ArticlePDF Available

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

September 2014
Journal of Visualized Experiments

September 2014

DOI:10.3791/51891

Source
PubMed

Authors:

Stancy Joseph

U.S. Food and Drug Administration

Karen D Cowden Dahl

Indiana University-Purdue University Indianapolis

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly proliferative, invasive, and chemoresistant tumor cells. Therefore, CSCs are an attractive population of cells to target therapeutically. CSCs are predicted to contribute to a number of types of malignancies including those in the blood, brain, lung, gastrointestinal tract, prostate, and ovary. Isolating and enriching a tumor cell population for CSCs will enable researchers to study the properties, genetics, and therapeutic response of CSCs. We generated a protocol that reproducibly enriches for ovarian cancer CSCs from ovarian cancer cell lines (SKOV3 and OVCA429). Cell lines are treated with 20 µM cisplatin for 3 days. Surviving cells are isolated and cultured in a serum-free stem cell media containing cytokines and growth factors. We demonstrate an enrichment of these purified CSCs by analyzing the isolated cells for known stem cell markers Oct4, Nanog, and Prom1 (CD133) and cell surface expression of CD177 and CD133. The CSCs exhibit increased chemoresistance. This method for isolation of CSCs is a useful tool for studying the role of CSCs in chemoresistance and tumor relapse.

Morphology of SKOV3 and OVCA429 cells and cancer stem cells (CSCs) selected from SKOV3 and OVCA429 cells. Phase contrast microscopy depicts SKOV3 and OVCA429 cells (adherent) that are untreated and have been selected for CSCs (spheroid).

…

Enrichment for CSCs yields non-adherent spheroids. (A) SKOV3 cells untreated and enriched for CSCs (60X magnification). (B) SKOV3-RFP cells that are untreated ( a and b ) or enriched for CSCs ( c and d ). Left panels depict phase contrast images and right panels depict fluorescence. Original magnification 40X. Scale bar = 400 microns.

…

CSCs exhibit increased chemoresistance compared to untreated cell lines. SKOV3 ( A and B ) and SKOV3-RFP ( C and D ), SKOV3 CSCs ( A and B ) and SKOV3-RFP CSCs ( C and D ) were treated with various concentrations of cisplatin ( A and C ) or paclitaxel (Taxol) ( B and D ). 96 hr post treatment MTT assay was performed. Experiments were performed in n≥3 and statistics were calculated using Two Way ANOVA; *p<0.05, ***p<0.0005. Please click here to view a larger version of this figure.

…

Flow Cytometry Analysis of stem cell markers in SKOV3 cells and SKOV3 CSCs alone or transduced or without RFP. CD133, CD117, and CD133/CD117 expression in (A) SKOV3 (untreated/control) cells, (B) SKOV3 CSCs, (C) SKOV3-RFP untreated cells, and (D) SKOV3-RFP CSCs. Experiments were performed in triplicate. Please click here to view a larger version of this figure.

…

Figures - uploaded by Stancy Joseph

Content may be subject to copyright.

Content uploaded by Stancy Joseph

Content may be subject to copyright.

Journal of Visualized Experiments www.jove.com

Video Article

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell

Lines

Jennifer M. Cole1, Stancy Joseph1, Christopher G. Sudhahar1, Karen D. Cowden Dahl1

1Department of Biochemistry and Molecular Biology, Indiana University School of Medicine

Correspondence to: Karen D. Cowden Dahl at kcowdend@iupui.edu

URL: http://www.jove.com/video/51891

DOI: doi:10.3791/51891

Keywords: Medicine, Issue 91, cancer stem cells, stem cell markers, ovarian cancer, chemoresistance, cisplatin, cancer progression

Date Published: 9/10/2014

Citation: Cole, J.M., Joseph, S., Sudhahar, C.G., Cowden Dahl, K.D. Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell

Lines. J. Vis. Exp. (91), e51891, doi:10.3791/51891 (2014).

Abstract

Cancer stem cells (CSCs) are defined as a subset of slow cycling and undifferentiated cells that divide asymmetrically to generate highly

proliferative, invasive, and chemoresistant tumor cells. Therefore, CSCs are an attractive population of cells to target therapeutically. CSCs are

predicted to contribute to a number of types of malignancies including those in the blood, brain, lung, gastrointestinal tract, prostate, and ovary.

Isolating and enriching a tumor cell population for CSCs will enable researchers to study the properties, genetics, and therapeutic response of

CSCs. We generated a protocol that reproducibly enriches for ovarian cancer CSCs from ovarian cancer cell lines (SKOV3 and OVCA429). Cell

lines are treated with 20 µM cisplatin for 3 days. Surviving cells are isolated and cultured in a serum-free stem cell media containing cytokines

and growth factors. We demonstrate an enrichment of these purified CSCs by analyzing the isolated cells for known stem cell markers Oct4,

Nanog, and Prom1 (CD133) and cell surface expression of CD177 and CD133. The CSCs exhibit increased chemoresistance. This method for

isolation of CSCs is a useful tool for studying the role of CSCs in chemoresistance and tumor relapse.

Video Link

The video component of this article can be found at http://www.jove.com/video/51891/

Introduction

Resistance to chemotherapy is a major impediment to the treatment and cure of cancer. Ovarian cancer is the 5th leading cause of cancer-

related deaths among women in the United States (American Cancer Society Facts and Figures 2013). Patients initially respond well to

chemotherapy, but most patients relapse1. After relapse patients are treated with a variety of additional chemotherapy agents with very little

benefit2. General properties of CSCs include unlimited proliferative capabilities, retention of an undifferentiated state, resistance to drug

treatment, efficient DNA repair, and ability to generate malignant tumor cells with different phenotypes3. CSCs frequently exhibit expression of

stem cell genes such as Nanog, Oct4, Sox2, Nestin, CD133, and CD117. CSCs often express elevated levels of ABCG2, and ALDH genes that

may contribute to drug efflux and metabolism3,4.

The first definitive evidence for CSCs was demonstrated by isolating acute myeloid leukemia-initiating cells that were capable of self-renewal and

tumor generation5. These leukemic stem cells expressed surface CD34 and generated leukemia in NOD/SCID (immunocompromised) mice5.

Since then CSCs have been identified in many cancer types including leukemias/lymphomas, breast, bladder, colorectal, endometrial, sarcomas,

hepatocellular carcinoma, melanomas, gliomas, ovarian, pancreatic, prostate, squamous cell carcinoma, and lung6. Therefore, being able to

study this subtype of cancer cell is advantageous.

The goal of this study is to create a protocol for the selection and isolation of chemoresistant CSCs. Several methods have been reported for

the isolation of CSCs from ovarian cancer cell lines. Non-adherent spheroids isolated from OVCAR-3, SKOV3, or HO8910 cultures demonstrate

stem-like properties7,8. Isolation of CD133+ cells from OVCAR-3 cultures also yields CSCs. CSCs have also been selected in culture by

treatment with chemotherapeutic agents. Treating tumor cell lines (OVCA433, Hey, and SKOV3 cells) with cisplatin and paclitaxel allows for

the expansion and isolation of CSCs4,9. While culture of some cell types in CSC media leads to isolation of CSCs, SKOV3 cells did not survive

culture in serum-free media or form sphere cells4. Therefore, treatment of cells with cisplatin and paclitaxel aided the expansion or isolation of

this population4.

Using a modification of the procedure presented by Ma and colleagues4 we developed a method to isolate CSCs from the ovarian cancer cell

lines. Our protocol is advantageous as it yields more viable cells while using less toxic chemotherapeutic agents. Cells are treated with cisplatin

and subsequently grown in serum-free media supplemented with growth factors (stem cell media). We isolate the resulting non-adherent sphere

cells and assay them for their expression of stem cell markers. This model enables the study of CSC properties and response to drug therapy.

Journal of Visualized Experiments www.jove.com

Protocol

1. Cell Culture and Fluorescent Labeling of Ovarian Cancer Cell Lines

1. Prepare SKOV3 media: McCoy media supplemented with 10% fetal bovine serum (FBS), 0.1 mM L-glutamine, 50 U/ml penicillin, and 50 μg/

ml streptomycin. Maintain OVCA429 cells in minimal essential media (MEM) supplemented with 10% FBS, 1 mM sodium pyruvate, 0.1 mM L-

glutamine, 50 U/ml penicillin, and 50 μg/ml streptomycin.

2. Propagate SKOV3 and OVCA429 cell lines in a humidified incubator at 37 °C with 5% CO2. Grow cells to 40-50% confluency.

3. Generate cells expressing red fluorescent protein (RFP) in order to monitor viability in vitro and in vivo.

1. To generate SKOV3 cells expressing RFP, add lentiviral particles expressing RFP and 10 μg/ml polybrene to SKOV3 media in the

absence of penicillin and streptomycin for 72 hr.

2. After 72 hr, select for RFP positive cells by Fluorescence Activated Cell Sorting (FACS) as follows: Trypsinize RFP and non-RFP

expressing cells, centrifuge at 125 x g for 5 min, resuspend cells at 107 cells/ml in PBS containing 0.1% BSA. On a cell sorter, use non-

RFP cells to determine the sorting parameters. Then collect cells that express high RFP using a 561 nm laser.

3. Alternatively, if the lentiviral plasmid expresses an antibiotic resistance cassette, select for RFP expressing cells by culturing in the

appropriate antibiotic (such as 10 mg/ml blasticidin). NOTE: The amount of lentiviral particles that needs to be used can vary by batch

and by cell type. Proper lentiviral titer should be determined for each cell type.

2. Enrichment of Cancer Stem Cells

1. Treat SKOV3, SKOV3-RFP, or OVCA429 cell lines with 20 μM of cisplatin for 72 hr. CAUTION: Cisplatin is toxic. Use protective clothing/

gloves and avoid contact with skin and mucus membranes. Do not dispose of cisplatin in wastewater.

2. Prepare CSC media: serum free DMEM/F12 media supplemented with 5 μg/ml insulin, 10 ng/ml human recombinant epidermal growth factor

(EGF), 10 ng/ml basic fibroblast growth factor (bFGF), 12 ng/ml leukemia inhibitory factor, and 0.4% bovine serum albumin (BSA).

3. Trypsinize cells. Culture surviving cells in CSC media.

NOTE: After 2 days in culture non-adherent spheroids will form.

4. Change media every 2 days by collecting media containing cells and centrifuging at 125 x g for 5 min. Then resuspend the pellet in fresh

CSC media. Check cells for viability every 2 days by counting cells and performing trypan blue exclusion.

5. Then collect CSCs for further experiments by centrifuging 129 x g for 5 min and resuspending the pellet in phenol containing guanidinium

thiocynate (RNA), phosphate buffered saline (PBS: 137 mM NaCl, 2.7 mM KCl, and 11.9 mM phosphate buffer, pH 7.4) with 0.1% BSA (for

flow cytometry), or CSC media to continue culturing the cells.

6. Monitor CSC cell morphology using a light microscope at 20X and 40X magnifications.

3. CSC Characterization via Gene Expression Analysis for Stem Cell Markers

1. Collect 3 preparations of CSCs by collecting media containing cells, centrifuging at 129 x g for 5 min, and resuspending the pellet in a

solution of phenol containing guanidinium thiocynate (other methods for RNA extraction may be used).

2. Prepare total RNA using TRIzol according to the manufacturer’s protocol. Synthesize complementary DNA (cDNA) from 0.1-1 µg of RNA

using a commercially available cDNA Reverse Transcription kit.

3. Perform quantitative reverse transcribed polymerase chain reaction (QRT-PCR).

1. Make up master mix for each set of primers containing QRT-PCR mix, primers, and water to total 8 µl per sample (primers with different

fluorophores can be amplified in the same well). For example, generate one master mix for Oct4-FAM, Nanog-Hex, and GAPDH-CY5.

Generate separate master mixes for Nestin and Prom1. Add 2 µl of cDNA template per sample.

NOTE: For this study, QRT-PCR was performed using the primers listed in Table 1.

2. Perform all QRT-PCR in duplicate for each sample using a real time PCR thermocycler capable of detecting multiple fluorophores.

Include no template controls.

3. Normalize stem cell gene expression to GAPDH expression for each sample using the ΔΔCT method.

Primer 1: 5′-CCCAAGGAATAGTCTGTAGAAGTG-3′

Primer 2: 5′-TGCATGAGTCAGTGAACAGG-3′

Oct-4-FAM

FAM probe: 5′-CTTCCAAGC/ZEN/TGCCCACCTAACTTCT/3IABkFQ -3′

Primer 1: 5′-CCTTCTGCGTCACACCATT-3′

Primer 2: 5′-AACTCTCCAACATCCTGAACC-3′

Nanog-HEX

HEX probe: 5′-CTGCCACCT/

ZEN.CTTAGATTTCATTCTCTGGT/3IABkFQ-3′

Primer 1: 5′-TGTAGTTGAGGTCAATGAAGGG-3′

Primer 2: 5′-ACATCGCTCAGACACCATG-3′

GAPDH-CY5

CY5 probe: 5′-AAGGTCGGAGTCAACGGATTTGGTC/3IABRQSP-3′

NESTIN-FAM Primer 1: 5′-AGGACCTGAGCGATCTGG-3′

Journal of Visualized Experiments www.jove.com

Primer 2: 5′-CGTTGGAACAGAGGTTGGAG-3′

FAM probe: 5′-AACTTTTCA/ZEN/GTAGCCCGCAGCC/3IABkFQ -3′

Primer 1: 5′-ACTCTCTCCAACAATCCATTCC-3′

Primer 2: 5′-AAACAATTCACCAGCAACGAG-3′

CD133-HEX

HEX probe: 5′-ACAATCACT/ZEN/

GAGCACTCTATACCAAAGCG/3IABkFQ-3

Table 1. Primers used for CSC characterization by QRT-PCR.

4. Analyzing CSCs for Cell Surface Markers CD117 and CD133

1. Harvest CSCs by collecting media containing cells and centrifuging at 125 x g for 5 min. Add 500 µl of a non-proteolytic cell detachment

solution to break-up cells. Centrifuge cells at 125 x g for 5 min to remove cell detachment solution. Then wash cells twice with cold PBS.

2. Incubate in normal growth media for 1 hr prior to labeling cells. Spin down cells for 5 min at 129 x g. Resuspend cells in PBS with 0.1% BSA

with anti-CD133-PE and anti-CD117-FITC.

3. Fix cells overnight in 1% paraformaldehyde. Caution: Paraformaldehyde is toxic (suspected carcinogen). Make in fume hood and use within a

week.

4. Perform flow cytometry to analyze CD117 (with an anti-CD117 conjugated to FITC) and CD133 (with anti-CD133 conjugated to PE) cell

surface expression on a flow cytometer. Collect data on cells in the FL1 (for FITC) and FL3 (for PE) channels. Generate gates for cells

expressing both FITC and PE. Generate a dot plot with 4 quadrants (FITC- and PE-, FITC+ PE-, FITC- PE+, and FITC+ and PE+) and

determine the number of cells in each quadrant.

5. Analyzing CSCs for Therapeutic Response

1. Plate 5,000 cells per well (SKOV3, SKOV3-RFP, SKOV3 CSC and SKOV3-RFP CSCs) on 96-well plates overnight.

2. Treat with cisplatin (0, 1, 10, 100, and 1,000 µM) or paclitaxel (0, 0.01, 0.1, 1, 10, and 100 µM) for 96 hr.

3. Perform MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) cell viability assay.

1. Plate 5,000 cells per 100 µl per well on a 96-well plate (plate cells in duplicate and include media only control wells).

2. After 24 hr, add 10 µl of 10 mg/ml MTT. Incubate at 37 °C for 2-4 hr (until precipitate forms).

3. Add 100 µl of MTT solvent 4 mM HCl, 0.1% NP-40 in isopropanol. Incubate for 15 min in dark.

4. Read plates at 570 nm on a plate reader.

Representative Results

To demonstrate that we isolated CSCs from epithelial ovarian cancer cell lines using cisplatin treatment, we first acquired images of the cell

lines prior to treatment and after selection. We used light microscopy to capture images of adherent (untreated) SKOV3 and OVCA429 cells and

SKOV3 and OVCA429 CSCs (Figure 1). CSCs appear round and not attached to the tissue culture plates (Figures 1 and 2). We further show

that SKOV3 cells transduced with RFP retain their fluorescence after isolation of the CSCs demonstrating that the cells are viable (Figure 2B).

Viable CSC cultures were assessed for their response to drug therapy. CSCs demonstrated increased resistance to cisplatin (particularly at

100 µM) and paclitaxel (10 µM) (Figure 3). CSCs are often characterized by their expression of stem cell genes. Expression of CD133 (also

known as Prom1), Nestin, Nanog, and Oct4 was examined. CD133 was significantly induced in SKOV3 CSC cultures compared to untreated

(control) cells (Figure 4A). CD133 was also induced in CSC cultures compared to untreated controls by 16-fold and 13-fold in the OVCA429

and OVCA429-RFP cells (data not shown). In initial experiments Oct4, Nanog, and Nestin were elevated in SKOV3 CSC cultures compared to

untreated, but the results were not statistically significant (Figure 4A). Upon repeating these experiments Oct4 and Nanog increased in SKOV3

CSCs compared to parental control cells (Figure 4B). Oct4 was increased by 4.7-fold and 8-fold in the OVCA429 and OVCA429-RFP cells

following the CSC enrichment protocol (not shown). Finally, SKOV3 CSCs exhibit increased cell surface expression of the CSC marker CD117

(Figure 5). In conclusion, this method allows for selection of viable spheroid CSCs (expressing stem cell markers) in ovarian cancer cell lines by

selection with cisplatin and growth in stem cell media.

Journal of Visualized Experiments www.jove.com

Figure 1. Morphology of SKOV3 and OVCA429 cells and cancer stem cells (CSCs) selected from SKOV3 and OVCA429 cells. Phase

contrast microscopy depicts SKOV3 and OVCA429 cells (adherent) that are untreated and have been selected for CSCs (spheroid).

Journal of Visualized Experiments www.jove.com

Figure 2. Enrichment for CSCs yields non-adherent spheroids. (A) SKOV3 cells untreated and enriched for CSCs (60X magnification).

(B) SKOV3-RFP cells that are untreated (a and b) or enriched for CSCs (c and d). Left panels depict phase contrast images and right panels

depict fluorescence. Original magnification 40X. Scale bar = 400 microns.

Journal of Visualized Experiments www.jove.com

Figure 3. CSCs exhibit increased chemoresistance compared to untreated cell lines. SKOV3 (A and B) and SKOV3-RFP (C and D),

SKOV3 CSCs (A and B) and SKOV3-RFP CSCs (C and D) were treated with various concentrations of cisplatin (A and C) or paclitaxel (Taxol)

(B and D). 96 hr post treatment MTT assay was performed. Experiments were performed in n≥3 and statistics were calculated using Two Way

ANOVA; *p<0.05, ***p<0.0005. Please click here to view a larger version of this figure.

Journal of Visualized Experiments www.jove.com

Figure 4. Stem cell marker expression in CSCs compared to untreated cells. QRT-PCR analysis was performed for SKOV3 (control) and

SKOV3 CSCs. (A) CD133 (Prom1), Nestin, Nanog, and OCT4 (normalized to GAPDH). (B) An additional experiment demonstrating that the

SKOV3-RFP CSCs obtained from this protocol yield cells with elevated OCT4 and Nanog compared to untreated cells. Results were normalized

with GAPDH expression. N=3 and statistics were calculated using students T-test; **p<0.02, ***p<0.002.

Journal of Visualized Experiments www.jove.com

Figure 5. Flow Cytometry Analysis of stem cell markers in SKOV3 cells and SKOV3 CSCs alone or transduced or without RFP.

CD133, CD117, and CD133/CD117 expression in (A) SKOV3 (untreated/control) cells, (B) SKOV3 CSCs, (C) SKOV3-RFP untreated cells, and

(D) SKOV3-RFP CSCs. Experiments were performed in triplicate. Please click here to view a larger version of this figure.

Discussion

CSCs that are resistant to therapy may be accountable for relapse after treatment of primary tumor. Characterization of CSCs may lead to

improved therapies for ovarian cancer. The critical parameters in the establishment of chemoresistant CSCs using the above protocol are timing

the length of treatment with chemotherapy and the concentration of chemotherapy. When using the protocol in Ma et al. it was found that after 7

days of treatment with cisplatin and paclitaxel, no viable cells remained4. By reducing the treatment to 3 days (with 20 µM cisplatin instead of 40

µM cisplatin and 10 µM paclitaxel), viable chemoresistant cells and CSCs developed. The length and dose of treatment may need to be altered

for different ovarian cancer cell lines.

The major limitation of this protocol is the length that the CSCs remain viable. Using this protocol, the CSCs remain viable for less than a week.

Therefore, the types of experiments and analysis for the CSCs need to be carefully timed.

Further characterization of the CSCs needs to be conducted. It would be useful to compare this method of CSCs to other methods of CSC

generation to determine the similarity and difference between these cell types. Comparison of stem cell markers, response to therapy, and best

system for in vivo analysis needs to be conducted between different methods for generating/selection of CSCs. It has been suggested that there

are different types of CSCs with different expression patterns of stem cell markers and different prognosis for patients10-12, thus further definition

of what type of CSCs are generated by this protocol may help determine how they relate to human malignancy. Finally, in order to rigorously

demonstrate that the CSCs isolated from this protocol are definitive CSCs, cells need to be injected into immunocompromised mice in a limiting

dilution assay. This assay demonstrates that CSCs are able to generate ovarian tumors at a low density.

Disclosures

The authors declare they have no competing financial interest.

Acknowledgements

Serene Samyesudhas and Dr. Lynn Roy assisted in preparing samples for filming.

References

1. Pennington, K., Pulaski, H., Pennington, M.., & Liu, J. R. Too Much of a Good Thing: Suicide Prevention Promotes Chemoresistance in

Ovarian Carcinoma. Curr Cancer Drug Targets. 10, 575-83, doi:EPub-Abstract-CCDT-49 [pii] (2010).

Journal of Visualized Experiments www.jove.com

2. Thigpen, T. A rational approach to the management of recurrent or persistent ovarian carcinoma. Clin Obstet Gynecol. 55, 114-130,

doi:10.1097/GRF.0b013e31824b9bc5 (2012).

3. Burgos-Ojeda, D., Rueda, B. R.., & Buckanovich, R. J. Ovarian cancer stem cell markers: prognostic and therapeutic implications. Cancer

letters. 322, 1-7, doi:10.1016/j.canlet.2012.02.002 (2012).

4. Ma, L., Lai, D., Liu, T., Cheng, W.., & Guo, L. Cancer stem-like cells can be isolated with drug selection in human ovarian cancer cell line

SKOV3. Acta Biochim Biophys Sin (Shanghai). 42, 593-602, doi:10.1093/abbs/gmq067 (2010).

5. Bonnet, D.., & Dick, J. E. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell.

Nature medicine. 3, 730-737 (1997).

6. Alison, M. R., Lim, S. M.., & Nicholson, L. J. Cancer stem cells: problems for therapy? The Journal of pathology. 223, 147-161, doi:10.1002/

path.2793 (2011).

7. Luo, X., Dong, Z., Chen, Y., Yang, L.., & Lai, D. Enrichment of ovarian cancer stem-like cells is associated with epithelial to mesenchymal

transition through an miRNA-activated AKT pathway. Cell proliferation. 46, 436-446, doi:10.1111/cpr.12038 (2013).

8. Wang, L., Mezencev, R., Bowen, N. J., Matyunina, L. V.., & McDonald, J. F. Isolation and characterization of stem-like cells from a human

ovarian cancer cell line. Molecular and cellular biochemistry. 363, 257-268, doi:10.1007/s11010-011-1178-6 (2012).

9. Abubaker, K. et al. Short-term single treatment of chemotherapy results in the enrichment of ovarian cancer stem cell-like cells leading to an

increased tumor burden. Molecular cancer. 12, 24, doi:10.1186/1476-4598-12-24 (2013).

10. Conic, I., Dimov, I., Tasic-Dimov, D., Djordjevic, B.., & Stefanovic, V. Ovarian epithelial cancer stem cells. ScientificWorldJournal. 11,

1243-1269, doi:10.1100/tsw.2011.112 (2011).

11. Liu, K. C. et al. Ovarian cancer stem-like cells show induced translineage-differentiation capacity and are suppressed by alkaline

phosphatase inhibitor. Oncotarget. 4, 12, 2366-2382 (2013).

12. Liu, T., Cheng, W., Lai, D., Huang, Y.., & Guo, L. Characterization of primary ovarian cancer cells in different culture systems. Oncology

reports. 23, 1277-1284 (2010).

Can Stemness and Chemoresistance Be Therapeutically Targeted via Signaling Pathways in Ovarian Cancer?

Article

Full-text available

Jul 2018

Ovarian cancer is the most lethal gynecological malignancy. Poor overall survival, particularly for patients with high grade serous (HGS) ovarian cancer, is often attributed to late stage at diagnosis and relapse following chemotherapy. HGS ovarian cancer is a heterogenous disease in that few genes are consistently mutated between patients. Additionally, HGS ovarian cancer is characterized by high genomic instability. For these reasons, personalized approaches may be necessary for effective treatment and cure. Understanding the molecular mechanisms that contribute to tumor metastasis and chemoresistance are essential to improve survival rates. One favored model for tumor metastasis and chemoresistance is the cancer stem cell (CSC) model. CSCs are cells with enhanced self-renewal properties that are enriched following chemotherapy. Elimination of this cell population is thought to be a mechanism to increase therapeutic response. Therefore, accurate identification of stem cell populations that are most clinically relevant is necessary. While many CSC identifiers (ALDH, OCT4, CD133, and side population) have been established, it is still not clear which population(s) will be most beneficial to target in patients. Therefore, there is a critical need to characterize CSCs with reliable markers and find their weaknesses that will make the CSCs amenable to therapy. Many signaling pathways are implicated for their roles in CSC initiation and maintenance. Therapeutically targeting pathways needed for CSC initiation or maintenance may be an effective way of treating HGS ovarian cancer patients. In conclusion, the prognosis for HGS ovarian cancer may be improved by combining CSC phenotyping with targeted therapies for pathways involved in CSC maintenance.

Androgen/Androgen Receptor Signaling in Ovarian Cancer: Molecular Regulation and Therapeutic Potentials

Article

Full-text available

Jul 2021
INT J MOL SCI

Ovarian cancer (OVCA) arises from three cellular origins, namely surface epithelial cells, germ cells, and stromal cells. More than 85% of OVCAs are EOCs (epithelial ovarian carcinomas), which are the most lethal gynecological malignancies. Cancer stem/progenitor cells (CSPCs) are considered to be cancer promoters due to their capacity for unlimited self-renewal and drug resistance. Androgen receptor (AR) belongs to the nuclear receptor superfamily and can be activated through binding to its ligand androgens. Studies have reported an association between AR expression and EOC carcinogenesis, and AR is suggested to be involved in proliferation, migration/invasion, and stemness. In addition, alternative AR activating signals, including both ligand-dependent and ligand-independent, are involved in OVCA progression. Although some clinical trials have previously been conducted to evaluate the effects of anti-androgens in EOC, no significant results have been reported. In contrast, experimental studies evaluating the effects of anti-androgen or anti-AR reagents in AR-expressing EOC models have demonstrated positive results for suppressing disease progression. Since AR is involved in complex signaling pathways and may be expressed at various levels in OVCA, the aim of this article was to provide an overview of current studies and perspectives regarding the relevance of androgen/AR roles in OVCA.

Types of Cancer Stem Cells

Chapter

Oct 2020

The discovery of cancer stem cells (CSCs) has revolutionized the field of cancer biology due to the intrinsic role of CSCs in the initiation, progression or relapse of cancers. The identification of different types of CSCs has given a great opportunity to researchers and clinicians, to understand the basic biology of various types of CSCs or cancers, and has also added an extra dimension in the development of innovative approaches or therapeutics to specifically target CSCs. The morbidity and mortality caused by various cancers have started to decline rapidly in the past couple of decades. Furthermore, the life expectancy of cancer patients have increased with the invention of modern state-of-the-art technologies, besides rapid advances in the development and preclinical testing of new drugs that target CSCs. Additionally, more insights into the molecular biology of CSCs was made possible, when unique cell markers, which are specific to a particular type of tumor was deciphered. Importantly, the characterization and evaluation of key signalling pathways in CSCs are critical, as emerging evidence indicate that CSCs play a key role in dissemination during cancer metastasis or relapse. In this chapter, we discuss about CSCs that are specific to ovarian, thyroid, melanoma and pancreatic cancers. We also discuss about the key CSC signalling pathways, as understanding them will advance the therapeutic strategies, or evaluation of efficacy of novel CSC-targeting drugs that could be used in the treatment of cancer patients.

Ovarian Cancer, Cancer Stem Cells and Current Treatment Strategies: A Potential Role of Magmas in the Current Treatment Methods

Article

Full-text available

Mar 2020

Epithelial ovarian cancer (EOC) constitutes 90% of ovarian cancers (OC) and is the eighth most common cause of cancer-related death in women. The cancer histologically and genetically is very complex having a high degree of tumour heterogeneity. The pathogenic variability in OC causes significant impediments in effectively treating patients, resulting in a dismal prognosis. Disease progression is predominantly influenced by the peritoneal tumour microenvironment rather than properties of the tumor and is the major contributor to prognosis. Standard treatment of OC patients consists of debulking surgery, followed by chemotherapy, which in most cases end in recurrent chemoresistant disease. This review discusses the different origins of high-grade serous ovarian cancer (HGSOC), the major sub-type of EOC. Tumour heterogeneity, genetic/epigenetic changes, and cancer stem cells (CSC) in facilitating HGSOC progression and their contribution in the circumvention of therapy treatments are included. Several new treatment strategies are discussed including our preliminary proof of concept study describing the role of mitochondria-associated granulocyte macrophage colony-stimulating factor signaling protein (Magmas) in HGSOC and its unique potential role in chemotherapy-resistant disease.

Can Stemness and Chemoresistance be Therapeutically Targeted via Signaling Pathways in Ovarian Cancer?

Preprint

Full-text available

Jun 2018

Ovarian cancer is the most lethal gynecological malignancy. Poor overall survival, particularly for patients with high grade serous (HGS) ovarian cancer, are often attributed to late stage at diagnosis and relapse following chemotherapy. HGS ovarian cancer is a heterogenous disease in that few genes are consistently mutated between patients. Additionally, HGS ovarian cancer is characterized by high genomic instability. For these reasons personalized approaches may be necessary for effective treatment and cure. Understanding the molecular mechanisms that contribute to tumor metastasis and chemoresistance are essential to improve survival rates. One favored model for tumor metastasis and chemoresistance is the cancer stem cell (CSC) model. CSCs are cells with enhanced self-renewal properties that are enriched following chemotherapy. Elimination of this cell population is thought to be a mechanism to increase therapeutic response. Therefore, accurate identification of stem cell populations that are most clinically relevant is necessary. While many CSC identifiers (ALDH, OCT4, CD133, and side population) have been established, it is still not clear which population(s) will be most beneficial to targeted in patients. Therefore, there is a critical need to characterize CSCs with reliable markers and find their weaknesses that will make the CSCs amenable to therapy. Many signaling pathways are implicated for their roles in CSC initiation and maintenance. Therapeutically targeting pathways needed for CSC initiation or maintenance may be an effective way of treating HGS ovarian cancer patients. In conclusion, the prognosis for HGS ovarian cancer may be improved by combining CSC phenotyping with targeted therapies for pathways involved in CSC maintenance.

Combination of a thioxodihydroquinazolinone with cisplatin eliminates ovarian cancer stem cell-like cells (CSC-LCs) and shows preclinical potential

Article

Full-text available

Dec 2017

Cancer stem cell-like cells (CSC-LCs) contribute to drug resistance and recurrence of ovarian cancer. Strategies that can eradicate CSC-LCs are expected to substantially improve the outcome of ovarian cancer treatment. We have previously identified a class of thioxodihydroquinazolinone small molecules, which have strong synergistic antitumor activity with platinum drugs, the standard chemotherapeutic agents for ovarian cancer treatment. In the current study, using the activity of aldehyde dehydrogenase (ALDH) as a marker of CSC-LCs, we demonstrated that the combination of thioxodihydroquinazolinone compound 19 with cisplatin is able to diminish ALDH-high CSC-LC populations in both platinum-resistant ovarian cancer cell lines and primary ovarian cancer cells from metastatic ascites of a cisplatin-resistant patient. Compound 19 enhanced the accumulation of intracellular cisplatin in ALDHhigh ovarian CSC-LCs. The combination of compound 19 with cisplatin was also able to reduce the sphere-forming capability of cisplatin-resistant ovarian cancer cells. Using a spheroid-based in vitro metastasis model of ovarian cancer, we demonstrated that the co-administration of compound 19 with cisplatin prevents ovarian cancer spheroid cells from attaching to substratum and spreading. In a cisplatin-resistant in vivo intraperitoneal xenograft mouse model, the combination of compound 19 with cisplatin significantly reduced tumor burden, as compared to cisplatin alone. Taken together, our study demonstrated that thioxodihydroquinazolinones represent a new class of agents that in combination with cisplatin are capable of eliminating CSC-LCs in ovarian cancer. Further development of thioxodihydroquinazolinone small molecules may yield a more effective treatment for cisplatin-resistant metastatic ovarian cancer.

Time-lapse microscopic observation of non-dividing cells in cultured human osteosarcoma MG-63 cell line

Article

Nov 2017

Cancer stem cells resemble normal tissue-specific stem cells in many aspects, such as self-renewal and plasticity. Like their non-malignant counterparts, cancer stem cells are suggested to exhibit a relative quiescence. The established cancer cell lines reportedly harbor slow-proliferating cells that are positive for some cancer stem cells markers. However, the fate of these cells and their progeny remains unknown. We used time-lapse microscopy and the contrast-based segmentation algorithm to identify and monitor actively dividing and non-dividing cells in human osteosarcoma MG-63 cell line. Within the monitored field of view the non-dividing cells were represented by three cells that never divided, and one cell that attempted to divide, but failed cytokinesis, and later, after significantly prolonged division, produced the progeny with enlarged segmented nuclei, thus pointing to a possible mitotic catastrophe. Together, these cells initially constituted about 6.2% of the total number of seeded cells, yet only 0.02% of all cells at the end of the observation period when cells became confluent. Non-dividing cells were characterized by rounded shape, dark nuclei, random cytoplasmic streaming and subtle oscillatory movement, however, they did not migrate and rarely formed cell-cell contacts as compared to actively dividing cells. Our data indicate that the observed non-dividing MG-63 cells do not have a growth advantage over other cells and, therefore, they do not contribute to the cancer stem cells pool.

Minicircle Versus Plasmid DNA Delivery by Receptor-Targeted Polyplexes

Article

Aug 2017

Minicircle DNA (MC) due to its minimal size and lack of bacterial backbone sequences presents a promising alternative to plasmid DNA (pDNA) for non-viral gene delivery in terms of biosafety and improved gene transfer. Here, luciferase pDNA (pCMV-luc) and analogous MC DNA (MC07.CMV-luc) were formulated into polyplexes with c-Met targeted, PEG-shielded sequence-defined oligoaminoamides or linear PEI (linPEI) as standard transfection agent. Distinct physicochemical and biological characteristics were observed for polyplexes formed with either pDNA or MC DNA as vectors. The carriers were found to dominate the shape of polyplexes, whereas the DNA type was decisive for the nanoparticle size. c-Met-targeted, tyrosine trimer-containing polyplexes were optimized into compacted rod structures with a size of 65-100 nm for pDNA and 35-40 nm for MC. Notably, these MC polyplexes display a lack of cell-cycle dependence of transfection and an ~200-fold enhanced gene transfer efficiency in c-Met-positive DU145 prostate carcinoma cultures over their tyrosine-free pDNA analogues.

Comparison of cancer stem cell enrichment between spheroids derived from single-cell and multicellular aggregate cultures

Article

Full-text available

Aug 2023

Introduction: Cancer stem cells (CSCs) represent a distinct group of cells within cancerous tissue that possess the ability to initiate tumorigenesis and exhibit potency, self-renewal, and drug resistance. The study of CSCs often encounters challenges in obtaining these cells of interest or generating a sufficient quantity for downstream analysis. Nevertheless, it is feasible to enrich CSCs in vitro by subjecting them to conditions that stimulate their CSC properties, such as prolonged exposure to drugs or radiation, or by promoting their self-renewal capability through spheroid culture. Spheroids are a specific type of cell culture that organizes cells into a three-dimensional structure, closely mimicking the in vivo environment. These spheroids consist of a heterogeneous cell population, including CSCs or tumor-propagating cells responsible for tumor growth and maintenance. In our study, we cultured spheroids derived from single cells as well as multicellular aggregates to enrich CSCs based on their self-renewal capability and the structural organization provided by the three-dimensional context. Methods: Comparing the spheroid cultures with the parental adherent monolayer cells, we observed higher expression of CSC markers, pluripotent genes, and adipogenic differentiation in both multicellular spheroids (MCS) and single cell-derived spheroids (SCDS) of the two tested cell lines. Results: The spheroids exhibited progressive growth in size throughout the culture period. When comparing the two methods, SCDS demonstrated greater expression of surface markers and all three pluripotent genes associated with CSCs. Furthermore, when assessing drug resistance potential and the expression of the ABCG2 drug efflux gene, only 5637 SCDS displayed increased resistance to cisplatin and upregulation of ABCG2. Conclusion: In conclusion, both the MCS and SCDS methods effectively enriched the population of bladder CSCs in the 5637 and HT-1376 bladder cancer cell lines. However, the SCDS method demonstrated a higher upregulation of CSC markers and pluripotent gene expression compared to MCS. It is worth noting that spheroid culture and CSC enrichment are not mutually exclusive and can coexist with increased chemotherapy resistance and upregulation of ABCG2 drug efflux gene expression. Moreover, the drug efflux capability may vary depending on the specific cell line and clonal lineage. These strategies can serve as valuable models for CSC enrichment, the study of cancer cell behavior, disease modeling, and personalized chemotherapy investigations.

The key roles of cancer stem cell-derived extracellular vesicles

Article

Full-text available

Mar 2021

Cancer stem cells (CSCs), the subpopulation of cancer cells, have the capability of proliferation, self-renewal, and differentiation. The presence of CSCs is a key factor leading to tumor progression and metastasis. Extracellular vesicles (EVs) are nano-sized particles released by different kinds of cells and have the capacity to deliver certain cargoes, such as nucleic acids, proteins, and lipids, which have been recognized as a vital mediator in cell-to-cell communication. Recently, more and more studies have reported that EVs shed by CSCs make a significant contribution to tumor progression. CSCs-derived EVs are involved in tumor resistance, metastasis, angiogenesis, as well as the maintenance of stemness phenotype and tumor immunosuppression microenvironment. Here, we summarized the molecular mechanism by which CSCs-derived EVs in tumor progression. We believed that the fully understanding of the roles of CSCs-derived EVs in tumor development will definitely provide new ideas for CSCs-based therapeutic strategies.

Ovarian cancer stem-like cells with induced translineage-differentiation capacity and are suppressed by alkaline phosphatase inhibitor

Article

Full-text available

Nov 2013

Spheroid formation is one property of stem cells-such as embryo-derived or neural stem cells-that has been used for the enrichment of cancer stem-like cells (CSLCs). However, it is unclear whether CSLC-derived spheroids are heterogeneous or whether they share common embryonic stemness properties. Understanding these features might lead to novel therapeutic approaches. Ovarian carcinoma is a deadly disease of women. We identified two types of spheroids (SR1 and SR2) from ovarian cancer cell lines and patients' specimens according to their morphology. Both types expressed stemness markers and could self-renew and initiate tumors when a low number of cells were used. Only SR1 could differentiate into multiple-lineage cell types under specific induction conditions. SR1 spheroids could differentiate to SR2 spheroids through epithelial-mesenchymal transition. Alkaline phosphatase (ALP) was highly expressed in SR1 spheroids, decreased in SR2 spheroids, and was absent in differentiated progenies in accordance with the loss of stemness properties. We verified that ALP can be a marker for ovarian CSLCs, and patients with greater ALP expression is related to advanced clinical stages and have a higher risk of recurrence and lower survival rate. The ALP inhibitor, levamisole, disrupted the self-renewal of ovarian CSLCs in vitro and tumor growth in vivo. In summary, this research provides a plastic ovarian cancer stem cell model and a new understanding of the cross-link between stem cells and cancers.This results show that ovarian CSLCs can be suppressed by levamisole. Our findings demonstrated that some ovarian CSLCs may restore ALP activity, and this suggests that inhibition of ALP activity may present a new opportunity for treatment of ovarian cancer.

Abubaker K, Latifi A, Luwor R, Nazaretian S, Zhu H, Quinn MA, Thompson EW, Findlay JK, Ahmed NShort-term single treatment of chemotherapy results in the enrichment of ovarian cancer stem cell-like cells leading to an increased tumor burden. Mol Cancer 12: 24

Article

Full-text available

Mar 2013
MOL CANCER

Over 80% of women diagnosed with advanced-stage ovarian cancer die as a result of disease recurrence due to failure of chemotherapy treatment. In this study, using two distinct ovarian cancer cell lines (epithelial OVCA 433 and mesenchymal HEY) we demonstrate enrichment in a population of cells with high expression of CSC markers at the protein and mRNA levels in response to cisplatin, paclitaxel and the combination of both. We also demonstrate a significant enhancement in the sphere forming abilities of ovarian cancer cells in response to chemotherapy drugs. The results of these in vitro findings are supported by in vivo mouse xenograft models in which intraperitoneal transplantation of cisplatin or paclitaxel-treated residual HEY cells generated significantly higher tumor burden compared to control untreated cells. Both the treated and untreated cells infiltrated the organs of the abdominal cavity. In addition, immunohistochemical studies on mouse tumors injected with cisplatin or paclitaxel treated residual cells displayed higher staining for the proliferative antigen Ki67, oncogeneic CA125, epithelial E-cadherin as well as cancer stem cell markers such as Oct4 and CD117, compared to mice injected with control untreated cells. These results suggest that a short-term single treatment of chemotherapy leaves residual cells that are enriched in CSC-like traits, resulting in an increased metastatic potential. The novel findings in this study are important in understanding the early molecular mechanisms by which chemoresistance and subsequent relapse may be triggered after the first line of chemotherapy treatment.

Isolation and characterization of stem-like cells from a human ovarian cancer cell line

Article

Full-text available

Dec 2011
MOL CELL BIOCHEM

Increasing evidence supports the existence of a subpopulation of cancer cells capable of self-renewal and differentiation into diverse cell lineages. These cancer stem-like or cancer-initiating cells (CICs) also demonstrate resistance to chemo- and radiotherapy and may function as a primary source of cancer recurrence. We report here on the isolation and in vitro propagation of multicellular ovarian cancer spheroids from a well-established ovarian cancer cell line (OVCAR-3). The spheroid-derived cells (SDCs) display self-renewal potential, the ability to produce differentiated progeny, and increased expression of genes previously associated with CICs. SDCs also demonstrate higher invasiveness, migration potential, and enhanced resistance to standard anticancer agents relative to parental OVCAR-3 cells. Furthermore, SDCs display up-regulation of genes associated with epithelial-to-mesenchymal transition (EMT), anticancer drug resistance and/or decreased susceptibility to apoptosis, as well as, down-regulation of genes typically associated with the epithelial cell phenotype and pro-apoptotic genes. Pathway and biological process enrichment analyses indicate significant differences between the SDCs and precursor OVCAR-3 cells in TGF-beta-dependent induction of EMT, regulation of lipid metabolism, NOTCH and Hedgehog signaling. Collectively, our results indicate that these SDCs will be a useful model for the study of ovarian CICs and for the development of novel CIC-targeted therapies.

Ovarian Epithelial Cancer Stem Cells

Article

Full-text available

Jun 2011
TSWJ

The last decade witnessed an explosion of interest in cancer stem cells (CSCs). The realization of epithelial ovarian cancer (EOC) as a CSC-related disease has the potential to change approaches in the treatment of this devastating disease dramatically. The etiology and early events in the progression of these carcinomas are among the least understood of all major human malignancies. Compared to the CSCs of other cancer types, the identification and study of EOC stem cells (EOCSCs) is rather difficult due to several major obstacles: the heterogeneity of tumors comprising EOCs, unknown cells of origin, and lack of knowledge considering the normal ovarian stem cells. This poses a major challenge for urgent development in this research field. This review summarizes and evaluates the current evidence for the existence of candidate normal ovarian epithelial stem cells as well as EOCSCs, emphasizing the requirement for a more definitive laboratory approach for the isolation, identification, and enrichment of EOCSCs. The present review also revisits the ongoing debate regarding other cells and tissues of origin of EOCs, and discusses early events in the pathogenesis of this disease. Finally, this review discusses the signaling pathways that are important regulators of candidate EOCSC maintenance and function, their potential role in the distinct pathogenesis of different EOC subtypes, as well as potential mechanisms and clinical relevance of EOCSC involvement in drug resistance.

Erratum: Cancer stem cells: Problems for therapy? (Journal of Pathology (2010) DOI: 10.1002/path.2793)

Article

Feb 2012

Enrichment of ovarian cancer stem-like cells is associated with epithelial to mesenchymal transition through an miRNA-activated AKT pathway

Article

Aug 2013
CELL PROLIFERAT

Evidence has indicated that ovarian epithelial cancer-type cells under serum-free culture conditions can form spheroid cells and exhibit characteristics expected of cancer stem-like cells (CSCs). However, the mechanism by which differentiated ovarian cancer cells acquire stem-cell properties during CSC enrichment has needed to be elucidated. Recent studies have demonstrated that induction of epithelial to mesenchymal transition (EMT) can generate CSCs and be associated with tumour aggressiveness and metastasis. Ovarian epithelial cancer cell lines, SKOV3 and HO8920, were cultured for spheroid cells and adherent cells. CSC enrichment was investigated using MTT assay, flow cytometery and qRT-PCR and expression level of PI3K/AKT pathway components was analysed by western blotting. Compared to adherent cells, the spheroid cells expressed mesenchymal markers highly and exhibited significantly more motility; we also observed increases in phosphate AKT1 levels in the spheroid cells. Moreover, transfection of miR-20a or miR-200c led to corresponding reduction in endogenous PTEN protein, while AKT1 and phosphate AKT1 levels were upregulated in miRNAs-transfected cells. Finally, PI3K/AKT pathway inhibitor LY294002 reduced expressions of mesenchymal markers and stem-cell gene activity in spheroid cells, enhancing sensitivity of spheroid cells to paclitaxel treatment. Our findings demonstrate that EMT contributed to enrichment of ovarian CSCs in vitro, making EMT targeting in epithelial ovarian cancer a novel therapeutic option.

A Rational Approach to the Management of Recurrent or Persistent Ovarian Carcinoma

Article

Mar 2012

J. Tate Thigpen

Evidence supports the current paradigm for the management of patients with recurrent or persistent ovarian carcinoma. The paradigm requires that patients be classified as platinum-sensitive or platinum-resistant. Patients who achieve a complete response with platinum-based therapy and experience at least 6 months free from recurrence should be categorized as having chemosensitive disease and should be retreated with carboplatin-based doublets. Patients who progress while receiving treatment, whose best response is stable disease, or who experience a complete response of <6 months duration should be categorized as having chemoresistant disease and should be treated with a nonplatinum single agent.

Ovarian Cancer Stem Cell Markers: Prognostic and Therapeutic Implications

Article

Feb 2012

Cancer stem cells are rare chemotherapy resistant cells within a tumor which can serve to populate the bulk of a tumor with more differentiated daughter cells and potentially contribute to recurrent disease. Ovarian cancer is a disease for which at the time of initial treatment we can obtain complete clinical remission in the majority of patients. Unfortunately, most will relapse and succumb to their disease. This clinical course is in line with the cancer stem cell model. In the past 5 years a significant amount of work has been done to identify cells with characteristics of ovarian cancer stem cells. This review will focus specifically on the markers used to define human ovarian cancer stem cells, the prognostic implications of the expression of these cancer stem cell markers in patient's primary tumors, and the potential of these cancer stem cell markers to serve as therapeutic targets.

Too Much of a Good Thing: Suicide Prevention Promotes Chemoresistance in Ovarian Carcinoma

Article

Sep 2010
CURR CANCER DRUG TAR

Ovarian cancer is the most lethal of gynecologic malignancies. Currently, standard treatment for epithelial ovarian cancer consists of surgical debulking followed by adjuvant chemotherapy with a platinum-based drug coupled with paclitaxel. While initial response to chemotherapy is high, the majority of patients develop recurrent disease which is characterized by chemoresistance. The primary cytotoxic effect of many chemotherapy drugs is mediated by apoptotic response in tumor cells. Recent data indicates that cross talk between the tumor microenvironment and malignant epithelial cells can influence apoptotic response as well. The identification of molecules involved in the regulation and execution of apoptosis, and their alterations in ovarian carcinoma have provided new insights into the mechanism behind the development of chemoresistance in this disease. Our challenge is now to devise strategies to circumvent cell death defects and ultimately improve response to treatment in ovarian carcinoma patients.

Cancer stem cells: Problems for therapy?

Article

Jan 2011
J PATHOL

Many, if not all, tumours contain a sub-population of self-renewing and expanding stem cells known as cancer stem cells (CSCs). The symmetric division of CSCs is one mechanism enabling expansion in their numbers as tumours grow, while epithelial-mesenchymal transition (EMT) is an increasingly recognized mechanism to generate further CSCs endowed with a more invasive and metastatic phenotype. Putative CSCs are prospectively isolated using methods based on either a surface marker or an intracellular enzyme activity and then assessed by a 'sphere-forming' assay in non-adherent culture and/or by their ability to initiate new tumour growth when xenotransplanted into immunocompromised mice-hence, these cells are often referred to as tumour-propagating cells (TPCs). Cell sub-populations enriched for tumour-initiating ability have also been found in murine tumours, countering the argument that xenografting human cells merely select human cells with an ability to grow in mice. Cancer progression can be viewed as an evolutionary process that generates new/multiple clones with a fresh identity; this may be a major obstacle to successful cancer stem cell eradication if treatment targets only a single type of stem cell. In this review, we first briefly discuss evidence that cancer can originate from normal stem cells or closely related descendants. We then outline the attributes of CSCs and review studies in which they have been identified in various cancers. Finally, we discuss the implications of these findings for successful cancer therapies, concentrating on the self-renewal pathways (Wnt, Notch, and Hedgehog), aldehyde dehydrogenase activity, EMT, miRNAs, and other epigenetic modifiers as potential targets for therapeutic manipulation.

Enrichment for Chemoresistant Ovarian Cancer Stem Cells from Human Cell Lines

Abstract and Figures

Recommended publications

Ovarian Cancer Stem Cells: Molecular Concepts and Relevance as Therapeutic Targets.

The Crosstalk between Ovarian Cancer Stem Cell Niche and the Tumor Microenvironment

Immune-phenotype assessment of ovarian cancer stem cells.

Tumor-Intrinsic PD-L1 Signaling in Cancer Initiation, Development and Treatment: Beyond Immune Evasi...