Impaired Balance of Mitochondrial Fission and Fusion in Alzheimer's Disease

Department of Pathology, Case Western Reserve University, Cleveland, Ohio 44106, USA.
The Journal of Neuroscience : The Official Journal of the Society for Neuroscience (Impact Factor: 6.34). 08/2009; 29(28):9090-103. DOI: 10.1523/JNEUROSCI.1357-09.2009
Source: PubMed
ABSTRACT
Mitochondrial dysfunction is a prominent feature of Alzheimer's disease (AD) neurons. In this study, we explored the involvement of an abnormal mitochondrial dynamics by investigating the changes in the expression of mitochondrial fission and fusion proteins in AD brain and the potential cause and consequence of these changes in neuronal cells. We found that mitochondria were redistributed away from axons in the pyramidal neurons of AD brain. Immunoblot analysis revealed that levels of DLP1 (also referred to as Drp1), OPA1, Mfn1, and Mfn2 were significantly reduced whereas levels of Fis1 were significantly increased in AD. Despite their differential effects on mitochondrial morphology, manipulations of these mitochondrial fission and fusion proteins in neuronal cells to mimic their expressional changes in AD caused a similar abnormal mitochondrial distribution pattern, such that mitochondrial density was reduced in the cell periphery of M17 cells or neuronal process of primary neurons and correlated with reduced spine density in the neurite. Interestingly, oligomeric amyloid-beta-derived diffusible ligands (ADDLs) caused mitochondrial fragmentation and reduced mitochondrial density in neuronal processes. More importantly, ADDL-induced synaptic change (i.e., loss of dendritic spine and postsynaptic density protein 95 puncta) correlated with abnormal mitochondrial distribution. DLP1 overexpression, likely through repopulation of neuronal processes with mitochondria, prevented ADDL-induced synaptic loss, suggesting that abnormal mitochondrial dynamics plays an important role in ADDL-induced synaptic abnormalities. Based on these findings, we suggest that an altered balance in mitochondrial fission and fusion is likely an important mechanism leading to mitochondrial and neuronal dysfunction in AD brain.

Full-text

Available from: bo su, Aug 20, 2014
Cellular/Molecular
Impaired Balance of Mitochondrial Fission and Fusion in
Alzheimer’s Disease
Xinglong Wang,
1
Bo Su,
1
Hyoung-gon Lee,
1
Xinyi Li,
1
George Perry,
1,2
Mark A. Smith,
1
and Xiongwei Zhu
1
1
Department of Pathology, Case Western Reserve University, Cleveland, Ohio 44106, and
2
College of Sciences, University of Texas at San Antonio, San Antonio,
Texas 78249
Mitochondrial dysfunction is a prominent feature of Alzheimer’s disease (AD) neurons. In this study, we explored the involvement of an
abnormal mitochondrial dynamics by investigating the changes in the expression of mitochondrial fission and fusion proteins in AD
brain and the potential cause and consequence of these changes in neuronal cells. We found that mitochondria were redistributed away
from axons in the pyramidal neurons of AD brain. Immunoblot analysis revealed that levels of DLP1 (also referred to as Drp1), OPA1,
Mfn1, and Mfn2 were significantly reduced whereas levels of Fis1 were significantly increased in AD. Despite their differential effects on
mitochondrial morphology, manipulations of these mitochondrial fission and fusion proteins in neuronal cells to mimic their expres-
sional changes in AD caused a similar abnormal mitochondrial distribution pattern, such that mitochondrial density was reduced in the
cell peripheryof M17 cells or neuronal process of primary neurons and correlated with reduced spine density in the neurite. Interestingly,
oligomeric amyloid-
-derived diffusible ligands (ADDLs) caused mitochondrial fragmentation and reduced mitochondrial density in
neuronal processes. More importantly, ADDL-induced synaptic change (i.e., loss of dendritic spine and postsynaptic density protein 95
puncta) correlated with abnormal mitochondrial distribution. DLP1 overexpression, likely through repopulation of neuronal processes
with mitochondria, prevented ADDL-induced synaptic loss, suggesting that abnormal mitochondrial dynamics plays an important role
in ADDL-induced synaptic abnormalities. Based on these findings, we suggest that an altered balance in mitochondrial fission and fusion
is likely an important mechanism leading to mitochondrial and neuronal dysfunction in AD brain.
Introduction
Characterized by neurofibrillary tangles, senile plaques, and pro-
gressive loss of neuronal cells in selective brain regions, Alzhei-
mer’s disease (AD) is a fatal degenerative dementia with initial
memory impairment that progresses to a total debilitating loss of
mental and physical faculties (Smith, 1998). Evidence suggests
that memory failure in AD is a result of synaptic loss and, among
all the early changes that occur in AD, is a robust correlate of
AD-associated cognitive deficits, leading to the notion that syn-
aptic dysfunction plays a critical role in the pathogenesis of AD
(DeKosky and Scheff, 1990; Terry et al., 1991; Coleman et al.,
2004). A myriad of studies have focused on the central role of
amyloid-
(A
) in the pathogenesis and progression of AD. A
oligomers may bind to dendritic spines, causing synaptic dys-
function (Lacor et al., 2004); however, the molecular mechanism
remains elusive.
In mammals, mitochondria are vital organelles known for
their essential role in energy metabolism and cell survival (Delet-
tre et al., 2000; Benard et al., 2007). Neurons are particularly
vulnerable to mitochondrial dysfunction because of their high
metabolic rate dependence and complex morphology (Delettre et
al., 2000; Benard et al., 2007). More specifically, mitochondria are
of pivotal importance for synaptic development and plasticity,
and changes in mitochondria distribution and/or function can
result in synaptic dysfunction and loss (Li et al., 2004; Verstreken
et al., 2005). Notably, whereas defects in mitochondrial function
are a prominent early event in AD (Blass et al., 2000; Swerdlow
and Kish, 2002; Zhu et al., 2004; Bubber et al., 2005), whether and
how mitochondrial defects contribute to synaptic dysfunction in
AD neurons is unclear.
Emerging evidence suggests that mitochondria are dynamic
organelles undergoing constant fission and fusion regulated by a
machinery involving large dynamin-related GTPases (Chan,
2006). Mitochondrial dynamics not only determines mitochon-
drial morphology and size, but also regulates mitochondrial dis-
tribution and function (Chan, 2006). Given the critical role of
mitochondria in neurons, impaired mitochondrial dynamics is
increasingly implicated in neurodegenerative diseases including
Parkinson and Huntington diseases (Exner et al., 2007; Deng et
al., 2008; Mortiboys et al., 2008; Poole et al., 2008; Yang et al.,
2008; Park et al., 2009; Wang et al., 2009). In relation to AD, A
caused rapid and severe impairment of mitochondrial transport
(Rui et al., 2006). More recently, we demonstrated an abnormal
mitochondrial morphology and distribution in AD fibroblasts
compared with normal healthy fibroblasts from age-matched
controls (Wang et al., 2008a) and found that amyloid-
protein
precursor (A
PP) overexpression, through A
overproduction,
caused abnormal mitochondrial dynamics in neurons (Wang et
al., 2008b). In this study, we aimed to determine whether an
Received March 20, 2009; revised May 6, 2009; accepted June 11, 2009.
This study is supported by the National Institutes of Health (AG031852) and the Alzheimer’s Association
(IIRG-07-60196).
Correspondence should be addressed to Dr. Xiongwei Zhu, Department of Pathology, Case Western Reserve
University, 2103 Cornell Road, Cleveland, OH 44106. E-mail: xiongwei.zhu@case.edu.
DOI:10.1523/JNEUROSCI.1357-09.2009
Copyright © 2009 Society for Neuroscience 0270-6474/09/299090-14$15.00/0
9090 The Journal of Neuroscience, July 15, 2009 29(28):9090 –9103
Page 1
imbalance in mitochondrial fission and fusion occurs in vivo in
AD neurons by exploring the expression of mitochondrial fis-
sion/fusion proteins [i.e., DLP1 (also referred to as Drp1), Fis1,
OPA1 and Mfn1/2] in AD brain and identifying the potential
cause and consequence of changes in these proteins related to
mitochondrial dynamics and synaptic function.
Materials and Methods
Cell culture and transfection. The human neuroblastoma cell line, M17,
was grown in Opti-MEM medium (Invitrogen), supplemented with 5%
or 10% (v/v) fetal bovine serum and 1% penicillin–streptomycin, in 5%
CO
2
in a humid incubator at 37°C. Cells were transfected using Effectene
(Qiagen) according to the manufacturer’s instructions. For cotransfec-
tion, a 3:1 ratio (indicated plasmid: Mito-DsRed2) was applied. Regular
culture medium containing 300
g/ml Geneticin (Invitrogen), 20
g/ml
Blasticidin (Invitrogen), or 150
g/ml of hygromycin B (Calbiochem)
was used for stable cell line selection. The selective medium was replaced
every 3 d until the appearance of foci, each apparently derived from a
single stably transfected cell. Stable cell lines were then picked and main-
tained with 100
g/ml Geneticin, 5
g/ml Blasticidin, or 30
g/ml
hygromycin. Primary neurons from embryonic day 18 (E18) rat hip-
pocampus (BrainBits) were seeded at 30,000 40,000 cells per well on
eight-well chamber slides coated with poly-
D-lysine/laminin (BD Bio-
sciences) in neurobasal medium supplemented with 2% B27 (Invitro-
gen)/0.5 m
M glutamine/25 mM glutamate. One-half of the culture
medium was changed every 3 d with neurobasal medium supplemented
with 2% B27 (Invitrogen) and 0.5 m
M glutamine. All cultures were kept
at 37°C in a humidified 5% CO
2
-containing atmosphere. More than 90%
of the cells were neurons after they were cultured for 7–17 d of culture in
vitro (DIV), which was verified by positive staining for the neuronal
specific markers microtubule-associated protein-2 (MAP2, dendritic
marker) and Tau-1 (axonal marker). At DIV 7–12, neurons were transfected
using Neurofect (Genlantis) according to the manufacturer’s protocol.
Expression vectors and antibodies. Mito-DsRed2 construct (Clontech),
green fluorescent protein (GFP)-tagged wild-type DLP1 (DLP1wt), mu-
tant DLP1 K38A and Fis1 constructs (gifts from Dr. Yisang Yoon,
University of Rochester, Rochester, NY), yellow fluorescent protein
(YFP)-tagged postsynaptic density protein 95 (PSD-95) (gift from Dr.
Ann Marie Craig, University of British Columbia, Vancouver, British
Columbia, Canada), and wild-type OPA1 (OPA1wt) and mutant OPA1
K301A constructs (gifts from Dr. Luca Scorrano, Venetian Institute of
Molecular Medicine, Venice, Italy) were obtained. The expression plas-
mids for Myc-tagged wild-type DLP1/DLP1 K38A were constructed
based on the pCMV-Tag3 vector (Stratagene), whereas Myc/GFP-tagged
wild-type OPA1/OPA1 K301A was based on pCMV-Tag vector (Strat-
agene) and pcDNA3.1 (Invitrogen), respectively. The micro-RNA (miR)
RNA interference (RNAi) vector was generated via the pcDNA 6.2-GW/
EmGFP-miR construct (Invitrogen). The miR RNAi sequence targeting
the open reading frame region of human or rat mitochondrial fission or
fusion proteins are as follows: human OPA1 (ATCACTTGCAAGATA-
AGCTGG), rat OPA1 (GCGCAGTATTGTTACAGACTT), human
Mfn2 (CTCCTTAGCAGACACAAAGAA), rat Mfn2 (GCTGGA-
CAGCTGGATTGATAA), human Mfn1 (ATTTCTTCCCATACCATC-
CTC), rat Mfn1 (GCAAACAAGGTTTCTTGTGCA), human Fis1 (TTACG-
GATGTCATCATTGTAC), and rat Fis1 (TGGTGCCTGGTTCGAAGCAAA).
miR RNAi construct targeting both human and rat DLP1 was described as pre-
viously (Wang et al., 2008a). Primary antibodies used included mouse anti-
DLP1/OPA1 (BD Biosciences), mouse anti-Mfn1 (Novus Biologicals), mouse
anti-Mfn2/cytochrome c oxidase subunit 1 (COX I) (Sigma), rabbit anti-Fis1
(Imgenex), mouse anti-glyceraldehyde-3-phosphate dehydrogenase (anti-
GAPDH) (Chemicon), rabbit anti-
-tubulin (Epitomics), rabbit anti-
phospho-DLP1 (Ser616) (Cell Signaling), and mouse anti-
-tubulin/Myc/
COX IV (Cell Signaling).
Immunocytochemical procedures. Hippocampal, frontal cortical, and
cerebellar brain tissue obtained postmortem was fixed and consecutive
6-
m-thick sections were prepared essentially as described previously
(Zhu et al., 2000). Cases used in this study included AD (n 5) and
control (n 5) cases. Immunocytochemistry was performed by the per-
oxidase–antiperoxidase protocol as described before (Zhu et al., 2000).
Absorption experiments were performed to verify the specificity of anti-
body binding. Each case was examined on a Zeiss Axiophot microscope
for neurons stained with DLP1, OPA1, Mfn1, Mfn2, Fis1, COX I (Mo-
lecular Probes), and tubulin. Positively stained neurons were counted.
Western blot analysis. Brain samples from gray matter of temporal cortex
of AD (n 13; ages 60 89 years, postmortem interval 1–24 h) and
age-matched control (n 12, ages 58 –92 years; postmortem interval
2–23 h) cases [based on clinical and pathological criteria established by
CERAD (the Consortium to Establish a Registry for Alzheimer’s Disease)
and an National Institute on Aging consensus panel (Khachaturian and Emr,
1984; Mirra, 2000)] or cells were lysed with 1 Cell Lysis Buffer (Cell Sig-
naling), plus 1 m
M PMSF (Sigma) and Protease Inhibitor Cocktail (Sigma).
Equal amounts of total protein extract (5
gor20
g) were resolved by
SDS-PAGE and transferred to Immobilon-P (Millipore). After blocking
with 10% nonfat dry milk, primary and secondary antibodies were applied as
previously described (Wang et al., 2008a) and the blots developed with Im-
mobilon Western Chemiluminescent HRP Substrate (Millipore).
Electron microscopy. Hippocampus tissue fixed in 2% paraformalde-
hyde was embedded in London Resin gold after ethanol dehydration and
polymerized with UV exposure. Sections (60 –100 nm) were placed on
nickel grids and incubated with COX antibody followed by gold-
conjugated secondary antibody. Grids were stained with uranyl acetate
and lead citrate and viewed in a Zeiss electron microscope at 80 kV
(CEM902; Zeiss, Oberkochen, Germany).
Cell treatments and measurements. Amyloid-
-derived diffusible li-
gands (ADDLs) were prepared using A
1-42
peptide (California Peptide)
as described before (Klein, 2002), except that phenol red free neurobasal
medium (Invitrogen) was used instead of phenol red free F12 medium.
Primary hippocampal cells were usually treated at DIV 7–16. The nega-
tive control A
42-1
peptide (Anaspec) was subject to the same prepara
-
tion procedure as ADDLs were. Cytotoxicity was measured by use of a
cytotoxicity detection kit (LDH; Roche). For differentiation of M17 cells,
serum content was reduced to 2%, and 1
M retinoic acid (Sigma-
Aldrich) was included in the culture medium.
To measure mitochondrial reactive oxygen species (ROS), the fluores-
cent probe MitoSOX (Invitrogen) was used according to the manufac-
turer’s protocol. Briefly, neurons were incubated with 2.5
M MitoSOX
in culture medium for 10 min, followed by three washes with prewarmed
Hanks’ balanced salt solution (Invitrogen). Cells were fixed in 4% para-
formaldehyde for 30 min and then stained and observed using a Zeiss
LSM 510 inverted fluorescence microscope.
Mitochondria were harvested from human brain samples or cells by
use of a mitochondrial isolation kit (Pierce) following the manufacturer’s
protocol. The cytosolic extracts were also used to determine DLP1 levels.
The biotin-switch assay was performed using an S-nitrosylated protein
detection assay kit (Cayman) following the manufacturer’s protocol. Bi-
otinylated DLP1 was immunoprecipitated with anti-DLP1 antibody in
radioimmunoassay precipitation buffer using Protein G-agarose beads
(Roche Diagnostics) according to the manufacturer’s protocol and ana-
lyzed by Western blot using avidin–HRP (Cayman).
Immunofluorescence. Cells were cultured on chamber slides. After treat-
ment, cells were fixed and stained as described previously (Wang et al.,
2008a). All fluorescence images were captured with a Zeiss LSM 510 inverted
fluorescence microscope or a Zeiss LSM 510 inverted laser-scanning confo-
cal fluorescence microscope. Confocal images of far-red fluorescence were
collected using 633 nm excitation light from a HeNe laser and a 650 nm
long-pass filter; images of Mito-DsRed2 red fluorescence were collected us-
ing 543 nm excitation light from an argon laser and a 560 nm long-pass filter;
and green fluorescence images were collected using 488 nm excitation light
from an argon laser and a 500 –550 nm bandpass barrier filter. Image analysis
was performed with open-source image analysis program Wright Cell Im-
aging Facility (WCIF) ImageJ (developed by W. Rasband; NIH).
Time-lapse imaging. Neurons were seeded in glass-bottom dishes
(MatTek) and then transfected with Mito-Dendra2. Forty-eight hours after
transfection, cells were placed in a well-equipped live imaging station (Zeiss
CTI-Controller 3700) with controlled CO
2
content, humidity, and temper
-
ature of stage, objective, and the air. Images were captured with a Zeiss LSM
510 inverted laser-scanning confocal fluorescence microscope. Images of red
Wang et al. Mitochondrial Dynamics in AD J. Neurosci., July 15, 2009 29(28):9090 –9103 9091
Page 2
signal were collected using 543 nm excitation light from an argon laser and a
560 nm long-pass filter; those of green fluorescence were collected using 488
nm excitation light from an argon laser and a 500 –550 nm bandpass barrier
filter. During time-lapse imaging, frames were captured every 10 s for at least
1 h without apparent phototoxicity or photobleaching. Image analysis was
also performed with open-source image-analysis programs WCIF ImageJ
(developed by W. Rasband; NIH).
Results
Changes in levels and distribution of mitochondrial
fission/fusion proteins in neurons from AD hippocampus
We investigated the expression pattern of mitochondrial fission
proteins (i.e., DLP1 and Fis1) and fusion proteins (i.e., OPA1,
Mfn1, and Mfn2) in hippocampal tissues from 13 AD patients
and 12 age-matched normal subjects. Immunoblot analysis re-
vealed significant changes in the levels of all five proteins: DLP1
levels were dramatically reduced by 74.3% in AD brains, and
OPA1, Mfn1, and Mfn2 levels were also reduced by 61.4%,
27.8%, and 33.6%, respectively. Interestingly, unlike other fis-
sion/fusion proteins, Fis1 levels were significantly increased 4.8-
fold in AD brains compared with age-matched control brains
(Fig. 1A, B). No significant changes in overall mitochondrial con-
tents were noted between AD and control samples, as evidenced
by the constant expression levels of COX IV, a mitochondrial
marker (Fig. 1A). Real-time PCR studies of five control and five
Figure 1. Mitochondrial fission and fusion protein expression and distribution in AD hippocampus. A, B, Representative immunoblot (A) and quantification (B) analysis revealed that in AD
hippocampus (n 13), levels of DLP1/OPA1/Mfn1/Mfn2 were reduced significantly, whereas levels of Fis1 were increased significantly compared with age-matched controls (n 12) (*p 0.05,
Student’s t test). Equal protein amounts (30
g) were loaded and confirmed with actin staining (A). C, Representative immunocytochemistry of DLP1, OPA1, Mfn1, Mfn2, and Fis1 in hippocampus
from AD (right) and age-matched controls (left). Scale bars, 50
m. D, Positively stained neurons were categorized into three groups: neurons with soma staining only, neurons with axon staining
only,andneuronswithbothaxonandsomastaining.QuantificationinfiveAD brains and five age-matched controls indicated that Fis1, OPA1, Mfn1, and Mfn2 demonstrated soma staining in 80%
of pyramidal neurons in AD hippocampus, significantly different from what was seen for control hippocampal neurons.
9092 J. Neurosci., July 15, 2009 29(28):9090 –9103 Wang et al. Mitochondrial Dynamics in AD
Page 3
AD cases confirmed a 60% increase in Fis1 mRNA levels in AD
but no changes in mRNA levels of other mitochondrial fission/
fusion proteins (not shown). Immunocytochemical analysis of
these proteins revealed extensive immunoreactivity of each of
these proteins in pyramidal neurons in hippocampal tissues from
age-matched control patients (Fig. 1C). Interestingly, only back-
ground neuronal immunoreactivity of DLP1 was noted in the
hippocampus from AD patients (Fig. 1C), consistent with the
greatly reduced levels revealed by immunoblot analysis. In con-
trast, extensive neuronal immunoreactivity was noted for the
other four mitochondrial fission/fusion proteins in hippocampal
tissues from AD patients; however, they displayed a distinctive
distribution pattern compared with that of control hippocampus
(Fig. 1C). Although all these proteins demonstrate a uniform
distribution throughout the soma and neurites of pyramidal neu-
rons in age-matched control hippocampus, in AD hippocampal
neurons, they accumulated in the soma and were depleted in the
neurite (Fig. 1C). Positively stained neurons were counted and
categorized into three groups: neurons with only soma staining,
neurons with only axon staining, and neurons with both axon
and soma staining. Indeed, all of these four proteins (i.e., Fis1,
OPA1, Mfn1, and Mfn2) demonstrated only soma staining in
80% of pyramidal neurons in AD hippocampus, significantly
different from what was seen for control hippocampal neurons
(Fig. 1D). Antibodies against each of these fission/fusion proteins
from two different sources were used in both immunocytochem-
ical and immunoblot studies, and similar results were obtained
(not shown). The specificity of each antibody was confirmed by
preabsorption of primary antibodies with their immunizing pep-
tides. Since Fis1, Mfn1, and Mfn2 are mitochondrial outer mem-
brane proteins and OPA1 is a mitochondrial inner membrane
protein, the consistent pattern of their redistribution to soma in
AD pyramidal neurons implies that mitochondria are redistrib-
uted in these neurons.
Mitochondria are redistributed in AD pyramidal neurons
To confirm the altered distribution of mitochondria in AD neu-
rons, we used a widely used mitochondrial marker, COX I, which
also demonstrated exclusive neuronal staining in both AD and
age-matched control cases (Fig. 2A). The mitochondrial localiza-
tion of COX I in pyramidal neurons was confirmed by electron
microscopy (Fig. 2B). Notably, immunocytochemical analysis
also revealed striking changes in the distributions of COX I im-
munoreactivity within neurons between AD and control cases:
localization of COX I in control cases is seen throughout the
soma and processes of most pyramidal neurons (85%) of the
hippocampus, whereas in AD cases, the immunoreactivity is es-
sentially limited to the soma with no more than 20% neurons
demonstrating positively stained processes. Since some neurons
may lose processes in sections as a result of the angle of cutting in
both AD and control cases, which may mask the difference, to
further clarify the changes in COX I distribution, immunofluo-
rescence analysis of tubulin and COX I double staining of AD and
age-matched control hippocampal tissues was performed (Fig.
2C). Quantitative analysis of tubulin staining revealed no signif-
icant difference in the percentages of neurons with soma staining
Figure 2. Altereddistribution of mitochondria in AD. A, Representative immunocytochemistry of COX I confirmed that in AD hippocampus, COX I staining of neuronal processes was significantly
reduced compared with age-matched controls (*p 0.05, Student’s t test). B, A representative immunoelectron micrograph of COX I gold labeling of mitochondria is shown. C, A representative
immunofluorescence picture of COX I staining (green) and tubulin (red) in AD hippocampus (bottom) and age-matched control (top). D, Quantification revealed that mitochondria were evenly
distributed in the control (n 5), whereas they were significantly constricted in the soma in AD hippocampus (n 5) (*p 0.05, Student’s t test).
Wang et al. Mitochondrial Dynamics in AD J. Neurosci., July 15, 2009 29(28):9090 –9103 9093
Page 4
only, neurite staining only, and both soma
and processes staining between AD and
age-matched control sections (Fig. 2D).
However, in control cases, the majority
(90%) of those neurons with long pro-
cesses contain COX I throughout the
soma and processes, whereas in AD cases,
only a minority of those neurons with
long processes contain COX I in the soma
and processes (20%) and the majority
of those neurons with long processes con-
tain COX I in the soma only (Fig. 2C, D).
Since COX I is a mitochondrial inner
membrane protein widely used as a mito-
chondrial marker, this finding confirms
that mitochondria accumulate in the
soma and are reduced in neuronal pro-
cesses in AD pyramidal neurons.
Changes in subcellular localization and
modification of DLP1 in AD brain
Previously we reported shorter mitochon-
dria in AD neurons (Wang et al., 2008b),
suggestive of enhanced mitochondrial fis-
sion. DLP1 is known to play a critical role
in the fission process; however, our results
indicated reduced levels of DLP1 in AD
neurons. Given that the majority of DLP1
in mammalian cells is cytosolic and it is
the mitochondrial DLP1 that participates
in mitochondrial fission (Smirnova et al., 2001), we hypothesized
that there may be comparable or even increased levels of mito-
chondrial DLP1 in AD compared with control brain samples. To
test this hypothesis, we conducted subcellular fractionation ex-
periments from AD and control brain homogenates, and the re-
sultant fractions were analyzed by probing immunoblots with
anti-DLP1 antibody as well as antibodies for GAPDH to track
cytosolic fractions, and with COX IV to track mitochondrial frac-
tions. We found slightly increased levels of mitochondrial DLP1
(not significant) in AD brain samples (Fig. 3A). The immunoblot
analysis also confirmed significantly reduced levels of cytosolic
DLP1 in AD samples (Fig. 3A). Phosphorylation of DLP1 at sev-
eral sites regulates its mitochondrial fission activity: whereas
there is still debate over whether phosphorylation of DLP1 at
Ser637 enhances or inhibits mitochondrial fission activity (Ce-
reghetti et al., 2008; Han et al., 2008), it appears that phosphory-
lation of DLP1 at Ser 616 activates mitochondrial fission activ-
ity (Taguchi et al., 2007). Given the known imbalance of kinase
and phosphatase activities such that increased phosphorylation
of multiple proteins was identified in AD brain, we determined
the levels of DLP1 phosphorylated at Ser616 in AD brain and
found significantly increased phosphorylated DLP1 at this site in
both mitochondrial and cytosolic fractions from AD brains com-
pared with control brains (Fig. 3A). A recent study suggested that
S-nitrosylation of DLP1 activates GTPase activity and mitochon-
drial fission and reported increased S-nitrosylation of DLP1 in
AD brain tissues (Cho et al., 2009); we also determined DLP1
nitrosylation in our studies by biotin-switch assay. Indeed, we
confirmed significantly increased S-nitrosylation of DLP1 in AD
brain tissues (Fig. 3B). These data suggest that, despite the reduc-
tion in overall levels of DLP1, there were comparable levels of
mitochondrial DLP1 in AD neurons, which likely contributes to
enhanced mitochondrial fission.
Modulations of mitochondrial fission/fusion proteins,
mimicking changes in AD neurons, cause abnormal
mitochondrial distribution in M17 cells
Since mitochondrial fission/fusion proteins not only control mi-
tochondrial morphology but also regulate mitochondrial distri-
bution, we hypothesized that changes in mitochondrial fission/
fusion proteins may also change mitochondrial morphology and
distribution in AD neurons. To test this hypothesis, we evaluated
whether changes in these proteins, mimicking the changes found
in AD neurons, affected mitochondrial morphology and distri-
bution in the M17 human neuroblastoma cell line. Stable M17
cell lines were generated with reduced expression of DLP1,
OPA1, Mfn1, and Mfn2, i.e., mitochondrial fission/fusion pro-
teins that demonstrated reduced levels in AD neurons, and over-
expression of Fis1, i.e., the mitochondrial fission/fusion protein
that demonstrated increased levels in AD neurons. The overex-
pression or reduced expression of mitochondrial fission/fusion
proteins was confirmed by Western blotting (Fig. 4A). There was
no increase in basal cell death in any of the cell lines compared
with control cells (i.e., untransfected or empty vector-transfected
cells) (data not shown). To visualize mitochondria, stable M17
cell lines were transiently transfected with Mito-DsRed2. Forty-
eight hours after transfection, cells were fixed, stained, and eval-
uated using laser confocal microscopy (Fig. 4B). Detailed analysis
of mitochondrial length revealed that these manipulations, mim-
icking changes in AD neurons, caused differential effects on mi-
tochondrial morphology: the majority of the M17 cells in control
lines demonstrated short tubular-form mitochondria, while al-
most 100% of stable M17 cells with reduced DLP1 expression
demonstrated elongated mitochondria, and the majority of M17
cells with reduced OPA1, Mfn1, or Mfn2 expression or increased
Fis1 expression demonstrated fragmented mitochondria (72.6
8.1%, 77.4 7.3%, 63.2 4.2%, or 84.7 6.4%, respectively)
Figure 3. Changes in subcellular localization and modification of DLP1 in AD brain. A, Representative immunoblot and quan-
tification analysis of DLP1 and phospho-DLP1 (Ser616) (p-DLP1) in the mitochondrial and cytosolic fraction from AD brains (n 8)
and age-matched control brains (n 8) indicated that, although relative mitochondrial DLP1 level (DLP1/COX IV) did not change
significantly,therelative ratio of p-DLP1 toDLP1 increased significantly in bothmitochondrial and cytosolic fractions fromADbrain
samples. All samples were also immunoblotted with antibodies to detect mitochondrial (COX IV) and cytoplasmic (GAPDH) mark-
ers. The absence of GAPDH in the mitochondrial fraction confirms the purity of preparations from brain tissues. B, Representative
immunoblot and quantification analysis of S-nitrosylated DLP1 (SNO-DLP1) by biotin-switch assay of AD brains (n 8) and
age-matched control brains (n 8) showed that relative SNO-DLP1 formation increased significantly in AD. All experiments were
repeated three times (*p 0.05, Student’s t test).
9094 J. Neurosci., July 15, 2009 29(28):9090 –9103 Wang et al. Mitochondrial Dynamics in AD
Page 5
(Fig. 4C). Most notably, despite their differential effects on mor-
phology, all manipulations caused a similar abnormal effect on
mitochondrial distribution when compared with untransfected
or empty vector-transfected control cells: in control cells, mito-
chondria were distributed evenly throughout the cytoplasm
(95% cells) (Fig. 4D). However, in stable M17 cells with re-
duced DLP1 expression, almost 100% of the cells demonstrated
an abnormal mitochondrial distribution with mitochondria
aggregating in the perinuclear area, whereas more remote cyto-
plasmic areas were devoid of mitochondria; 63.5 3.2%, 87.8
3.2%, 78.3 5.3%, or 82.5 7.3% of cells in the stable M17 cell
lines with reduced OPA1, Mfn1, or Mfn2 expression or increased
Fis1 expression, respectively, demonstrated similar abnormal mi-
tochondrial distributions (Fig. 4D).
We also generated stable M17 cell lines overexpressing domi-
nant negative DLP1 or OPA1 mutants. As expected, they caused
effects similar to those of DLP1 or OPA1 knockdown on mito-
chondrial morphology and distribution (Fig. 4C, D): overexpres-
sion of the DLP1 K38A mutant caused elongated mitochondria,
whereas overexpression of OPA1 K301A mutant caused frag-
mented mitochondria (Fig. 4C), but both caused abnormal mi-
tochondrial distribution with mitochondria accumulating in the
perinuclear area (Fig. 4D).
In addition, we further generated stable M17 cells lines over-
expressing DLP1 or OPA1 or with reduced expression of Fis1, i.e.,
changes opposite to those observed in AD neurons (Fig. 4C, D).
The analysis of mitochondrial morphology and distribution in
these cell lines revealed that DLP1 overexpression caused primar-
ily fragmented mitochondria, and Fis1 knockdown caused pri-
marily elongated mitochondria, whereas overexpression of
OPA1 in cells resulted in a heterogeneous population of mito-
chondria that varied in shape (Fig. 4C). However, neither of these
manipulations caused abnormal perinuclear accumulation of
mitochondria (Fig. 4D).
Modulations of mitochondrial fission/fusion proteins,
mimicking changes in AD, cause abnormal mitochondrial
distribution in differentiated primary neuronal cells
To study the effect of modulating this mitochondrial fission/
fusion expression in differentiated cells, primary rat hippocam-
pal neurons (DIV 7–12) were transfected with GFP-tagged miR
RNAi expression vectors targeting DLP1, OPA1, Mfn1, or Mfn2
or a Myc-tagged Fis1 expression vector. Cells were fixed and
stained 3 or 4 d after transfection. Positively transfected cells can
be identified by GFP fluorescence or Myc immunostaining. In
nontransfected control hippocampal neurons, mitochondria
were abundant and overlapping in soma and proximal neurites
but were separated from each other and evenly distributed in
distal neurites and usually demonstrated short tubular forms
with an average length of 2.1 0.08
m (Fig. 5A, B). In DLP1
knockdown neurons, many mitochondria in neurites became ex-
tremely long (10
m) and the average mitochondrial length
increased significantly (4.1 0.56
m) (Fig. 5B). However,
mitochondrial number was significantly reduced in neuronal
processes (Fig. 5C), leaving large lengths of neurites devoid of
mitochondria (Fig. 5E). Indeed, the neurite mitochondrial index
(total mitochondrial length/neurite length) in neuronal pro-
cesses 200
m in length beginning from the cell body, used as an
index for mitochondrial coverage in neuronal processes, was sig-
nificantly decreased (Fig. 5D). OPA1, Mfn1, and Mfn2 knock-
down as well as Fis1 overexpression caused mitochondria to
become globular and significantly shorter in positively trans-
fected neurons (Fig. 5A, B). Mitochondrial aggregates were often
observed in the neuronal processes of Mfn1 knockdown or Fis1-
overexpressing neurons. Most importantly, despite their differen-
tial effect on mitochondrial morphology compared with DLP1
knockdown, manipulations of OPA1, Mfn1, Mfn2, or Fis1 all caused
significantly reduced neuritic mitochondrial density (Fig. 5C), de-
creased neurite mitochondrial index (Fig. 5D), and increased length
Figure 4. Modulations of mitochondrial fission/fusion proteins, mimicking changes in AD neurons, cause abnormal mitochondrial distribution in M17 cells. A, Representative immunoblot
analysis of M17 cells stably knocking down or overexpressing mitochondrial fission and fusion proteins. Equal protein amounts (15
g) were loaded. Tubulin immunoblot was used as an internal
loading control. B, Representative confocal pictures of mitochondria in M17 cells either stably overexpressing (OE) or knocking down (RNAi) mitochondrial fission/fusion proteins. Cells were
transfected with Mito-DsRed2 to label mitochondria. For knockdown experiments, GFP was tagged to the micro-RNAi construct. For overexpression experiments, tubulin was immunostained as
green to label the cell shape. C, D, Quantifications of mitochondrial morphology (C) and abnormal distribution (D) in M17 cell either stably overexpressing or knocking down mitochondrial
fission/fusion proteins revealed differential effects on mitochondrial morphology but similar effects on abnormal mitochondrial distribution for those manipulations mimicking changes in AD. Scale
bars, 20
m. At least 500 cells were analyzed in triplicate for each cell line (*p 0.05, Student’s t test).
Wang et al. Mitochondrial Dynamics in AD J. Neurosci., July 15, 2009 29(28):9090 –9103 9095
Page 6
of neurites devoid of mitochondria in the neuronal processes (Fig.
5E) in positively transfected hippocampal neurons, a phenomenon
also observed in DLP1 knockdown neurons, consistent with the re-
distribution pattern of mitochondria in M17 cells.
Differentiated hippocampal neurons were also transiently
transfected with dominant negative DLP1 or OPA1 mutants and
essentially caused effects similar to DLP1 or OPA1 knockdown
on mitochondrial morphology and distribution (Fig. 5B–E). In con-
trast, overexpression of DLP1 caused fragmented mitochondria but
increased mitochondrial number in neuronal processes with an
overall increase in neurite mitochondrial index (Fig. 5B–E). OPA1
overexpression led to a heterogeneous effect on mitochondrial mor-
phology and Fis1 knockdown caused mitochondria elongation, but
neither changed mitochondrial density in neuronal processes or
neurite mitochondrial index in rat primary neurons (Fig. 5B–E).
Effect of mitochondrial fission/fusion proteins on
dendritic spines
As one approach to determine whether alterations in mitochon-
drial dynamics correlate with neuronal changes, we compared
the number of dendritic spines, an important index of synaptic
plasticity. Rat E18 primary hippocampal neurons (DIV 9) were
transfected with GFP-tagged miR RNAi expression vectors tar-
geting DLP1, OPA1, Mfn1, or Mfn2 or a Myc-tagged Fis1 expres-
Figure 5. Modulations of mitochondrial fission/fusion proteins, mimicking changes in AD, cause similar abnormalities in differentiated primary neuronal cells. A, Representative pictures of
mitochondria in primary rat E18 hippocampal neurons (DIV 7–12) transiently transfected with GFP-tagged miR RNAi expression vector targeting DLP1, OPA1, Mfn1, or Mfn2 (DLP1, OPA1, Mfn1, or
Mfn2 RNAi) or a Myc-tagged Fis1 expression vector (Fis1 OE) and Mito-DsRed2 (Red) to label mitochondria. For Myc-tagged Fis1 overexpression, a GFP-expressing vector was also cotransfected to
show neurites and soma. Positively transfected cells were identified by GFP fluorescence (green) or Myc immunostaining (white). BE, Quantification of mitochondrial length (B), number (C),
neurite mitochondrial index (total mitochondrial length/neurite length) (D), and axial length of neurites devoid of mitochondria (E) in a segment of neuronal process 400
m in length beginning
from the cell body of neurons either overexpressing or knocking down mitochondrial fission/fusion proteins (*p 0.05, Student’s t test). Scale bars, 20
m. At least 20 cells were analyzed in each
experiment, and experiments were repeated three times.
9096 J. Neurosci., July 15, 2009 29(28):9090 –9103 Wang et al. Mitochondrial Dynamics in AD
Page 7
sion vector together with Mito-DsRed2 to label mitochondria.
Three days later, neurons were fixed and stained. Positively trans-
fected neurons were identified by GFP fluorescence or Myc im-
munostaining. For each neuron, dendritic segments with 100
200
m in length beginning 100
m from the cell body were
selected. In dendrites with large diameters, mitochondria were
overlapping and abundant in the proximal area but separated
from each other in the distal area similarly to what was seen for
dendrites with small diameter. Protrusions of 0.5–5
m in length
that had a clear neck and expanded mushroom-like heads or a
stubby shape were defined as dendritic spines. At DIV 12, den-
drites of control neurons were extensively covered with dendritic
spines (Fig. 6 A). However, neurons with DLP1 downregulation
showed a markedly reduced spine density (1.1 0.35/10
m)
compared with nontransfected or control RNAi-transfected neu-
rons (4.2 0.46/10
m). Similarly OPA1, Mfn1, or Mfn2 knock-
down as well as Fis1 overexpression also caused markedly re-
duced spine density (Fig. 6 A, B). To determine whether these
changes correlated with a loss of mitochondria in the vicinity of
the spine, the frequency of spine occupancy by mitochondria was
measured. It was found that the number of spines containing at
least one mitochondrion in a 1-
m-diameter region centered in
the middle of the spine was significantly reduced in all neurons
with DLP1/OPA1/Mfn1/Mfn2 knockdown or Fis1 overexpres-
sion (Fig. 6C).
Effects of A
on mitochondrial
dynamics in primary neurons
It is believed that soluble A
oligomers are
involved in the pathogenesis of AD. We
previously demonstrated that A
PP over-
expression, likely through A
overproduc-
tion, induces mitochondrial dysfunction
through altered mitochondrial dynam-
ics (Wang et al., 2008b). It was reported
that A
25-35
induced mitochondrial
fragmentation before cell death. To di-
rectly examine the potential effect of A
oligomers on mitochondria, rat hip-
pocampal neurons (DIV 7–9) were co-
transfected with a GFP expression vector
to label cell shape and Mito-DsRed2 to
highlight mitochondria. Two days after
transfection, neurons were incubated
with 800 n
M oligomeric ADDLs. As a con-
trol, in parallel experiments, neurons
were treated with 10
M A
42-1
; the re
-
verse peptide was subjected to the same
preparation steps as ADDLs. After treat-
ment for 24 h, cells were fixed, stained,
and imaged by laser confocal microscopy.
Treatment with ADDLs led to signifi-
cantly reduced mitochondrial length in
neurites, suggestive of enhanced mito-
chondrial fragmentation (Fig. 7A, B).
More importantly, unlike the vehicle-
or A
42-1
-treated controls, large seg
-
ments of neurites were devoid of mito-
chondria (Fig. 7E). In fact, the neuritic
mitochondrial density and the neurite
mitochondrial index were also signifi-
cantly reduced in neuronal processes of
ADDL-treated primary neurons (Fig.
7C, D). The negative control, A
42-1
,
had no effect on any of these mitochondrial parameters.
The readily discernible individual mitochondrion in distal
neurites makes it possible to measure the occurrence of mito-
chondrial fusion and fission events. A fusion event was defined as
two separate mitochondria moving toward each other, forming a
physical connection into one intact organelle and moving to-
gether. A fission event was recognized by the division of a single
mitochondrion into two distinct mitochondria. Both fission and
fusion events were counted in the segment of axon 100
min
length beginning 300
m from the cell body of control or ADDL-
treated neurons during 20 min time-lapse recordings. Mitochon-
dria rapidly underwent constant fission and fusion in control
neurons (0.0263 0.0102 events/
m in 20 min for fusion and
0.0399 0.0098 events/
m in 20 min for fusion) (Fig. 7F, G).
Similar rates were seen in neurons treated with the reverse pep-
tide, A
42-1
. In contrast, mitochondrial fission and fusion oc
-
curred at a much lower frequency in neurons treated with ADDLs
(0.0036 0.0019 events/
m in 20 min for fusion and 0.0048
0.002 events/
m in 20 min for fusion), suggesting that both mi-
tochondrial fission and fusion were impaired in ADDL-treated
primary neurons (Fig. 7F, G). Further, the ratios of the total time
each mitochondrion involved in fission/fusion spent in the post-
fission “single state” (defined as the time interval from fission to
fusion) and post-fusion “fused state” (defined as the time interval
from fusion to fission) during the 20 min recording time were
Figure 6. Effect of mitochondrial fission/fusion proteins on dendritic spines. Primary rat E18 primary hippocampal neurons
were transfected at DIV 9 with the indicated plasmids. For each neuron, dendritic segments of 100 –200
m in length beginning
100
m from the cell body were selected. A, Representative pictures of positively transfected neurons are shown. B, C, Quantifi-
cation of spine number and the percentage of spines supported by mitochondria (*p 0.05, Student’s t test). Scale bars, 5
m. At
least 20 cells were analyzed in each experiment, and experiments were repeated three times.
Wang et al. Mitochondrial Dynamics in AD J. Neurosci., July 15, 2009 29(28):9090 –9103 9097
Page 8
determined. In both control neurons and those treated with
A
42-1
, the total times each mitochondrion spent in the post-
fusion state and post-fission state were similar (Fig. 7H ).
However, in the ADDL-treated neurons, mitochondria spent
significantly less time in the post-fusion state compared with
the post-fission state (Fig. 7H ).
We next sought to determine whether A
oligomers induced
changes in the expression of these mitochondrial fission and fu-
Figure 7. Effects of ADDLs on mitochondrial morphology and distribution in primary neurons. Primary rat E18 hippocampal neurons (DIV 9 –12) transfected with GFP and Mito-DsRed2 were
treated with 800 n
M ADDLs for 24 h. Twenty-four hours of treatment of A
42-1
, subject to the same procedure that produces ADDLs, was used as a control. A, Representative pictures of positively
transfectedneurons.Red,DsRed;green,GFP;white:tubulinstaining.BE,Quantificationofmitochondriallength(B),density(C),neuritemitochondrialindex(D),andaxiallengthofneuritesdevoid
of mitochondria (E) in a segment of neuronal process 400
m in length beginning from the cell body of neurons (*p 0.05, Student’s t test). At least 20 cells were analyzed in each experiment,
experiments were repeated three times. F, Demonstration of the effect of ADDLs on mitochondrial fission and fusion events. Rat E18 hippocampal neurons (DIV 9) were transfected with
Mito-DsRed2.Twenty-four hours after incubation with or without 800n
M ADDLs at DIV 11, neurons were imaged intime lapse (10 s interval, 20 min). Representativethresholded time-lapse pictures
showed active mitochondrial fission and fusion in the segment of axon 100
m in length beginning 300
m from the cell body of control or ADDL-treated neurons. Active mitochondrial fission
(filled arrows) and fusion (empty arrows) and fast-moving mitochondria (asterisks) are marked. G, H, Both fusion and fission were impaired significantly by ADDLs (G), and mitochondria spent
significantly less time in the post-fusion fused state than in the post-fission single state (H ). At least 20 neurons were analyzed in three independent experiments (*p 0.05, Student’s t test). IL,
Immunoblot and quantitative analysis of DLP1 and OPA1 levels in neurons treated at the indicated dosages of ADDLs for 24 h (I, J )orat800n
M for the indicated periods of time (K, L) revealed that
ADDLs induced a dose- and time-dependent decrease in DLP1 and OPA1 levels (*p 0 0.05, Student’s t test). C, Control, UNT, untreated. M, Unlike ADDLs, 10
M A
42-1
had no effect on the
expression of DLP1 and OPA1. Equal protein amounts (15
g) were loaded. Actin immunoblot was used as an internal loading control.
9098 J. Neurosci., July 15, 2009 29(28):9090 –9103 Wang et al. Mitochondrial Dynamics in AD
Page 9
sion proteins in rat hippocampal neurons. Primary neurons (DIV
712) were incubated with different doses of ADDLs (50 n
M–10
M) for 24 h or with 800 nM ADDLs for various period of time
(0 –24 h) and cell lysates were prepared for immunoblot analysis
of mitochondrial fission and fusion proteins. As a negative con-
trol, neurons were also treated with 10
M A
42-1
for 24 h. No
apparent cell death under these conditions with either ADDLs or
A
42-1
treatment was observed, as determined by LDH assay
(data not shown). Interestingly, ADDL treatment caused a signif-
icant decrease in DLP1 and OPA1 levels in a dose-dependent
manner (Fig. 7I, J), whereas there was no significant change in
Mfn1, Mfn2, or Fis1 level (data not shown). In fact, 800 n
M ADDL
treatment induced a significant reduction in DLP1 or OPA1 lev-
els as early as 2 h, and the effect lasted for at least 24 h (Fig. 7K, L).
In contrast, A
42-1
treatment did not change mitochondrial fis
-
sion and fusion protein levels compared with what was seen for
untreated or vehicle-treated neurons (Fig. 7M).
We further determined the levels of DLP1 in the mitochon-
drial fraction and found that A
oligomers induced significantly
increased levels of mitochondrial DLP1 (Fig. 8A). Similar to what
was seen for AD brain, increased mitochondrial DLP1 was ac-
companied by A
oligomer-induced increased levels of phos-
phorylation (Fig. 8A) and S-nitrosylation (Fig. 8B) of DLP1.
Effects of DLP1 and OPA1 on A
-induced alterations in
mitochondrial dynamics
To determine the role of DLP1 and/or OPA1 in A
-induced
abnormal mitochondrial morphology and distribution, rat hip-
pocampal neurons (DIV 9) were tran-
siently transfected with Myc-tagged
DLP1wt or GFP-tagged OPA1wt. Mito-
DsRed2 was cotransfected to label mito-
chondria. Two days after transfection,
neurons were treated with 800 nM ADDLs
for 24 h, fixed, and stained. Positively
transfected cells were selected based on
DsRed fluorescence signal and Myc im-
munoreactivity (or GFP fluorescence sig-
nal). As shown before, in the absence of
ADDL treatment, mitochondria became
fragmented in neurons overexpressing
DLP1 but were more heterogeneous in
shape, with an increase in average mito-
chondrial length in neurons overexpress-
ing OPA1 (Fig. 9C). Mitochondrial num-
ber and coverage in the neuronal
processes were increased in neurons over-
expressing DLP1 but unchanged in neu-
rons overexpressing OPA1 (Fig. 9A, B). In
control primary neurons expressing only
vector, ADDLs induced mitochondrial
fragmentation, reduced mitochondrial
number and neuritic mitochondrial in-
dex, and increased the average length of
neuritic segments devoid of mitochondria
in the neuronal processes (Fig. 9B–E).
Interestingly, in the presence of
ADDLs, OPA1 overexpression restored
mitochondrial length to a level compara-
ble with what was seen for untreated con-
trols (Fig. 9C). However, OPA1 overex-
pression had no effects on ADDL-induced
decrease in mitochondrial number and
neurite mitochondrial index or increase
in average length of neuritic segments devoid of mitochondria in
the neuronal processes in positively transfected primary neurons
(Fig. 9A–E). On the other hand, in contrast to OPA1-
overexpressing neurons, in the presence of ADDLs, DLP1 over-
expression did not change mitochondrial length but restored mi-
tochondrial number, the neurite mitochondrial index, and the
average length of neuritic segments devoid of mitochondria to a level
comparable with untreated controls in positively transfected neu-
rons (Fig. 9A–E).
Effects of DLP1 and OPA1 on A
-induced functional changes
Mitochondria serve as the primary source of endogenous ROS.
By using a fluorescence red dye, MitoSOX, to measure mitochon-
drial ROS production, we were able to demonstrate that treat-
ment of rat hippocampal neurons with ADDLs resulted in a large
increase of mitochondrial ROS levels in rat hippocampal neurons
(Fig. 10A, B). In the absence of ADDL treatment, OPA1 overex-
pression led to a significantly decreased basal level of mitochon-
drial ROS, as evidenced by the lower fluorescence signal in
positively transfected cells compared with those of neighboring
nontransfected cells and GFP vector-transfected control cells
(Fig. 10A, B). However, DLP1 overexpression did not signifi-
cantly change the basal mitochondrial ROS levels. Similarly, in
the presence of ADDL treatment, OPA1 overexpression signifi-
cantly lowered mitochondrial ROS levels to a level comparable
with that of untreated controls, whereas DLP1 overexpression
had no effects (Fig. 10 A, B).
Figure 8. Effects of ADDLs on subcellular localization and modification of DLP1 in primary rat E18 hippocampal neurons. A,
Representativeimmunoblot and quantification analysis showedthat both relative mitochondrialDLP1 level (DLP1/COX IV) andthe
relative ratio of phospho-DLP1 (p-DLP1) to DLP1 increased significantly in primary rat E18 hippocampal neurons (DIV 12) treated
with 800 n
M ADDLs for 24 h. Unlike ADDLs, 10
M A
42-1
had no effect on either relative mitochondrial DLP1 level (DLP1/COX IV)
or the relative ratio of p-DLP1/DLP1 (not shown). All samples were also immunoblotted with antibodies to detect mitochondrial
(COXIV)andcytoplasmic(GAPDH) markers. The absence of GAPDH inthemitochondrialfractionconfirms the purity of preparations
from cell lysates. B, Representative immunoblot and quantification analysis further revealed that S-nitrosylated DLP1 (SNO-DLP1)
formation was also enhanced in primary rat E18 hippocampal neurons (DIV 12) treated with 800 n
M ADDLs for 24 h. As a control, 10
M A
42-1
did not affect SNO-DLP1 formation. All experiments were repeated three times (*p 0.05, Student’s t test).
Wang et al. Mitochondrial Dynamics in AD J. Neurosci., July 15, 2009 29(28):9090 –9103 9099
Page 10
Consistent with previous findings
demonstrating that ADDL treatment neg-
atively impacted synaptic function (Lacor
et al., 2004), we found that 24 h treatment
with 800 n
M ADDLs also induced a signif-
icantly reduced dendritic spine number in
rat hippocampal neurons (DIV 12) (Fig.
10C, D). Notably, in the presence of
ADDL treatment, DLP1 overexpression
significantly alleviated ADDL-induced
decreases in dendritic spine number (Fig.
10C, D). In contrast, OPA1 overexpres-
sion had no effects on dendritic spine
number with or without ADDL treat-
ment. We further studied the effects of
ADDL treatment on excitatory synapses
by measuring the expression of PSD-95 in
primary neurons (Fig. 10 E, F). We trans-
fected primary neurons (DIV 9) with
YFP-tagged PSD-95 to label excitatory
synapses and Mito-DsRed2 to label mito-
chondria together with or without Myc-
tagged DLP1wt or OPA1wt. At DIV 11,
neurons were treated with 800 n
M ADDLs
for 24 h and then fixed. Positively trans-
fected cells were selected based on YFP/
DsRed fluorescence signal and Myc im-
munoreactivity. In the absence of ADDL
treatment, DLP1 overexpression led to an
increased number of PSD-95 puncta,
whereas OPA1 overexpression had no ef-
fect on puncta number (Fig. 10E, F ). As
expected, ADDL treatment significantly
decreased the number of PSD-95 puncta
(Fig. 10 E, F ). Interestingly, ADDL-
induced reduction in the number of
PSD-95 puncta was effectively prevented
by DLP1 overexpression but not by OPA1
overexpression. Overall, these data sug-
gested that DLP1-regulated mitochon-
drial distribution played an important
role in ADDL-induced change of den-
dritic spine and synapse plasticity.
Discussion
In this study, we demonstrated significant alterations in the ex-
pression pattern of mitochondrial fission/fusion proteins in hip-
pocampal tissues from AD compared with age-matched control
brain. We found reduced levels of DLP1/OPA1/Mfn1/Mfn2 and
increased levels of Fis1 in AD hippocampus, consistent with the
notion that mitochondrial dynamics are altered in AD. More
importantly, all of these proteins accumulated in the soma and
were depleted in neuronal processes in AD neurons. Given that
OPA1, Mfn1/2, and Fis1 are mitochondrial membrane proteins,
these data suggest a potential redistribution of mitochondria in
AD neurons. In this regard, we also demonstrated that COX I, a
widely used mitochondrial marker, was redistributed in a similar
pattern, confirming that mitochondria are redistributed in AD
neurons. To explore the consequence of changes in the expres-
sion levels of mitochondrial fission/fusion proteins, the expres-
sion of these proteins was manipulated in M17 cells and primary
hippocampal neurons in a way that mimicked their expression
changes in AD. Although these manipulations caused different
effects on mitochondrial morphology, they all caused reduced
mitochondrial density in the cell periphery (M17 cells) or neuro-
nal processes (primary neurons) which correlated with reduced
spine numbers (primary neurons), suggesting that the altered
expression of these proteins may play an important role in mito-
chondrial redistribution and synaptic dysfunction in AD neu-
rons. In an attempt to address the potential cause of abnormal
mitochondrial dynamics, we found that ADDL treatment led not
only to mitochondrial fragmentation, consistent with previous
studies (Barsoum et al., 2006), but also to mitochondrial deple-
tion from neuronal processes. ADDLs likely caused abnormal
mitochondrial dynamics directly through adverse effects on
DLP1 and OPA1 expression, since DLP1 overexpression rescued
ADDL-induced abnormal mitochondrial distribution, whereas
OPA1 overexpression restored ADDL-induced mitochondrial
fragmentation. Most importantly, we found that ADDL-induced
mitochondrial depletion from dendrites correlated with reduced
dendritic spine density and PSD-95 puncta number, which could
be effectively reversed by DLP1 overexpression through repopu-
Figure 9. Effects of DLP1 and OPA1 on ADDL-induced mitochondrial dynamics changes. A, Representative pictures of neurons
(DIV12) cotransfected with GFP-, Mito-DsRed2-, and Myc-tagged wild-type DLP1 or wild-type OPA1 after 24 h treatment with 800
n
M ADDLs. Areas enclosed in white boxes are shown at higher magnification in Inset panels (right) to allow better appreciation of
changes in mitochondrial morphology and density. Red, DsRed; green, Myc; white, Tubulin staining. BE, Quantification of
mitochondrial number (B), length (C), neurite mitochondrial index (D), and axial length of neurites not covered by mitochondria
(E) in neurons with indicated treatment or manipulation (*p 0.05, when compared with the nontransfected or empty vector-
transfected normal control cells;
#
p 0.05, when compared with control or empty vector-transfected cells with ADDL treatment;
Student’s t test). At least 20 neurons were analyzed in three independent experiments. UNT, Untreated.
9100 J. Neurosci., July 15, 2009 29(28):9090 –9103 Wang et al. Mitochondrial Dynamics in AD
Page 11
lation of neuronal processes with mitochondria, suggesting that
abnormal mitochondrial dynamics plays an important role in
ADDL-induced synaptic dysfunction and loss.
Our previous finding of reduced mitochondrial length in the
soma of AD neurons compared with controls suggested that an
abnormal mitochondrial dynamics toward enhanced fission may
be involved in neuronal dysfunction in AD (Wang et al., 2008b).
The major finding of the current study is an altered expression
pattern of mitochondrial fission and fusion proteins in vivo in AD
brain, confirming that the balance of mitochondrial fission and
fusion is indeed tipped in AD neurons, which thus likely contrib-
utes to mitochondrial dysfunction and neurodegeneration in
vivo. However, although OPA1/Mfn1/Mfn2 reduction or Fis1
overexpression could lead to mitochondrial fragmentation,
DLP1 reduction could cause mitochondrial elongation and thus
may make the net effect on mitochondrial morphology uncertain
(Chan, 2006). Interestingly, despite the overall reduction in
DLP1 levels, we found mitochondrial DLP1 levels remained sim-
ilar between AD and control samples and were increased in
ADDL-treated neurons. In this regard, it is of interest to note that
DLP1 phosphorylation at Ser616 and S-nitrosylation activate its
mitochondrial fission activity (Taguchi et al., 2007; Cho et al.,
2009), and we found increased DLP1 phosphorylation and
S-nitrosylation in AD and ADDL-treated neurons. Given that the
majority of DLP1 in mammalian cells is cytosolic and it is the
mitochondrial DLP1 that participates in mitochondrial fission
(Smirnova et al., 2001), the comparable or increased mitochon-
drial DLP1 levels in AD or ADDL-treated samples, coupled with
increased DLP1 S-nitrosylation, suggested that changes in DLP1
in AD and ADDL-treated neurons, along with changes in other
fission/fusion proteins, likely contributes to enhanced mitochon-
drial fission. Such a notion is obviously supported by the net
outcome of mitochondrial fragmentation in ADDL-treated
neurons.
Figure 10. Effects of DLP1 and OPA1 on ADDL-induced changes in mitochondrial function and neuronal function. A, B, Representative fluorescent pictures and quantification of
mitochondrial ROS in neurons (DIV 12) transfected with GFP-tagged wild-type DLP1 or wild-type OPA1 with or without ADDL treatment. Mitochondrial RO S was labeled by MitoSOX;
Positive transfected cells were selected by GFP signal. C, D,Representative pictures and quantification of dendritic spine in neurons with or without ADDL treatment. Neurons (DIV 9) were
cotransfected with GFP- and Myc-tagged wild-type DLP1 or OPA1. Positive transfected cells were selected on the basis of GFP and Myc staining. E, F, To study the effect of A
on PSD-95,
neurons (DIV 9) were cotransfected with YFP-tagged PSD-95 to label excitatory synapses, Mito-DsRed2 to label mitochondria, and Myc-tagged DLP1 or OPA1 constructs. Shown are
representative pictures and quantification of PSD-95 puncta in neurons with or without ADDL treatment and manipulation. Red, DsRed; green, YFP; blue, MAP2A. Scale bars, 5
m. At
least 20 neurons were analyzed in three independent experiments (* p 0.05, when compared with the nontransfected or empty vector-transfected normal control cells;
#
p 0.05,
when compared with control or empty vector-transfected cells with ADDL treatment; Student’s t test).
Wang et al. Mitochondrial Dynamics in AD J. Neurosci., July 15, 2009 29(28):9090 –9103 9101
Page 12
Interestingly, a detailed measurement of mitochondrial fis-
sion and fusion events in ADDL-treated primary neurons re-
vealed that although neuronal mitochondria are still capable of
fusing and dividing, they fuse and divide at a significantly slower
rate, suggesting that both fission and fusion are impaired, consis-
tent with altered expression of both fission and fusion proteins. It
is unclear whether a slower but still balanced mitochondrial fis-
sion and fusion process has any effect on mitochondrial function.
Notably, although both fission and fusion slowed down at similar
rates, we found that mitochondria switched from spending sim-
ilar amounts of time in the post-fusion fused state and post-
fission single state in control cells to spending the majority of
their time in the post-fission single state in ADDL-treated cells,
which is likely the reason that a net outcome of decreased mito-
chondrial length was observed in these cells. Such a switch of
steady-state morphology is likely attributable to the reduced ex-
pression of OPA1 caused by ADDL treatment, because recent
studies demonstrated that nonfusing mitochondria are charac-
terized by reduced OPA1 expression and that OPA1 depletion in
individual mitochondrion may preclude its fusion even if sur-
rounded by fusion-competent mitochondria (Twig et al., 2008).
Our results also showed that the distribution of mitochondrial
membrane proteins OPA1/Mfn1/Mfn2/Fis1 was altered in AD
neurons such that neuronal processes were devoid of these pro-
teins, a mitochondrial redistribution in AD neurons that was also
confirmed with a more widely used mitochondrial marker, COX
I. Intracellular mitochondria distribution is of critical impor-
tance to neurons since the great morphological complexity and
dependency on mitochondria for energy at multiple selective
sites make neurons particularly sensitive to perturbations in mi-
tochondrial distribution (Kann and Kovacs, 2007). The loss of
mitochondria from axon terminals leads to synaptic dysfunction
in flies (Stowers et al., 2002; Melov, 2004; Guo et al., 2005). Most
interestingly, in relation to mitochondrial distribution, we dem-
onstrated in M17 neuroblastoma cells that knockdown of DLP1/
OPA1/Mfn1/Mfn2 or overexpression of Fis1, conditions that
mimic changes in AD neurons, all caused perinuclear accumula-
tion of mitochondria, leaving more remote areas of the cell de-
void of mitochondria. Similarly, all of these manipulations also
resulted in a significant reduction of mitochondrial density and
uneven mitochondrial coverage in neuronal processes in differ-
entiated primary hippocampal neurons with significantly greater
axial neurite length devoid of mitochondria. Our data suggest
that changes in the expression of these mitochondrial fission and
fusion proteins likely underlie abnormal mitochondrial distribu-
tion in AD neurons.
Many in the field believe that A
plays a central role in the
pathogenesis of AD (Kamenetz et al., 2003). Early changes in the
AD brain include loss of synapses and synaptic loss is the most
robust correlate of AD-associated cognitive deficits. A
is a ho-
meostatic regulator of synaptic strength (Kamenetz et al., 2003),
suggesting that perturbations in soluble A
levels might be linked
to the learning and memory deficits in AD patients (Masliah et
al., 2001). Indeed, AD mouse models with elevated A
levels
exhibit decreased neuronal synaptophysin and PSD-95 staining
as well as dendritic spine loss (Mucke et al., 2000; Lanz et al., 2003;
Almeida et al., 2005; Spires et al., 2005) along with learning def-
icits well before the formation of senile plaques. Application of
A
or soluble oligomers (e.g., ADDLs), either in vitro or in vivo,
adversely affects LTP and synaptic transmission (Lambert et al.,
1998; Walsh et al., 2002; Wang et al., 2002; Cleary et al., 2005).
Along these lines, A
overexpression decreases spine density
(Hsieh et al., 2006) and ADDLs directly bind to dendritic spines
(Lacor et al., 2004) and induce abnormalities in spine composi-
tion, shape, and abundance (Lacor et al., 2007). However, it re-
mains unclear how these A
effects are transduced to synaptic
dysfunction. In this study, we found that ADDLs induced mito-
chondrial fragmentation accompanied by a decrease in mitochon-
drial coverage in neurites. At the same time, ADDL treatment also
caused significant decreases in the levels of both DLP1 and OPA1.
Functionally, ADDL treatment increased mitochondrial ROS
levels and decreased spine density and PSD 95-positive puncta. It
was reported that number of dendritic mitochondria affected the
number and plasticity of spines and synapses and, indeed, there is
a correlation between dendritic spine morphogenesis and re-
cruitment of nearby mitochondria (Li et al., 2004). In our study,
we found that DLP1 overexpression could not prevent mito-
chondrial ROS overproduction induced by ADDLs but could
efficiently alleviate synaptic loss or dysfunction caused by AD-
DLs, suggesting that mitochondrial distribution regulated by
DLP1 probably accounted for the synaptic dysfunction induced
by ADDLs. On the other hand, we showed that OPA1 could
alleviate ADDL-induced ROS overproduction by mitochondria.
These data suggest that OPA1 plays an important role in ADDL-
induced mitochondrial dysfunction, and yet one cannot rule out
the possibility that OPA1 is also involved in ADDL-induced syn-
aptic abnormalities through its effect on mitochondrial function.
Together, our data demonstrate significant changes in the ex-
pression and distribution of mitochondrial fission and fusion
proteins in vivo in AD and suggest altered mitochondrial dynam-
ics likely contribute to mitochondrial and neuronal dysfunction
in disease pathogenesis. We further found that A
-induced ab-
normal mitochondrial dynamics plays an important role in A
-
induced mitochondrial and synaptic dysfunction. Modulating
the expression of mitochondrial fission and fusion proteins likely
represents a potential novel therapeutic strategy for treating AD.
References
Almeida CG, Tampellini D, Takahashi RH, Greengard P, Lin MT, Snyder EM,
Gouras GK (2005) Beta-amyloid accumulation in APP mutant neurons
reduces PSD-95 and GluR1 in synapses. Neurobiol Dis 20:187–198.
Barsoum MJ, Yuan H, Gerencser AA, Liot G, Kushnareva Y, Gra¨ber S, Kovacs
I, Lee WD, Waggoner J, Cui J, White AD, Bossy B, Martinou JC, Youle RJ,
Lipton SA, Ellisman MH, Perkins GA, Bossy-Wetzel E (2006) Nitric
oxide-induced mitochondrial fission is regulated by dynamin-related
GTPases in neurons. EMBO J 25:3900 –3911.
Benard G, Bellance N, James D, Parrone P, Fernandez H, Letellier T, Rossig-
nol R (2007) Mitochondrial bioenergetics and structural network orga-
nization. J Cell Sci 120:838 848.
Blass JP, Sheu RK, Gibson GE (2000) Inherent abnormalities in energy me-
tabolism in Alzheimer disease. Interaction with cerebrovascular compro-
mise. Ann N Y Acad Sci 903:204 –221.
Bubber P, Haroutunian V, Fisch G, Blass JP, Gibson GE (2005) Mitochon-
drial abnormalities in Alzheimer brain: mechanistic implications. Ann
Neurol 57:695–703.
Cereghetti GM, Stangherlin A, Martins de Brito O, Chang CR, Blackstone C,
Bernardi P, Scorrano L (2008) Dephosphorylation by calcineurin regu-
lates translocation of Drp1 to mitochondria. Proc Natl Acad Sci U S A
105:15803–15808.
Chan DC (2006) Mitochondrial fusion and fission in mammals. Annu Rev
Cell Dev Biol 22:79 –99.
Cho DH, Nakamura T, Fang J, Cieplak P, Godzik A, Gu Z, Lipton SA (2009)
S-nitrosylation of Drp1 mediates beta-amyloid-related mitochondrial fis-
sion and neuronal injury. Science 324:102–105.
Cleary JP, Walsh DM, Hofmeister JJ, Shankar GM, Kuskowski MA, Selkoe DJ,
Ashe KH (2005) Natural oligomers of the amyloid-beta protein specifi-
cally disrupt cognitive function. Nat Neurosci 8:79 84.
Coleman P, Federoff H, Kurlan R (2004) A focus on the synapse for neuro-
protection in Alzheimer disease and other dementias. Neurology
63:1155–1162.
9102 J. Neurosci., July 15, 2009 29(28):9090 –9103 Wang et al. Mitochondrial Dynamics in AD
Page 13
DeKosky ST, Scheff SW (1990) Synapse loss in frontal cortex biopsies in
Alzheimer’s disease: correlation with cognitive severity. Ann Neurol
27:457–464.
Delettre C, Lenaers G, Griffoin JM, Gigarel N, Lorenzo C, Belenguer P,
Pelloquin L, Grosgeorge J, Turc-Carel C, Perret E, Astarie-Dequeker C,
Lasquellec L, Arnaud B, Ducommun B, Kaplan J, Hamel CP (2000) Nu-
clear gene OPA1, encoding a mitochondrial dynamin-related protein, is
mutated in dominant optic atrophy. Nat Genet 26:207–210.
Deng H, Dodson MW, Huang H, Guo M (2008) The Parkinson’s disease
genes pink1 and parkin promote mitochondrial fission and/or inhibit
fusion in Drosophila. Proc Natl Acad Sci U S A 105:14503–14508.
Exner N, Treske B, Paquet D, Holmstro¨m K, Schiesling C, Gispert S, Carballo-
Carbajal I, Berg D, Hoepken HH, Gasser T, Kru¨ger R, Winklhofer KF,
Vogel F, Reichert AS, Auburger G, Kahle PJ, Schmid B, Haass C (2007)
Loss-of-function of human PINK1 results in mitochondrial pathology
and can be rescued by parkin. J Neurosci 27:12413–12418.
Guo X, Macleod GT, Wellington A, Hu F, Panchumarthi S, Schoenfield M,
Marin L, Charlton MP, Atwood HL, Zinsmaier KE (2005) The GTPase
dMiro is required for axonal transport of mitochondria to Drosophila
synapses. Neuron 47:379 –393.
Han XJ, Lu YF, Li SA, Kaitsuka T, Sato Y, Tomizawa K, Nairn AC, Takei K,
Matsui H, Matsushita M (2008) CaM kinase I alpha-induced phosphor-
ylation of Drp1 regulates mitochondrial morphology. J Cell Biol
182:573–585.
Hsieh H, Boehm J, Sato C, Iwatsubo T, Tomita T, Sisodia S, Malinow R
(2006) AMPAR removal underlies Abeta-induced synaptic depression
and dendritic spine loss. Neuron 52:831– 843.
Kamenetz F, Tomita T, Hsieh H, Seabrook G, Borchelt D, Iwatsubo T, Sisodia
S, Malinow R (2003) APP processing and synaptic function. Neuron
37:925–937.
Kann O, Kovacs R (2007) Mitochondria and neuronal activity. Am J Physiol
292:C641–C657.
Khachaturian ZS, Emr M (1984) Research workshop on the diagnosis of
Alzheimer-disease. Neurobiol Aging 5:161–162.
Klein WL (2002) A beta toxicity in Alzheimer’s disease: globular oligomers
(ADDLs) as new vaccine and drug targets. Neurochem Int 41:345–352.
Lacor PN, Buniel MC, Chang L, Fernandez SJ, Gong Y, Viola KL, Lambert
MP, Velasco PT, Bigio EH, Finch CE, Krafft GA, Klein WL (2004) Syn-
aptic targeting by Alzheimer’s-related amyloid beta oligomers. J Neurosci
24:10191–10200.
Lacor PN, Buniel MC, Furlow PW, Clemente AS, Velasco PT, Wood M, Viola
KL, Klein WL (2007) A
oligomer-induced aberrations in synapse com-
position, shape, and density provide a molecular basis for loss of connec-
tivity in Alzheimer’s disease. J Neurosci 27:796 807.
Lambert MP, Barlow AK, Chromy BA, Edwards C, Freed R, Liosatos M,
Morgan TE, Rozovsky I, Trommer B, Viola KL, Wals P, Zhang C, Finch
CE, Krafft GA, Klein WL (1998) Diffusible, nonfibrillar ligands derived
from Abeta1–42 are potent central nervous system neurotoxins. Proc
Natl Acad Sci U S A 95:6448 6453.
Lanz TA, Carter DB, Merchant KM (2003) Dendritic spine loss in the hip-
pocampus of young PDAPP and Tg2576 mice and its prevention by the
ApoE2 genotype. Neurobiol Dis 13:246–253.
Li Z, Okamoto K, Hayashi Y, Sheng M (2004) The importance of dendritic
mitochondria in the morphogenesis and plasticity of spines and synapses.
Cell 119:873– 887.
Masliah E, Mallory M, Alford M, DeTeresa R, Hansen LA, McKeel DW Jr,
Morris JC (2001) Altered expression of synaptic proteins occurs early
during progression of Alzheimer’s disease. Neurology 56:127–129.
Melov S (2004) Modeling mitochondrial function in aging neurons. Trends
Neurosci 27:601– 606.
Mirra S (2000) Vascular lesions and the Consortium to Establish a Registry
for Alzheimer’s Disease (CERAD). Brain Pathol 10:591.
Mortiboys H, Thomas KJ, Koopman WJ, Klaffke S, Abou-Sleiman P, Olpin S,
Wood NW, Willems PH, Smeitink JA, Cookson MR, Bandmann O
(2008) Mitochondrial function and morphology are impaired in parkin-
mutant fibroblasts. Ann Neurol 64:555–565.
Mucke L, Masliah E, Yu GQ, Mallory M, Rockenstein EM, Tatsuno G, Hu K,
Kholodenko D, Johnson-Wood K, McConlogue L (2000) High-level
neuronal expression of A
1–42
in wild-type human amyloid protein pre
-
cursor transgenic mice: synaptotoxicity without plaque formation. J Neu-
rosci 20:4050 4058.
Park J, Lee G, Chung J (2009) The PINK1-Parkin pathway is involved in the
regulation of mitochondrial remodeling process. Biochem Biophys Res
Commun 378:518 –523.
Poole AC, Thomas RE, Andrews LA, McBride HM, Whitworth AJ, Pallanck
LJ (2008) The PINK1/Parkin pathway regulates mitochondrial mor-
phology. Proc Natl Acad Sci U S A 105:1638 –1643.
Rui Y, Tiwari P, Xie Z, Zheng JQ (2006) Acute impairment of mitochondrial
trafficking by
-amyloid peptides in hippocampal neurons. J Neurosci
26:10480–10487.
Smirnova E, Griparic L, Shurland DL, van der Bliek AM (2001) Dynamin-
related protein Drp1 is required for mitochondrial division in mamma-
lian cells. Mol Biol Cell 12:2245–2256.
Smith MA (1998) Alzheimer disease. Int Rev Neurobiol 42:1–54.
Spires TL, Meyer-Luehmann M, Stern EA, McLean PJ, Skoch J, Nguyen PT,
Bacskai BJ, Hyman BT (2005) Dendritic spine abnormalities in amyloid
precursor protein transgenic mice demonstrated by gene transfer and
intravital multiphoton microscopy. J Neurosci 25:7278 –7287.
Stowers RS, Megeath LJ, Go´ rska-Andrzejak J, Meinertzhagen IA, Schwarz TL
(2002) Axonal transport of mitochondria to synapses depends on mil-
ton, a novel Drosophila protein. Neuron 36:1063–1077.
Swerdlow RH, Kish SJ (2002) Mitochondria in Alzheimer’s disease. Int Rev
Neurobiol 53:341–385.
Taguchi N, Ishihara N, Jofuku A, Oka T, Mihara K (2007) Mitotic phos-
phorylation of dynamin-related GTPase Drp1 participates in mitochon-
drial fission. J Biol Chem 282:11521–11529.
Terry RD, Masliah E, Salmon DP, Butters N, DeTeresa R, Hill R, Hansen LA,
Katzman R (1991) Physical basis of cognitive alterations in Alzheimer’s
disease: synapse loss is the major correlate of cognitive impairment. Ann
Neurol 30:572–580.
Twig G, Elorza A, Molina AJ, Mohamed H, Wikstrom JD, Walzer G, Stiles L,
Haigh SE, Katz S, Las G, Alroy J, Wu M, Py BF, Yuan J, Deeney JT, Corkey
BE, Shirihai OS (2008) Fission and selective fusion govern mitochon-
drial segregation and elimination by autophagy. EMBO J 27:433–446.
Verstreken P, Ly CV, Venken KJ, Koh TW, Zhou Y, Bellen HJ (2005) Syn-
aptic mitochondria are critical for mobilization of reserve pool vesicles at
Drosophila neuromuscular junctions. Neuron 47:365–378.
Walsh DM, Klyubin I, Fadeeva JV, Cullen WK, Anwyl R, Wolfe MS, Rowan
MJ, Selkoe DJ (2002) Naturally secreted oligomers of amyloid beta pro-
tein potently inhibit hippocampal long-term potentiation in vivo. Nature
416:535–539.
Wang H, Lim PJ, Karbowski M, Monteiro MJ (2009) Effects of overexpres-
sion of huntingtin proteins on mitochondrial integrity. Hum Mol Genet
18:737–752.
Wang HW, Pasternak JF, Kuo H, Ristic H, Lambert MP, Chromy B, Viola KL,
Klein WL, Stine WB, Krafft GA, Trommer BL (2002) Soluble oligomers
of beta amyloid (1-42) inhibit long-term potentiation but not long-term
depression in rat dentate gyrus. Brain Res 924:133–140.
Wang X, Su B, Fujioka H, Zhu X (2008a) Dynamin-like protein 1 reduction
underlies mitochondrial morphology and distribution abnormalities in
fibroblasts from sporadic Alzheimer’s disease patients. Am J Pathol
173:470 482.
Wang X, Su B, Siedlak SL, Moreira PI, Fujioka H, Wang Y, Casadesus G, Zhu
X (2008b) Amyloid-beta overproduction causes abnormal mitochon-
drial dynamics via differential modulation of mitochondrial fission/fu-
sion proteins. Proc Natl Acad Sci U S A 105:19318 –19323.
Yang Y, Ouyang Y, Yang L, Beal MF, McQuibban A, Vogel H, Lu B (2008)
Pink1 regulates mitochondrial dynamics through interaction with the
fission/fusion machinery. Proc Natl Acad Sci U S A 105:7070 –7075.
Zhu X, Rottkamp CA, Boux H, Takeda A, Perry G, Smith MA (2000) Acti-
vation of p38 kinase links tau phosphorylation, oxidative stress, and cell
cycle-related events in Alzheimer disease. J Neuropathol Exp Neurol
59:880 888.
Zhu X, Smith MA, Perry G, Aliev G (2004) Mitochondrial failures in Alz-
heimer’s disease. Am J Alzheimers Dis Other Demen 19:345–352.
Wang et al. Mitochondrial Dynamics in AD J. Neurosci., July 15, 2009
29(28):9090 –9103 9103
Page 14
  • Source
    • "G418 (400 μg/mL) was used to select for cells that stably expressed APN [34, 35]. For apn gene knockdown experiments, apn gene fragments were cloned into the pcDNA ™ 6.2-GW/miR expression vector (Invitrogen) [36]. The resultant pcDNA ™ 6.2-GW/ miR-APN plasmid was transfected into IPEC-J2 cells and established cell lines of pcDNA ™ 6.2-GW/miR-apn were screened and selected using Blasticidin S Hydrochloride (Blasticidin S HCl, 4 µg/mL). "
    [Show abstract] [Hide abstract] ABSTRACT: F4 + enterotoxigenic Escherichia coli (ETEC) strains cause diarrheal disease in neonatal and post-weaned piglets. Several different host receptors for F4 fimbriae have been described, with porcine aminopeptidase N (APN) reported most recently. The FaeG subunit is essential for the binding of the three F4 variants to host cells. Here we show in both yeast two-hybrid and pulldown assays that APN binds directly to FaeG, the major subunit of F4 fimbriae, from three serotypes of F4 + ETEC. Modulating APN gene expression in IPEC-J2 cells affected ETEC adherence. Antibodies raised against APN or F4 fimbriae both reduced ETEC adherence. Thus, APN mediates the attachment of F4 + E. coli to intestinal epithelial cells.
    Full-text · Article · Dec 2016 · Veterinary Research
    • "The imbalance between these two processes is critical for mitochondrial function. In neurodegenerative conditions as AD but also in chronological aging, changes in fusion/fission imbalance were reported [18, 51]. B A CFig. 4 Results of elevated plus maze (EPM) test in senescenceaccelerated prone mouse (SAMP8) fed with normal diet (SP8 ND), high-fat diet (SP8 HF), or high-fat diet plus resveratrol (SP8 HF + RV). a Time spent in closed arms. "
    [Show abstract] [Hide abstract] ABSTRACT: Metabolic stress induced by high-fat (HF) diet leads to cognitive dysfunction and aging, but the physiological mechanisms are not fully understood. Senescence-accelerated prone mouse (SAMP8) models were conducted under metabolic stress conditions by feeding HF for 15 weeks, and the preventive effect of resveratrol was studied. This dietary strategy demonstrates cognitive impairment in SAMP8-HF and significant preventive effect by resveratrol-treated animals. Hippocampal changes in the proteins involved in mitochondrial dynamics optic atrophy-1 protein (OPA1) and mitofusin 2 (MFN2) comprised a differential feature found in SAMP8-HF that was prevented by resveratrol. Electronic microscopy showed a larger mitochondria in SAMP8-HF + resveratrol (SAMP8-HF + RV) than in SAMP8-HF, indicating increases in fusion processes in resveratrol-treated mice. According to the mitochondrial morphology, significant increases in the I-NDUFB8, II-SDNB, III-UQCRC2, and V-ATPase complexes, in addition to that of voltage-dependent anion channel 1 (VDAC1)/porin, were found in resveratrol-treated animals with regard to SAMP8-HF, reaching control-animal levels. Moreover, tumor necrosis factor alpha (TNF-α) and interleukin (IL-6) were increased after HF, and resveratrol prevents its increase. Moreover, we found that the HF diet affected the Wnt pathway, as demonstrated by β-catenin inactivation and modification in the expression of several components of this pathway. Resveratrol induced strong activation of β-catenin. The metabolic stress rendered in the cognitive and cellular pathways altered in SAMP8 focus on different targets in order to act on preventing cognitive impairment in neurodegeneration, and resveratrol can offer therapeutic possibilities for preventive strategies in aging or neurodegenerative conditions.
    No preview · Article · Feb 2016 · Molecular Neurobiology
  • Source
    • "These observations suggest that Aβ-mediated cytotoxic effects lead to enhanced Drp1 activity through the generation of nitric oxide. One study found the contrary result of reduced levels of Drp1 in fibroblasts from sporadic AD patients and AD patient brains (Wang et al., 2008aWang et al., , 2009a). The same group provided further evidence that overexpression of APP in M17 neuroblastoma cells results in predominant mitochondrial fragmentation and decreased levels of Drp1 and OPA1, while overexpression of Drp1 or OPA1 could partially rescue some of these defects (Wang et al., 2008b). "
    [Show abstract] [Hide abstract] ABSTRACT: Mitochondrial dysfunction is one of the earliest and most prominent features in the brains of Alzheimer’s disease (AD) patients. Recent studies suggest that mitochondrial dysfunction plays a pivotal role in the pathogenesis of AD. Neurons are metabolically active cells, causing them to be particularly dependent on mitochondrial function for survival and maintenance. As highly dynamic organelles, mitochondria are characterized by a balance of fusion and fission, transport, and mitophagy, all of which are essential for maintaining mitochondrial integrity and function. Mitochondrial dynamics and mitophagy can therefore be identified as key pathways in mitochondrial quality control. Tremendous progress has been made in studying changes in these key aspects of mitochondrial biology in the vulnerable neurons of AD brains and mouse models, and the potential underlying mechanisms of such changes. This review highlights recent findings on alterations in the mitochondrial dynamics and mitophagy in AD and discusses how these abnormalities impact mitochondrial quality control and thus contribute to mitochondrial dysfunction in AD.
    Full-text · Article · Feb 2016 · Frontiers in Cellular Neuroscience
Show more