.
15. Deporter DA, Watson PA, Pilliar RM, Chipman ML, Valiquette
NA. Histological comparison in the dog of porous-coated vs
threaded dental implants. J Dent Res. 1990;69(5):1138–45.
16. Reis de Vasconcellos LM, Oliveira FN, Leite DO, et al. Novel
production method of porous surface Ti samples for biomedical
application. J Mater Sci Mater Med. 2012;23(2):357–64.
17. Dalby MJ, McCloy D, Robertson M, Wilkinson CDW, Oreffo
ROC. Osteoprogenitor response to defined topographies with
nanoscale depths. Biomaterials. 2006;27(8):1306–15.
18. Masaki C, Schneider GB, Zaharias R, Seabold D, Stanford C.
Effects of implant surface microtopography on osteoblast gene
expression. Clin Oral Implants Res. 2005;16(6):650–6.
19. Schwartz Z, Lohmann CH, Vocke AK, et al. Osteoblast response
to titanium surface roughness and 1a, 25-(OH) 2D3 is mediated
through the mitogen-activated protein kinase (MAPK) pathway.
J Biomed Mater Res. 2001;56(3):417–26.
20. Reis de Vasconcellos LM, Moreira Barbara MA, Deco CP, et al.
Healing of normal and osteopenic bone with titanium implant and
low-level laser therapy (GaAlAs): a histomorphometric study in
rats. Laser Med Sci. 2014;29(2):575–80.
21. Vasconcellos LMR, Carvalho YR, Prado RF, et al. Porous tita-
nium by powder metallurgy for biomedical application: charac-
terization, cell citotoxity and in vivo tests of osseointegration. In:
Hudak R, Penhaker M, Majernik J, editors. Biomedical engi-
neering: technical applications in medicine. 1st ed. Rijeka:
InTech; 2012. p. 47–74.
22. Mailhot JM, Borke JL. An isolation and in vitro culturing method
for human intraoral bone cells derived from dental implant
preparation sites. Clin Oral Implant Res. 1998;9(1):43–50.
23. Beloti MM, Martins W Jr, Xavier SP, Rosa AL. In vitro osteo-
genesis induced by cells derived from sites submitted to sinus
259 Page 10 of 11 J Mater Sci: Mater Med (2015) 26:259
123
grafting with anorganic bovine bone. Clin Oral Implant Res.
2008;19(1):48–54.
24. Livak KJ, Schmittgen TD. Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-Delta Delta
C(T)) Method. Methods. 2001;25(4):402–8.
25. Xu J, Weng X-J, Wang X, et al. Potential use of porous titanium-
niobium alloy in orthopedic implants: preparation and experi-
mental study of its biocompatibility in vitro. Plos One 2013;8(11).
26. Rosa AL, Crippa GE, de Oliveira PT, Taba M Jr, Lefebvre L-P,
Beloti MM. Human alveolar bone cell proliferation, expression of
osteoblastic phenotype, and matrix mineralization on porous
titanium produced by powder metallurgy. Clin Oral Implant Res.
2009;20(5):472–81.
27. Sista S, Wen C, Hodgson PD, Pande G. The influence of surface
energy of titanium-zirconium alloy on osteoblast cell functions
in vitro. J Biomed Mater Res A. 2011;97A(1):27–36.
28. Navarro M, Michiardi A, Castano O, Planell JA. Biomaterials in
orthopaedics. J R Soc Interface. 2008;5(27):1137–58.
29. Hsu HC, Hsu SK, Tsou HK, et al. Fabrication and characteriza-
tion of porous Ti-7.5Mo alloy scaffolds for biomedical applica-
tions. J Mater Sci Mater Med. 2013;24(3):645–57.
30. Choi K, Kuhn JL, Ciarelli MJ, Goldstein SA. The elastic moduli
of human subchondral, trabecular, and cortical bone tissue and
the size-dependency of cortical bone modulus. J Biomech.
1990;23(11):1103–13.
31. Elmay W, Prima F, Gloriant T, et al. Effects of thermomechanical
process on the microstructure and mechanical properties of a
fully martensitic titanium-based biomedical alloy. J Mech Behav
Biomed Mater. 2013;18:47–56.
32. Challa VS, Mali S, Misra RD. Reduced toxicity and superior
cellular response of preosteoblasts to Ti-6Al-7Nb alloy and
comparison with Ti-6Al-4V. J Biomed Mater Res A. 2013;101(7):
2083–9.
33. Sista S, Wen C, Hodgson PD, Pande G. Expression of cell
adhesion and differentiation related genes in MC3T3 osteoblasts
plated on titanium alloys: role of surface properties. Mater Sci
Eng C Mater Biol Appl. 2013;33(3):1573–82.
34. Lindner M, Bergmann C, Telle R, Fischer H. Calcium phosphate
scaffolds mimicking the gradient architecture of native long
bones. J Biomed Mater Res A. 2014;102(10):3677–84.
35. Isaac J, Galtayries A, Kizuki T, Kokubo T, Berda A, Sautier JM.
Bioengineered titanium surfaces affect the gene-expression and
phenotypic response of osteoprogenitor cells derived from mouse
calvarial bones. Eur Cell Mater. 2010;20:178–96.
36. Kumar A, Bhat V, Balakrishnan M, et al. Bioactivity and surface
characteristics of titanium implants following various surface
treatments: an in vitro study. J Oral Implant. 2014. doi:10.1563/
aaid-joi-D-13-00292.
37. Teixeira LN, Crippa GE, Lefebvre LP, et al. The influence of
pore size on osteoblast phenotype expression in cultures grown
on porous titanium. Int J Oral Maxillofac Surg. 2012;41(9):
1097–101.
38. Caparros C, Guillem-Marti J, Molmeneu M, et al. Mechanical
properties and in vitro biological response to porous titanium
alloys prepared for use in intervertebral implants. J Mech Behav
Biomed Mater. 2014;39:79–86.
39. Takemoto M, Fujibayashi S, Neo M, et al. Mechanical properties
and osteoconductivity of porous bioactive titanium. Biomaterials.
2005;26(30):6014–23.
40. Carinci F, Pezzetti F, Volinia S, et al. Analysis of MG63
osteoblastic-cell response to a new nanoporous implant surface
by means of a microarray technology. Clin Oral Implant Res.
2004;15(2):180–6.
41. Cooper LF, Masuda T, Yliheikkila PK, Felton DA. Generaliza-
tions regarding the process and phenomenon of osseointegration.
Part II. In vitro studies. Int J Oral Maxillofac Implant. 1998;13(2):
163–74.
42. Ferraz EP, Sa JC, de Oliveira PT, et al. The effect of plasma-
nitrided titanium surfaces on osteoblastic cell adhesion, prolif-
eration, and differentiation. J Biomed Mater Res A. 2014;102(4):
991–8.
43. Capellato P, Smith BS, Popat KC, Alves Claro APR. Fibroblast
functionality on novel Ti-30Ta nanotube array. Mater Sci Eng C
Mater Biol Appl. 2012;32(7):2060–7.
44. Hofstetter W, Sehr H, de Wild M, et al. Modulation of human
osteoblasts by metal surface chemistry. J Biomed Mater Res A.
2013;101(8):2355–64.
45. Hughes FJ, Turner W, Belibasakis G, Martuscelli G. Effects of
growth factors and cytokines on osteoblast differentiation. Peri-
odontology. 2000;2006(41):48–72.
46. Hu Y, Tang XX, He HY. Gene expression during induced dif-
ferentiation of sheep bone marrow mesenchymal stem cells into
osteoblasts. Genet Mol Res. 2013;12:6527–34.
47. Pereira KK, Alves OC, Novaes AB, et al. Progression of osteo-
genic cell cultures grown on microtopographic titanium coated
with calcium phosphate and functionalized with a type I collagen-
derived peptide. J Periodontol. 2013;84(8):1199–210.
48. de Oliveira PT, Nanci A. Nanotexturing of titanium-based sur-
faces upregulates expression of bone sialoprotein and osteopontin
by cultured osteogenic cells. Biomaterials. 2004;25(3):403–13.
49. Haynes DR, Rogers SD, Hay S, Pearcy MJ, Howie DW. The
differences in toxicity and release of bone-resorbing mediators
induced by titanium and cobalt-chromium-alloy wear particles.
J Bone Joint Surg Am. 1993;75(6):825–34.
J Mater Sci: Mater Med (2015) 26:259 Page 11 of 11 259
123
ResearchGate has not been able to resolve any citations for this publication.
Article
Full-text available
Abstract This study compared the surface topography, hydrophilicity and bioactivity of titanium implants after three different surface treatments (sandblasting and acid etching, modified sandblasting and acid etching and thermal oxidation) with those of machined implants. One hundred indigenously manufactured threaded titanium implants were subjected to three methods of surface treatment. The surface roughness of the non-treated (Group A) and treated samples (Groups B, C, D) was evaluated with a scanning electron microscope (SEM) and profilometer. The wettability was visually examined using a colored dye solution. The calcium ions attached to the implant surface after immersing in simulated body fluid (SBF) were assessed on days 1, 2 and 7 with an atomic electron spectroscope. The data were analyzed statistically. The SBF test allowed the precipitation of a calcium phosphate layer on all surface-treated samples, as evident in the SEM analysis. A significantly higher amount of calcium ions and increased wettability were achieved in the thermally oxidized samples. The mean roughness was significantly lower in group A (0.85± 0.07) compared to group B (1.35± 0.17), group C (1.40± 0.14) and group D (1.36± 0.18). The observations from this in vitro study indicated that surface treatment of titanium improved the bioactivity. Moreover, it has been identified that the implants that were sandblasted, acid etched and then oxidized attracted more calcium ions.
Article
Full-text available
The improvement of bone ingrowth into prosthesis and enhancement of the combination of the range between the bone and prosthesis are important for long-term stability of artificial joints. They are the focus of research on uncemented artificial joints. Porous materials can be of potential use to solve these problems. This research aims to observe the characteristics of the new porous Ti-25Nb alloy and its biocompatibility in vitro, and to provide basic experimental evidence for the development of new porous prostheses or bone implants for bone tissue regeneration. The Ti-25Nb alloys with different porosities were fabricated using powder metallurgy. The alloys were then evaluated based on several characteristics, such as mechanical properties, purity, pore size, and porosity. To evaluate biocompatibility, the specimens were subjected to methylthiazol tetrazolium (MTT) colorimetric assay, cell adhesion and proliferation assay using acridine staining, scanning electron microscopy, and detection of inflammation factor interleukin-6 (IL-6). The porous Ti-25Nb alloy with interconnected pores had a pore size of 200 µm to 500 µm, which was favorable for bone ingrowth. The compressive strength of the alloy was similar to that of cortical bone, while with the elastic modulus closer to cancellous bone. MTT assay showed that the alloy had no adverse reaction to rabbit bone marrow mesenchymal stem cells, with a toxicity level of 0 to 1. Cell adhesion and proliferation experiments showed excellent cell growth on the surface and inside the pores of the alloy. According to the IL-6 levels, the alloy did not cause any obvious inflammatory response. All porous Ti-25Nb alloys showed good biocompatibility regardless of the percentage of porosity. The basic requirement of clinical orthopedic implants was satisfied, which made the alloy a good prospect for biomedical application. The alloy with 70% porosity had the optimum mechanical properties, as well as suitable pore size and porosity, which allowed more bone ingrowth.
Article
Full-text available
In this study, the mechanical substrate and topographical surface properties of anodized Ti30Ta alloy were investigated using scanning electron microscopy (SEM), energy-dispersive spectroscopy (EDS) and contact angle measurement. The anodization process was performed in an electrolyte solution containing HF (48%) and H2SO4 (98%) in the volumetric ratios 1:9 with the addition of 5% dimethyl sulfoxide (DMSO) at 15 V, 25 V and 35 V for 20 and 40 min, producing a nanotube architecture when anodized at 35 V for 40 min. Human dermal fibroblasts (HDF, neonatal) were utilized to evaluate the biocompatibility of Ti30Ta nanotubes and Ti30Ta alloy after 1 and 3 days of culture. Cellular adhesion, proliferation, viability, cytoskeletal organization and morphology were investigated using fluorescence microscope imaging, biochemical assay and SEM imaging respectively. The results presented identify altered material properties and improved cellular interaction on Ti30Ta nanotubes as compared to Ti30 Ta alloy.
Article
Titanium porous implants with interconnected porous structure were successfully prepared by powder metallurgy techniques by using grounded HDH titanium powder. Porous size and porosity can be controlled by space material characteristics prior to powder mixture. The porous structure enhances the bone formation, ingrowth and the implant displacement resistance. Dense core with integrated porous surface titanium implants were manufactured by one step compacting method seems to be a promising approach for bone tissue engineering. The implant porous region behaviors like a titanium/bone composite in order to accommodate the tensions due the mismatch of elastic modulus. Despite the conflicting results, the hydroxyapatite coating through biomimetic treatment merits further study because of the improved osseointegration obtained in vivo.
Article
The generation of titanium foams is a promising strategy for modifying the mechanical properties of intervertebral reinforcements. Thus, the aim of this study was to compare the in vitro biological response of Ti6Al4V alloys with different pore sizes for use in intervertebral implants in terms of the adhesion, proliferation, and differentiation of pre-osteoblastic cells. We studied the production of Ti6Al4V foams by powder metallurgy and the biological responses to Ti6Al4V foams were assessed in terms of different pore interconnectivities and elastic moduli. The Ti6Al4V foams obtained had similar porosities of approximately 34%, but different pore sizes (66 µm for fine Ti6Al4V and 147 µm for coarse Ti6Al4V) due to the sizes of the microsphere used. The Ti6Al4V foams had a slightly higher Young׳s modulus compared with cancellous bone. The dynamic mechanical properties of the Ti6Al4V foams were slightly low, but these materials can satisfy the requirements for intervertebral prosthesis applications. The cultured cells colonized both sizes of microspheres near the pore spaces, where they occupied almost the entire area of the microspheres when the final cell culture time was reached. No statistical differences in cell proliferation were observed; however, the cells filled the pores on fine Ti6Al4V foams but they only colonized the superficial microspheres, whereas the cells did not fill the pores on coarse Ti6Al4V foams but they were distributed throughout most of the material. In addition, the microspheres with wide pores (coarse Ti6Al4V) stimulated higher osteoblast differentiation, as demonstrated by the Alcaline Phosphatase (ALP) activity. Our in vitro results suggest that foams with wide pore facilitate internal cell colonization and stimulate osteoblast differentiation.
Article
The aim of this study was to observe the dynamic expression of osteopontin, type I collagen, and osteocalcin genes during the differentiation of bone marrow mesenchymal stem cells (BMSCs) into osteoblasts and confirm whether BMSCs can differentiate and mature into osteoblasts. A healthy, 2-month-old Altay tailed sheep was obtained, and 10 mL bone marrow was extracted from the posterior superior iliac spine of the sheep via puncture. Sheep BMSCs were extracted using a whole bone marrow culture method and cultured for osteogenic induction. Total RNA from the BMSCs was extracted, and the gene expression levels of osteopontin, type I collagen, and osteocalcin at the 1st, 2nd, 3rd, and 4th passages of uninduced and induced BMSCs were detected using reverse transcription-polymerase chain reaction. The surface antigen CD44 was also detected in the BMSCs. After induction by culturing in osteoinductive medium, BMSCs in the 1st, 2nd, 3rd, and 4th passages displayed stage-specific expression of osteopontin, type I collagen, and osteocalcin genes. The positive expression rate of BMSC-specific antigen CD44 in the 4th passage of osteogenic-induced BMSCs was 99.8%. In vitro-cultured sheep BMSCs in osteogenic culture medium gradually differentiated into osteoblasts, which stage-specifically expressed osteoblast-specific genes such as osteopontin, type I collagen, and osteocalcin at the 4th passage after induction. At this passage, these cells had osteoblast functions.
Article
The synthesis of beta-tricalcium phosphate (β-TCP) scaffolds offering both the macroporous inner structure required for proper in vivo degradation and a non-macroporous outer structure for the enhancement of mechanical properties continues to be a challenge. The hypothesis of this study was to realize biomimetic β-TCP scaffolds with a macroporous inner structure and a compact outer structure using a lost wax casting technique. The porosity, macropore size, interconnectivity of the inner porous structure, and diameter of the outer compact structure were adjusted to specific values using a three-dimensional wax printer to manufacture the wax molds for the casting process. After the slip casting, the wax was pyrolyzed and the specimens were sintered. The resulting graded β-TCP scaffolds (porous + compact) were characterized and compared with β-TCP scaffolds with overall apparent macropores (only porous) and samples without macropores (only compact). The porosity and the compressive strength of the only compact, porous + compact, and only porous β-TCP samples were 31.4 ± 0.4 vol %, 55.6 ± 0.9 vol %, and 66.9 ± 0.4 vol % and 192 ± 7 MPa, 36 ± 2 MPa, and 9 ± 1 MPa, respectively. The macropore size was 500 µm and the micropore size was up to 10 µm, both featuring a completely open porous structure. From these results, we conclude that the lost wax casting technique offers an excellent method for the fabrication of β-TCP scaffolds with an inner macroporous structure and compact outer structure which mimics the cancellous and cortical structure of natural bone. © 2013 Wiley Periodicals, Inc. J Biomed Mater Res Part A: A: 1-8, 2013.
Article
When osteoblasts are cultured on surfaces of increasing microroughness, they exhibit decreases in proliferation, increases in differentiation and local factor production, and enhanced response to 1α,25(OH)2D3. The cells interact with surfaces through integrins, which signal by the same pathways used by 1α,25(OH)2D3, including protein kinase C via phospholipase C and protein kinase A via phospholipase A2. This provides opportunities for crosstalk that may contribute to the synergistic effects of surface roughness and the vitamin D metabolite. Because these pathways converge at mitogen-activated protein kinase (MAPK), we tested the hypothesis that the extracellular signal-regulated kinase (ERK1/2) subclass of MAPKs mediates the effects of surface roughness and 1α,25(OH)2D3. MG63 osteoblast-like osteosarcoma cells were cultured on commercially pure Ti disks with various surface roughnesses: pretreatment (PT; 0.6 μm average roughness [Ra]), coarse grit-blasted and acid-etched (SLA; 4 μm RA), and titanium plasma-sprayed (TPS; 5.2-μm Ra). At confluence, cells were treated for 24 h with control media or media containing 10−7M 1α,25(OH)2D3. One-half of the cultures received 1 μM or 10 μM PD98059, a specific inhibitor of the ERK family of MAPKs. PD98059 alone did not affect proliferation, osteocalcin production, or production of transforming growth factor-β1 or nitric oxide, regardless of the surface roughness. Alkaline phosphatase was reduced by the inhibition of the ERK family kinases on all surfaces to a comparable extent. However, when PD98059 was added to the cultures with 1α,25(OH)2D3, the effects of the seco-steroid were blocked, including the synergistic increases seen in MG63 cells cultured on SLA or TPS. These results indicate that ERK1/2 MAPK is required for the maintenance of alkaline phosphatase at control levels and that the effects of 1α,25(OH)2D3 are mediated by ERK1/2. However, the effects of surface roughness are not due to the ERK family of MAPKs. This suggests that alternative pathways may be used, including those mediated by other MAPK subclasses. © 2001 John Wiley & Sons, Inc. J Biomed Mater Res 56: 417–426, 2001