Phomopsis azadirachtae – The Die-Back of Neem Pathogen.

Abstract

Neem (Azadirachta indica) commonly known as ‘Indian lilac’ or ‘Margosa’, is a native tree to India. Neem finds very wide application and both wood as well as non-wood products are utilized in many ways. Neem products have antibacterial, antifungal, insecticidal and other versatile biological activities. However, neem is not free from microbial diseases though having biological activity against various microorganisms. Many bacteria and fungi are known to infect neem. A new fungus Phomopsis azadirachtae was reported on neem causing die-back. The fungus infects the neem trees of all age and size. The symptoms of the disease are twig blight, inflorescence blight and fruit rot. The disease results in almost 100% loss of fruit production.
Keywords: Azadirachta indica; Diseases of neem; Die-back of neem; Phomopsis azadirachtae.

Full text

e
eJ
JB
Bi
io
o
Electronic
Journal of Biology, 2008, Vol. 4(3):112-119
Phomopsis azadirachtae – The Die-Back of Neem Pathogen
Girish K.1,2,*, Shankara Bhat S.1,3
1. Department of Studies in Microbiology, Manasagangotri, University of Mysore, Mysore -
570 006, Karnataka, India;
2. Department of Microbiology, Maharanis Science College for Women, JLB Road, Mysore -
570 005, Karnataka, India;
3. Labland Biodiesel Private Limited, # 98, 7th main, Jayalakshmipuram, Mysore - 570 012,
Karnataka, India.
* Corresponding author. Tel: +91-9341816617; E-mail: girishk77@yahoo.com
T
I
Abstract
Neem (Azadirachta indica) commonly known as
‘Indian lilac’ or ‘Margosa’, is a native tree to India.
Neem finds very wide application and both wood as
well as non-wood products are utilized in many
ways. Neem products have antibacterial, antifungal,
insecticidal and other versatile biological activities.
However, neem is not free from microbial diseases
though having biological activity against various
microorganisms. Many bacteria and fungi are
known to infect neem. A new fungus Phomopsis
azadirachtae was reported on neem causing die-
back. The fungus infects the neem trees of all age
and size. The symptoms of the disease are twig
blight, inflorescence blight and fruit rot. The disease
results in almost 100% loss of fruit production.
Keywords: Azadirachta indica; Diseases of neem;
Die-back of neem; Phomopsis azadirachtae.
1. Introduction
Neem is an evergreen deciduous tree. It is
commonly called “Indian lilac” or “Margosa” and
belongs to the Mahogany family Meliaceae. It is
native to Indian sub-continent. The Persian name of
the neem is Azad-Darakht-E-Hind, which means
‘free tree of India'. Over 20 million trees are found
all over India. Karnataka stands third with a
percentage of 5.5% trees [1]. Neem tree has
adaptability to a wide range of climatic, topographic
and edaphic factors and compared to other species
is well adapted to stress conditions [2]. It is referred
as “Tree for solving global problems”.
In India, parts of neem tree have been in use for
medicinal purposes. Ayurveda regards the tree as a
‘Sarva roga nivarini’. In addition to durable wood,
non-wood products like flowers, fruits, seed, oil,
cake, leaf, bark and gum also find various uses [3].
Neem seeds yield 40% of deep yellow fatty oil, the
well-known ‘Margosa oil’, which has medicinal
properties and finds its use in treating chronic skin
diseases, ulcers, leprosy rheumatism and sprain [4].
he seed cake is cheap and useful fertilizer.
Neem tops the list of 2,400 plant species that are
reported to have pesticidal properties. Over 195
species of insects are affected by neem extracts
and insects that have become resistant to synthetic
pesticides are also controlled with these extracts.
Owing to its versatile characteristics neem is rightly
called the “village pharmacy” or “Doctor tree” or
“Wonder Tree of India” or “The bitter Gem”.
n spite of its well-known antifungal and
antibacterial and other versatile biological activities,
neem is not free from microbial diseases. Many
fungal and bacterial pathogens were reported on it
[4,5]. Die-back of neem is caused by Phomopsis
azadirachtae Sateesh, Bhat & Devaki. The fungus
affects leaves, twigs and inflorescence, irrespective
of age, size and height of the tree. In severely
affected trees it has resulted in almost always 100%
loss of fruit production [6], which in turn has affected
the availability of a highly valuable source of
botanical pesticide, the seed. The disease is
spreading at an alarming rate and needs to be
controlled quickly. According to field survey
conducted, almost all the trees in and around
Mysore were affected with the fungus [3].
2. Microflora and diseases of neem
The bacterial diseases reported on neem include
leaf spot disease caused by Pseudomonas
azadirachtae [7], Xanthomonas azadirachtii [8,9].
The fungal diseases that have been reported on
neem include pink disease caused by Corticium
salmonicolor [10], twig canker and shot-hole incited
by Phoma jolyana [11], leaf spot caused by
Pseudocercospora subsessilis [12], blight and stem
rot caused by Sclerotium rolfsii [13], leaf web-blight
caused by Rhizoctonia solani [13-15], leaf spotting
and blight incited by Alternaria alternata and
Colletotrichum gleosporioides [16]. Root rot disease
incited by Ganoderma lucidum [5] and Ganoderma
applanatum [17] damping-off caused by Fusarium
oxysporum [5], powdery-mildew caused by Oidium
azadirachtae [5], die-back disease incited by
ISSN 1860-3122 - 112 -

e
eJ
JB
Bi
io
o
Electronic
Journal of Biology, 2008, Vol. 4(3):112-119
Phomopsis azadirachtae [18], collar-rot incited by
Fusarium semitectum [19] and stem-rot caused by
Sclerotinia sclerotiorum [20].
Neem seed mycoflora includes Aspergillus spp.,
Penicillium sp. [3,21,22], Xylaria azadirachtae [5],
Aspergillus ochraceus, A. niger, A. flavus,
P. azadirachtae, Fusarium oxysporum, Mycelia
sterilia [3,23]. Fusarium avenaceum was reported
as an endophytic fungus on neem [24]. Mahesh et
al. [25] isolated a total of 77 endophytic fungal
isolates belonging to 15 genera from the inner bark
of A. indica (Table 1).
Table 1. Endophytic fungi isolated from inner bark of
neem (Azadirachta indica).
No. Endophytic fungi
Ascomycetes
1a Chaetomium crispatum
1b Chaetomium globosum
Coelomycetes
2 Pestalotiopsis spp.
3 Phoma eupyrena
4 Phyllosticta spp.
Hyphomycetes
5 Acremonium acremonium
6a Aspergillus flavus
6b Aspergillus niger
6c Aspergillus oryzae
7a Cladosporium acaciicola
7b Cladosporium cladosporioides
8 Cochlonema verrucosum
9 Curvularia lunata
10a Fusarium clamydosporum
10b Fusarium moniliformae var. subglutinans
10c Fusarium oxysporum
10d Fusarium solani
11 Gliomastix spp.
12 Nigrospora oryzae
13 Penicillium spp.
14 Trichoderma spp.
15 Verticillium albo-atrum
Sterile mycelia
3. Die-back of neem
Die-back of neem is caused by Phomopsis
azadirachtae Sateesh, Bhat and Devaki. The
occurrence of die-back of neem was first reported
from new forests of Dehra Dun, North India [26].
Sateesh et al. [18] first identified and reported the
pathogen causing die-back of neem – Phomopsis
azadirachtae (Figure 1). The disease symptoms
include twig blight, inflorescence blight and fruit rot.
At present it is the major, devastating disease of
neem [6].
3.1 Disease symptoms
Disease has been noticed in neem trees
irrespective of age, size and height. The disease is
more pronounced during August to December,
though can be observed throughout year.
Appearance of symptoms starts with the on-set of
rainy season and becomes progressively severe in
later part of the rainy season and early winter
season. The terminal branches are mainly affected.
The disease results in the progressive death of the
tree, year after year [3]. Twig blight is the major
symptom (Figure 2). Disease also results in
inflorescence blight and fruit rot resulting in almost
100% fruit yield loss [6]. Disease spreads through
conidia that are disseminated by rain droplets and
insects [3]. The pathogen is also seed-borne [23].
Figure 1. 10-days-old Culture of Phomopsis azadirachtae
on Potato Dextrose Agar.
3.2 The Pathogen
P. azadirachtae, the incitant of die-back on neem is
a deuteromycetes fungus [18]. The pathogen was
successfully isolated from all the twig explants
collected from diseased neem trees on PDA
medium (Figure 3). Though many species of
Phomopsis have been reported to have teliomorph
(Diaporthe), it was not identified with
P. azadirachtae. It was not possible to induce
teliomorphic or sexual phase in P. azadirachtae, in
spite of cultivating the pathogen on specific media,
under specific conditions required to induce sexual
phase. No collateral host has been identified.
The pathogen produces two types of spores:
Alpha(α) – conidia (Figure 4) and Beta(β)- conidia
(Figure 5). α – conidia are fertile and germinate
readily but germination of β- conidia has not been
observed. The ergosterol estimation study
confirmed the presence of pathogen in neem
tissues [3].
The description of pathogen is as follows:
“Mycelium immersed, branched, septate, profuse,
colourless, becomes pale brown later. Conidiomata
pycnidial, solitary or aggregate, half-immersed, pale
brown to dark brown or black, ampuliform or
subglobose, unilocular, thick-walled, textura
annularis, uniform throughout with the endogenous
basal swelling cone with lumina of bigger cells,
ISSN 1860-3122 - 113 -

e
eJ
JB
Bi
io
o
Electronic
Journal of Biology, 2008, Vol. 4(3):112-119
outer layers melanised, 300-500 µm high, up to 900
µm, wide in sections, very short basal clypei, ostiole
single, unilocular, circular, papillate. Conidiophores
simple or branched, short or elongate, septate,
filiform, hyaline, line the inner layer of locule, 12-20
X 1.6-2.0 µm conidiogenous cells phialidic, subulate
or filiform, integrated or discrete, channel and
collarette minute, hyaline, periclinal thickenings of
variable thickness, 5-8 X 1.6-3 µm, produce both
alpha-conidia and beta-conidia, conidia
acropleurogenous. Conidia of two types, in a cream
to dark yellow coloured slimy cirrhi: alpha-conidia
hyaline, fusiform, straight, 2-4 guttulate, smooth,
aseptate, 4.8-11 X 1.6-3.2 µm, germinate readily,
beta-conidia hyaline, filiform, hamate, eguttulate,
aseptate, 16-25.6 X 1.6-2.0 µm germination
unknown” [18].
A. Healthy B. Die-back affected
Figure 2. The Neem Tree.
Figure 3. Culture of Phomopsis azadirachtae from die-
back affected neem twigs.
3.3 Cultural conditions
Light was found to have effect on sporulation, but
not on mycelial growth. Sporulation requires proper
light of about 8-12h per day along with high relative
humidity. The optimum temperature for vegetative
growth of P. azadirachtae is in the range of 26-28oC
and the pathogen can grow in a wide temperature
range of 10-35oC. Optimum pH was found to be 6
(range 4-9). Out of eleven carbon sources viz.,
cellobiose, cellulose, fructose, galactose, glucose,
maltose, mannitol, lactose, sorbitol, starch, and
sucrose - sucrose and starch were found to be the
best carbon sources. Among the different nitrogen
sources such as ammonium sulphate, asparagine,
glycine, potassium nitrate, sodium nitrite and urea -
ammonium sulphate and potassium nitrite were
ISSN 1860-3122 - 114 -

e
eJ
JB
Bi
io
o
Electronic
Journal of Biology, 2008, Vol. 4(3):112-119
opted by the pathogen. Among the different
vitamins supplied viz., thiamine, pyridoxine,
riboflavin, nicotinic acid, biotin and inositol,
P. azadirachtae grew well on thiamine, riboflavin,
nicotinic acid and pyridoxine amended media. The
pathogen requires about 8-10 days for complete
growth of mycelial mat in a 90mm diam. Petri dish
and sporulation starts after 15 days. The nature of
pathogen to grow under wide range of physical
conditions and to assimilate various chemical
factors indicates its ability to survive in varied
environmental conditions [3].
Figure 4. Alpha conidia of Phomopsis azadirachtae.
Figure 5. Beta conidia of Phomopsis azadirachtae.
3.4 Pathogenicity studies
Conidial inoculation, mycelial inoculation and tooth-
pick inoculation methods were tried. Conidial
inoculation method proved to be suitable to
establish the pathogen in neem plant.
Establishment of pathogen resulted in the
development of twig blight symptom characteristic
of die-back disease. The same fungus was isolated
from the twigs of all the neem plants inoculated with
conidia [3]. The pathogen was unable to infect allied
taxon of the same family, Melia azedarach,
revealing its restricted host range to A. indica [3]
3.5 Viability of mycelia and conidia
At room temperature, aerial mycelia remained
viable for about 18 months on all types of media
tested. Viability of mycelium varied at refrigerated
conditions with respect to different media ranging
from 21-36 months [3]. The viability and germination
of conidia also varied depending on the type of
media and storage conditions. Conidia could be
maintained viable up to 24 months at room
temperature and up to 36 months at refrigerated
conditions especially on Potato Dextrose Agar (PDA)
and Malt Extract Agar (MEA) [3]. This ability of
pathogen to retain viability of conidia and mycelia
for comparatively long time in varied environmental
conditions may be the reason for the reoccurrence
of the disease in subsequent monsoon reasons [3].
Figure 6. Culture of Phomopsis azadirachtae from die-
back affected neem seeds.
3.6 Seed-borne nature of P. azadirachtae in
neem
Figure 7. Culture of Phomopsis azadirachtae from die-
back affected neem embryo.
P. azadirachtae is seed-borne and seed transmitted
(Figure 6). Thus it gets transmitted from seed to
seedling and might result in wide spread of disease.
Studies on the seed-borne nature of the pathogen
ISSN 1860-3122 - 115 -

e
eJ
JB
Bi
io
o
Electronic
Journal of Biology, 2008, Vol. 4(3):112-119
revealed that P. azadirachtae was deep seated.
The pathogen was present in seed coat, cotyledons
and embryo. Many other fungi were isolated from
seeds, except embryo, such as Aspergillus
ochraceous, A. niger, A. flavus, Fusarium
oxysporum, Penicillium sp. and Mycelia sterilia.
Only P. azadirachtae was isolated from embryo
(Figure 7). Seed to seedling transfer studies
revealed that the pathogen can cause seed rot,
seedling rot, formation of weak seedlings, seedlings
with fibrous root system and without root system
[3,23].
3.7 Biological studies
Variations among the P. azadirachtae isolates
collected from different districts of Karnataka and
Tamilnadu, South India were studied.
P. azadirachtae isolates showed cultural,
morphological, pathogenic and biochemical
variation. Significant differences in the mycelial
type, colour of the colony, texture, radial growth and
number of pycnidia were observed among the
isolates [27,28]. Isolates of P. azadirachtae
collected from different geographical regions of
Karnataka [29] and Tamilnadu [30] exhibited
marked variations in their electrophoretic protein
profile. All these parameters investigated suggest
the presence of intraspecific variability among the
P. azadirachtae isolates and its heterogeneous
nature.
Methods to detect P. azadirachtae using
polymerase chain reaction (PCR) have been
developed. rDNA sequences of many Phomopsis
spp. were retrieved from the database and were
subjected for multiple alignment using CLUSTAL
program to select conserved sequences, which
were used to design Phomopsis specific primer
pairs (forward and reverse) using Primer3 Software.
Specificity of the selected sequence with
Phomopsis sp. was examined by comparing the
DNA data to those of the GenBank database. The
two primers, Phf-5'CGGATCTCTTGGTTCTGGCA-
3' and Phr-5' GACGCTCGAACAGGCATGCC-3'
have the potential to produce 141-bp DNA as
amplified product [33] and the primer PF1 (5'-
ATCTCTTGGTTCTGGCATCG) and primer PF2 (5'-
GCTTGAGGGTTGAAATGACG) have the potential
to produce a 154 bp DNA as amplified product [34]
in PCR.
Histopathological studies of naturally infected
neem tree explants and seeds showed the
presence of the pathogen in diseased neem tissues.
The pathogen was found to be both intra as well as
intercellular. The pathogens' presence was also
observed in vascular tissues revealing its systemic
nature [27,31].
Fluorescence microscopy approach to evaluate
the viability of conidia showed that α- conidia are
more fertile than β- conidia. It was difficult to study
viability of β- conidia using natural autofluorescence
method as β- conidia didn’t germinate readily. The
percentage germination data of α- conidia didn’t
match the percentage non-fluorescing conidia data,
and this might be because of presence of dormant
α- conidia [27,32].
P. azadirachtae produces phytotoxins. Culture
filtrate of the pathogen inhibited the germination of
neem seeds indicating the production of a
phytotoxic secondary metabolite that can reduce
the seed vigour and seed quality [3]. The isolates of
P. azadirachtae collected from different regions of
Karnataka [27] and Tamilnadu [28] varied in the
phytotoxic effect of their culture filtrates on the
neem seed germination. Bioassay of crude toxin
extract of P. azadirachtae against neem callus
growth resulted in the progressive inhibition of
callus growth and necrosis [28]. Callus was
obtained from cotyledonary explants on Murashige-
Skoog (MS) medium amended with 1 ppm BAP and
1 ppm Kinetin as per Sateesh [3].
3.8 PCR-based detection / identification of
Phomopsis azadirachtae
P. azadirachtae was isolated on PDA from die-
back infected neem twigs. The DNA was extracted
from all the isolates. Phomopsis genus-specific
primers were then used for the amplification of
extracted DNA by PCR. Primers, Phf and Phr
produced 141-bp DNA as amplified product [33] and
the primer PF1 and primer PF2 produced a 154 bp
DNA as amplified product [34] confirming the
isolates as Phomopsis .
P. azadirachtae was isolated on PDA from die-
back infected neem twigs, seeds and embryo. The
DNA was extracted from all the isolates.
Amplification of DNA producing expected 141 bp
product indicated the organism isolated from die-
back affected neem tissues was P. azadirachtae
[35]. The primers PF1 and PF2 were utilized to
detect the presence of P. azadirachtae in diseased
neem tissues such as neem twigs, neem seeds and
embryo. DNA was isolated from die-back affected
neem tissues and amplified using the mentioned
primers, which resulted in the yield of a PCR
product of expected size i.e., 154 bp, confirming the
presence of P. azadirachtae and its systemic nature
[34].
DNA samples isolated from other fungi such as
Aspergillus sp., Fusarium sp., Penicillium sp.,
Mycelia sterilia and an unidentified bacterium
isolated on neem were also amplified using the
above mentioned two primer pairs. No amplification
occurred confirming the Phomopsis specific nature
of these primers [33,34]. DNA samples extracted
from a few isolates of P. azadirachtae collected
from different regions of Tamilnadu were also
amplified using the primers PF1 and PF2, which
amplified all the DNA samples to produce the
expected 154 bp size PCR product. Thus, any
ISSN 1860-3122 - 116 -

e
eJ
JB
Bi
io
o
Electronic
Journal of Biology, 2008, Vol. 4(3):112-119
isolate of P. azadirachtae can be identified using
this primer pair [34].
3.9 Study of disease incidence
A disease survey of die-back of neem was done,
using Global Positioning System (GARMIN 12), in
different agroclimatic regions of Karnataka and
Tamilnadu, India. Hand held GPS used in this study
helps in continuous monitoring of the diseased
trees. The details of individual tree such as height,
girth, age, latitude, longitude, altitude and disease
severity at each surveyed place were obtained and
plotted on topographic maps, using MAPINFO
software. Survey revealed that the severity of die-
back disease was independent of tree age and size.
A very high incidence of die-back was observed in
most places of Karnataka and Tamilnadu, which
was almost 100% in most of the places irrespective
of climatic conditions [36,37].
3.9 Management studies
Six different systemic fungicides viz., Bavistin 50%
W.P., Bayleton 25% W.P., Baynate 75% W.P.,
Calixin 80% E.C. and Kitazin 48% E.C., were tried.
Bavistin was most effective, which completely
suppressed mycelial growth, sporulation and
conidial germination at 0.3 ppm. Treatment of neem
seeds with bavistin resulted in the death of the
seed-borne pathogen. Germination of neem seeds
was not affected by bavistin even at higher
concentrations (up to 2000 ppm) [3]. Carbendazim
(bavistin) at 0.25 ppm and thiophanate methyl at
0.75 ppm controlled the growth of the pathogen
completely [38].
Effect of bavistin on neem callus cultures was
studied. Cotyledonary explants produced good
callus on Murashige-Skoog (MS) medium amended
with 1 ppm BAP and 1 ppm Kinetin. Exposure of
neem calluses to bavistin at 200 ppm and above
resulted in reduced growth and necrosis was
observed on exposure to bavistin at 500 ppm and
above concentrations [3].
Bacterial antagonists, Bacillus cereus,
B. subtilis, Enterobacter aerogenes, Pseudomonas
fluorescence and fungal antagonists, Trichoderma
harzianum, T. viridae, Gliocladium virens,
Aspergillus niger, A. oryzae, Penicillium
chrysogenum, Chaetomium globosum were tested
against P. azadirachtae by dual culture method.
Bacillus subtilis showed significant inhibitory effect
on P. azadirachtae. Ten times concentrated culture
filtrate of B. subtilis completely inhibited the growth
of P. azadirachtae. Volatile compounds of B. subtilis
had no effect on the growth of pathogen. B. subtilis
produced both heat labile and heat stable antibiotics.
Heat labile antibiotics were found to be highly
potent against P. azadirachtae [3].
The pathogen is highly variable. This may be
because of the difference in environmental and
ecological conditions of various geographical
regions. The basic understanding of the biology of
the pathogen would help in preventing the spread of
the disease and thereby protecting the healthy
neem trees from damage. Geographic information
and global positioning system can be effectively
used in tree disease management.
The ethyl acetate fractions of culture filtrates of
six antagonistic microorganisms such as Bacillus
cereus, Bacillus subtilis, Pseudomonas aeruginosa,
Pseudomonas oleovorans, Trichoderma harzianum
and Trichoderma viride were tested for their
antifungal activity against P. azadirachtae.
B. subtilis and Ps. aeruginosa were highly effective
in suppressing the growth of the pathogen at very
low concentration i.e., at 25 ppm [28].
Effect of 24 botanical pesticides was studied.
Only five plant species produced good results i.e.,
Lawsonia inermis, Asparagus officinalis, Bambusa
arundinacea, Lantana camera and Macrosolen
parasiticus. L. inermis produced greater inhibitory
effect at lower concentration in comparison with
other four plant species. Ethanol, methanol and
aqueous extracts of L. inermis were tried and
aqueous extracts were highly effective against
P. azadirachtae [3].
Five essential oils – eucalyptus oil, pepper oil,
nutmeg oil, coriander oil, fennel oil and two
oleoresins – turmeric oleoresin and capsicum
oleoresin were screened against P. azadirachtae.
High activity was observed with nutmeg oil which
completely inhibited the growth of pathogen at 2000
ppm [27].
4. Conclusion
The nutritional requirements, and physiological
conditions required for the growth of
P. azadirachtae have been understood. Isolation of
the pathogen from die-back affected neem explants
collected from different regions of Karnataka and
Tamilnadu shows that the disease is spreading at
an alarming rate and is prevalent in almost all neem
growing areas. The seed-borne nature of pathogen
may be one of the reason for wide spread nature of
the disease.
PCR methodology for identification of the
pathogen in diseased neem explants has been
developed. Isolation and identification of
P. azadirachtae by conventional method requires
about 15 to 21 days, whereas the PCR-based
technique is capable of detecting very low
propogules within 4 - 5 days or directly from
diseased tissues in even less time. The primers
developed amplify the Phomopsis specific DNA and
could be utilized for rapid and reliable PCR-based
detection of the pathogen in neem tissues
especially in seeds. This will help to quarantine the
neem seeds and prevent the spread of the disease.
The pathogen produces toxin and the toxin
seems to have a role in the pathogenesis. Although
pathogenesis has been understood to some extent,
ISSN 1860-3122 - 117 -

e
eJ
JB
Bi
io
o
Electronic
Journal of Biology, 2008, Vol. 4(3):112-119
proper knowledge of toxin chemistry and its role in
pathogenesis requires further investigations and the
current investigations provide a proper base for this.
The management strategy was successful in vitro
against P. azadirachtae and needs field tests to go
for large scale applications.
References
[1] Bahuguna, V.K. (1997) Silviculture and management
practices for cultivation of Azadirachta indica (Neem).
Indian For, 123: 379-386.
[2] Chari, M.S. (1996) Neem and transfer of technology.
In: Neem and Environment (Vol. I), (Singh, R.P.,
Chari, M.S., Raheja, K., et al., eds.). Oxford and IBH
publishing Co. Pvt. Ltd., New Delhi, India.
[3] Sateesh, M.K. (1998) Microbiological investigations on
die-back disease of neem (Azadirachta indica A.
Juss.). Ph.D. thesis. University of Mysore. Mysore,
India.
[4] Anonymous. (1992) Neem – A tree for solving global
problems. National Academy Press, Washington
D.C., U.S.A.
[5] Tewari, D.N. (1992) Monograph of neem (Azadirachta
indica A. Juss.). International Book Distributors,
Dehra Dun, India.
[6] Shankara Bhat, S., Sateesh, M.K., Devaki, N.S. (1998)
A new destructive disease of neem (Azadirachta
indica) incited by Phomopsis azadirachtae. Curr Sci,
74: 17-19.
[7] Srivastava, S.K., Patel, P.N. (1969) Epidemiology of
bacterial leaf spot, blight and shot-hole disease of
neem in Rajasthan. Indian Phytopathol, 22: 237-244.
[8] Chakravarthi, B.P., Gupta, D.K. (1975) A non-
pigmented strain of Xanthomonas azadirachtii Moniz
and Raj causing leaf spot of neem (Azadirachta
indica A. Juss.). Curr Sci, 44: 240-241.
[9] Moniz, L., Raj, H.H. (1967) Xanthomonas azadirachtii
sp. nov. causing leaf spot disease in Azadirachta
indica A. Juss. Indian J Microbiol, 7: 159-160.
[10] Bakshi, B.K. (1976) Forest pathology: Principles and
practice in forestry. Forest Research Institute, Dehra
Dun, India.
[11] Singh, I., Chauhan. (1984) Phoma jolyana, a new
pathogen on neem (Azadirachta indica). Indian For,
110: 1058-1060.
[12] Castellani, E., Mohamed, M.I. (1984) Diseases of
Azadirachta indica in Somalia. 1 Cercospora disease.
Riv Agric Subtrop e Trop 78: 733-739.
[13] Sankaran, K.V., Balasundaran, M., Sharma, J.K.
(1986) Seedling diseases of Azadirachta indica in
Kerala, India. Eur J For Pathol, 16: 324-328.
[14] Mehrotra, M.D. (1990) Rhizoctonia solani, a
potentially dangerous pathogen of Khasi pine and
hardwoods in forest nurseries in India. Eur J For
Pathol, 20: 329-338.
[15] Mehrotra, M.D. (1989) Leaf blight of some hardwood
species in Assam and Meghalaya and its control in
the nursery. Indian For, 115: 378-384.
[16] Mehrotra, M.D., Pandey, P.C. (1992) Some important
nursery diseases of Azadirachta indica and their
control. In: Monograph of Neem (Azadirachta indica
A. Juss) (Tewari, D.N., Author). International Book
Distributors, Dehra Dun, India.
[17] Chakraborthy, R., Konger, G. (1995) Root-rot of
neem (Azadirachta indica) caused by Ganoderma
applanatum. Indian for, 121: 1081-1082.
[18] Sateesh, M.K., Shankara Bhat, S., Devaki, N.S.
(1997) Phomopsis azadirachtae sp. nov. from India.
Mycotaxon 65: 517-520.
[19] Uniyal, K. (1999) Collar-rot in Azadirachta indica and
its control. Indian for, 125: 513-516.
[20] Ghasolia, R.P., Shivpuri, A. (2004) Neem- A new
host of Sclerotinia sclerotiorum. J Mycol Plant Pathol,
34: 200.
[21] Sinniah, D., Varghese, G., Bhaskaran, G., et al.
(1983) Fungal flora of neem seeds and neem oil
toxicity. Malay Appl Biol, 38: 20-25.
[22] Verma, N., Srivastava, K.K. (1993) Fungal species
associated with seeds of some common desert tree
species. In: Proceedings of 45th annual meeting.
Indian Phytopathological Society, Akola, Maharashtra,
India.
[23] Sateesh, M.K., Shankara Bhat, S. (1999) Detection of
seed–borne Phomopsis azadirachtae and its
transmission in Azadirachta indica (Neem). Seed Sci
Technol, 27: 753-759.
[24] Rajgopal, K., Suryanarayanan, T.S. (2000) Isolation
of endophytic fungi from leaves of neem (Azadirachta
indica A.Juss.). Curr Sci, 78: 1375-1378.
[25] Mahesh, B., Tejesvi, M.V., Nalini, M.S., et al. (2005)
Endophytic mycoflora of inner bark of Azadirachta
indica A. Juss. Curr Sci, 88: 218-219.
[26] Khan, S.N. (1992) Record of Phomopsis twig blight in
Azadirachta indica from Dehra Dun (unpublished). In:
Monograph of Neem (Azadirachta indica A. Juss)
(Tewari, D.N., Author). International Book Distributors,
Dehra Dun, India.
[27] Fathima, S.K. (2004) Investigations on the biology
and management of Phomopsis azadirachtae on
neem. Ph.D thesis, University of Mysore, Mysore,
India. pp 135.
[28] Girish, K. (2007) Studies on the biology and
management of Phomopsis azadirachtae – the
incitant of die-back disease on neem (Azadirachta
indica A. Juss). Ph.D. thesis, University of Mysore.
Mysore, India.
[29] Fathima, S.K., Shankara Bhat, S., Girish, K. (2004)
Variation in Phomopsis azadirachtae, the incitant of
die-back of neem. Indian Phytopathol, 57: 30-
[30] Girish, K., Shankara Bhat, S., Raveesha. K.A. (2007)
Intraspecific variability in Phomopsis azadirachtae
infecting neem. Arch Phytopathol Plant Protect, DOI:
10.1080 / 03235400701191580.
[31] Fathima, S.K., Shankara Bhat, S., Sateesh, M.K.
(2004) Histopathology of neem seeds naturally
infected with Phomopsis azadirachtae. Seed Res, 32:
93-95.
ISSN 1860-3122 - 118 -

e
eJ
JB
Bi
io
o
Electronic
Journal of Biology, 2008, Vol. 4(3):112-119
[32] Fathima, S.K., Shankara Bhat, S. (2004) Natural
autofluorescence in the conidia of Phomopsis
azadirachtae. Asian J Microbiol Biotechnol Environ
sci, 6: 21-24.
[36] Nagendra Prasad M.N., Shankara Bhat, S.,
Haraprasad, N. (2007) Die-back disease of neem in
Karnataka and Tamilnadu, India. In: Proccedings of
World neem conference. Fifth World Neem
Conference, 21-24 Nov. 2007, Coimbatore, India.
p 42.
[33] Nagendra Prasad, M.N., Shankara Bhat, S. Charith
Raj, A.P., et al. (2006) Molecular detection of
Phomopsis azadirachtae the causative agent of die-
back disease of neem by Polymerase chain reaction.
Curr Sci, 91: 158-159.
[37] Nagendra Prasad, M.N., Shankara Bhat S.,
Haraprasad, N., et al. (2008) Study of die-back
disease incidence of neem in Karnataka, India and
PCR based identification of the isolates. Arch
Phytopathol Plant Protect, DOI:
10.1080/03235400701875406.
[34] Girish, K., Shankara Bhat, S., Raveesha, K.A., (2007)
PCR-based detection of Phomopsis azadirachtae in
die-back affected neem seeds. Arch Phytopathol
Plant Protect, DOI: 10.1080 / 03235400701281628. [38] Girish, K., Shankara Bhat, S., Raveesha, K.A. (2007)
In vitro screening of systemic fungicides against
Phomopsis azadirachtae, the incitant of die-back
disease of neem. Arch Phytopathol Plant Protect,
(DOI 10. 1080/03235400601036646)
[35] Nagendra Prasad, M.N., Shankara Bhat, S., Charith
Raj, A.P. (2007) Detection of Phomopsis
azadirachtae from die-back affected neem twigs,
seeds and embryo by Polymerase chain reaction.
Arch Phytopathol Plant Protect, DOI:
10.1080/03235400600982584.
ISSN 1860-3122 - 119 -