ArticlePDF Available

Supraphysiological androgen levels induce cellular senescence in human prostate cancer cells through the Src-Akt pathway

Authors:

Abstract and Figures

Prostate cancer (PCa) is the second leading cause of cancer mortality of men in Western countries. The androgen receptor (AR) and AR-agonists (androgens) are required for the development and progression of the normal prostate as well as PCa. However, it is discussed that in addition to their tumor promoting activity, androgens may also exhibit tumor suppressive effects. A biphasic growth response to androgens a growth-promoting and -inhibition has been observed that suggests that administration of supraphysiological androgen levels mediates growth reduction in AR expressing PCa cells. Detection of senescence markers, three dimensional interphase fluorescence in situ hybridization (3D-iFISH), qRT-PCR, Western blotting, detection of GFP fusions, prostatectomy, ex vivo culturing. Here, we describe that supraphysiological levels of androgens induce cell cycle arrest and markers of cellular senescence in human PCa cells, which may in part explain the growth inhibitory role of androgens. The expression of the senescence associated beta galactosidase is observed by treatment with the natural androgen DHT or the less metabolized synthetic androgen R1881. The induction of senescence marker was detected in human PCa cell lines as well as in human primary PCa tissue derived from prostatectomy treated ex vivo. Using interphase FISH (iFISH) suggests that the androgen-induced cellular senescence is associated with localizing the genomic E2F1 locus to senescence associated heterochromatic foci. Analysis of different signaling pathways in LNCaP cells suggest that the p16-Rb-E2F1 pathway is essential for the induction of cellular senescence since treatment with siRNA directed against p16 reduces the level of androgen-induced cellular senescence. Based on the rapid induction of androgen-mediated cellular senescence we identified the Src-PI3K-Akt-signaling pathway and autophagy being in part involved in androgen regulation. Taken together, our data suggest that AR-agonists at supraphysiological levels mediate induction of cellular senescence in human PCa cells, which may have a protective anti-cancer role. These results provide also new insights for understanding androgen-mediated regulation of PCa growth.
Higher androgen levels induce growth inhibition and G1 arrest in LNCaP cells. LNCaP cells were treated for 72 h with 1 pM R1881 defined as low androgen levels (LAL) and 1 nM R1881 as supraphysiological androgen levels (SAL). A. SAL treatment inhibits growth of LNCaP cells. Cells were treated with the indicted concentrations of R1881 for three days. Cell number was determined and plotted against the untreated control. For each time point n = 4, the errors are shown in SEM. B. Viability analysis of treated cells was measured by the MTT assay. LNCaP cells were treated for 72 h with DMSO or with the indicated concentrations of R1881 following spectrometrical measurement to analyze the relative cell viability. Data represent the mean from triplets and show the cell viability in percent. C. To analyze the irreversibility of androgen-induced cellular senescence LNCaP cells were treated with SAL or LAL as well as DMSO for 72 h. Afterwards compounds were removed and cells were cultured for additional 72 h, followed by fixation and determination of the SA β-gal activity level via light microscopy at a 200x magnification. 3x 200 cells from triplets were counted and their means in percent diagramed. D. FACS analysis was performed to analyze the cell cycle state of R1881 treated cells. LNCaP cells were incubated for 72 h with solvent control or R1881 (SAL or LAL) and stained with propidium iodide followed by cell sorting analysis. The acquired FACS data were analyzed by Cylchred (Ormerod, Hoy). Counts of the different cell cycle phases were represented in percent.
… 
Androgen-induced cellular senescence is mediated through the tumor suppressors p16-pRb. To examine the signaling pathways involved in the induction of cellular senescence, Western blotting, 3D-FISH of interphase nuclei, qRT-PCRs and transient transfections with siRNA were performed. LNCaP cells were incubated for 72 h with solvent control or different R1881 concentrations (1 pM = LAL; 1 nM = SAL). C, solvent control (DMSO). A. qRT-PCR was performed to analyze mRNA expression of p14. Gene expression was normalized to β-actin and the values for untreated samples (C). Error bars indicate the standard deviation of the mean of doublets. B. Protein levels of p53 as a target of p14 were detected with immunoblotting using antibodies against p53 and acetylated p53 (ac p53) known to be involved in cellular senescence pathway. Quantification of the bands was realized via Labimage D1 and the expression levels of the target proteins were normalized and given as band intensity to the loading control α-tubulin, untreated sample. C. Changes of the p16-pRb pathway by androgen treatment were analyzed by Western blotting. D-G) Quantitative qRT-PCR was performed to analyze mRNA expression with primers directed against indicated mRNAs. Gene expression was normalized to β-actin. Error bars indicate the standard deviation of the mean of doublets. C: solvent control (DMSO). H. Transient transfection of small interference RNA (siRNA) and subsequent SA β-gal assays were used to analyze the effects of p16 on the androgen-induced senescence. LNCaP cells were transfected via electroporation with srambled control (SCR) siRNA as negative control or p16 siRNA and without any siRNA (-) 24 h prior R1881 treatment. Thereafter, cells were fixed and analyzed for SA β-Gal activity using a light microscopy at 200x magnification and 3× 200 cells were counted and as means of the triplets in percent diagramed.
… 
Content may be subject to copyright.
R E S E A R C H Open Access
Supraphysiological androgen levels induce
cellular senescence in human prostate cancer
cells through the Src-Akt pathway
Julia Roediger
1,4
, Wiebke Hessenkemper
1
, Sophie Bartsch
1
, Marina Manvelyan
1
, Soeren S Huettner
1
, Thomas Liehr
1
,
Mohsen Esmaeili
1
, Susan Foller
3
, Iver Petersen
2
, Marc-Oliver Grimm
3
and Aria Baniahmad
1*
Abstract
Background: Prostate cancer (PCa) is the second leading cause of cancer mortality of men in Western countries. The
androgen receptor (AR) and AR-agonists (androgens) are required for the development and progression of the normal
prostate as well as PCa. However, it is discussed that in addition to their tumor promoting activity, androgens may also
exhibit tumor suppressive effects. A biphasic growth response to androgens a growth-promoting and -inhibition has
been observed that suggests that administration of supraphysiological androgen levels mediates growth reduction in
AR expressing PCa cells.
Methods: Detection of senescence markers, three dimensional interphase fluorescence in situ hybridization (3D-iFISH),
qRT-PCR, Western blotting, detection of GFP fusions, prostatectomy, ex vivo culturing.
Results: Here, we describe that supraphysiological levels of androgens induce cell cycle arrest and markers of cellular
senescence in human PCa cells, which may in part explain the growth inhibitory role of androgens. The expression of
the senescence associated beta galactosidase is observed by treatment with the natural androgen DHT or the less
metabolized synthetic androgen R1881. The induction of senescence marker was detected in human PCa cell lines as
well as in human primary PCa tissue derived from prostatectomy treated ex vivo. Using interphase FISH (iFISH) suggests
that the androgen-induced cellular senescence is associated with localizing the genomic E2F1 locus to senescence
associated heterochromatic foci. Analysis of different signaling pathways in LNCaP cells suggest that the p16-Rb-E2F1
pathway is essential for the induction of cellular senescence since treatment with siRNA directed against p16 reduces the
level of androgen-induced cellular senescence. Based on the rapid induction of androgen-mediated cellular senescence
we identified the Src-PI3K-Akt-signaling pathway and autophagy being in part involved in androgen regulation.
Conclusions: Taken together, our data suggest that AR-agonists at supraphysiological levels mediate induction of cellular
senescence in human PCa cells, which may have a protective anti-cancer role. These results provide also new insights for
understanding androgen-mediated regulation of PCa growth.
Keywords: Nuclear receptor, Non-genomic signaling, Tumor suppression, Cellular senescence, Autophagy
Background
Prostate Cancer (PCa) is an important age-related dis-
eases being the most common cancer malignancy and
the second leading cause of cancer mortality in men in
western countries [1]. Initially, PCa progression is andro-
gen receptor (AR)- and androgen-dependent. Unfortu-
nately, after 1218 months of hormone ablation therapy
the advanced PCa growth is becoming androgen-
independent but remains dependent on AR [2], which
indicates the importance of developing new therapeutic
strategies. Interestingly, it is known that with increased
age the androgen level is decreasing, which seems to be
timely associated with increased risk of PCa [3,4]. It has
been suggested that androgens first have a protective
role for prostate proliferation [4-8]. In line with this,
Niu et al. [9] revealed using a mouse model that the
functional AR exhibits both proliferation promoting as
* Correspondence: aria.baniahmad@med.uni-jena.de
1
Institute of Human Genetics, Jena University Hospital, 07740 Jena, Germany
Full list of author information is available at the end of the article
© 2014 Roediger et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain
Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article,
unless otherwise stated.
Roediger et al. Molecular Cancer 2014, 13:214
http://www.molecular-cancer.com/content/13/1/214
well as tumor suppressive functions. However androgen-
mediated growth inhibition is less examined and not well
understood, and thus it is postulated that androgen ad-
ministration could reduce PCa growth.
Cellular senescence is an irreversible cell cycle arrest me-
diated through exogenous and endogenous stimuli, which
cause changes in cell morphology and gene expression pro-
files [10,11]. New insights reveal that cellular senescence
occurs during embryogenesis as a normal programmed
mechanism that plays instructive roles in development and
controls patterning [12,13]. It is suggested that this cellular
program may be reactivated during early premalignant car-
cinogenesis as a protective cellular mechanism to prevent
malignant cancer. Therefore, the proliferation arrest of sen-
escent cells has been indicated to act tumor suppressive. In
malignant cells, however, this program of cell cycle arrest
by cellular senescence seems to be inhibited [14]. Hence,
the process of cellular senescence represents a natural
defense mechanism against tumor progression and thus the
exogenous re-activation and induction of cellular senes-
cence is a potential target for cancer therapy [15].
Tumorsuppressorproteinsand their signaling pathways
such as the p14-p53-p21 and p16-pRb-E2F1 pathways are
involved in the induction of cellular senescence [16-19].
Further, autophagy, a highly conserved, lysosome-mediated
process that degrades cytoplasmic components, seems to
be linked to the initiating of cellular senescence [20,21].
Cellular senescence is also associated with changes in the
nuclear chromatin structure to generate senescence-
associated heterochromatic foci (SAHF) as another marker
for cellular senescence [22].
The AR belongs to the nuclear hormone receptor super-
family. Besides its function as a ligand-controlled tran-
scription factor the AR is also to induce ligand-mediated
so called rapid signaling in the cytoplasm such as the
MAP-kinase and the Src tyrosine kinase signaling [23-27].
Here, our data suggest that androgens induce cellular
senescence in a concentration-dependent manner in hu-
man PCa cell lines, which may explain the growth inhibi-
tory role of androgens. This is confirmed by ex vivo studies
with primary human PCa biopsy material, where androgens
induce cellular senescence in malignant human PCa tissue.
Furthermore, we observed that besides the tumor suppres-
sors p16, pRb also Src - Akt, mediate the androgen-
mediated induction of cellular senescence. The data provide
molecular insights into androgen-mediated cellular senes-
cence representing important principles to understand the
role of AR-signaling as a target of PCa therapy.
Results & discussion
AR-agonists induce cellular senescence in a
concentration-dependent manner in PCa cell lines
AR-agonists are known to promote prostate development
as well as PCa growth [28]. However, Sonnenschein et al.
[29] described a concentration-dependent proliferation ar-
rest in PCa cells after treatment with the natural agonist
DHT or the synthetic R1881 at supraphysiological levels.
Notably, the underlying cellular and molecular mecha-
nisms are still unclear. Therefore, we hypothesized that
androgens may induce a pathway of cellular senescence.
Androgen-dependent growing LNCaP cells were
treated with DHT and R1881 for 3 days and through the
measurement of SA β-Gal activity the induction of cellu-
lar senescence was analyzed. Interestingly, we observed
that both the natural and the synthetic androgen induce
cellular senescence in a concentration-dependent man-
ner. Administration of 1 nM R1881 or 1 nM DHT indi-
cate a strong induction of SA β-Gal activity, in contrast,
lower androgen levels show the basal level of cellular
senescence similar to the untreated or the solvent con-
trol (Figure 1A, B). Higher concentrations of R1881 result
in a higher percentage of cells expressing this marker
compared to the natural compound DHT indicating a
higher potency to induce cellular senescence. An explan-
ation for this might be that in addition to a higher affinity
for the AR, R1881 as a synthetic androgen is not metabo-
lized as rapidly as the natural DHT [30]. Therefore, R1881
was used for further studies. Based on these results we de-
fined here 1nM R1881 as supraphysiological androgen
level (SAL) and 1pM R1881 concentration as low andro-
gen level (LAL). Longer treatment periods did not increase
the level of SA β-Gal activity indicating that 3 days of
treatment with SAL is sufficient to induce cellular senes-
cence (Additional file 1: Figure S1).
To confirm the androgen-induced cellular senescence,
we examined a further marker, the formation of
senescence-associated heterochromatic foci (SAHF).
DAPI staining of the treated cells revealed that SAL
treatment induces an accumulation of heterochromatin
in LNCaP cells (Figure 1C). Similar results were ob-
tained in androgen-independent growing C4-2 cells
where androgen treatment also induced both the SA β-
Gal activity and the formation of SAHFs (Figure 1D, E).
Moreover, using PC3-AR cells expressing the human AR
we observed induction of cellular senescence under SAL
but not LAL conditions (Additional file 2: Figure S2A),
whereas we did not observe an androgen-induced cellular
senescence using non-AR expressing PC3 cells (Additional
file 2: Figure S2B). This confirms that androgen-induced
cellular senescence is AR-dependent PCa cell lines.
Growth analyses were performed to analyze the rela-
tion between the proliferation rate of LNCaP cells and
the concentration of the androgen R1881 (Figure 2A).
The data indicate that at LAL the cell number of the
androgen-dependent cells increases whereas cells grow
less in the presence of SAL. This suggests a growth in-
hibition at higher, supraphysiological levels of androgens.
The observed biphasic growth response upon androgen
Roediger et al. Molecular Cancer 2014, 13:214 Page 2 of 15
http://www.molecular-cancer.com/content/13/1/214
A
C
D
E
B
Figure 1 AR-agonists induce cellular senescence in LNCaP and C4-2 human prostate cancer cell lines in a concentration dependent manner.
Androgen dependent growing LNCaP and castration resistant C4-2 PCa cell lines were incubated with DMSO as solvent control and different concentrations
of the synthetic and more stable androgen R1881 or the natural androgen DHT for 72 h. Because DHT is metabolized rapidly, DHT was added daily. 1 pM
R1881 is defined as low androgen levels (LAL) and 1 nM R1881 as supraphysiological androgen levels (SAL). Cells were fixed and analyzed for SA β-Gal activity
using a light microscopy and 3x 200 cells were counted and as means of the triplets in percent diagramed. A.SAβ-gal activity of LNCaP cells treated with
R1881 (methyltrienolone). B.SAβ-gal activity of LNCaP cells treated with DHT. C.SAβ-Gal staining in LNCaP cells at 200x magnification by phase microscopy.
Upper panel: Arrowheads indicate the blue precipitations in the cytoplasm in senescent cells. Lower panel depicts the formation of senescence associated
heterochromatic foci (SAHF) via DAPI staining of the nucleus. For fluorescence microscopy a 1000x magnification was used. Arrowheads mark accumulation
of heterochromatic foci. D.SAβ-Gal activity of the human castration resistant PCa cells C4-2. E. Microscopy of cells after SA β-Gal activity detection
(upper panel) and DAPI staining with SAHF formation (lower panel) after androgen treatment of C4-2 cells.
Roediger et al. Molecular Cancer 2014, 13:214 Page 3 of 15
http://www.molecular-cancer.com/content/13/1/214
A
B
D
C
Figure 2 Higher androgen levels induce growth inhibition and G1 arrest in LNCaP cells. LNCaP cells were treated for 72 h with 1 pM
R1881 defined as low androgen levels (LAL) and 1 nM R1881 as supraphysiological androgen levels (SAL). A. SAL treatment inhibits growth of
LNCaP cells. Cells were treated with the indicted concentrations of R1881 for three days. Cell number was determined and plotted against the
untreated control. For each time point n = 4, the errors are shown in SEM. B. Viability analysis of treated cells was measured by the MTT assay.
LNCaP cells were treated for 72 h with DMSO or with the indicated concentrations of R1881 following spectrometrical measurement to analyze the
relative cell viability. Data represent the mean from triplets and show the cell viability in percent. C. To analyze the irreversibility of androgen-induced
cellular senescence LNCaP cells were treated with SAL or LAL as well as DMSO for 72 h. Afterwards compounds were removed and cells were cultured
for additional 72 h, followed by fixation and determination of the SA β-gal activity level via light microscopy at a 200x magnification. 3x 200 cells from
triplets were counted and their means in percent diagramed. D. FACS analysis was performed to analyze the cell cycle state of R1881 treated cells.
LNCaP cells were incubated for 72 h with solvent control or R1881 (SAL or LAL) and stained with propidium iodide followed by cell sorting analysis.
The acquired FACS data were analyzed by Cylchred (Ormerod, Hoy). Counts of the different cell cycle phases were represented in percent.
Roediger et al. Molecular Cancer 2014, 13:214 Page 4 of 15
http://www.molecular-cancer.com/content/13/1/214
treatment is in line with previous observations [29,31]
and is in accordance with the observed induction of cel-
lular senescence at supraphysiological androgen levels.
To reveal whether SAL changes the cell viability, MTT-
assays were performed. The data indicate that treated
LNCaP cells remain viable at similar levels as compared to
untreated LNCaP cells (Figure 2B). Next, we analyzed
whether the activity of the senescent marker that appears
after three days is reversible. For this purpose androgens
were removed after 3 days by washing the cells and fresh
medium without androgens was added for further
3 days. The level of SA β-Gal activity remains un-
changed after removal of SAL treatment suggesting
that the androgen-induced cellular senescence is irre-
versible (Figure 2C).
In general, cellular senescence is associated with an ar-
rest at the G1/G0 phase of the cell cycle. FACS analyses
were performed which indicates that androgen treatment
at SAL increases the number of cells in the G1/G0 phase
of the cell cycle (Figure 2D), which is in agreement with
our data.
Thus, these data suggest that supraphysiological levels
of androgens induce markers of cellular senescence and
inhibit cell growth in a concentration-dependent manner
in both androgen-dependent and -independent growing
PCa-cell lines.
AR-agonists induce cellular senescence in human PCa
tissue ex vivo
To detect whether androgens induce cellular senescence
in primary tissue samples, human PCa specimens de-
rived from prostatectomies were treated for 2 days with
10 nM and 1 μM R1881 or 1 μM DHT ex vivo. DHT
levels in men range between 0.8 2.5 nM [32]. However
the level decrease by age. R1881 has been shown to be
more potent compared to DHT, therefore higher concen-
trations of DHT or R1881 were used to ensure supraphy-
siological levels and that the compounds reach the cells
within the tissue blocks that had a thickness of about 5 ×
5 mm. Interestingly, the SA β-Gal activity was highly in-
creased after androgen administration; in contrast there
were only few SA β-Gal positive stained cells detectable in
PCa tissue without hormone treatment of the same biopsy
(Figure 3A). Differences between the androgens DHT and
R1881 were not observed. Thus, the data suggest that an-
drogen treatment leads to the induction of SA β-Gal activ-
ity in human PCa tissue ex vivo.
Furthermore, RNA was extracted from these tissue
samples to analyze the expression level of the tumor
suppressor p16, p14 and p21, which are described to be
involved in cellular senescence [17-19]. The p14 gene
expression was increased after DHT as well as R1881 ad-
ministration (Figure 3B). p21 and p16 gene expression
exhibited an up-regulation by androgens at SAL.
In summary, to our knowledge this is the first time
that reveal that androgen treatment is able to induce cel-
lular senescence in human PCa tissue ex vivo, which is
in line with the hypothesis that PCa may undergo cellu-
lar senescence and that the LNCaP cell line can serve
well as a suitable in vitro senescence model system that
represents similarities to ex vivo studies using primary
human cancer tissue.
Androgen-induced cellular senescence is mediated
through tumor suppressor genes in LNCaP cells
The p14 gene expression, an activator of p53 via the in-
hibition of Mdm2, was up-regulated in the PCa tissue ex
vivo upon androgen treatment. To examine the role of
this pathway we analyzed mRNA expression after ad-
ministration of androgens in LNCaP cells. The gene ex-
pression of p14 is also increased at SAL but not at LAL
(Figure 4A). An acetylation and stabilization of the tumor
suppressor p53 has been described to occur by senescence-
inducing stimuli [33]. However, neither the total nor acety-
lated protein levels of p53 seem to be changed after andro-
gen treatment in comparison to DMSO as solvent control
(Figure 4B), indicating that p53 might not be involved in
the androgen-mediated cellular senescence.
p16, as a cyclin-dependent kinase inhibitor, is known to
mediate a hypophosphorylation of pRb and consequently
a down regulation of the E2F1 transactivation as wells as
the E2F1 gene expression [33]. After administration of
SAL an upregulation of p16, hypophosphorylation of pRb
and down-regulation of the pRb targets Cyclin D1 as well
as of E2F1 protein levels were observed indicating that
the p16-pRb pathway is regulated by SAL treatment
(Figure 4C). Similar results were obtained by treating the
cells for 6 days (Additional file 3: Figure S3). In contrast,
LAL treatment mediated no detectable changes of p16,
Cyclin D1 and E2F1 expression level. In line with this,
SAL treatment led to inhibition of down-stream targets
of pRB, Cyclin D1 as well as E2F1 at mRNA level
(Figure 4D, E), whereas the p16 mRNA is upregulated
by SAL doses (Figure 4F). Accordingly, the mRNA level
of ID1, an inhibitor of p16 expression, is reduced upon
SAL administration (Figure 4G). Thus, these data indi-
cate that the p16-pRb-E2F1 pathway is associated with
the androgen-mediated cellular senescence.
Interestingly, transient knock-down of p16 by siRNA
strongly reduces the R1881-mediated level of SA β-Gal
activity compared to scrambled (SCR) siRNA, whereas
knock-down of p16 without androgen treatment results
in basal level similar to the controls (Figure 4H) indicat-
ing that the androgen-induced cellular senescence is in
part mediated by the induction of p16.
It has been suggested that the formation of SAHFs co-
incides with stable repression of E2F target genes in a
pRb-dependent manner [34]. SAHFs are considered as
Roediger et al. Molecular Cancer 2014, 13:214 Page 5 of 15
http://www.molecular-cancer.com/content/13/1/214
heterochromatin, which is also found perinuclear. Since
E2F1 regulates the expression of its own gene by a positive
feedback loop, we analyzed whether the human E2F1 gene
loci localize to SAHF vicinity and whether the E2F1 locus
changes its position within the cell nucleus. For that pur-
pose we used interphase 3D-FISH (3D-iFISH) to label the
E2F1 locus on chromosome 20 and counterstained with
DAPI to detect SAHFs of interphase LNCaP cells. SAHFs
were sparely detected in control treatment. SAL treatment
indicated that the FISH signals are in the vicinity of
SAHFs (Figure 5A). Analyzing 24 interphase 3D nuclei we
found that 65% of the E2F1 covering FISH-signals are
colocalizing with SAHFs and 35% of the FISH signals lie
outside of SAHFs (data not shown, Figure 5B), which indi-
cates an enrichment of the genomic locus within the
SAHFs. Interestingly, analyzing the location of the E2F1
loci in the control treated group reveals a preferred central
and intermediate localization of the E2F1 loci, whereas
SAL treatment indicates an increase of FISH signals in the
nuclear periphery (Figure 5B), suggesting an androgen-
induced change of the nuclear localization of the E2F1 loci
under SAL conditions.
Taken together, the data strongly indicate that androgen
treatment at SAL induces cellular senescence through the
induction of the p16-pRB-E2F1 pathway.
Rapid signaling participates in androgen-induced cellular
senescence
We sought to analyze shorter incubation times of andro-
gens to investigate the minimal treatment time for
A
B
Figure 3 AR-agonists induce cellular senescence in human PCa tissue ex vivo.Human prostate cancer tissues after prostatectomy were
used to examine the effect of androgens ex vivo. PCa tissue (n = 5 patients) and control (n = 2) samples were treated daily with 1 μM DHT or 10
nM and 1 μM R1881 for 48 h. A. Pictures of representative SA β-Gal stained cryosections (10 μm thickness) of untreated or treated PCa tumor
tissue and non-tumor tissue. Bars represent 300 μm and spots of SA β-gal positive cells were labeled with arrows. B. Analysis of the gene expression of
p16, p14 and p21 was performed via qRT-PCR. Gene expression was normalized to GAPDH and the values for untreated samples were set as one. Error
bars indicate the standard deviation of the mean of doublets of the samples of one group.
Roediger et al. Molecular Cancer 2014, 13:214 Page 6 of 15
http://www.molecular-cancer.com/content/13/1/214
A
C
F
H
D
E
G
B
Figure 4 Androgen-induced cellular senescence is mediated through the tumor suppressors p16-pRb. To examine the signaling pathways
involved in the induction of cellular senescence, Western blotting, 3D-FISH of interphase nuclei, qRT-PCRs and transient transfections with siRNA
were performed. LNCaP cells were incubated for 72 h with solvent control or different R1881 concentrations (1 pM = LAL; 1 nM = SAL). C, solvent
control (DMSO). A. qRT-PCR was performed to analyze mRNA expression of p14. Gene expression was normalized to β-actin and the values for
untreated samples (C). Error bars indicate the standard deviation of the mean of doublets. B. Protein levels of p53 as a target of p14 were
detected with immunoblotting using antibodies against p53 and acetylated p53 (ac p53) known to be involved in cellular senescence pathway.
Quantification of the bands was realized via Labimage D1 and the expression levels of the target proteins were normalized and given as band
intensity to the loading control α-tubulin, untreated sample. C. Changes of the p16-pRb pathway by androgen treatment were analyzed by
Western blotting. D-G) Quantitative qRT-PCR was performed to analyze mRNA expression with primers directed against indicated mRNAs. Gene
expression was normalized to β-actin. Error bars indicate the standard deviation of the mean of doublets. C: solvent control (DMSO). H. Transient
transfection of small interference RNA (siRNA) and subsequent SA β-gal assays were used to analyze the effects of p16 on the androgen-induced
senescence. LNCaP cells were transfected via electroporation with srambled control (SCR) siRNA as negative control or p16 siRNA and without
any siRNA () 24 h prior R1881 treatment. Thereafter, cells were fixed and analyzed for SA β-Gal activity using a light microscopy at 200x
magnification and 3× 200 cells were counted and as means of the triplets in percent diagramed.
Roediger et al. Molecular Cancer 2014, 13:214 Page 7 of 15
http://www.molecular-cancer.com/content/13/1/214
androgen-induced cellular senescence. Administration of
androgens at LAL reveals no changes in the level of cel-
lular senescence at any time point. In contrast, the SA
β-Gal activity under SAL conditions is increased after
only 3 h of treatment and reaches a maximum after 72 h
(Figure 6A). These data indicate that the R1881-induced
cellular senescence is partially mediated through a rapid
signaling response.
On the one hand, Western blotting data indicate that
the total amount of Src seems to be unchanged after
SAL treatment (Figure 6B). The ratio between Src and
phospho-Src is changed towards a slight increase of Src
phosphorylation after SAL. Interestingly, we also ob-
served an increase of Akt phosphorylation (Figure 6B).
Based on these findings we investigated the involvement
of the Src- and Akt-kinase in androgen-induced cellular
senescence using first a Src-specific inhibitor. Notably,
treatment of LNCaP cells with the Src inhibitor PP2
under SAL conditions reduces the androgen-mediated
cellular senescence (Figure 6C). In contrast, inhibition of
Src without androgens or with LAL has no detectable
influence on the SA β-Gal activity in LNCaP cells com-
pared to control. This indicates that the androgen-
induced cellular senescence is mediated in part by Src-
signaling.
On the other hand, blocking MEK1/2-kinases, which
function downstream of the Src-kinase, via the U0126 in-
hibitor reveals no obvious effect on androgen-induced cel-
lular senescence. In line with this, R1881 mediates no
change of the phosphorylation level of ERK1/2 (Additional
file 4: Figure S4). Furthermore, other Src downstream fac-
tors such as p38 and STAT3 were analyzed using specific
inhibitors without an indication for their participation in
this process (data not shown). With this background we
focused on other pathways downstream of the Src-kinase.
Akt phosphorylation is a well-known pathway of the
Src tyrosine kinase and involves signaling molecules
such as the PI3K as well as the mammalian target of
rapamycin (mTOR). Using inhibitors the role of these
factors in androgen-mediated cellular senescence was
analyzed. Inhibition of PI3K, an Akt-activating kinase,
by the 3-MA inhibitor, reduced the level of androgen-
induced cellular senescent cells (Figure 6D), which con-
firms that the Src-Akt signaling pathway is involved in
androgen-induced cellular senescence at supraphysiologi-
cal levels. Similarly, using a specific Akt-kinase inhibitor
(Akti) reveals a strong reduction of the SAL-mediated SA
β-Gal activity (Figure 6E). Thereby, treatment with the
Akt-inhibitor alone results in a basal level of cellular sen-
escence similar to untreated or DMSO control, whereas in
combination with SAL the androgen-mediated cellular
senescence is strongly reduced and close to the basal level.
Since the incubation at SAL but not at LAL specifically in-
creases the phosphorylation level of Akt protein as well as
inhibition of this pathway reduces androgen-induced cel-
lular senescence, we assume that the Akt-kinase could be
one key regulator of androgen-induced cellular senescence
in LNCaP cells.
Thus, the data suggest that the Src tyrosine kinase and
the downstream Akt-PI3K pathway mediate in part the
androgen-induced cellular senescence.
A further downstream target of the Src- and the Akt-
kinase is mTOR, which is involved in proliferation and
cell cycle regulation processes [35]. Rapamycin alone
mediates no detectable change in the level of cellular
senescence. In contrast, rapamycin co-treated with SAL
resulted in reduction of SA β-Gal positive stained cells
(Figure 6F).
Notably, AR translocaton studies using a GFP-AR ex-
pression plasmid indicate that neither the Src-kinase in-
hibitor PP2 nor the mTOR inhibitor rapamycin seem to
have an influence on the receptor nuclear translocation
(data not shown). Thus, the data show that rapamycin re-
duces the androgen-mediated SA β-Gal activity and sug-
gest that mTOR is partially involved in androgen-
mediated cellular senescence. This supports the notion
that the Src-Akt-mTOR signaling mediates the androgen-
mediated induction of cellular senescence.
Taken together, these observations indicate that
androgen-induced cellular senescence is mediated at
least in part by the AR-driven rapid signaling pathway
involving the Src-Akt-mTOR signaling.
Androgens regulate autophagy acivity in LNCaP cells
Rapamycin was described to induce the degradation
process autophagy [36]. Gamerdinger et al. [20] linked
this process to cellular senescence. Since rapamycin is
reducing SAL-mediated cellular senescence in LNCaP
cells, we therefore hypothesized a link between androgen-
induced cellular senescence and autophagy.
The conversion of LC3 was analyzed, which is an im-
portant marker of autophagy activity, derived from the
cytosolic LC3-I into the autophageosom-associated LC3-
II [37]. Accordingly, autophagy activity is measured by the
ratio of LC3-I to LC3-II. LC3-II is detectable in the control
(Figure 7A) suggesting basal autophagy activity in LNCaP
cells. After LAL incubation LC3 conversion is reduced and
the protein level of LC3-I is increased (Figure 7A). The dif-
ferent levels of LC3-I may derive from reduced conversion/
degradation or protein stability/expression. Interestingly,
thedataalsorevealapromotionoftheconversionofLC3-I
into LC3-II after SAL administration, indicated by the
higher level of LC3-II compared to LC3-I (Figure 7A).
These results lead to the assumption that supraphysiologi-
cal levels of androgens influence autophagy markers and
autophagy activity. The strong reduction of the ratio is in
part reverted by treatment with rapamycin or the Src in-
hibitor PP2, which is associated with the inhibition of SAL-
Roediger et al. Molecular Cancer 2014, 13:214 Page 8 of 15
http://www.molecular-cancer.com/content/13/1/214
mediated SA β-Gal activity. This indicates that autophagy is
associated with the SAL-mediated cellular senescence.
Furthermore, a punctuated LC3 pattern, which is indica-
tive of the integration of LC3 as protein aggregates into
the autophageosome membrane and therefore an autoph-
agy marker [38] was employed using the GFP-LC3 fusion
protein. Interestingly, SAL treatment induced a specific
GFP pattern, which is still visible in combination with the
autophagy inducer rapamycin but was inhibited through
3-MA co-treatment (Figure 7B), indicating that SAL treat-
ment is associated with enhanced autophagy. Thus inhib-
ition of PI3K and autophagy by 3-MA reduces the level of
androgen-mediated cellular senescence.
Since androgens induce a robust induction of p14 gene
expression in LNCaP cells (Figure 3B) as an androgen re-
sponse, we analyzed the androgen-induced expression of
p14 after shorter treatment times. In the presence or ab-
sence of 3-MA time-dependent experiments suggest that
under SAL conditions the induction of p14 mRNA expres-
sion is observed after only 16 hours (Figure 7C) indicating
that p14 may not be the timely primary target of the rapid
response to androgen-induced cellular senescence. Inter-
estingly, 3-MA treatment counteracts the androgen-
induced p14 gene expression (Figure 7C). Thus, these
results suggest that androgens upregulates of autophagy
activity, which supports the hypothesis that supraphy-
siological levels of androgens regulate autophagy activ-
ity in LNCaP cells.
Taken together, reduction of SAL-mediated cellular
senescence by 3-MA is associated with an inhibition of
androgen-induced autophagy activity linking androgen-
mediated cellular senescence with autophagy.
A
B
Figure 5 Three dimensional interphase FISH (3D-iFISH) indicates an androgen-induced change of the nuclear localization of the E2F1
loci under SAL conditions. A. 3D-iFISH of interphase LNCaP nuclei using a DNA probe directed against the genomic E2F1 gene loci (chromosome
20) were performed and costained with DAPI to detect the location of the genomic locus in relation to formed SAHFs after SAL treatment. One nucleus
is shown representatively at various angles for 3D projection. Analysis of 24 nuclei suggests that 65% of the E2F1 loci colocalize with SAHFs (see text).
B. Analysis of 24 senescent LNCaP nuclei in the same experimental setup as in (I) summarizing the location of the E2F1 loci within the nuclei
differentiating between a peripheral, intermediate and center localization of the E2F1 genomic loci on chromosome 20.
Roediger et al. Molecular Cancer 2014, 13:214 Page 9 of 15
http://www.molecular-cancer.com/content/13/1/214
A
B
D
EF
C
Figure 6 Supraphysiological androgen levels mediate cellular senescence in LNCaP cells partially through rapid signaling. The induction of
cellular senescence in LNCaP cells induced by androgens was determined after indicated treatment times with solvent control, 1 pM (low androgen
levels = LAL) or 1 nM R1881 (supraphysiological androgen level =SAL). After the treatment times cells were washed to remove the compounds and
cultured for total of 3 days. Afterwards, cells were fixed and analyzed for SA β-Gal activity using a light microscopy at 200x magnification and 3x 200
cells were counted and as means of the triplets plotted in percent. A. LNCaP cells were treated between 1 for up to 72 h. Thereby at shorter incubation
times, indicated compounds were removed and cells were cultivated until 72 h in total. B. LNCaP cells were incubated for 72 h with R1881 and
followed by detection of Akt and Src as well as their phosphorylated forms by specific antibodies by Western blot analysis. For quantification LabImage
D1 was used. C. Detection of SA β-gal staining of LNCaP cells incubated for 72 h with the Src tyrosine kinase inhibitor PP2 (1 μM) in combination with
LAL and SAL. D. The PI3-kinase inhibitor 3-MA was added to LNCaP cell culture at the indicated concentrations with and without R1881 for 3 d and
analyzed using light microscopy and 3x 200 cells were counted and the mean of the triplets is diagrammed in percent. E. Detection of SA β-Gal
staining of LNCaP cells incubated for 72 h with an Akt-inhibitor (Akti; 1 μM) in combination with SAL treatment. F. Detection of SA β-Gal staining of
LNCaP cells incubated for 72 h with the mTOR inhibitor rapamycin (1 nM) in combination with LAL or SAL treatment.
Roediger et al. Molecular Cancer 2014, 13:214 Page 10 of 15
http://www.molecular-cancer.com/content/13/1/214
Conclusions
Notably, several reports show that supraphysiological
levels of androgens inhibit the proliferation of human
PCa cells and tumor growth [5-9]. It is suggested that
PCa tumor cells respond in a biphasic manner to andro-
gens. Both at very low and at supraphysiological andro-
gen levels the growth of PCa tumor cells is inhibited. A
study on a large prospective cohort, contributes to the
gathering evidence that the long standing androgen hy-
pothesisof increasing PCa risk with increasing androgen
levels might be rejected [39-41]. Furthermore, it has been
suggested that the androgen-activated AR acts also as a
tumor suppressor for prostate cancer [9]. In line with this,
treatment of mice with SAL inhibits the growth of human
CRPCa cells in xenograft mouse model system in vivo
[39,42].
The androgen-dependent human LNCaP PCa cells,
widely used as a PCa model system, display a biphasic pro-
liferative response to androgen stimulation low androgen
concentrations stimulate proliferation, while higher andro-
gen concentrations inhibit cell proliferation [43,44]. How-
ever, the underlying molecular mechanism is not fully
understood. Here, we suggest that the induction of cellular
senescence by supraphysiological androgens may in part
explain the inhibition of PCa growth.
Thus, we demonstrate that the induction of cellular
senescence markers is detectable in LNCaP cells, the hu-
man CRPCa C4-2 cells as well as in human PCa tissue
derived from prostatectomies treated with supraphysio-
logical levels of androgens. The induction of the tumor
suppressor p16 was observed and accordingly a hypo-
phosphorylationofpRB.E2F1expressionisinpart
auto-regulated by E2F1 binding sites in the E2F1 pro-
moter [45]. Hypophosphorylated pRb will thus inhibit
E2F1-mediated transcriptional activity and thus E2F1
mRNA expression, which is reflected by the observed data.
Since siRNA of p16 reduces the level of senescent cells we
therefore hypothesize that supraphysiological androgens
mediate cellular senescence in part through the p16-pRB-
E2F1 pathway. In line with this, we observed an accumula-
tion of the E2F1 gene locus in SAHFs.
Based on the surprisingly rapid response of androgen
exposure to induce cellular senescence and the use of in-
hibitors of the tyrosine kinase family, Akt and mTOR,
that inhibit the androgen-induced cellular senescence,
we furthermore suggest that the rapid, non-genomic an-
drogen action is involved in the induction of cellular
senescence by supraphysiological androgens.
The induction of cellular senescence in human PCa cells
has been described by our group using novel AR-specific
antagonists addressing the human AR [46] being the first
report an AR-dependent induction of cellular senescence.
The induction of cellular senescence has been described for
PC3 cells, a human metastatic PCa cell line that have
originally lost AR expression, stably transfected with the
human AR and treated with the androgen R1881, defined
there as DHT [47]. We confirmed also the androgen-
induced cellular senescence in PC3-AR cells. Interestingly
PC3-AR cells are p53 negative and the p16 locus in hyper-
methylated [47,48] In line with this and with previous re-
port [47] were unable to detect neither p16 nor a regulation
of E2F1 levels by SAL or LAL (Additional file 5: Figure S5),
whereas we observed an induction of p21 mRNA
level by SAL. The lack of p16 expression in PC3-AR
cells suggests that the androgen-induced cellular sen-
escenceismediatedbyadifferentpathwayinthese
cells and suggests that the AR might have interest-
ingly various cellular pathways to induce androgen-
mediated cellular senescence.
Taken together, our data suggest that supraphysiological
androgens induce cellular senescence in human PCa tis-
sues as well as the PCa model cell lines LNCaP and C4-2.
To our knowledge this is the first description that andro-
gens induce cellular senescence ex vivo. Induction of the
tumor suppressor p16 and its pathway is one underlying
molecular mechanism to induce cellular senescence to-
gether with androgen-mediated rapid signaling is involved
in mediating androgen-induced cellular senescence.
Since inhibition of PCa growth is a primary goal in
therapy, the induction of cellular senescence and cell
cycle inhibition represents an interesting option and
may explain previous finding that androgens seem to
have some beneficial roles.
Methods
Cell lines and culture
As a model of human androgen-dependent growing PCa a
LNCaP (lymph node prostate cancer) cell line was used.
Cells were cultured in RPMI (1640) with 10% FBS, 1%
penicillin/streptomycin, 1% sodium pyruvate and 25 mM
HEPES (pH 7.8). Additionally, the C4-2 cell line was used
to represent androgen-independent growing PCa cells.
Cells were cultured in DMEM supplemented with
20% F12, 10% FCS, 5 μg/ml insulin, 5 μg/ml apotransferin,
0.25 μg/ml biotin, 25 μg/ml adenine and 1% penicillin/
streptomycin. All cells were cultured in a 5% CO
2
-95%
air, humidified atmosphere at 37°C. Growth assays were
performed as described earlier [49].
Senescence-associated β-galactosidase (SA β-Gal) staining
The staining was performed essentially as described by
Dimri et al. [50]. Cells were seeded at 20% density as
triplets. The next day cells were treated with the indi-
cated compounds for different incubation times. After-
wards, the cells were washed with PBS and fixed for
5 min in 1% glutardialdehyde. Fixed cells were washed
with PBS and incubated with fresh SA β-Gal staining
solution [40 mM citric acid/sodium phosphate buffer
Roediger et al. Molecular Cancer 2014, 13:214 Page 11 of 15
http://www.molecular-cancer.com/content/13/1/214
A
B
C
Figure 7 Androgen-mediated cellular senescence is linked to autophagy activity. To examine the association between the androgen-mediated
induction of SA β-gal activity as a specific marker for cellular senescence and autophagy the conversion of LC3 was analyzed after 3 d incubation of
LNCaP cells with SAL or LAL. A. The conversion of LC3 I to LC3 II as a marker of autophagy activity was detected by Western blotting experiments.
LNCaP cells were treated with the Src tyrosine kinase inhibitor PP2 (1 μM) or the mTOR inhibitor rapamycin (1 nM) in addition to SAL and the conversion
of the autophagy marker from LC3 I to LC3 II was detected via Western blotting. Quantification of the bands was performed by the Labimage D1 program.
The expression levels of LC3 I and II were normalized to the band intensities of the loading untreated sample control β-actin that was set as 1. The ratios
of these values are indicated below. B. The puncated pattern of LC3 is indicative for autophagy activity and was analyzed by using GFP-LC3. LNCaP cells
were transfected with GFP-LC3 and treated with the indicated compounds for the indicated period. The distribution of GFP-LC3 and formation of
puncated pattern was analyzed by fluorescence microscopy. C. The up-regulation of p14 gene expression by SAL is inhibited by an inhibitor of PI3K
and autophagy. qRT-PCR of LNCaP cells that were treated with the indicated time periods with and without SAL and 3-MA as described in Figure 3B.
Roediger et al. Molecular Cancer 2014, 13:214 Page 12 of 15
http://www.molecular-cancer.com/content/13/1/214
(pH 6.0) containing 1 mg X-gal (5-bromo-4-chloro-3-
indolyl-b-D-galactopyranoside)/ml, 5 mM potassium
ferrocyanide 5 mM potassium ferricyanide, 150 mM
NaCl, and 2 mM MgCl
2
] at 37°C without CO
2
.The
staining solution contains X-Gal, a galactopyranosid,
which is converted by an active galactosidase into a blue
colorant. After overnight incubation blue stained cells
were detected and counted by light microscopy [50,51].
200 cells per well were counted and the average of trip-
lets is diagramed. Used compounds are: 1 nM (supra-
physiological androgen level = SAL) and 1 pM R1881
(low androgen level = LAL) (Methyltrionolone, Perkin
Elmer); 10 nM DHT (Sigma); 1 μM Src-Inhibitor PP2
(4-amino-5-(4-chloophenyl)-7-(t-butyl)Pyrazolo(3,4-d)
pyrimidine, Calbiochem); 1 μM Akt-Inhibitor (1 L6-Hy-
droxymethyl-chiro-Insoitol-2-(R)-2-O-methyl-3-O-
octadecyl-sn-glycerocarbonat, Calbiochem) and 1 nM
rapamycin as an inhibitor of mTOR (LC Laboratories).
Detection of senescence-associated heterochromatic
foci (SAHF)
Cells were seeded as duplicates in RPMI at 10% conflu-
ence. After 24 h the cells were treated with different
compounds for 3 d followed by washing with PBS and
collected via trypsinization. DNA was visualized by
DAPI (4,6-Diamidino-2-phenylindol) at 1 μg/ml after
dropping cells on glass slides and dehydration. Images
were taken by fluorescence microscopy.
FACS analysis
LNCaP cells were seeded as duplicates in RPMI at 10%
confluence. After 24 h cells were treated with different
compounds for 3 d. For FACS analysis cells were trypsi-
nized, washed twice with PBS and fixed for 3 h with 70%
ethanol at 20°C. Afterwards cells were incubated for
45 min at 4°C while rotating with staining solution
(2.5 μg/ml propidium iodide, 0.1 mg/ml RNAse A and
0.05% Triton X-100). 10 000 cells were analyzed with
CyFlow ML cytometer (Partec, Muenster, Germany) and
the cell cycle phases were determined by Cylchred. The
percentage of cells in the different cell cycle phases is
indicated.
MTT viability assay
LNCaP cells were seeded as triplets in RPMI at 5% con-
fluence on 96-well plates. The next day cells were
treated with the different compounds for 3 d followed
by the addition of MTT-solution (cell growth determin-
ation Kit MTT based Marker, Sigma) and 4 h incubation
at 37°C. Afterwards, the media/MTT-solution was re-
moved, MTT-solvent was added and cells were mea-
sured at a wavelength of 570 nM (reference wavelength:
690 nM) via an ELISA-Reader.
Western blot analysis
After 3 d of treatment proteins extracts were obtained
via NETN buffer (200 mM NaCl, 20 mM Tris/HCl pH
= 8.0, 1 mM EDTA, 0.5% NP40) and freezing-thawing
using liquid nitrogen. Proteins were loaded on SDS-
PAGEs with different acrylamid content, specific for the
size of the investigated proteins. Visualization of proteins
blotted on the membrane were performed by different
primary antibodies [α-Tubulin, β-Actin, pRb (Abcam);
p21, p53, ac p53 (Lys 379), p16, Cyclin D1, phospho-
pRb (Ser 807/811), Src, phospho-Src (Tyr 416), Akt,
phospho-Akt (Ser 473; Cell Signaling); E2F1 (Santa
Cruz); LC3 (Sigma)] and secondary antibodies [anti-
mouse, anti-rabbit (Santa Cruz)] coupled with horserad-
ish peroxidase with enhanced chemiluminescence.
Quantification of the bands was performed by the Lab-
image D1 program.
Quantitative reverse transcription PCR (qRT-PCR)
RNA was isolated using peqGOLD TriFast (Peqlab) accord-
ing to the manufacturers protocol. RNA was used in a one-
step qRT-PCR reaction using the SuperScript III Platinum
SYBR Green One-Step qRT-PCR Kit (Invitrogen) with the
following primer sequences (indicated as 53):
p14 forw. CCTGGAGGCGGCGAGAAC, rev. CAG
CACGAGGGCCACAGC;
p16 forw. CTTGCCTGGAAAGATACCG, rev. CCC
TCCTCTTTCTTCCTCC;
p21 forw. TCGACTTTGTCACCGAGACACCAC, rev.
CAGGTCCACATGGTCTTCCTCTG;
Atg3 forw. GCCCCAGGATGCAGAATGTG, rev.
CAATTCTTCCCCTGTAGCCCATTG;
Atg5 forw. GCTTCGAGATGTGTGGTTTGGACG,
rev. CCAAGGAAGAGCTGAACTTGATGC,
Atg7 forw. CAGTTTGCCCCTTTTAGTCAGTGCC,
rev. AGCTTCATCCAGCCGATACTCGTTC,
β-actin forw. ACAGAGCCTCGCCTTTGCCGA, rev.
CACGATGGAGGGGAAGACG;
Beclin 1 forw. CAGGTGAGCTTCGTGTGCC, rev.
CCTGGCTGGGGGGATGAATC;
CyclinD1 forw. TCAACCTAAGTTCGGTTCCGATG,
rev. GTCAGCCTCCACACTCTTGC;
E2F1: Fw: GCAGAGCAGATGGTTATGG, rev.
GATCTGAAAGTTCTCCGAAGAG:
GAPDH forw. GTGAACCATGAGAAGTATGACA
AC, rev. GAGTCCTTCCACGATACC;
ID1 forw. GGTAAACGTGCTGCTCTACGACATG,
rev. CTCCAGCACGTCATCGACTACATC;
LC3A forw. CGAGTTGGTCAAGATCATCCGGC,
rev. GCTCGTAGATGTCCGCGATGGGCG,
LC3B forw. TAGAGCGATACAAGGGGGAGAAGC,
rev. TGTGTCGTTCACCAACAGGAAG and
PI3K forw. GCTTGGAAGGGAAGAGAGAACAAAA
GAG, rev. CTTGGGCATTCCTGGGCAG.
Roediger et al. Molecular Cancer 2014, 13:214 Page 13 of 15
http://www.molecular-cancer.com/content/13/1/214
Obtained data analyses were normalized to β-actin or
GAPDH mRNA levels and diagramed as fold induction.
Results were analyzed via the ΔΔCt-method.
siRNA transfection
To analyze the expression of specific genes in eukaryotic
cells, stealth RNAi (Invitrogen) was used. LNCaP cells were
trypsinized and with 1020 nM siRNA transiently trans-
fected by electroporation. As negative control srcambled
siRNA, and additionally one sample without any siRNA
were used. The knockdown efficiency was detected via
qRT-PCRtoanalyzethespecificgeneexpression.The
transfected cells were treated with different compounds
24 h after electroporation and the induction of cellular sen-
escence was analyzed.
Ex vivo human prostate tissue analysis
Prostate cancer tissue derived from prostatectomy was
pathological examined and as 5 x 5 mm pieces cultured
with the different hormones in RPMI (1640) with 10%
FCS, 1% penicillin/streptomycin, 1% sodium pyruvate
and 25 mM HEPES (pH 7.8) for 2 d. Afterwards, the
PCatissuewascutin5-10μMslicesviaacryotomeand
SA β-gal staining and RNA isolation followed as de-
scribed before. Ethical approval was granted (3286-11/
11). Gleason scores were between 7 and 9. Pre-surgery
PSA values were between 4 and 16 ng/ml.
3D - interphase fluorescence in situ hybridization (iFISH)
3D-iFISH in LNCaP cell nuclei of untreated or treated cell
with SAL for three days was performed as described earl-
ier for lymphocytes [52]. DNA probes for the region
q11.1-qter that include the E2F1 gene locus were obtained
from the Multicolor Chromosome Banding (MCB) probes
library (particularly, MCB 203 DNA probe was used).
Overlap of chromosome 20 and SAHFs was found in 57
from 88 totally analyzed cells. DAPI staining was used to
detect SAHFs. Overlap of FISH-signals and SAHFs was
evaluated using the Cell^P software (Olympus).
Additional files
Additional file 1: Figure S1. Detection of the SAbeta Gal activity
comparing three and six days of incubation with low (LAL) or
supraphysiological (SAL) androgen levels in LNCaP cells. Similar
experimental setup as in Figure 1A. The level of senescent cells is not
increased with longer treatment times.
Additional file 2: Figure S2. Detection ofthe SAbeta Gal activity
comparing three and six days of incubation with low (LAL) or
supraphysiological (SAL) androgen levels in PC3AR cells or PC3-tetAR cells
kindly provided by Dr. Volpert (Mirochnik et al. [47]). Similar experimental setup
as in Figure 1A. Androgens mediate the induction of cellular senescence. A)
Level of senescent cells after 3 or 6 days of treatment. B) Doxycyclin inducible
expression of the human AR and ARdependent as well androgendependent
induction of cellular senescence.
Additional file 3: Figure S3. Changes of the indicated factors by
androgen treatment for 6 days using LNCaP cells were analyzed by (A)
qRTPCR and (B) by Western blotting similarly as described in Figure 4.
β-actin was used as loading control. Quantification of the bands was realized
via Labimage D1 and the expression levels of the target proteins were
normalized and given as band intensity to the loading control β-actin,
untreated sample was set arbitrarily as one. C: solvent control (DMSO).
Additional file 4: Figure S4. Detection of p21 and E2F1 mRNA and
protein levels in PC3AR cells after in response LAL or SAL androgen
levels detected by (A) qRT-PCR or (B) Western blotting, respectively. The
p21 mRNA levels are increased after SAL whereas no significant changes
of E2F1 were observed after androgen treatment for 72 hours.
Additional file 5: Figure S5. Detection of MEK1/2 phosphorylation in
response LAL or SAL androgen levels in LNCaP cells detected by Western
blotting. No significant changes of phosphorylation level of ERK1/2 were
observed after androgen treatment for 72 hours. C: solvent control (DMSO).
Abbreviations
AR: Androgen receptor; CRPCa: Castration resistant PCa;
DHT: Dihydrotestosterone; DMSO: Dimethyl sulfoxide; iFISH: Interphase
fluorescence in situ hybridyzation; LAL: Low androgen levels;
mTOR: Mammalian target of rapamycin; PCa: Prostate cancer; PSA: Prostate
specific antigen; R1881: Methyltrienolone; SA β-Gal: Senescence-associated
beta-galactosidase; SAHF: Senescence-associated heterochromatic foci;
SAL: Supraphysiological androgen levels; wt: Wild-type.
Competing interests
The authors declare that they have no competing interests.
Authorscontributions
JR identified and analyzed the androgen-induced senescence in LNCaP cell
lines WH has been involved in molecular analyses of the human tissue
samples. SB has performed part of the qRT-PCRs, MM has performed the
3D-iFISH. TH supervised and gave input to 3D-iFISH SSH and M.E. have analyzed
the p16 expression and analyzed the androgen response to PC3-AR. SF provided
the tissue samples
.
IP provided the pathology of the human tissue samples. M-OG
performed surgery. AB provided the funding and supervision. All authors read and
approved the final manuscript.
Acknowledgements
We are grateful for Dr. Volpert for providing the tet-inducible PC3-AR cells.
We are also grateful to Dipl. Biochem. Florian Kraft for technical help using
FACS. This work was supported by the German Cancer Aid to A.B and the
Jena University Hospital.
Author details
1
Institute of Human Genetics, Jena University Hospital, 07740 Jena, Germany.
2
Institute of Pathology, Jena University Hospital, 07740 Jena, Germany.
3
Institute of Urology, Jena University Hospital, 07740 Jena, Germany.
4
Present
address: National Institutes of Health (NIH) Section on Molecular
Morphogenesis, Bethesda, MD 20892-5431, USA.
Received: 24 April 2014 Accepted: 27 August 2014
Published: 12 September 2014
References
1. Jemal A, Siegel R, Xu J, Ward E: Cancer statistics, 2010. CA Cancer J Clin
2010, 60:277300.
2. Cronauer MV, Culig Z: Molecular aspects of prostate cancer. World J Urol
2012, 30:277278.
3. Dai WS, Kuller LH, LaPorte RE, Gutai JP, Falvo-Gerard L, Caggiula A: The
epidemiology of plasma testosterone levels in middle aged men. Am J
Epidemiol 1981, 114:804816.
4. Prehn RT: On the prevention and therapy of prostate cancer by
androgen administration. Cancer Res 1999, 59:41614164.
5. Morley JE, Kaiser FE, Perry HM, Patrick P, Morley PM, Stauber PM, Vellas B,
Baumgartner RN, Garry PJ: Longitudinal changes in testosterone,
luteinizing hormone, and follicle-stimulating hormone in healthy older
men. Metabolism 1997, 46:410413.
Roediger et al. Molecular Cancer 2014, 13:214 Page 14 of 15
http://www.molecular-cancer.com/content/13/1/214
6. Umekita Y, Hiipakka RA, Kokontis JM, Liao S: Human prostate tumor
growth in athymic mice: inhibition by androgens and stimulation by
finasteride. Proc Natl Acad Sci U S A 1996, 93:1180211807.
7. Calabrese EJ: Androgens: biphasic dose responses. Crit Rev Toxicol 2001,
31(45):517522.
8. Denmeade SR, Isaacs JT: Bipolar androgen therapy: the rationale for rapid
cycling of supraphysiologic androgen/ablation in men with castration
resistant prostate cancer. Prostate 2010, 70:16001607.
9. Niu Y, Altuwaijri S, Lai KP, Wu CT, Ricke WA, Messing EM, Yao J, Yeh S, Cang
C: Androgen receptor is a tumor suppressor and proliferator in prostate
cancer. Proc Natl Acad Sci U S A 2008, 26;105(34):1218212187.
10. Campisi J: Cellular senescence as a tumor-suppressor mechanism.
Trends Cell Biol 2001, 11:2731.
11. Shay JW, Roninson IB: Hallmarks of senescence in carcinogenesis and
cancer therapy. Oncogene 2004, 23:29192933.
12. Storer M, Mas A, Robert-Moreno A, Pecoraro M, Ortells MC, Di Giacomo V,
Yosef R, Pilpel N, Krizhanovsky V, Sharpe J, Keyes WM: Senescence is a
developmental mechanism that contributes to embryonic growth and
patterning. Cell 2013, 21;155(5):11191130.
13. Muñoz-Espín D, Cañamero M, Maraver A, Gómez-López G, Contreras J,
Murillo-Cuesta S, Rodríguez-Baeza A, Varela-Nieto I, Ruberte J, Collado M,
Serrano M: Programmed cell senescence during mammalian embryonic
development. Cell 2013, 21;155(5):11041118.
14. Collado M, Gil J, Efeyan A, Guerra C, Schuhmacher AJ, Barrada M, Benguria
A, Zaballos A, Flores JM, Barbacid M, Beach D, Serrano M: Senescence in
premalignant tumours. Nature 2005, 436:642.
15. Schmitt CA: Cellular senescence and cancer treatment. Biochim Biophys
Acta 2007, 1775(1):520.
16. Wei W, Hemmer RM, Sedivy JM: Role of p14(ARF) in replicative and induced
senescence in human fibroblasts. Mol Cell Biol 2001, 20:67486757.
17. Krtolica A, Campisi J: Cancer and aging: a model for the cancer promoting
effects of the aging stroma. Int J Biochem Cell Biol 2002, 34:14011414.
18. Schwarze SR, Fu VX, Desotelle JA, Kenowsky ML, Jarrard DF: The
identification of senescence-specific genes during the induction of
senescence in prostate cancer cells. Neoplasia 2005, 7:816823.
19. Campisi J, dAdda di Fagagna F: Cellular senescence: when bad things
happen to good cells. Nat Rev Mol Cell Biol 2007, 8:729740.
20. Gamerdinger M, Hajieva P, Kaya AM, Wolfrum U, Hartl FU, Behl C: Protein
quality control during aging involves recruitment of the
macroautophagy pathway by BAG3. EMBO J 2009, 28:889901.
21. Young ARJ, Narita M, Ferreira M, Kirschner K, Sadaie M, Darot JFJ, Arakawa S,
Shimizu S, Watt FM, Narita M: Autophagy mediates the mitotic
senescence transition. Genes Dev 2009, 23:798803.
22. Narita M: Quality and quantity control of proteins in senescence.
Aging 2010, 2(5):311314.
23. PeterzielH,MirkS,SchonertA,BeckerM,KlockerH,CatoACB:Rapid signaling
by androgen receptor in prostate cancer cells. Oncogene 1999, 18:63226329.
24. Kang Z, Jänne OA, Palvimo JJ: Coregulator recruitment and histone
modifications in transcriptional regulation by the androgen receptor.
Mol Endocrinol 2004, 18(11):26332648.
25. Hammes SR, Levin ER: Extra-nuclear steroid receptors: nature and
function. Endocr Rev 2007, 28:726741.
26. Migliaccio A, Castoria G, Di Domenico M, de Falco A, Lombardi M, Barone
MV, Ametrano D, Zannini MS, Abbondanza C, Auricchio F: Steroid-induced
androgen receptor-estradiol receptor beta-Src complex triggers prostate
cancer cell proliferation. EMBO J 2000, 16;19(20):54065417.
27. Migliaccio A, Di Domenico M, Castoria G, Nanayakkara M, Lombardi M,
de Falco A, Bilancio A, Varricchio L, Ciociola A, Auricchio F: Steroid receptor
regulation of epidermal growth factor signaling through Src in breast
and prostate cancer cells: steroid antagonist action. Cancer Res 2005,
15;65(22):1058510593.
28. Jenster G: The role of the androgen receptor in the development and
progression of prostate cancer. Semin Oncol 1999, 26(4):407421.
29. Sonnenschein C, Olea N, Pasanen ME, Soto AM: Negative controls of cell
proliferation: human prostate cancer cells and androgens. Cancer Res
1989, 49:34743481.
30. Bonne C, Raynaud J-P: Assay of androgen binding sites by exchange with
methyltrienolone (R1881). Steroids 1976, 27:497508.
31. Schayowitz A, Sabnis G, Goloubeva O, Njar VC, Brodie AM: Prolonging
hormone sensitivity in prostate cancer xenografts through dual
inhibition of AR and mTOR. Br J Cancer 2010, 103(7):10011007.
32. Kaufman JM, Vermeulen A: The decline of androgen levels in elderly men
and its clinical and therapeutic implications. Endocr Rev 2005, 26:833876.
33. Sakaguchi K, Herrera JE, Saito S, Miki T, Bustin M, Vassilev A, Anderson CW,
Appella E: DNA damage activates p53 through a phosphorylation-
acetylation cascade. Genes Dev 1998, 12:28312841.
34. Narita M, Nune S, Heard E, Narita M, Lin AW, Hearn SA, Spector DL, Hannon
GJ, Lowe SW: Rb-mediated heterochromatin formation and silencing of
E2F target genes during cellular senescence. Cell 2003, 113:703716.
35. Shaw RJ: LKB1 and AMP-activated kinase control of mTOR signaling and
growth. Acta Physiol 2009, 196:6580.
36. Sabatini DM: mTOR and cancer: insights into a complex relationship.
Nat Rev Cancer 2006, 6:729734.
37. Kroemer G, Marino G, Levine B: Autophagy and the integrated stress
response. Mol Cell 2010, 40:280293.
38. Gottlieb RA, Mentzer RM: Autophagy during cardiac stress: joys and
frustrations of autophagy. Annu Rev Physiol 2010, 72:4559.
39. Isaacs JT, DAntonio JM, Chen S, Antony L, Dalrymple SP, Ndikuyeze GH, Luo
J, Denmeade SR: Adaptive auto-regulation of androgen receptor provides
a paradigm shifting rationale for bipolar androgen therapy (BAT) for
castrate resistant human prostate cancer. Prostate 2012, 72(14):14911505.
40. Raynaud JP: Prostate cancer risk in testosterone-treated men. J Steroid
Biochem Mol Biol 2006, 102(15):261266.
41. Stattin P, Lumme S, Tenkanen L, Alfthan H, Jellum E, Hallmans G, Thorensen
S, Hakulinen T, Luostarinen T, Lehtinen M, Dillner J, Stenman UH, Stenman
M, Hakama M: High levels of circulating testosterone are not associated
with increased prostate cancer risk; a pooled prospective study. Int J
Cancer 2004, 108:418424.
42. Chuu C-P, Kokontis JM, Hiipakka RA, Fukuchi J, Lin H-P, Lin C-Y, Huo C, Su
L-C, Liao S: Androgen suppresses proliferation of castration-resistant
LNCaP 104-R2 prostate cancer cells through androgen receptor, Skp2,
and c-Myc. Cancer Sci 2011, 11:20222028.
43. de Launoit Y, Veilleux R, Dufour M, Simard J, Labrie F: Characteristics of the
biphasic action of androgens and of the potent antiproliferative effects
of the new pure antiestrogen EM-139 on cell cycle kinetic parameters in
LNCaP human prostatic cancer cells. Cancer Res 1991, 51:51655170.
44. Dehm SM, Tindall DJ: Androgen receptor structural and functional
elements: role and regulation in prostate cancer. Mol Endocrinol 2007,
21:28552863.
45. Johnson DG, Ohatani K, Nevis JR: Autoregulatory control of E2F1
expression in response to positive and negative regulators of cell cycle
progression. Genes Dev 1994, 8:15141525.
46. Fousteris MA, Schubert U, Roell D, Roediger J, Ballis N, Nikolaropoulos SS,
Baniahmad A, Giannis A: 20-Aminosteroids as a novel class of selective
and complete androgen receptor antagonists and inhibitors of prostate
cancer cell growth. Bioorg Med Chem 2010, 1;18(19):69606969.
47. Mirochnik Y, Veliceasa D, Williams L, Maxwell K, Yemelyanov A, Budunova I,
Volpert OV: Androgen receptor drives cellular senescence. PLoS One 2012,
7(3):e31052.
48. Jarrard DF, Sarkar S, Shi Y, Yeager TR, Magrane G, Kinoshita H, Nassif N,
Meisner L, Newton MA, Waldman FM, Reznikoff CA: p16/pRb pathway
alterations are required for bypassing senescence in human prostate
epithelial cells. Cancer Res 1999, 59(12):29572964.
49. Papaioannou M, Schleich S, Prade I, Degen S, Roell D, Schubert U, Tanner T,
Claessens F, Matusch R, Baniahmad A: The natural compound atraric acid is an
antagonist of the human androgen receptor inhibiting cellular invasiveness
and prostate cancer cell growth. JCellMolMed2009, 13:22102223.
50. Dimri GP, Lee X, Basile G, Acosta M, Scott G, Roskelley C, Medrano EE,
Linskens M, Rubelj I, Pereira-Smith O, Peacocket M, Campisi J: A biomarker
that identifies senescent human cells in culture and in aging skin
in vivo. Proc Natl Acad Sci U S A 1995, 26;92:93639367.
51. Lorenz V, Hessenkemper W, Rödiger J, Kyrylenko S, Kraft F, Baniahmad A:
Sodium butyrate induces cellular senescence in neuroblastoma and
prostate cancer cells. Hormone Mol Biol Clin Invest 2011, 7(1):265272.
52. Manvelyan M, Hunstig F, Mrasek K, Bhatt S, Pellestor F, Weise A, Liehr T: Position
of chromosomes 18, 19, 21 and 22 in 3D-preserved interphase nuclei of
human and gorilla and white hand gibbon. Mol Cytogenet 2008, 29;1:9.
doi:10.1186/1476-4598-13-214
Cite this article as: Roediger et al.:Supraphysiological androgen levels
induce cellular senescence in human prostate cancer cells through the
Src-Akt pathway. Molecular Cancer 2014 13:214.
Roediger et al. Molecular Cancer 2014, 13:214 Page 15 of 15
http://www.molecular-cancer.com/content/13/1/214
... Interestingly, PCa exhibits a biphasic growth response toward androgen concentrations. Low, physiological androgen levels (LAL) promote growth, whereas, paradoxically, high, supraphysiological androgen levels (SAL) inhibit also PCa cell proliferation in preclinical models [2][3][4][5]. ...
... Induction of cell senescence by SAL is AR-dependent. AR negative human PCa cells does not respond to SAL, whereas an inducible AR-expression system in AR-negative cells renders cells sensitive to SAL-mediated cell senescence [4,17]. ...
... Notably the androgen-induced phosphorylation disappears within one hour [19]. Interestingly, the AKT inhibitor, AKTi, inhibits SAL-mediated cell senescence in LNCaP cells, whereas inhibition of the MAPK pathway did not interfere with the SAL-mediated cell senescence [4], suggesting that the AR-AKT signaling mediates androgen-induced cell senescence. ...
Article
Full-text available
The bipolar androgen therapy (BAT) to treat prostate cancer (PCa) includes cycles of supraphysiological androgen levels (SAL) under androgen-deprivation therapy (ADT). We showed previously that SAL induces cellular senescence in androgen-sensitive PCa cells and in ex vivo-treated patient PCa tumor samples. Here, we analyzed the underlying molecular pathway and reveal that SAL induces cellular senescence in both, castration-sensitive (CSPC) LNCaP and castration-resistant PCa (CRPC) C4-2 cells through the cell cycle inhibitor p15INK4b and increased phosphorylation of AKT. Treatment with the AKT inhibitor (AKTi) potently inhibited SAL-induced expression of p15INK4b and cellular senescence in both cell lines. Proximity-ligation assays (PLA) combined with high-resolution laser-scanning microscopy indicate that SAL promotes interaction of endogenous androgen receptor (AR) with AKT in the cytoplasm as well as in the nucleus detectable after three days. Transcriptome sequencing (RNA-seq) comparing the SAL-induced transcriptomes of LNCaP with C4-2 cells as well as with AKTi-treated cell transcriptomes revealed landscapes for cell senescence. Interestingly, one of the identified genes is the lncRNASAT1. SAL treatment of native patient tumor samples ex vivo upregulates lncRNASAT1. In PCa tumor tissues, lncRNASAT1 is downregulated compared with nontumor tissues of the same patients. Knockdown indicates that the lncRNASAT1 is crucial for SAL-induced cancer-cell senescence as an upstream factor for pAKT and for p15INK4b. Further, knockdown of lncRNASAT1 enhances cell proliferation by SAL, suggesting that lncRNASAT1 serves as a tumor suppressor at SAL. Interestingly, immunoprecipitation of AR detected lncRNASAT1 as an AR-interacting partner that regulates AR target-gene expression. Similarly, RNA-ChIP experiments revealed the interaction of AR with lncRNASAT1 on chromatin. Thus, we identified a novel AR-lncRNASAT1-AKT-p15INK4b signaling axis to mediate SAL-induced cellular senescence.
... It is suggested that the sudden switch in the androgen levels provide less time for adaptive responses of AR-signaling [7]. Mechanistically, we found that SAL induces cellular senescence in human PCa tumor cell lines, as well as in PCa tissues obtained from patients with prostatectomy [8]. This suggests that SAL may induce a tumor suppressive program in PCa cells. ...
... The cultivation of both LNCaP and C4-2 cells were described previously [8]. As defined earlier based on androgen-dependent growth, we used 1nM R1881 or 10nM DHT as SAL, 1pM R1881 or 10pM DHT as LAL, and DMSO as the solvent control [8]. ...
... The cultivation of both LNCaP and C4-2 cells were described previously [8]. As defined earlier based on androgen-dependent growth, we used 1nM R1881 or 10nM DHT as SAL, 1pM R1881 or 10pM DHT as LAL, and DMSO as the solvent control [8]. For the knockdown of ING1 and ING2, retroviral vectors pLMP-shING1b and pSR-shING2a were used with pLMP-shluc or pSR-shluc as the controls, respectively. ...
Article
Full-text available
The human telomerase is a key factor during tumorigenesis in prostate cancer (PCa). The androgen receptor (AR) is a key drug target controlling PCa growth and regulates hTERT expression, but is described to either inhibit or to activate. Here, we reveal that androgens repress and activate hTERT expression in a concentration-dependent manner. Physiological low androgen levels activate, while, notably, supraphysiological androgen levels (SAL), used in bipolar androgen therapy (BAT), repress hTERT expression. We confirmed the SAL-mediated gene repression of hTERT in PCa cell lines, native human PCa samples derived from patients treated ex vivo, as well as in cancer spheroids derived from androgen-dependent or castration resistant PCa (CRPC) cells. Interestingly, chromatin immuno-precipitation (ChIP) combined with functional assays revealed a positive (pARE) and a negative androgen response element (nARE). The nARE was narrowed down to 63 bp in the hTERT core promoter region. AR and tumor suppressors, inhibitor of growth 1 and 2 (ING1 and ING2, respectively), are androgen-dependently recruited. Mechanistically, knockdown indicates that ING1 and ING2 mediate AR-regulated transrepression. Thus, our data suggest an oppositional, biphasic function of AR to control the hTERT expression, while the inhibition of hTERT by androgens is mediated by the AR co-repressors ING1 and ING2.
... However, when androgen-sensitive PCa cell lines, as well as ex vivo PCa tissue, were challenged with supraphysiological doses of androgens (SPA), it induces cell cycle arrest at the G1 phase and cell senescence through cell cycling regulators such as CDK inhibitor p16, Rb1, and E2F1 (106). The SPA-induced cell cycle arrest can be partially alleviated by small molecule inhibitors against Src and Akt (106). ...
Article
Full-text available
While the androgen receptor (AR) signalling is the mainstay therapeutic target for metastatic prostate cancers, these tumours will inevitably develop therapy resistance to AR pathway inhibitors suggesting that prostate tumour cells possess the capability to develop mechanisms to bypass their dependency on androgens and/or AR to survive and progress. In many studies, protein kinases such as Src are reported to promote prostate tumour progression. Specifically, the pro-oncogene tyrosine Src kinase regulates prostate cancer cell proliferation, adhesion, invasion, and metastasis. Not only can Src be activated under androgen depletion, low androgen, and supraphysiological androgen conditions, but also through crosstalk with other oncogenic pathways. Reciprocal activations between Src and AR proteins had also been reported. These findings rationalize Src inhibitors to be used to treat castrate-resistant prostate tumours. Although several Src inhibitors had advanced to clinical trials, the failure to observe patient benefits from these studies suggests that further evaluation of the roles of Src in prostate tumours is required. Here, we summarize the interplay between Src and AR signalling during castrate-resistant prostate cancer progression to provide insights on possible approaches to treat prostate cancer patients.
... qRT-PCR assays were performed as explained elsewhere [64]. The primer sequences are listed in Supplementary Tables 1 and 2. ...
Article
Full-text available
Castration-resistant prostate cancer (CRPC) is an aggressive lethal form of prostate cancer (PCa). Atraric acid (AA) not only inhibits the wild-type androgen receptor (AR) but also those AR mutants that confer therapy resistance to other clinically used AR antagonists, indicating a different mode of AR antagonism. AA induces cellular senescence and inhibits CRPC tumour growth in in vivo xenograft mouse model associated with reduced neo-angiogenesis suggesting the repression of intratumoural neo-angiogenesis by AA. In line with this, the secretome of CRPC cells mediates neo-angiogenesis in an androgen-dependent manner, which is counteracted by AA. This was confirmed by two in vitro models using primary human endothelial cells. Transcriptome sequencing revealed upregulated angiogenic pathways by androgen, being however VEGF-independent, and pointing to the pro-angiogenic factor angiopoietin 2 (ANGPT2) as a key driver of neo-angiogenesis induced by androgens and repressed by AA. In agreement with this, AA treatment of native patient-derived PCa tumour samples ex vivo inhibits ANGPT2 expression. Mechanistically, in addition to AA, immune-depletion of ANGPT2 from secretome or blocking ANGPT2-receptors inhibits androgen-induced angiogenesis. Taken together, we reveal a VEGF-independent ANGPT2-mediated angiogenic pathway that is inhibited by AA leading to repression of androgen-regulated neo-angiogenesis.
... The expression of this lncRNA is down-regulated in PCa tumor tissue compared to nontumor tissue indicating a tumor suppressive function. LncRNASAT1 is up-regulated by the treatment with supraphysiological androgen level (SAL) in PCa cells and human PCa tissue ex vivo and mediates the SAL-induced cellular senescence [67]. Further, it has been shown that lncRNASAT1 interacts with AR on chromatin level regulating AR transactivation and AR target gene expression [68]. ...
Article
Full-text available
The androgen receptor (AR) is a member of the nuclear receptor superfamily and has three functional domains, namely the N-terminal, DNA binding, and C-terminal domain. The N-terminal domain harbors potent transactivation functions, whereas the C-terminal domain binds to androgens and antiandrogens used to treat prostate cancer. AR has genomic activity being DNA binding-dependent or through interaction with other DNA-bound transcription factors, as well as a number of non-genomic, non-canonical functions, such as the activation of the ERK, AKT, and MAPK pathways. A bulk of evidence indicates that non-coding RNAs have functional interactions with AR. This type of interaction is implicated in the pathogenesis of human malignancies, particularly prostate cancer. In the current review, we summarize the available data on the role of microRNAs, long non-coding RNAs, and circular RNAs on the expression of AR and modulation of AR signaling, as well as the effects of AR on their expression. Recognition of the complicated interaction between non-coding RNAs and AR has practical importance in the design of novel treatment options, as well as modulation of response to conventional therapeutics.
... Genomic technologies have pioneered the discovery of androgen-regulated genes (ARGs) and sought to determine how the aberrant expression of such genes contributes to the development and progression of localized PCa, mPCa, and CRPC 4,[27][28][29] . In AR-positive PCa cells, proliferation is stimulated by physiologic concentrations androgens (PA) (e.g., 0.1-1 nM dihydrotestosterone-DHT) and repressed by SPA (e.g., ≥ 10 nM DHT or ≥ 1n nM synthetic androgen R1881) 24,26,[30][31][32][33][34][35][36][37][38][39] . SPA antagonizes cell proliferation by causing AR-mediated repression of both cell-cycle genes (e.g., cyclin D1, CDK4/6, CDKN1A) 40 , DNA replication genes (e.g., MCM4) 41 , and genes linked to cellular senescence 38 . ...
Article
Full-text available
Supraphysiologic androgen (SPA) inhibits cell proliferation in prostate cancer (PCa) cells by transcriptional repression of DNA replication and cell-cycle genes. In this study, quantitative glycoprotein profiling identified androgen-regulated glycoprotein networks associated with SPA-mediated inhibition of PCa cell proliferation, and androgen-regulated glycoproteins in clinical prostate tissues. SPA-regulated glycoprotein networks were enriched for translation factors and ribosomal proteins, proteins that are known to be O -GlcNAcylated in response to various cellular stresses. Thus, androgen-regulated glycoproteins are likely to be targeted for O -GlcNAcylation. Comparative analysis of glycosylated proteins in PCa cells and clinical prostate tissue identified androgen-regulated glycoproteins that are differentially expressed prostate tissues at various stages of cancer. Notably, the enzyme ectonucleoside triphosphate diphosphohydrolase 5 was found to be an androgen-regulated glycoprotein in PCa cells, with higher expression in cancerous versus non-cancerous prostate tissue. Our glycoproteomics study provides an experimental framework for characterizing androgen-regulated proteins and glycoprotein networks, toward better understanding how this subproteome leads to physiologic and supraphysiologic proliferation responses in PCa cells, and their potential use as druggable biomarkers of dysregulated AR-dependent signaling in PCa cells.
... Cross-phosphorylation events between AKT and AR are an example. On one hand, androgen-bound AR leads to an increase of AKT phosphorylation [77,78]. On the other hand, AKT phosphorylates AR at Ser210, Ser213, Ser215, Ser791, and Ser792 in order to regulate AR transcriptional activity and expression [68,79,80]. ...
Article
Full-text available
Androgen deprivation therapy (ADT) and androgen receptor (AR)-targeted therapy are the gold standard options for treating prostate cancer (PCa). These are initially effective, as localized and the early stage of metastatic disease are androgen- and castration-sensitive. The tumor strongly relies on systemic/circulating androgens for activating AR signaling to stimulate growth and progression. However, after a certain point, the tumor will eventually develop a resistant stage, where ADT and AR antagonists are no longer effective. Mechanistically, it seems that the tumor becomes more aggressive through adaptive responses, relies more on alternative activated pathways, and is less dependent on AR signaling. This includes hyperactivation of PI3K-AKT-mTOR pathway, which is a central signal that regulates cell pro-survival/anti-apoptotic pathways, thus, compensating the blockade of AR signaling. The PI3K-AKT-mTOR pathway is well-documented for its crosstalk between genomic and non-genomic AR signaling, as well as other signaling cascades. Such a reciprocal feedback loop makes it more complicated to target individual factor/signaling for treating PCa. Here, we highlight the role of PI3K-AKT-mTOR signaling as a resistance mechanism for PCa therapy and illustrate the transition of prostate tumor from AR signaling-dependent to PI3K-AKT-mTOR pathway-dependent. Moreover, therapeutic strategies with inhibitors targeting the PI3K-AKT-mTOR signal used in clinic and ongoing clinical trials are discussed.
Article
The bipolar androgen therapy (BAT) includes the treatment of prostate cancer (PCa) patients with supraphysiological androgen level (SAL). Interestingly, SAL induces cell senescence in PCa cell lines as well as ex vivo in tumor samples of patients. The SAL-mediated cell senescence was shown to be androgen receptor (AR)-dependent and mediated in part by non-genomic AKT signaling. RNA-seq analyses compared with and without SAL treatment as well as by AKT inhibition (AKTi) revealed a specific transcriptome landscape. Comparing the top 100 genes similarly regulated by SAL in two human PCa cell lines that undergo cell senescence and being counteracted by AKTi revealed 33 commonly regulated genes. One gene, ERBB receptor feedback inhibitor 1 (ERRFI1), encodes the mitogen-inducible gene 6 (MIG6) that is potently upregulated by SAL, whereas the combinatory treatment of SAL with AKTi reverses the SAL-mediated upregulation. Functionally, knockdown of ERRFI1 enhances the pro-survival AKT pathway by enhancing phosphorylation of AKT and the downstream AKT target S6, whereas the phospho-retinoblastoma (pRb) protein levels were decreased. Further, the expression of the cell cycle inhibitor p15INK4b is enhanced by SAL and ERRFI1 knockdown. In line with this, cell senescence is induced by ERRFI1 knockdown and is enhanced slightly further by SAL. Treatment of SAL in the ERRFI1 knockdown background enhances phosphorylation of both AKT and S6 whereas pRb becomes hypophosphorylated. Interestingly, the ERRFI1 knockdown does not reduce AR protein levels or AR target gene expression, suggesting that MIG6 does not interfere with genomic signaling of AR but represses androgen-induced cell senescence and might therefore counteract SAL-induced signaling. The findings indicate that SAL treatment, used in BAT, upregulates MIG6, which inactivates both pRb and the pro-survival AKT signaling. This indicates a novel negative feedback loop integrating genomic and non-genomic AR signaling.
Article
The discovery that androgens play an important role in the progression of prostate cancer (PCa) led to the development of androgen deprivation therapy (ADT) as a first line of treatment. However, paradoxical growth inhibition has been observed in a subset of PCa upon administration of supraphysiological levels of testosterone (SupraT), both experimentally and clinically. Here we report that SupraT activates cytoplasmic nucleic acid sensors and induces growth inhibition of SupraT-sensitive PCa cells. This was initiated by the induction of two parallel autophagy-mediated processes, namely, ferritinophagy and nucleophagy. Consequently, autophagosomal DNA activated nucleic acid sensors that converge on NF-κB to drive immune signaling pathways. Chemokines and cytokines secreted by the tumor cells in response to SupraT resulted in increased migration of cytotoxic immune cells to tumor beds in xenograft models and patient tumors. Collectively, these findings indicate that SupraT may inhibit a subset of PCa by activating nucleic acid sensors and downstream immune signaling.
Article
Full-text available
In cancer, two unique and seemingly contradictory behaviors are evident: on the one hand, tumors are typically stiffer than the tissues in which they grow, and this high stiffness promotes their malignant progression; on the other hand, cancer cells are anchorage-independent—namely, they can survive and grow in soft environments that do not support cell attachment. How can these two features be consolidated? Recent findings on the mechanisms by which cells test the mechanical properties of their environment provide insight into the role of aberrant mechanosensing in cancer progression. In this review article, we focus on the role of high stiffness on cancer progression, with particular emphasis on tumor growth; we discuss the mechanisms of mechanosensing and mechanotransduction, and their dysregulation in cancerous cells; and we propose that a ‘yin and yang’ type phenomenon exists in the mechanobiology of cancer, whereby a switch in the type of interaction with the extracellular matrix dictates the outcome of the cancer cells.
Article
Full-text available
The most potent steroid in human prostatic carcinoma LNCaP cells, i.e., dihydrotestosterone (DHT), has a biphasic stimulatory effect on cell proliferation. At the maximal stimulatory concentration of 0.1 n\i DHT, analysis of cell kinetic parameters shows a decrease of the Go-Gi fraction with a corresponding increase of the S and G2+ M fractions. In contrast, concentrations of l nMDHT or higher induce a return of cell proliferation to control levels, reflected by an increase in the Go-Gi fraction at the expense of the S and especially the G2+ M fractions. Continuous labeling for 144 h with the nucleotide analogue S'-bromodeoxyuridine shows that the percentage of cycling LNCaP cells rises more than 90% after treat ment with stimulatory concentrations of DHT, whereas in control cells as well as in cells treated with high concentrations of the androgen, this value remains below 50%. Although LNCaP cells do not contain detect able estrogen receptors, the new pure steroidal antiestrogen EM-139 not only reversed the stimulation of cell proliferation and cell kinetics induced by stimulatory doses of DHT but also inhibited basal cell proliferation.
Article
Full-text available
The accepted androgen receptor (AR) role is to promote proliferation and survival of prostate epithelium and thus prostate cancer progression. While growth-inhibitory, tumor-suppressive AR effects have also been documented, the underlying mechanisms are poorly understood. Here, we for the first time link AR anti-cancer action with cell senescence in vitro and in vivo. First, AR-driven senescence was p53-independent. Instead, AR induced p21, which subsequently reduced ΔN isoform of p63. Second, AR activation increased reactive oxygen species (ROS) and thereby suppressed Rb phosphorylation. Both pathways were critical for senescence as was proven by p21 and Rb knock-down and by quenching ROS with N-Acetyl cysteine and p63 silencing also mimicked AR-induced senescence. The two pathways engaged in a cross-talk, likely via PML tumor suppressor, whose localization to senescence-associated chromatin foci was increased by AR activation. All these pathways contributed to growth arrest, which resolved in senescence due to concomitant lack of p53 and high mTOR activity. This is the first demonstration of senescence response caused by a nuclear hormone receptor.
Article
Full-text available
Extracts from Pygeum africanum are used in the treatment of prostatitis, benign prostatic hyperplasia and prostate cancer (Pca), major health problems of men in Western countries. The ligand-activated human androgen receptor (AR) supports the growth of the prostate gland. Inhibition of human AR by androgen ablation therapy and by applying synthetic anti-androgens is therefore the primary goal in treatment of patients. Here, we show that atraric acid (AA) isolated from bark material of Pygeum africanum has anti-androgenic activity, inhibiting the transactivation mediated by the ligand-activated human AR. This androgen antagonistic activity is receptor specific and does not inhibit the closely related glucocorticoid or progesterone receptors. Mechanistically, AA inhibits nuclear transport of AR. Importantly, AA is able to efficiently repress the growth of both the androgen-dependent LNCaP and also the androgen-independent C4-2 Pca cells but not that of PC3 or CV1 cells lacking AR. In line with this, AA inhibits the expression of the endogenous prostate specific antigen gene in both LNCaP und C4-2 cells. Analyses of cell invasion revealed that AA inhibits the invasiveness of LNCaP cells through extracellular matrix. Thus, this study provides a molecular insight for AA as a natural anti-androgenic compound and may serve as a basis for AA derivatives as a new chemical lead structure for novel therapeutic compounds as AR antagonists, that can be used for prophylaxis or treatment of prostatic diseases.
Article
Cellular senescence is an extremely stable form of cell cycle arrest that limits the proliferation of damaged cells and may act as a natural barrier to cancer progression. In this study, we describe a distinct heterochromatic structure that accumulates in senescent human fibroblasts, which we designated senescence-associated heterochromatic foci (SAHF). SAHF formation coincides with the recruitment of heterochromatin proteins and the retinoblastoma (Rb) tumor suppressor to E2F-responsive promoters and is associated with the stable repression of E2F target genes. Notably, both SAHF formation and the silencing of E2F target genes depend on the integrity of the Rb pathway and do not occur in reversibly arrested cells. These results provide a molecular explanation for the stability of the senescent state, as well as new insights into the action of Rb as a tumor suppressor.
Article
Cellular senescence disables proliferation in damaged cells, and it is relevant for cancer and aging. Here, we show that senescence occurs during mammalian embryonic development at multiple locations, including the mesonephros and the endolymphatic sac of the inner ear, which we have analyzed in detail. Mechanistically, senescence in both structures is strictly dependent on p21, but independent of DNA damage, p53, or other cell-cycle inhibitors, and it is regulated by the TGF-β/SMAD and PI3K/FOXO pathways. Developmentally programmed senescence is followed by macrophage infiltration, clearance of senescent cells, and tissue remodeling. Loss of senescence due to the absence of p21 is partially compensated by apoptosis but still results in detectable developmental abnormalities. Importantly, the mesonephros and endolymphatic sac of human embryos also show evidence of senescence. We conclude that the role of developmentally programmed senescence is to promote tissue remodeling and propose that this is the evolutionary origin of damage-induced senescence.
Article
Senescence is a form of cell-cycle arrest linked to tumor suppression and aging. However, it remains controversial and has not been documented in nonpathologic states. Here we describe senescence as a normal developmental mechanism found throughout the embryo, including the apical ectodermal ridge (AER) and the neural roof plate, two signaling centers in embryonic patterning. Embryonic senescent cells are nonproliferative and share features with oncogene-induced senescence (OIS), including expression of p21, p15, and mediators of the senescence-associated secretory phenotype (SASP). Interestingly, mice deficient in p21 have defects in embryonic senescence, AER maintenance, and patterning. Surprisingly, the underlying mesenchyme was identified as a source for senescence instruction in the AER, whereas the ultimate fate of these senescent cells is apoptosis and macrophage-mediated clearance. We propose that senescence is a normal programmed mechanism that plays instructive roles in development, and that OIS is an evolutionarily adapted reactivation of a developmental process.
Cellular senescence leads to an irreversible block of cellular division capacity both in cell culture and in vivo. The induction of an irreversible cell cycle arrest is very useful for treatment of cancer. Histone deacetylases (HDACs) are considered as therapeutic targets to treat cancer patients. HDAC inhibitors repress cancer growth and are used in various clinical trials. Here, we analyzed whether sodium butyrate (NaBu), an inhibitor of class I and II HDACs, induces cellular senescence in neuroblastoma and prostate cancer (PCa) including an androgen-dependent as well as an androgen-independent human PCa cell line. We found that the HDAC inhibitors NaBu and valproic acid (VPA) induce cellular senescence in tumor cells. Interestingly, also an inhibitor of SIRT1, a class HDAC III, induces cellular senescence. Both neuroblastoma and human prostate cancer cell lines express senescence markers, such as the Senescence Associated-β-galactosidase (SA-β-Gal) and Senescence Associated Heterochromatin Foci (SAHF). Furthermore, NaBu down-regulates the proto-oncogenes c-Myc, Cyclin D1 and E2F1 mRNA levels. The mRNA level of the cell cycle inhibitor p16 remains unchanged whereas that of the tumor suppressor p21 is strongly up-regulated. Interestingly, NaBu treatment robustly increases reactive oxygen species (ROS) levels. These results indicate an epigenetic regulation and an association of HDAC inhibition and ROS production with cellular senescence. The data underline that tumor cells can be driven towards cellular senescence by HDAC inhibitors, which may further arise as a potent possibility for tumor suppression.
Article
Cell culture/xenograft and gene arrays of clinical material document that development of castration resistant prostate cancer (CRPC) cells involves acquisition of adaptive auto-regulation resulting in >25-fold increase in Androgen Receptor (AR) protein expression in a low androgen environment. Such adaptive AR increase paradoxically is a liability in castrated hosts, however, when supraphysiologic androgen is acutely replaced. Cell synchronization/anti-androgen response is due to AR binding to replication complexes (RC) at origin of replication sites (ORS) in early G1 associated with licensing/restricting DNA for single round of duplication during S-phase. When CRPC cells are acutely exposed to supraphysiologic androgen, adaptively increased nuclear AR is over-stabilized, preventing sufficient degradation in mitosis, inhibiting DNA re-licensing, and thus death in the subsequent cell cycle. These mechanistic results and the fact that AR/RC binding occurs in metastatic CRPCs directly from patients provides a paradigm shifting rationale for bipolar androgen therapy (BAT) in patient progressing on chronic androgen ablation. BAT involves giving sequential cycles alternating between periods of acute supraphysiologic androgen followed by acute ablation to take advantage of vulnerability produced by adaptive auto-regulation and binding of AR to RC in CRPC cells. BAT therapy is effective in xenografts and based upon positive results has entered clinical testing.
Article
Androgen ablation therapy is the primary treatment for metastatic prostate cancer. However, this therapy is associated with several undesired side-effects, including increased risk of cardiovascular diseases. To study if termination of long-term androgen ablation and restoration of testosterone levels could suppress the growth of relapsed hormone-refractory prostate tumors, we implanted testosterone pellets in castrated nude mice carrying androgen receptor (AR)-positive LNCaP 104-R2 cells, which relapsed from androgen-dependent LNCaP 104-S cells after long-term androgen deprivation. 104-R2 tumor xenografts regressed after testosterone pellets were implanted. Of 33 tumors, 24 adapted to elevation of testosterone level and relapsed as androgen-insensitive tumors. Relapsed tumors (R2Ad) expressed less AR and prostate-specific antigen. We then studied the molecular mechanism underlying the androgenic regulation of prostate cancer cell proliferation. Androgen suppresses proliferation of 104-R2 by inducing G(1) cell cycle arrest through reduction of S-phase kinase-associated protein 2 (Skp2) and c-Myc, and induction of p27(Kip1). 104-R2 cells adapted to androgen treatment and the adapted cells, R2Ad, were androgen-insensitive cells with a slower growth rate and low protein level of AR, high levels of c-Myc and Skp2, and low levels of p27(Kip1). Nuclear AR and prostate-specific antigen expression is present in 104-R2 cells but not R2Ad cells when androgen is absent. Overexpression of AR in R2Ad cells regenerated an androgen-repressed phenotype; knockdown of AR in 104-R2 cells generated an androgen-insensitive phenotype. Overexpression of Skp2 and c-Myc in 104-R2 cells blocked the growth inhibition caused by androgens. We concluded that androgens cause growth inhibition in LNCaP 104-R2 prostate cancer cells through AR, Skp2, and c-Myc.