Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in

Abstract

Significance
Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas)-mediated genome engineering promises to revolutionize genetic studies in a variety of systems. Here we describe an optimized set of tools for CRISPR/Cas experiments in the model organism Drosophila melanogaster . These tools can be used for remarkably efficient germline transmission of ( i ) loss-of-function insertion and deletion mutations in essential genes or ( ii ) precise changes in the genome sequence introduced by homology-directed repair. These tools also permit efficient biallelic targeting of genes in somatic cells, thereby demonstrating a novel application of CRISPR/Cas in rapidly revealing mutant phenotypes within the organism. Our work also paves the way for high-throughput genetic screens in Drosophila with CRISPR/Cas.

Full text

Optimized CRISPR/Cas tools for efficient germline and
somatic genome engineering in Drosophila
Fillip Port
a,1
, Hui-Min Chen
b
, Tzumin Lee
b
, and Simon L. Bullock
a,1
a
Division of Cell Biology, Medical Research Council Laboratory of Molecular Biology, Cambridge CB2 0QH, United Kingdom; and
b
Howard Hughes Medical
Institute, Janelia Farm Research Campus, Ashburn, VA 20147
Edited* by Ruth Lehmann, New York University Medical Center, New York, NY, and approved May 28, 2014 (received for review March 24, 2014)
The type II clustered regularly interspaced short palindromic repeats
(CRISPR)/CRISPR-associated (Cas) system has emerged recently as
a powerful method to manipulate the genomes of various organ-
isms. Here, we report a toolbox for high-efficiency genome engi-
neering of Drosophila melanogaster consisting of transgenic Cas9
lines and versatile guide RNA (gRNA) expression plasmids. Sys-
tematic evaluation reveals Cas9 lines with ubiquitous or germ-
line–restricted patterns of activity. We also demonstrate differential
activity of the same gRNA expressed from different U6 snRNA pro-
moters, with the previously untested U6:3 promoter giving the most
potent effect. An appropriate combinationof Cas9 and gRNA allows
targeting of essential and nonessential genes with transmission rates
ranging from 25–100%. We also demonstrate that our optimized
CRISPR/Cas tools can be used for offset nicking-based mutagenesis.
Furthermore, in combination with oligonucleotide or long double-
stranded donor templates, our reagents allow precise genome edit-
ing by homology-directed repair with rates that make selection
markers unnecessary. Last, we demonstrate a novel application of
CRISPR/Cas-mediated technology in revealing loss-of-function phe-
notypes in somatic cells following efficient biallelic targeting by
Cas9 expressed in a ubiquitous or tissue-restricted manner. Our
CRISPR/Cas tools will facilitate the rapid evaluation of mutant phe-
notypes of specific genes and the precise modification of the ge-
nome with single-nucleotide precision. Our results also pave the
way for high-throughput genetic screening with CRISPR/Cas.
Experimentally induced mutations in the genomes of model
organisms have been the basis of much of our current
understanding of biological mechanisms. However, traditional
mutagenesis tools have significant drawbacks. Forward genetic
approaches such as chemical mutagenesis lack specificity, lead-
ing to unwanted mutations at many sites in the genome. Tradi-
tional reverse genetic approaches, such as gene targeting by
conventional homologous recombination, suffer from low effi-
ciency and therefore are labor intensive. In recent years novel
methods have been developed that aim to modify genomes with
high precision and high efficiency by introducing double-stand
breaks (DSBs) at defined loci (1). DSBs can be repaired by ei-
ther nonhomologous end joining (NHEJ) or homology-directed
repair (HDR). NHEJ is an error-prone process that frequently
leads to the generation of small, mutagenic insertions and
deletions (indels). HDR repairs DSBs by precisely copying se-
quence from a donor template, allowing specific changes to be
introduced into the genome (2).
The type II clustered regular interspersed short palindromic
repeat (CRISPR)/CRISPR-associated (Cas) system has emerged
recently as an extraordinarily powerful method for inducing site-
specific DSBs in the genomes of a variety of organisms. The
method exploits the RNA-guided endonuclease Cas9, which plays
a key role in bacterial adaptive immune systems. Target specificity
of Cas9 is encoded by a 20-nt spacer sequence in the crisprRNA,
which pairs with the transactivating RNA to direct the endonu-
clease to the complementary target site in the DNA (3). For
genome engineering, crisprRNA and transactivating RNA can be
combined in a single chimeric guide RNA (gRNA), resulting in
a simple two-component system for the creation of DSBs at
defined sites (3). Binding of the Cas9/gRNA complex at a genomic
target site is constrained only by the requirement for an adjacent
short protospacer-adjacent motif (PAM), which for the commonly
used Streptococcus pyogenes Cas9 is NGG (4).
Several groups recently demonstrated CRISPR/Cas-mediated
editing of the genome of Drosophila melanogaster (5–12), a key
model organism for biological research. However, the rate of
mutagenesis has varied widely both within and among different
studies. Differences in the methods used to introduce Cas9 and
gRNAs into the fly likely contribute significantly to different
experimental outcomes. Kondo and Ueda (8) expressed both
Cas9 and gRNA from transgenes stably integrated into the ge-
nome, but all other studies have used microinjection of expres-
sion plasmids or of in vitro-transcribed RNA into embryos to
deliver one or both CRISPR/Cas components (5–7, 9–11). Much
of the currently available evidence suggests that transgenic
provision of Cas9 increases rates of germ-line transmission
substantially (8, 10, 11). However, the influence of different
regulatory sequences within cas9 transgenes on the rate of mu-
tagenesis and on the location where mutations are generated
within the organism has not been evaluated. The effect of dif-
ferent promoter sequences on the activities of gRNAs also has
not been explored systematically. Therefore it is possible that
suboptimal tools are being used currently for many CRISPR/Cas
experiments in Drosophila.
Previous studies in Drosophila have focused on the use of
CRISPR/Cas to create heritable mutations in the germ line. In
principle, efficient biallelic targeting within somatic cells of
Significance
Clustered regularly interspaced short palindromic repeats
(CRISPR)/CRISPR-associated (Cas)-mediated genome engineering
promises to revolutionize genetic studies in a variety of systems.
Here we describe an optimized set of tools for CRISPR/Cas
experiments in the model organism Drosophila melanogaster.
These tools can be used for remarkably efficient germline trans-
mission of (i) loss-of-function insertion and deletion mutations in
essential genes or (ii) precise changes in the genome sequence
introduced by homology-directed repair. These tools also permit
efficient biallelic targeting of genes in somatic cells, thereby
demonstrating a novel application of CRISPR/Cas in rapidly re-
vealing mutant phenotypes within the organism. Our work also
paves the way for high-throughput genetic screens in Dro-
sophila with CRISPR/Cas.
Author contributions: F.P. conc eived the study; F.P. and S.L.B. designed rese arch; F.P.
performed research; H.-M.C. and T.L. contributed new reagents and first discovered the
difference in activity between U6:2 and U6:3 promoters; F.P. and S.L.B. analyzed data; and
F.P. and S.L.B. wrote the paper.
The authors declare no conflict of interest.
*This Direct Submission article had a prearranged editor.
Freely available online through the PNAS open access option.
1
To whom correspondence may be addressed. E-mail: fport@mrc-lmb.cam.ac.uk or
sbullock@mrc-lmb.cam.ac.uk.
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.
1073/pnas.1405500111/-/DCSupplemental.
www.pnas.org/cgi/doi/10.1073/pnas.1405500111 PNAS
|
Published online July 7, 2014
|
E2967–E2976
GENETICS PNAS PLUS

Drosophila would represent a powerful system to dissect the func-
tions of genes within an organismal context. However, the feasibility
of such an approach has not been explored so far.
Here, we present a versatile CRISPR/Cas toolbox for Drosophila
genome engineering consisting of a set of systematically evaluated
transgenic Cas9 lines and gRNA-expression plasmids. We describe
combinations of Cas9 and gRNA sources that can be used to in-
duce, with high efficiency, loss-of-function mutations in nonessential
or essential genes and integration of designer sequences by HDR.
Finally, we show that our optimized transgenic tools permit efficient
biallelic targeting in a variety of somatic tissues of the fly, allowing
the characterization of mutant phenotypes directly in Cas9/gRNA-
expressing animals.
Results
Generation and Evaluation of Cas9 Transgenes. We generated a se-
ries of Cas9-expressing transgenes (Table S1) to compare their
expression patterns and endonuclease activities. Expression plas-
mids were produced encoding S. pyogenes Cas9 [codon optimized
for expression in human (13, 14) or Drosophila cells] fused to
0
20
40
60
80
100
ebony yellow
A
B
gRNA target: yellow
control
C
F
act-cas9
vasa-cas9 (on X)
vasa-cas9 (on 3)
nos-cas9:GFP
nosG4VP16>cas9
nos-cas9
% phenotypically yellow
DE
-7
-8,+1
-4,+5
-3
act-cas9 vasa-cas9 (on X) nos-cas9
nosG4VP16
UAS-cas9
nos-cas9:GFPvasa-cas9 (on 3)
gRNA target: ebony
control
% phenotypically ebony
0
20
40
60
80
100
act-cas9
vasa-cas9 (on X)
vasa-cas9 (on 3)
nos-cas9:GFP
nosG4VP16>cas9
nos-cas9
Chr. 3R Chr. X
/ 74bp /
-4
+5
-4
Protospacer
PAM
ebony
yellow
act-cas9 vasa-cas9 (on X) nos-cas9
nosG4VP16
UAS-cas9
nos-cas9:GFPvasa-cas9 (on 3)
2242232
alleles:
2222222
***
*
***
***
*** **
alleles:
Fig. 1. Systematic evaluation of transgenic Cas9 strains. (A) Schematic of sequence and position of gRNA-e and gRNA-y target sites in the eand yloci. UTRs are
shown in gray, and coding sequences are shown as colored blocks. Cas9 cut sites are indicated by arrowheads. (Band C) Representative examples of female flies
expressing one copy of the different cas9 transgenes and one copy of the U6:3-gRNA-e (B)orU6:3-gRNA-y (C) transgene compared with wild-type controls (at
least 200 adults of each genotype were examined). Body coloration darker (B) or lighter (C) than the control indicates CRISPR/Cas-mediated mutagenesis of the
target gene in epidermal cells. The number of wild-type alleles present in each animal that must be mutated to give rise to the mutant phenotype is indicated
below each image. Somatic targeting is widespread in animals expressing act-cas9 or vasa-cas9, is sporadic in animals expressing nos-cas9:GFP and nosG4VP16
UAS-cas9 (arrowheads), and is undetectable in animals expressing nos-cas9.(Dand E) Assessment of germ-line transmission of nonfunctional e(D)andy(E)
alleles induced by different cas9 transgenes, performed by crossing animals expressing cas9 and the appropriate gRNA to eor ymutant animals. Data represent
mean and SEM from at least eight (D)orfour(E) independent crosses for each cas9 line. Efficient germ-line transmission of CRISPR/Cas-induced mutations was
observed for all cas9 transgenes, although statistically significant differences in mean values were apparent (*P<0.05; **P<0.01; ***P<0.001; unpaired ttest
compared with act-cas9 with the same gRNA). Displayed values for U6:3-gRNA-y experiments are normalized to account for the 25% of ymutant offspring that
would be expected in some crosses in the absence of CRISPR/Cas-mediated mutagenesis (Table S3). (F) Examples of sequences of CRISPR/Cas-induced germ-line
mutations in eand y(found in the offspring of act-cas9 gRNA flies). Some mutations were observed in severaldifferent flies. The in-frame mutation in e(bottom
sequence) was obtained from a fly with wild-type pigmentation. The start codon in this and subsequent figures is shown in bold text.
E2968
|
www.pnas.org/cgi/doi/10.1073/pnas.1405500111 Port et al.

nuclear localization signals under the control of different regu-
latory sequences. We generated two constructs in which Cas9
was under the control of the nos promoter, which is active in
the male and female germ line (15), and the nos 3′UTR, which
targets protein synthesis to the germ cells (15). These constructs
are similar to those used by two previous studies to provide Cas9
transgenically (8, 10). We also generated two novel constructs:
(i)act-cas9, in which Cas9 is fused to the ubiquitously expressed
actin5C (act)promoterandtheSV403′UTR, and (ii)UAS-
cas9, which has yeast upstream-activating sequences (UAS),
allowing expression under control of the Gal4 transcriptional
activator (16), and the p10 3′UTR, which promotes efficient
translation (17). These plasmids were integrated into the Dro-
sophila genome at defined positions using the attB/attP/Phi31C
system (18, 19). We also obtained two published stocks that
express, from different genomic locations, a cas9 transgene un-
der control of the vasa promoter and 3′UTR that is purported to
restrict expression of the endonuclease to the germ line (11).
To test the different Cas9 lines functionally, we designed a
gRNA targeting the ebony (e) gene on chromosome 3 (referred
to as “gRNA-e”) (Fig. 1A). Mutation of both wild-type ealleles
leads to very dark coloration of the adult cuticle. gRNA-e targets
Cas9 to the 5′end of the ecoding sequence, 25 bp after the
translation initiation codon. A construct expressing gRNA-e
from the promoter of the U6:3 spliceosomal snRNA gene (see
below) was integrated stably at the attP2 site on chromosome 3
(Table S2). Transgenic supply of the gRNA was designed to
eliminate the variability between experiments that is associated
with direct injection of a plasmid or in vitro-transcribed RNA
into embryos, thereby facilitating meaningful comparison of the
activities of the different Cas9 lines.
Flies expressing the U6:3-gRNA-e transgene were crossed to
the transgenic Cas9 lines (see Fig. S1 for the general crossing
scheme). Remarkably, all adult offspring expressing gRNA-e and
act-cas9 had mosaic pigmentation in which the majority of cuticle
exhibited very dark coloration (Fig. 1B). This result demon-
strates highly efficient biallelic targeting of ein somatic cells.
Surprisingly, the two independent genomic insertions of vasa-
cas9 in combination with gRNA-e also resulted in emutant tissue
throughout most of the cuticle (Fig. 1B). Thus, Cas9 activity is
not restricted to the germ line by either vasa-cas9 transgene. All
nos-cas9:GFP U6:3-gRNA-e flies had patches of dark cuticle,
but these patches were relatively small and infrequent (Fig. 1B).
A similar phenotype was observed in ∼40% of flies in which
U6:3-gRNA-e was combined with UAS-cas9 driven by the strong
transcriptional activator Gal4VP16 under the control of nos
regulatory sequences (nosG4VP16) (Fig. 1B). In contrast, all nos-
cas9 U6:3-gRNA-e flies had wild-type coloration of the entire
cuticle (Fig. 1B). The differential activity of nos-cas9:GFP and
nos-cas9—both of which use the same nos promoter and 3′
UTR sequences and are inserted at the same genomic location—
presumably reflects an influence of the GFP moiety, number of
nuclear localization signals, or differences in the codon use for
the Cas9 ORF in each construct (Table S1).
We next compared the somatic activity of the cas9 transgenes
using a second gRNA transgene, which targets the X-linked
yellow (y) gene 94 bp after the start codon (referred to as “gRNA-y”)
(Fig. 1A). This gRNA also was expressed from the U6:3 pro-
moter and was stably integrated at the attP2 site. In the absence
of a wild-type yallele, the adult cuticle has lighter, yellow pig-
mentation. The combination of U6:3-gRNA-y with act-cas9 or
vasa-cas9 led to a predominantly yellow cuticle in all animals
(Fig. 1C). This was even the case in a vasa-cas9 U6:3-gRNA-y
genotype in which four wild-type yalleles had to be mutated
to give the yellow phenotype (Fig. 1C); note that different crosses
had different numbers of y
+
alleles because of differences
in the genotypes of the Cas9 parental strains (Fig. 1C,Table
S3,andMaterials and Methods). In contrast, nos-cas9:GFP
U6:3-gRNA-y animals had cuticle that contained only small
clones of ymutant tissue (Fig. 1C), whereas the combination
of U6:3-gRNA-y with nosG4VP16 >UAS-cas9 or nos-cas9 resulted
in phenotypically wild-type cuticle throughout the animal (Fig. 1C).
nos-cas9 U6:3-gRNA-y males, in which only a single wild-type yallele
had to be mutated to produce yellow cuticle, also had wild-type
pigmentation throughout the animal (Fig. S2). Together, the
experiments with gRNA-e and gRNA-y demonstrate that act-
cas9 and vasa-cas9 have substantial activity in cells that give
rise to the cuticle, but activity in these cells is relatively low
in nos-cas9:GFP and nosG4VP16 >UAS-cas9 flies and is not
detectable in nos-cas9 flies.
We next assessed the germ-line transmission of CRISPR/Cas-
induced mutations in eand y(Fig. 1 Dand Eand Table S4).
Individual flies containing each cas9 transgene and U6:3-gRNA-
ewere crossed to a classical emutant strain. All cas9 transgenes
resulted in 42–54% of transmitted ealleles being nonfunctional
(mean values from at least eight crosses per transgene) with the
exception of nos-cas9, for which the mean value was 26 ±3%
(Fig. 1Dand Table S4). Sequencing of nonfunctional ealleles
from one of these crosses revealed a range of small indels in the
vicinity of the predicted Cas9 cleavage site (Fig. 1F); this finding
is consistent with molecular analysis of CRISPR/Cas-induced
alleles in other studies (5–8, 10).
We assessed the transmission of CRISPR/Cas-induced
ymutant alleles by crossing flies containing U6:3-gRNA-y and the
different cas9 transgenes to a strain with a classical ymutant allele.
In all cases, an average of >70% of the progeny expected to have
wild-type pigmentation in the absence of mutagenesis had phe-
notypically yellow cuticle (Fig. 1Eand Table S4). In the case of
the act-cas9 and one of the vasa-cas9 transgenes, an average of
99–100% of such progeny were yellow (Fig. 1Eand Table S4),
demonstrating CRISPR/Cas-induced mutagenesis of wild-type
yalleles in almost every germ cell. As expected, sequencing
analysis of the progeny revealed indels at the predicted location
of the ylocus (Fig. 1F). Collectively our experiments indicate
that act-cas9 and vasa-cas9 transgenes can induce mutations in
somatic and germ-line cells with high frequencies and that nos-
cas9 allows efficient germ-line transmission of mutations without
widespread targeting in somatic cells.
It was intriguing that for each cas9 transgene the frequency
of transmission of nonfunctional yalleles was higher than that
observed for ealleles (Fig. 1 Dand E). To determine whether the
ability of eto tolerate in-frame mutations at the gRNA-e target
site contributes to this difference, the target site of eight phe-
notypically wild-type progeny from act-cas9 U6:3-gRNA-e parents
was sequenced. Seven flies had small indels that retain the
overall reading frame (e.g., Fig. 1F); only a single fly inherited an
unmodified elocus. Thus, the frequency of nucleotide changes in
gRNA-e experiments is substantially higher than suggested by
phenotypic screening.
Optimized Single and Double gRNA Expression Vectors. To date,
gRNAs targeting the Drosophila genome have been transcribed
from one of the RNA polymerase III-dependent promoters
of the U6 snRNA genes (5, 9–11). There are three U6 genes in
the fly: U6:1,U6:2,andU6:3. The great majority of published
CRISPR/Cas experiments have used gRNAs produced by the
U6:2 promoter. The U6:1 promoter has been assessed in a
single experiment using direct plasmid injection to deliver the
gRNA construct (10), and the U6:3 promoter has not been
used previously. To compare the activity of the three U6 pro-
moters in CRISPR/Cas experiments, plasmids were generated
harboring each U6 promoter followed by the gRNA core
sequence and a BbsI restriction-site cassette (Fig. 2Aand
Fig. S3). The plasmids also contained an attB site to allow
integration at defined positions in the Drosophila genome and
an eye pigmentation marker to permit screening for insertion
Port et al. PNAS
|
Published online July 7, 2014
|
E2969
GENETICS PNAS PLUS

events. We used these plasmids to generate constructs expressing
gRNA-y under the control of each U6 promoter. To avoid posi-
tional effects on gRNA expression, each construct was stably
integrated at the attP40 site on chromosome 2.
Flies expressing each gRNA-y transgene were crossed to flies
expressing the act-cas9 transgene. All progeny expressing act-
cas9 and U6:3-gRNA-y developed a completely yellow cuticle
(Fig. 2B). This finding indicates extremely efficient targeting
of the two wild-type yalleles in this cross, consistent with results
of combining this cas9 transgene with U6:3-gRNA-y integrated at
another genomic site (Fig. 1C). All act-cas9 U6:1-gRNA-y ani-
mals developed cuticle that was mostly yellow but had small
spots of wild-type tissue (Fig. 2B). In contrast, all act-cas9
U6:2-gRNA-y flies retained large amounts of wild-type cuticle
with many small yellow patches (Fig. 2B). We also produced flies
expressing nos-cas9 and each of the U6-gRNA-y constructs and
assessed the germ-line transmission of nonfunctional yalleles to
the next generation as described above. Of the progeny expected
to have wild-type pigmentation in the absence of CRISPR/
Cas-mediated targeting, 69 ±2%, 41 ±3%, and 99 ±1%
were phenotypically yellow when the U6:1,U6:2 and U6:3 pro-
moters were used, respectively (Fig. 2Cand Table S4). Col-
lectively, these results demonstrate that the different U6
promoters differ substantially in their ability of drive muta-
genesis in both somatic cells and the germ line, with U6:3
having the strongest, U6:2 having the weakest, and U6:1 having
intermediate activity.
Simultaneous expression of two gRNAs can be used to create
defined deletions (5, 8), to target two genes simultaneously (20),
or to mutagenize a single gene by offset nicking (21, 22). The last
method increases CRISPR/Cas specificity by combining a Cas9
“nickase”mutant [Cas9
D10A
(3)], which cuts only one DNA strand,
with two gRNAs to the target gene. DSBs are induced by this
protein only when two molecules are guided to opposite strands
of the DNA in close proximity, an event that is extremely un-
likely at an off-target site. This method has not been used pre-
viously in Drosophila. To enable simultaneous expression of two
gRNAs, we produced a plasmid containing both the U6:1 and
U6:3 promoters adjacent to gRNA core sequences (Fig. 2D).
Different promoters were chosen to avoid the risk associated
with recombination between identical sequences during cloning
exercises. The plasmid was designed to allow one-step cloning of
U6:1-gRNA-y
AB
CG13624Esyt2
snRNA
U6:1
snRNA
U6:2
snRNA
U6:3
Chr. 3R
}
}
}
pCFD3
A
m
p
R
a
t
t
B
U
6
:
3
g
R
N
A
v
e
r
m
i
l
i
o
n
pCFD2
a
t
t
B
U
6
:
2
g
R
N
A
v
e
r
m
i
l
i
o
n
A
m
p
R
pCFD1
a
t
t
B
v
e
r
m
i
l
i
o
n
A
m
p
R
U
6
:
1
g
R
N
A
Esyt2
act-cas9
U6:2-gRNA-y U6:3-gRNA-y
control
CD
U6:2 y1 gRNA U6:3 y1 gRNA
control U6:1-gRNA-e, U6:3-gRNA-cu
pCFD4
a
t
t
B
v
e
r
m
i
l
i
o
n
A
m
p
R
U
6
:
1
g
R
N
A
U
6
:
3
g
R
N
A
ebony Protospacer
PAM
curled
act-cas9
Addgene
49408
Addgene
49409
Addgene
49410
Addgene 49411
E
-33,+2
-47,+4
-42,+2
-18,+4
-7,+2
-25,+3
yellow Protospacer PAM
wt
Founder
animals
mutant
offspring
75%
42%
3/4
60/144
U6:3-gRNA-y
% phenotypically yellow
U6:2-gRNA-y
U6:1-gRNA-y
*
**
*
*
0
20
40
60
80
100
Fig. 2. Versatile gRNA-expression vectors. (A) Schematic of the U6 locus. U6 genes are shown as orange blocks; intervening sequences and neighboring genes
are shown in gray. Sequences 5′to each U6 gene were cloned in front of a core gRNA sequence to generate plasmids pCFD1–3. The asterisk indicates positions
of the BbsI cloning cassette for insertion of target sequence. (B) Differential activity of U6-gRNA constructs in epidermal cells. Female flies are shown that are
heterozygous for act-cas9 and a gRNA-y transgene under the control of the U6:1,U6:2,orU6:3 promoter. Lighter body coloration indicates CRISPR/Cas-
mediated mutagenesis of the two wild-type yalleles present in these flies. Arrowheads show examples of wild-type pigmentation with the U6:1 promoter and
mutant pigmentation with the U6:2 promoter. (C) Mean germ-line transmission rates using different gRNA transgenes. nos-cas9 U6-gRNA-y females were
crossed to ymutant males, and ymutant offspring were counted (three crosses per genotype). Displayed values are adjusted to account for the 25% of
ymutant offspring expected in the absence of mutagenesis. Error bars represent SEM. (D) Targeting of two genes in the same animal with a double gRNA
vector, pCFD4. Representative images are shown of flies that express act-cas9 in the absence or presence of a single transgene expressing gRNAs to eand cu.
The arrowhead indicates the curled wing of a fly with extensive ebony pigmentation. (E)pCFD4 allows mutagenesis by offset-nicking in combination with act-
cas9
D10A
.(Upper Left) Target sites of gRNAs (arrowheads indicate location of nicks). (Right) Summary of results from injecting pCFD4 encoding the two y
gRNAs into transgenic act-cas9
D10A
embryos and crossing to yflies to assess germ-line transmission of loss-of-function yalleles. In these and other figures,
“founder”refers to an animal that transmitted mutant alleles to the next generation. In the four crosses, 22 of 22 files, 11 of 56 flies, 27 of 31 files, and none
of 35 flies inherited a nonfunctional yallele. (Lower Left) Sequence of six different indels found in 20 analyzed yellow progeny.
E2970
|
www.pnas.org/cgi/doi/10.1073/pnas.1405500111 Port et al.

the two gRNAs by introducing target sequences in PCR primers
(Fig. S3) and therefore allows more convenient and rapid work-
flow than a previously reported strategy for the same task, which
used sequential cloning of gRNAs adjacent to two U6:2 pro-
moters (8).
We used our dual gRNA plasmid to make a transgenic line
simultaneously expressing gRNAs targeting eor curled (cu), which
causes a curled wing phenotype when mutated (23), and crossing
that line to act-cas9 flies. All 120 of the analyzed act-cas9 gRNA-e
gRNA-cu flies had large patches of dark cuticle, and 52% had
one or two curled wings (Fig. 2D). Thus, the dual gRNA plasmid
can be used to target two genes in the same animal efficiently.
We also integrated two sequences targeting opposite strands
of the ylocus into the dual gRNA vector and injected the plasmid
directly into transgenic embryos expressing the Cas9
D10A
nickase
under the control of the act promoter (Table S1). Forty-two
percent of the offspring from injected animals received a non-
functional yallele, which we confirmed was associated with
indels at the expected position (Fig. 2E). All transgenic animals
expressing both act-cas9
D10A
and the strong single-target U6:3-
gRNA-y transgene had wild-type coloration of the cuticle, in-
dicating that single DNA nicks have low mutagenic potential
in flies. We conclude that the dual gRNA vector can be used in
combination with act-cas9
D10A
flies to create mutagenic DSBs
through offset nicking.
Efficient Germ-Line Transmission of Mutations in Essential Genes. The
experiments described above identified Cas9 and gRNA reagents
that can target nonessential genes in somatic and/or germ-line
tissues with different efficiencies. We next sought to identify Cas9/
gRNA combinations that can give efficient germ-line transmission
of mutations in genes that are essential for viability. Doing so
necessitates finding conditions in which transmission is not
compromised by deleterious effects of biallelic gene targeting in
somatic tissues. We generated transgenic fly lines expressing
gRNAs targeting the genes encoding either the secreted signal-
ing molecule Wingless (Wg) or the Wg secretion factor Wntless
(Wls). Both the wg and wls genes are essential in the soma for
development of Drosophila to adult stages (24–26). Both gRNAs
were under the control of the U6:3 promoter and integrated at
the attP40 site. gRNA-wg directs Cas9 to cut just after the region
of the target gene that encodes the signal sequence, and gRNA-
wls directs Cas9 to cut within the signal sequence-encoding re-
gion of the target gene (Fig. 3A).
No offspring survived past the pupal stage when U6:3-gRNA-wg
or U6:3-gRNA-wls flies were crossed to the ubiquitous act-cas9
line (Fig. 3B), presumably because of effective biallelic targeting
of wg and wls in the soma. Crossing vasa-cas9,nos-cas9:GFP, and
nosG4VP16 >UAS-cas9 to each gRNA also resulted in substan-
tial lethality, with the few animals that progressed to adulthood
exhibiting a range of morphological defects consistent with
defects in Wg signaling (Fig. 3C). Unsurprisingly, many of these
adults died shortly after eclosion, and those that survived often
had poor fertility. In contrast, no significant lethality was ob-
served for nos-cas9 U6:3-gRNA-wg and nos-cas9 U6:3-gRNA-wls
pupae (Fig. 3B). All the eclosed adults appeared morphologically
normal, with the exception of 5% of nos-cas9 U6:3-gRNA-wls
flies that had small notches in the wing (Fig. 3C). This phenotype
indicates a local impairment of Wg signaling, suggesting that not
all Cas9 activity is restricted to the germ line when nos-cas9 is
combined with this gRNA. This series of experiments demonstrates
that only the nos-cas9 line has sufficiently germ-line–restricted
Cas9 activity to allow efficient development of flies to adulthood
when either essential gene is targeted.
wntless
wingless
A
B
Chr. 2L
C
Chr. 3L
nos-cas9
nosG4VP16
UAS-cas9
nos-cas9:GFP nos-cas9
/ 46bp / Protospace
r
PAM
DE
-27
-45
-24
-16, +10
-2, +6
-5, +7
-6
-13
-8
wt
Offspring from nos-cas9 U6:3-gRNA-wls
nos-cas9:GFP
vasa-cas9 (on 3)
vasa-cas9 (on X)
act-cas9
nosG4VP16
UAS-cas9
nos-cas9
U6:3-gRNA-wg U6:3-gRNA-wls U6:3-gRNA-wlsU6:3-gRNA-wg
0.0 0.2 0.4 0.6 0.8 1.0
0.0 0.2 0.4 0.6 0.8 1.0
% animals developing
until pupal stage
% animals developing
until pupal stage
lethal
severe malformations
mild malformations
normal appearance
founder
animals
100%
4/4
offspring
12/19
63%
nos-cas9 U6:3-gRNA-wg
Fig. 3. Efficient targeting of essential genes. (A) Schematic of sequence and position of target sites of gRNA-wg and gRNA-wls.(B) Summary of fate of
animals that developed to pupal stage and that coexpressed U6:3-gRNA-wg or U6:3-gRNA-wls with different cas9 transgenes. (C) Representative examples of
phenotypes observed in adult cas9 gRNA-wg and cas9 gRNA-wls flies. Defects consistent with perturbed Wg signaling include wing notches (Upper)and
malformation of the legs and abdominal segments (Lower). Images at the left and center left show severe malformations; image on the top right shows mild
malformations. The arrowhead indicates a wing notch, which was found in 5% of nos-cas9 U6:3-gRNA-wls flies. (D) Summary of results assessing transmission
of wg loss-of-function alleles (wg
LOF
) by genetic complementation tests with a known wg null allele (in the four crosses, four of four flies, one of six flies, three
of five flies, and four of four flies inherited a wg
LOF
allele). wg
CRISPR
alleles that retain function are not detected by this method. (E) Assessment of trans-
mission of nonfunctional wls alleles. A fertile nos-cas9 gRNA-wls fly was crossed to a balancer stock, and the wls locus of 15 heterozygous progeny was
sequenced. Ten sequencing chromatograms could be read unambiguously; all contained indels at the target site. The mutated sequence is shown below the
wild-type sequence. The 27-bp deletion was recovered in two different flies.
Port et al. PNAS
|
Published online July 7, 2014
|
E2971
GENETICS PNAS PLUS

We next evaluated germ-line transmission of CRISPR/Cas-
induced mutations in wg and wls using nos-cas9. Nineteen ran-
domly selected offspring of nos-cas9 U6:3-gRNA-wg flies were
tested for wg mutations by genetic complementation with a pre-
viously characterized wg null allele (27). The wg null allele was
not complemented in 12 of the 19 crosses, demonstrating effi-
cient creation of nonfunctional wg mutations by CRISPR/Cas
(Fig. 3D).
The nos-cas9 U6:3-gRNA-wls females were poorly fertile,
which is compatible with the requirement for maternal Wls
during embryonic development (25, 26). The nos-cas9 U6:3-
gRNA-wls males also had low fertility, raising the possibility of
a previously undescribed role for Wls in the male germ line.
Nonetheless, we were able to sequence wls alleles from PCR
products of 15 randomly selected offspring of an outcrossed nos-
cas9 U6:3-gRNA-wls fly that was fertile. The sequencing chro-
matograms had double peaks around the gRNA target site in
every case. This pattern indicates the presence of a CRISPR/
Cas-induced wls mutant allele in each fly, along with the wild-
type allele inherited from the other parent. Peaks from the
mutagenized and wild-type wls alleles could be called un-
ambiguously in the sequencing traces from 10 of the 15 samples;
each of these 10 traces revealed an indel mutation, nine of which
were unique (Fig. 3E). Many of the indels created frameshifts or
removed the ATG start codon, presumably resulting in loss of wls
function. Together these results show that our optimized CRISPR/
Cas system allows the generation of loss-of-function alleles in
essential genes at frequencies that make screening with meth-
ods other than direct DNA sequencing unnecessary.
Precise Genome Modification by HDR. The work described above
identified tools for generating loss-of-function indel mutations in
both the soma and germ line of Drosophila. In many cases, it is
desirable to dissect gene function further by introducing specific
sequence changes into the genome. In Drosophila it has been
possible for several years to create specific genome modifications
by HDR, although targeting typically occurs with very low
efficiency (28). Recent studies have suggested that zinc finger,
transcriptional activator-like effector (TALE), and Cas9 nucleases
can increase the efficiency of HDR in flies, implying that the gen-
eration of site-specific DSBs is rate limiting (11, 12, 27, 29, 30).
Therefore we tested whether the highly effective creation of DSBs
by our transgenic CRISPR/Cas system could be exploited to facil-
itate efficient HDR.
We first attempted to introduce a missense mutation into the
wls locus using an ssDNA oligonucleotide donor (ssODN). We
designed an ssODN harboring a G-to-C transversion at the
gRNA-wls target site, which would cause a Gly11Ala mutation in
Wls and remove the PAM sequence (Fig. 4A). The ssODN was
injected into nos-cas9 U6:3-gRNA-wls preblastoderm embryos,
with six of the resulting flies outcrossed. Sequence analysis of the
wls locus from the offspring of these crosses revealed that four of
the six flies had transmitted the designed change, with 28% of
the 46 tested progeny receiving the mutation (Fig. 4 Band C).
Sixty-one percent of the total progeny instead inherited an indel
mutation at the target site, and the other animals received an
unmodified wls allele. We also introduced an 11-bp sequence
containing a restriction site into the elocus by ssODN injection
into act-cas9 U6:3-gRNA-e embryos; 11% of the 76 progeny an-
alyzed contained the desired mutation (Fig. S4). These data
demonstrate that our CRISPR/Cas tools can support HDR using
oligonucleotide-derived sequences with efficiencies compatible
with direct screening for targeting events by PCR and sequenc-
ing. We also injected a circular double-stranded plasmid con-
taining the GFP-coding sequence flanked by 1.4- and 1.7-kb
homology arms from the wg locus into nos-cas9 U6:3-gRNA-wg
embryos (Fig. S5A). The donor template is designed to produce
an in-frame insertion of GFP within the wg coding region, leading
to a secreted Wg::GFP protein. Thirty-eight percent of the off-
spring of injected embryos expressed a GFP protein in the Wg
expression pattern, which appeared to be secreted (Fig. S5 B–D).
PCR-based analysis of the wg locus in five of these animals con-
firmed successful ends-out targeting in all cases (Fig. S5E).
These data provide evidence that our CRISPR/Cas tools also
can be used to introduce longer exogenous sequences into an
essential gene with high efficiency.
CRISPR/Cas as a Tool for Analyzing Loss-of-Function Mutant Phenotypes
in Somatic Tissues. An important result from the evaluation of our
tools is that transgenic CRISPR/Cas with U6:3-gRNAs can result
in highly effective biallelic mutagenesis in the soma. We noticed
in our experiments targeting yand ethat cuticles frequently
contained large patches of cells with the same mutant phenotype
(Fig. 1 Band C), presumably resulting from clonal inheritance of
the same CRISPR/Cas-induced lesion. Analysis of classical Dro-
sophila mutations in genetic mosaics has been invaluable for un-
derstanding functions of genes that act at multiple stages during
development as well as cell autonomous and nonautonomous
mechanisms (31). However, generating the stocks required to in-
duce clones by traditional methods is time consuming (Discus-
sion). Therefore we wondered if our CRISPR/Cas tools could be
used for the rapid generation of clones in which both alleles of
essential genes are mutated.
We first analyzed wing imaginal discs from act-cas9 U6:3-
gRNA-wls third-instar larvae using an antibody that recognizes
the C-terminal tail of the Wls protein (32). Endogenous Wls
is expressed ubiquitously in the wing imaginal disc, where it is
required for the secretion of the Wg signaling molecule from
Wg-producing cells (25, 26, 32). All wing imaginal discs from
control act-cas9 U6:3-gRNA-e animals had wild-type Wls protein
levels and distribution (Fig. 5A). In contrast, all act-cas9 U6:3-
gRNA-wls wing imaginal discs examined contained patches of
cells with partially reduced Wls levels, with no Wls protein,
or with wild-type Wls levels (Fig. 5B). The first two scenarios
C
ADonor:
B
G32C allele
WT allele
wntless Chr. 3L
Protospacer
PAM
Genome:
*
founder
animals
offspring 13/46
28%
4/6
67%
nos-cas9 U6:3-gRNA-wls
+ HDR donor
Fig. 4. Efficient incorporation of an exogenous sequence in wls by HDR
following Cas9-induced DSBs. (A) Schematic of the donor DNA in relation to
the gRNA target site at the wls locus. The donor was a single-stranded oli-
gonucleotide with 60-nt homology to the wls locus at either side of the Cas9
cut site and a G-to-C transversion (red, lowercase) that disrupts the PAM
sequence. Donor DNA was injected into embryos that were the progeny of
nos-cas9 females and U6:3-gRNA-wls males. (B) Summary of results from
screening flies for HDR events by PCR and sequencing. In the six crosses,
none of eight flies, two of eight flies, three of eight flies, six of seven flies,
none of seven flies, and two of eight flies inherited the wls
G32C
allele. (C)
Example of the verification of the precise integration of the donor DNA in
the wls locus by direct sequencing of a PCR product amplified from a het-
erozygous fly. Double peaks in the chromatogram represent an overlay of
the sequence from the mutant and wild-type wls alleles. The asterisk indi-
cates the position of the mutation.
E2972
|
www.pnas.org/cgi/doi/10.1073/pnas.1405500111 Port et al.

presumably reflect clonal tissue that has one or two wls mutant
alleles, respectively, that fail to produce full-length Wls protein.
Wg protein was retained in Wg-producing cells within clones that
lacked detectable Wls protein (Fig. 5B), confirming biallelic
disruption of wls.
We next examined wing imaginal discs from act-cas9 U6:3-
gRNA-wg animals using an anti-Wg antibody (33). The Wg ex-
pression domain normally includes a stripe of cells along the
dorsal–ventral boundary of the wing pouch, a pattern always
observed in act-cas9 U6:3-gRNA-e discs (Fig. 5A). In contrast,
act-cas9 U6:3-gRNA-wg discs had disrupted patterns of Wg ex-
pression (Fig. 5C). Although clones that lost all detectable Wg
protein were common, presumably reflecting biallelic loss-of-
function mutations, we also observed clones with increased abun-
dance or altered subcellular distribution of the protein (Fig. 5C
and Fig. S6). These latter clones likely contain in-frame muta-
tions at the gRNA target site that confer new properties to the
Wg protein. This finding suggests that CRISPR/Cas also can
shed light on the functional roles of specific regions of a protein.
The experiments described above demonstrated that act-cas9
and U6:3-gRNA can be used in imaginal discs to induce biallelic
targeting of essential genes in a stochastic fashion. To investigate
whether our transgenic CRISPR/Cas tools can reveal somatic
mutant phenotypes at earlier developmental stages, we attempted
to disrupt wg function in the embryo. wg is expressed zygotically in
the embryo and is required for segment polarity; classical wg null
mutants fail to complete embryogenesis and have regions of naked
cuticle replaced with an array of denticles (24). Our earlier finding
that many act-cas9 U6:3-gRNA-wg embryos develop to pupal
stages demonstrates that they retain significant wg function
(Fig. 3B). We therefore generated a gRNA transgene that simul-
taneously expresses three gRNAs targeting the wg promoter
(gRNA-wg
P1–3
). This construct, in which the gRNAs were under
the control of the U6:1,U6:2, and U6:3 promoters, was integrated
Wls A’ A’’
BB’B’’
CC’C’’
AWg merge
merge
merge
act-cas9 gRNA-wls
act-cas9 gRNA-wg
control
D
E
control
act-cas9 gRNA-wgP1-3
enG4>cas9 G80ts gRNA-wlscontrol
H
I
1
23
4
F
G
control
act-cas9 gRNA-wgP1-3
parental: nos-cas9 gRNA-wls
Wls Wg
Wls Wg
JK LM
parental: nos-cas9 gRNA-wls
control act-cas9 gRNA-wgP1-3
Wg
Wg
Wg
Fig. 5. Revealing mutant phenotypes through efficient biallelic targeting with transgenic CRISPR/Cas. (A–C) Genetic mosaics induced in third-instar wing
imaginal discs by somatic CRISPR/Cas. (A) Control act-cas9 U6:3-gRNA-e wing discs have ubiquitous expression of Wls and expression of Wg in a stripe along
the dorsal–ventral boundary. (B)act-cas9 U6:3-gRNA-wls discs have patches of cells with wild-type Wls levels, partially reduced Wls expression, and no de-
tectable Wls protein. Wg protein accumulates intracellularly in Wg-producing cells in the absence of Wls (bracket). (C) Clones with different distributions of
endogenous Wg protein can be observed in act-cas9 U6:3-gRNA-wg discs: 1, wild type; 2, nuclear accumulation; 3, increased Wg levels; and 4, no Wg protein.
A second example with abnormal nuclear Wg staining is shown at higher magnification in Fig. S6. Images are representative of >10 discs of each genotype.
(D–K) Biallelic targeting by transgenic CRISPR/Cas can reveal mutant phenotypes during embryogenesis. (D–F) Cuticle preparations at the end of embryo-
genesis. (D)act-cas9 U6:3-gRNA-e control animal. (Eand F)Allact-cas9 gRNA-wg
P1–3
embryos (E) and most embryos from nos-cas9 U6:3-gRNA-wls parents (F)
have naked region of cuticle replaced by denticle bands (exemplified by arrowheads). (G–K) Analysis of Wg protein in stage 9/10 embryos by immunostaining
(“fire”lookup table facilitates comparison of Wg signal intensity in different genotypes). Compared with control nos-cas9 U6:3-gRNA-e embryos (G), Wg
signal is strongly reduced in act-cas9 gRNA-wg
P1–3
embryos (H) and is strongly increased in embryos from nos-cas9 U6:3-gRNA-wls parents (I). (Jand K) Higher-
magnification views of Wg protein in embryos, showing variation in levels in act-cas9 gRNA-wg
P1–3
embryos (K), presumably caused by independent CRISPR/
Cas targeting events in subsets of cells. act-cas9 U6:3-gRNA-e is shown as a control (J). Images are representative of >50 embryos examined. (Land M) Cas9
activity can be focused on specific tissues by Gal4/UAS. Expression of gRNA-wls together with UAS-cas9 (line CFD5 in Table S1) under the control of enGal4 and
Gal80
ts
gives rise to viable flies that have wing notches posteriorly in the adult wing (M; arrowhead). Control wing (L) is from an animal that did not inherit
the gRNA-wls transgene. All genotypes in this figure refer to one copy of each transgene. (Scale bars: A–C,40μm; D–F,100μm; G–K,30μm.)
Port et al. PNAS
|
Published online July 7, 2014
|
E2973
GENETICS PNAS PLUS

at the attP2 site. All act-cas9 gRNA-wg
P1–3
animals arrested before
the end of embryogenesis with a strong segmentpolarity phenotype
(Fig. 5 Dand E). This result presumably reflects biallelic disruption
of wg expression, because a single functional copy of wg is sufficient
for normal development. Indeed, immunostaining of act-cas9
gRNA-wg
P1–3
embryos revealed strongly reduced expression of
Wg protein compared with act-cas9 U6:3-gRNA-e controls (Fig. 5
G, H, J, and K), indicative of interference with transcription of both
alleles. We conclude that somatic CRISPR/Cas can be used to
induce biallelic mutations in genes that are expressed zygotically
in embryos.
Additional observations indicated that transgenic CRISPR/
Cas also can be used to study loss-of-function embryonic phe-
notypes of maternally contributed genes. As described above,
nos-cas9 U6:3-gRNA-wls adults had low fertility. Closer inspec-
tion revealed that intercrosses of these flies resulted in many
eggs being laid but with less than 5% developing to larval stages.
Wls normally is contributed maternally to the embryo. Although
zygotic wls null mutants from heterozygous mothers develop
until pupal stages, offspring of mothers with a homozygous wls-
mutant germ line die at embryonic stages with cuticle phenotypes
typical of perturbed Wg signaling (25, 26). The great majority of
embryos from nos-cas9 U6:3-gRNA-wls mothers arrested at the
end of embryogenesis with segment polarity phenotypes remi-
niscent of wls germ-line mutant clones (Fig. 5F). This observa-
tion indicates biallelic disruption of wls in the germ line of
nos-cas9 U6:3-gRNA-wls females. Consistent with this notion,
immunostaining revealed a strong accumulation of Wg protein
within producing cells of embryos derived from nos-cas9 U6:3-
gRNA-wls mothers (Fig. 5I), presumably resulting from defective
Wg protein secretion in the absence of Wls.
Finally, we explored whether biallelic gene targeting in specific
somatic cell types was possible by coupling CRISPR/Cas to the
Gal4/UAS system. UAS-cas9 was combined with engrailed-Gal4
(enGal4), which drives UAS expression specifically in posterior
compartments of the animal, and gRNA-wls. We also included
a temperature-sensitive Gal80 transgene (Gal80
ts
)torestrict
Cas9 activity further by temporal control of Gal4. Following a
temperature shift of second-instar larvae of this genotype to 29 °C,
many adult flies had pronounced notches specifically in the
posterior half of the wing (Fig. 5 Land M).This phenotype was
not observed in the absence of gRNA-wls (Fig. 5L).These results
show that biallelic targeting of essential genes can be focused
on specific cell types by regulating expression of Cas9 with Gal4/
UAS. However, the first generation of UAS-cas9 constructs
requires optimization. Substantial lethality was observed when
UAS-cas9 transgenic lines were crossed to strong, ubiquitous
Gal4 drivers, and this lethality was not dependent on the pres-
ence of a gRNA. This toxicity also was not dependent on the
endonuclease activity of Cas9, because it also was observed with
a catalytically dead mutant protein. Furthermore, when UAS-
cas9 was combined with gRNA-wls, we observed some wls
−
clones
in wing discs that were independent of Gal4 activity. Nonetheless
this effect, which presumably is caused by leaky expression from
the UAS promoter, was not sufficient to produce wing notching
in the adult. Future efforts will be aimed at producing UAS-cas9
variants that have reduced expression levels but still retain suf-
ficient activity for biallelic targeting in response to Gal4.
Discussion
CRISPR/Cas promises to revolutionize genome engineering in
a large variety of organisms. Although proof-of-principle studies
have demonstrated CRISPR/Cas-mediated mutagenesis in
Drosophila melanogaster (5–12), a systematic evaluation of dif-
ferent tools has not been reported. We have developed a collec-
tion of tools to harness further the potential of CRISPR/Cas for
functional studies in Drosophila. We have characterized different
Cas9 and gRNAs expression constructs and revealed combinations
that allow mutagenesis of essential and nonessential genes
with high rates, support efficient integration of exogenous
sequences, and can reveal mutant phenotypes readily in somatic
tissues.
To assess the activity of different constructs, we used a fully
transgenic CRISPR/Cas system in which Cas9 and gRNA are
expressed from plasmid sequences stably integrated at defined
positions in the genome. The advantage of this approach for
comparative analysis is the low variability between experiments.
For example, we found that 100% of flies expressing transgenic
Cas9 and gRNA constructs had efficient germ-line mutagenesis
of the target site. In contrast, the number of animals that transmit
mutations to the next generation using delivery of one or both
CRISPR/Cas components by RNA or DNA microinjection is
highly variable and often is less than 50% (5, 6, 9–11). However,
injection-based CRISPR/Cas may be advantageous under certain
circumstances, such as when one wishes to generate a mutation
directly in a complex genetic background. Our gRNA-expression
plasmids are also suitable for this purpose.
Our quantitative analysis using transgenic Cas9 and gRNA
constructs reveals that, of the three U6 promoters, the previously
uncharacterized U6:3 promoter leads to the strongest gRNA
activity. This observation suggests that targeting rates of previous
approaches have been limited by the selection of the U6:2
or U6:1 promoter. In combination with highly active Cas9 lines
(e.g., act-cas9,vasa-cas9), transgenic U6:3-gRNA can be used to
transmit mutations in nonessential genes through the germ line
with remarkably high efficiency (i.e., with 50–100% of offspring
receiving a nonfunctional CRISPR-generated allele). However,
these Cas9 lines also are active outside the germ line, and biallelic
targeting in the soma effectively prevents their use for trans-
mission of mutations in essential genes in combination with
U6:3-gRNA transgenes. The ubiquitous activity of vasa-cas9 pre-
sumably was masked in a previous study in which a U6:2-gRNA
plasmid targeting the eye pigmentation gene rosy was injected at
the posterior of the embryo, thereby restricting its activity in the
vicinity of the future germ cells (11). It remains to be evaluated if
activity of CRISPR/Cas is sufficiently restricted by this approach
to allow efficient germ-line transmission of mutations in essential
genes. We demonstrate that efficient targeting of essential genes
is possible using U6:3-gRNA transgenes in combination with the
transgenic nos-cas9 line in which endonuclease activity is largely
germ-line restricted. This finding held true even for wls, which is
required in the germ line, because fertility (although much re-
duced) was not abolished.
Our optimized CRISPR/Cas system also allowed the inte-
gration of designer mutations with high efficiency. By injecting
oligonucleotide donors and donor plasmids into embryos ex-
pressing cas9 and gRNA transgenes, we achieved precise modi-
fication of the target site in 11–38% of all offspring analyzed. A
previous study in which an oligonucleotide was injected together
with cas9 and gRNA plasmids found that 0.3% of all offspring
integrated the exogenous sequence at the target site (5). Very
recently, Gratz et al. (11) have reported integration rates for
larger constructs that range from 0–11% by injecting the donor
and gRNA plasmid into vasa-cas9 transgenic embryos. It is dif-
ficult to compare the integration efficiency of our method with
that in previous studies directly because of the use of different
gRNAs, donors, and target genes. Nonetheless, the increased
reproducibility and efficiency of site-specific DSB generation
with our optimized, fully transgenic CRISPR/Cas system is likely
to facilitate integration of exogenous sequences by HDR as com-
pared with methods that deliver Cas9 or gRNA by direct embryo
injection. The frequency of integration is of paramount impor-
tance when the goal is to introduce subtle changes in the DNA
sequence, such as individual point mutations, because a low rate
of integration necessitates screening by cointegration of a marker
gene, which can affect function of the targeted locus [note that
E2974
|
www.pnas.org/cgi/doi/10.1073/pnas.1405500111 Port et al.

exogenous sequences are still retained following removal of
markers by site-specific recombinases (34)]. We demonstrate
here that optimized transgenic CRISPR/Cas can facilitate the
introduction of precise changes at endogenous loci with rates
that make it practical to screen solely by PCR and Sanger se-
quencing. We envisage that one important application of our
tools will be the introduction of disease mutations into the Dro-
sophila genome to model human pathologies.
We also demonstrate a novel application of CRISPR/Cas in
rapidly analyzing gene function in somatic cells. Our optimized
tools permit efficient generation of genetic mosaics in which
clones of cells have biallelic gene disruption. Mitotic recombina-
tion using the yeast site-specific recombinase Flp is typically used
for this purpose in Drosophila (34). This method requires recom-
bination of the mutation of interest onto a chromosome contain-
ing the FLP recombinase target (FRT) site; this process is time
consuming, particularly for genes located close to the FRT site.
Somatic CRISPR/Cas requires only one cross to give rise to
mosaics. Furthermore, unlike the FRT/Flp system, there is no
a priori reason for CRISPR/Cas to require cell division, and
hence this method should be better suited for interrogating gene
function in differentiated tissues such as the adult brain. One
advantage of FRT/Flp in mosaic analysis is that clones can be
marked readily by the presence or absence of a linked marker
gene, such as gfp. Here we identified mutant cells with antibodies
specific to the proteins studied, but for many proteins no anti-
body will be available. Under these circumstances we envisage
mutant tissue being identified first by using CRISPR/Cas to gen-
erate a line in which a fluorescent protein or short epitope tag
has been knocked into the endogenous locus. In any case, such
a reagent would be valuable for characterizing the function of
the protein. We anticipate that CRISPR/Cas and FRT-Flp will
coexist as complementary methods for mosaic analysis of gene
function in the future.
As is the case for somatic CRISPR/Cas, RNAi can reveal
mutant phenotypes after a single cross. However, RNAi often
reduces gene expression only partially, meaning that some mutant
phenotypes can be incompletely penetrant or missed all together
because of residual protein. Somatic CRISPR/Cas readily provides
access to null-mutant phenotypes caused by biallelic out-of-frame
mutations. Consequently, somatic targeting of all genes tested
(e,y,cu,wg,orwls) revealed the classical loss-of-function mutant
phenotype with high penetrance. Furthermore, RNAi is notorious
for off-target effects (35), which can complicate phenotypic anal-
ysis significantly. Early studies in human cells did suggest that off-
target mutagenesis also is prevalent for CRISPR/Cas (36, 37).
However, experiments in Drosophila so far have failed to detect
induced mutations at sites without perfect complementarity
(6, 11). These findings suggest that CRISPR/Cas operates with
high fidelity in flies, although addressing the issue of specificity
definitively will require genome-wide searches for induced indels.
Nonetheless, it is encouraging that nonspecific phenotypes were
not detected in any of our experiments targeting e,y,cu,wg, or wls.
A recent study showed that truncating the target sequence of
gRNAs results in improved fidelity of CRISPR/Cas in human cells
(38), suggesting a straightforward approach to minimize the risk of
off-target effects in Drosophila. Our generation of tools for offset
nicking-based mutagenesis in flies provides a further option for
increasing specificity. Because of the ease with which CRISPR/Cas
experiments can be performed, the specificity of mutant pheno-
types generated with wild-type Cas9 also can be tested using
multiple independent gRNAs.
High-throughput genetic screens are likely to be another im-
portant application of somatic gene targeting by CRISPR/Cas.
The generation of gRNA-expression plasmids through cloning
of annealed short oligonucleotides is an easy and economic
one-step process that is scalable to generate a library of targeting
vectors for thousands of genes. CRISPR/Cas-based screens will
be particularly powerful if mutagenesis can be restricted in time
and space. We have taken a step in this direction by demon-
strating that expressing Cas9 under the control of the Gal4/UAS
system can enrich biallelic targeting within a defined group of cells.
Materials and Methods
Addition materials and methods are described in SI Materials and Methods.
Plasmid Construction. Unless otherwise noted, cloning was performed with
the Gibson Assembly Master Mix (New England Biolabs). PCR products were
produced with the Q5 High-Fidelity 2×Master Mix (New England Biolabs). All
inserts were verified by sequencing. Details of plasmid construction are
available in SI Materials and Methods. Primers used for plasmid construction
are listed in Table S5.
Drosophila Genetics. Details of transgenes and fly stocks are given in Tables
S1–S3 and S6. Throughout this study, transgenic cas9 virgin females were
crossed to U6-gRNA–expressing males.
Assessing relative activity of Cas9 and gRNA lines.All crosses involving gRNA-e
produced offspring with two wild-type ealleles that can be subjected to
gene targeting by CRISPR/Cas. Because some Cas9 strains were generated in
aymutant background and some attP sites are marked by y
+
transgenes,
offspring from the different gRNA-y crosses inherit different numbers of y
alleles from their parents (Fig. 1Cand Table S3). As a result, either 0% or
25% of F2 offspring from the different crosses would be expected to be
phenotypically yellow in the absence of CRISPR/Cas-mediated mutagenesis.
To correct for this imbalance, we subtracted 25% of the phenotypically
yellow animals when calculating germ-line transmission rates of nonfunc-
tional alleles from data collected from the latter type of cross.
Genetic complementation of wg loss-of-function alleles. nos-cas9/+; gRNA-wg/+
flies were crossed to a Sp/CyO balancer strain. Individual flies of the geno-
type wg
test
/CyO then were crossed to wg
TV-Cherry
/CyO flies. wg
TV-Cherry
is a
wg null allele in which the first exon of wg is replaced with a homologous
recombination targeting cassette (27). The next generation of the crosses
was screened for the presence or absence of flies without the CyO chro-
mosome. Cultures in which all flies had the CyO chromosome indicated that
the wg
test
allele could not genetically complement wg
TV-Cherry
and hence did
not encode functional Wg protein.
Molecular Characterization of Target Loci. To identify the molecular nature of
CRISPR/Cas-induced mutations, genomic DNA was extracted from individual
flies or larvae by crushing them in 15 μL microLysis-plus (Microzone) and
releasing the DNA in a thermocycler according to the supplier’s instructions.
We used 0.5 μL of the supernatant in 25-μL PCR reactions (Q5 2×Master Mix
kit; New England Biolabs) using primers binding 300–500 bp upstream and
downstream of the target site. PCR products were gel purified and were
either sent directly for Sanger sequencing or cloned into pBluescript-SK(+)
by Gibson assembly. In the latter case, single colonies were selected as
templates for PCR amplification, and PCR products were sequenced. Direct
sequencing of PCR products from genomic DNA of heterozygous flies usually
yields an overlay of the DNA sequence from both chromosomes. Indels can
be observed as regions with double peaks in the trace. In the majority of
such regions the sequence of both alleles can be called unambiguously (see
Fig. 4Cand Fig. S4Dfor examples).
Embryo Injections. Embryos were injected using standard procedures (further
details are given in SI Materials and Methods). For the delivery of plasmid
DNA for the production of transgenes with the Phi31C system, 150 ng/μLof
DNA in sterile dH
2
O was injected. ssODNs designed to modify the wls locus
were injected into the posterior region of nos-cas9/+; U6-3-gRNA-wls/+
preblastoderm embryos as a 750-ng/μLsolutionindH
2
O.
ACKNOWLEDGMENTS. We thank C. Alexandre, A. Baena-Lopez, K. Beumer,
D. Carroll, M. Harrison, K. Koles, K. O’Connor-Giles, A. Rodal, J. P. Vincent,
J. Wildonger, and others from the Drosophila genome engineering com-
munity for generously sharing unpublished results and reagents; S. Gratz
for further details of published yHDR experiments; M. Reimao-Pinto and
T. Samuels for help with cloning and genotyping; and S. Aldaz, K. Basler,
J. Bischof, S. Collier, J. Crooker, N. Perrimon, K. Röper, D. Stern, and R. Yagi for
additional reagents. This study was supported by a Marie-Curie IntraEuro-
pean Fellowship (to F.P.), the Swiss National Science Foundation (to F.P.),
Howard Hughes Medical Institute (H.-M.C. and T.L.), and by UK Medical Re-
search Council Project U105178790 (S.L.B.).
Port et al. PNAS
|
Published online July 7, 2014
|
E2975
GENETICS PNAS PLUS

1. Carroll D (2014) Genome engineering with targetable nucleases. Annu Rev Biochem
2(83):409–439.
2. Wyman C, Kanaar R (2006) DNA double-strand break repair: all’s well that ends well.
Annu Rev Genet 40:363–383.
3. Jinek M, et al. (2012) A programmable dual-RNA-guided DNA endonuclease in
adaptive bacterial immunity. Science 337(6096):816–821.
4. Sternberg SH, Redding S, Jinek M, Greene EC, Doudna JA (2014) DNA interrogation
by the CRISPR RNA-guided endonuclease Cas9. Nature 507(7490):62–67.
5. Gratz SJ, et al. (2013) Genome engineering of Drosophila with the CRISPR RNA-guided
Cas9 nuclease. Genetics 194(4):1029–1035.
6. Bassett AR, Tibbit C, Ponting CP, Liu J-L (2013) Highly efficient targeted mutagenesis
of Drosophila with the CRISPR/Cas9 system. Cell Reports 4(1):220–228.
7. Yu Z, et al. (2013) Highly efficient genome modifications mediated by CRISPR/Cas9 in
Drosophila.Genetics 195(1):289–291.
8. Kondo S, Ueda R (2013) Highly improved gene targeting by germline-specific Cas9
expression in Drosophila.Genetics 195(3):715–721.
9. Sebo ZL, Lee HB, Peng Y, Guo Y (2014) A simplified and efficient germline-specific
CRISPR/Cas9 system for Drosophila genomic engineering. Fly (Austin) 8(1):52–57.
10. Ren X, et al. (2013) Optimized gene editing technology for Drosophila melanogaster
using germ line-specific Cas9. Proc Natl Acad Sci USA 110(47):19012–19017.
11. Gratz SJ, et al. (2014) Highly specific and efficient CRISPR/Cas9-catalyzed homology-
directed repair in Drosophila.Genetics 196(4):961–971.
12. Yu Z, et al. (2014) Various applications of TALEN- and CRISPR/Cas9-mediated ho-
mologous recombination to modify the Drosophila genome. Biol Open 3(4):271–280.
13. Mali P, et al. (2013) RNA-guided human genome engineering via Cas9. Science
339(6121):823–826.
14. Jinek M, et al. (2013) RNA-programmed genome editing in human cells. eLife 2:
e00471.
15. Van Doren M, Williamson AL, Lehmann R (1998) Regulation of zygotic gene expres-
sion in Drosophila primordial germ cells. Curr Biol 8(4):243–246.
16. Brand AH, Perrimon N (1993) Targeted gene expression as a means of altering cell
fates and generating dominant phenotypes. Development 118(2):401–415.
17. Pfeiffer BD, Truman JW, Rubin GM (2012) Using translational enhancers to increase
transgene expression in Drosophila.Proc Natl Acad Sci USA 109(17):6626–6631.
18. Groth AC, Fish M, Nusse R, Calos MP (2004) Construction of transgenic Drosophila by
using the site-specific integrase from phage phiC31. Genetics 166(4):1775–1782.
19. Bischof J, Maeda RK, Hediger M, Karch F, Basler K (2007) An optimized transgenesis
system for Drosophila using germ-line-specific phiC31 integrases. Proc Natl Acad Sci
USA 104(9):3312–3317.
20. Wang H, et al. (2013) One-step generation of mice carrying mutations in multiple
genes by CRISPR/Cas-mediated genome engineering. Cell 153(4):910–918.
21. Mal i P, et al. (2013) CAS9 trans criptional activators fo r target specificity scree ning
and paired nickases for co operative genome engineer ing. Nat Biotechnol 31(9):
833–838.
22. Ran FA, et al. (2013) Double nicking by RNA-guided CRISPR Cas9 for enhanced ge-
nome editing specificity. Cell 154(6):1380–1389.
23. Grönke S, Bickmeyer I, Wunderlich R, Jäckle H, Kühnlein RP (2009) Curled encodes the
Drosophila homolog of the vertebrate circadian deadenylase Nocturnin. Genetics
183(1):219–232.
24. Nüsslein-Volhard C, Wieschaus E (1980) Mutations affecting segment number and
polarity in Drosophila.Nature 287(5785):795–801.
25. Bänziger C, et al. (2006) Wntless, a conserved membrane protein dedicated to the
secretion of Wnt proteins from signaling cells. Cell 125(3):509–522.
26. Bartscherer K, Pelte N, Ingelfinger D, Boutros M (2006) Secretion of Wnt ligands re-
quires Evi, a conserved transmembrane protein. Cell 125(3):523–533.
27. Baena-Lopez LA, Alexandre C, Mitchell A, Pasakarnis L, Vincent J-P (2013) Accelerated
homologous recombination and subsequent genome modification in Drosophila.
Development 140(23):4818–4825.
28. Rong YS, Golic KG (2000) Gene targeting by homologous recombination in Dro-
sophila.Science 288(5473):2013–2018.
29. Beumer KJ, et al. (2008) Efficient gene targeting in Drosophila by direct embryo in-
jection with zinc-finger nucleases. Proc Natl Acad Sci USA 105(50):19821–19826.
30. Beumer KJ, et al. (2013) Comparing zinc finger nucleases and transcription acti-
vator-like effector nucleases for gene targeting in Drosophila. G3 (Bethesda) 3(10):
1717–1725.
31. Wolfner MF, Goldberg ML (1994) Harnessing the power of Drosophila genetics.
Methods Cell Biol 44:33–80.
32. Port F, et al. (2008) Wingless secretion promotes and requires retromer-dependent
cycling of Wntless. Nat Cell Biol 10(2):178–185.
33. Brook WJ, Cohen SM (1996) Antagonistic interactions between wingless and decap-
entaplegic responsible for dorsal-ventral pattern in the Drosophila Leg. Science
273(5280):1373–1377.
34. Bischof J, Basler K (2008) Recombinases and their use in gene activation, gene in-
activation, and transgenesis. Methods Mol Biol 420:175–195.
35. Ma Y, Creanga A, Lum L, Beachy PA (2006) Prevalence of off-target effects in Dro-
sophila RNA interference screens. Nature 443(7109):359–363.
36. Fu Y, et al. (2013) High-frequency off-target mutagenesis induced by CRISPR-Cas
nucleases in human cells. Nat Biotechnol 31(9):822–826.
37. Pattanayak V, et al. (2013) High-throughput profiling of off-target DNA cleavage
reveals RNA-programmed Cas9 nuclease specificity. Nat Biotechnol 31(9):839–843.
38. Fu Y, Sander JD, Reyon D, Cascio VM, Joung JK (2014) Improving CRISPR-Cas nuclease
specificity using truncated guide RNAs. Nat Biotechnol 32(3):279–284.
E2976
|
www.pnas.org/cgi/doi/10.1073/pnas.1405500111 Port et al.

Supporting Information
Port et al. 10.1073/pnas.1405500111
SI Materials and Methods
Cas9 Expression Plasmids. act-cas9.The plasmid pUASTattB (a gift
from Konrad Basler, University of Zurich, Zurich) was cut with
HindIII and EcoRI to remove the UAST-hsp70 cassette. The
act5c 5′regulatory region was amplified with primers act5c fwd/
rev from pAct5c >CD2 >Gal4 (a gift from Silvia Aldaz, Medical
Research Council Laboratory of Molecular Biology, Cambridge,
United Kingdom) and cloned into the open backbone from the
previous step, creating pAct5cattB.pAct5cattB was cut with EcoRI
and XhoI, followed by insertion of a human codon-optimized
Cas9 coding sequence including a nuclear localization signal that
was amplified from Addgene plasmid 41815 (1) using primers
hCas9Add41815 fwd/rev. The resulting plasmid was termed
“pAct5c-cas9.”
act-cas9
D10A
.To create a nickase version of Cas9, aspartic acid 10 in
one of the active sites was mutated to alanine (2). Cas9
D10A
was
amplified from pAct5c-cas9 with primers act-cas9nick fwd/rev.
The forward primer introduced the point mutation into the PCR
product, which was inserted into pAct5c-cas9 that had been di-
gested with EcoRI.
nos-cas9.The plasmid pUASTattB was cut with BamHI to remove
the UAST-hsp70-SV40 3′UTR cassette. The nos regulatory re-
gions were amplified with primers nosProm fwd/rev and nos3′
fwd/rev from pNos-PhiC31 (a gift from Konrad Basler). The
Cas9 coding sequence with an SV40 nuclear localization signal
was amplified from plasmid Addgene 41815 (1) using primers
hCas9Add41815 fwd2/rev2. The final plasmid was assembled in
a four-fragment Gibson reaction to yield pnos-cas9.
nos-cas9:GFP.The plasmid was created in the same way as pnos-
cas9, except that the Cas9 coding region fused to a sequence
encoding GFP and two nuclear localization signals was amplified
from Addgene plasmid 42234 [which contains a different human
codon optimized version to plasmid 41815 (3)] with primers
hCas9Add42234 fwd/rev.
UAS-cas9 (for CFD3 and 4).The coding sequence of Streptococcus
pyogenes Cas9 was codon-optimized for expression in Drosophila
using the online tool from Integrated DNA Technologies (IDT),
followed by addition of sequence coding for the nuclear locali-
zation signal of the Drosophila UDE1 protein (4) to the 3′end.
The DNA sequence was ordered as gBlocks from IDT with 30-
bp overlapping homologies between fragments and was con-
structed by Gibson assembly. The cas9 sequence was amplified
from the assembled gBlocks using primers DmCas9pJFRC81 fwd/
rev and cloned into the KpnI/XbaI site of pJFRC81 (Addgene
36432) (5) using conventional T4 DNA ligase-mediated cloning.
The sequence provided by pJFRC81 includes the 3′UTR from
the Autographa californica nuclear polyhedrosis virus p10 gene,
which acts as a strong translational enhancer.
UAS-cas9 (for CFD5 and 6).ADrosophila codon-optimized cas9 with
N- and C-terminal nuclear localization signal was cloned into
pJFRC28 (Addgene 36431) (5), using the KpnI and XbaI re-
striction sites. The Cas9 cDNA was a gift from Justin Crocker
(David Stern laboratory, Howard Hughes Medical Institute, Janelia
Farm Research Campus, Ashburn, VA).
Guide RNA Expression Plasmids. The sequence encoding the three
Drosophila U6 genes (based on Flybase release FB2013_04) with
the U6 RNA sequences replaced by guide RNA (gRNA) core
sequences (Table S5) was synthesized by IDT. The sequence
starts with 5′-ATTTTCAACGTCCTCGATAG and ends with
TTCGCTTAATGCGTATGCAT-3′. This construct is referred
to as “3xU6-gRNA”and served as the PCR template for the
cloning of the individual gRNA expression plasmids. The back-
bone of the individual pCFD gRNA vectors, containing an attB
site, a vermilion eye pigmentation marker, and an Ampicillin
resistance gene, was PCR amplified from pValium22 (a gift from
Norbert Perrimon, Harvard University, Cambridge, MA) using
primers pCFDbackbone fwd/rev.
pCFD1, 2, and 3. pCDF1,pCFD2, and pCFD3 contain, respectively,
the U6:1,U6:2, and U6:3 promoters. Each promoter was am-
plified from the 3xU6-gRNA construct using a specific U6 prom
fwd/rev primer pair. These promoter sequences were assembled
together with the gRNA core and genomic 3′region amplified
from the 3xU6-gRNA construct with gRNAterm fwd/rev and the
pCFD backbone.
pCFD4. The double gRNA vector was produced by amplifying a
BbsI spacer-gRNA-U6-3 promoter fragment from the 3xU6-gRNA
construct using pCFD4 fwd/rev primers and cloning it into
pCFD1 that had been digested with BbsI.
pCFD1–3allow cloning of annealed complementary oligo-
nucleotides into the BbsI-digested backbone using standard
procedures to produce the following 5′-to-3′configuration:
U6 promoter-gRNA target sequence-gRNA core sequence. Two
gRNA target sites can be introduced into pCDF4 by a simple
PCR-based method. Cloning procedures for pCFD1–4are docu-
mented in further detail in Fig. S3. The four gRNA expression
vectors, together with their sequences, are available at www.
addgene.org (pCDF1, Addgene no. 49408; pCDF2, Addgene
no. 49409, pCDF3, Addgene no.49410; pCDF4, Addgene no.
49411). Most gRNA target sites used in this study were cloned
into earlier versions of the pCFD backbone containing a white
marker gene using Gibson assembly, except for gRNA-e gRNA-cu
and gRNA-y
offset
, which were generated in pCFD4. We confirmed
that gRNA plasmids containing white or vermilion marker genes
function with comparable efficiency.
gRNA Design. Target sites were designed so that they direct Cas9-
mediated cleavage to the 5′end of the coding sequence, except
for gRNA-wg
P1–3
, which targets the promoter. To reduce the risk
of off-target cleavage, target sites were chosen that do not have
highly homologous sites elsewhere in the genome. Off-target
potential was assessed using CRISPR target finder (http://tools.
flycrispr.molbio.wisc.edu/targetFinder/) (6) or E-CRISPR (www.
e-crisp.org/E-CRISP/) (7). Because a 5′guanine is required for
transcription from U6 promoters, target sites that lack this fea-
ture were extended in the 5′direction by a single guanine. The 5′
extensions do not appear to affect gRNA function (8).
Wg::GFP Donor Plasmid Production. The 5′and 3′homology arms
were PCR amplified from genomic DNA from nos-cas9 flies
using primers wgGFP5′fwd, wgGFP5′rev, wgGFP3′fwd, and
wgGFP3′rev. The eGFP coding sequence flanked by sequences
coding for short linker peptides from Ig G2 were amplified from
an eGFP-containing plasmid (S.L.B. laboratory stock) using
primers wgGFPGFPfwd and wgGFPGFPrev. The sequences of
all primers as well as the sequence encoding the linkers can be
found in Table S5. All fragments were assembled by Gibson
assembly into pBluescript SK-(+) (Stratagene) that was digested
with XhoI and NotI.
Fly Transgenesis and Culture. Transgenic lines were generated by
standard PhiC31-integrase–mediated transformation using in-
jected DNA constructs (9). The attP integration sites used for
different experiments are documented in Tables S1 and S2.
Port et al. www.pnas.org/cgi/content/short/1405500111 1of10

Other stocks used and their sources are listed in Table S6. All
crosses were performed at 25 °C with 50 ±5% relative humidity
and a 12-h light/dark cycle.
Embryo Injections. Embryos were collected on apple juice plates
for 30 min at 25 °C, briefly rinsed with tap water, and dechor-
ionated for 60 s in 6% sodium hypochlorite. After extensive
washing with tap water, embryos were lined up on apple agar
plates with a paintbrush, transferred to a coverslip coated in
heptane glue, and desiccated for 5–8 min in a box containing
silica gel. Embryos were covered in Voltalef 10S oil (VWR
International) and transferred to a Nikon Eclipse microscope
equipped with a manual micromanipulator (Narishige). DNA
was microinjected in the proximity of the posterior pole of em-
bryos using a heat-pulled glass needle (Microcaps, Drummond)
attached to an air-filled 20-mL syringe. All injections were per-
formed at 22 ±1 °C, with typically 50–100 embryos injected 45–
60 min after egg-laying. For the delivery of plasmid DNA for the
production of transgenes, 150 ng/μL of DNA in sterile dH
2
O was
injected. Single-stranded oligonucleotides designed to modify
the wntless (wls)orebony (e) locus (ordered as 4-nM Ultramers
from IDT) were injected into the posterior region of nos-cas9/+;
U6:3-gRNA-wls/+or act-cas9/+; U6-3-gRNA-e/+embryos, re-
spectively, as a 750-ng/μL or 500-ng/μL solution of DNA in
dH
2
O. Plasmid DNA that acts as a donor template for homologous
recombination-mediated integration of eGFP into the wg locus
was injected at a concentration of 750 ng/μL into nos-cas9/+;
U6:3-gRNA-wg/+embryos. After injection of plasmids or oligo-
nucleotides, embryos were transferred on their coverslips to
a plastic box containing wet paper towel at 25 °C until they
hatched as larvae. Larvae were collected with forceps and trans-
ferred to a food vial with fresh yeast, followed by culture at 25 °C.
Immunohistochemistry and Visualization of GFP Fluorescence. Wing
imaginal discs from third-instar larvae were dissected in chilled
PBS. Fixation was performed in 4% paraformaldehyde in PBS
containing 0.3% Triton-X100 (PBT) for 25 min at room tem-
perature. After three washings with PBT, discs were incubated
overnight at 4 °C with primary antibodies diluted in PBT.
Imaginal discs subsequently were washed three times with PBT
containing 1% heat-inactivated goat serum for at least 1 h, fol-
lowed by incubation in secondary antibodies diluted in PBT for
2 h at room temperature. Samples were washed three times in
PBT and mounted in Vectashield medium containing DAPI
(Vector Laboratories). Antibodies used were polyclonal rabbit
anti-Wntless (anti-Wls) (1:1,000) (10), monoclonal mouse anti-
Wingless (anti-Wg) (4D4; 1:50; Developmental Studies Hybrid-
oma Bank), Alexa Fluor 488 goat anti-mouse (1:400; Invitrogen)
and Alexa Fluor 555 goat anti-rabbit (1:400; Invitrogen). Discs
were prepared for visualization of Wg::GFP fluorescence by
fixation in 4% paraformaldehyde for 25 min, followed by three
washes for 5 min each in PBT and mounting in Vectashield.
Drosophila embryos were collected on apple agar plates and
dechorionated for 90 s in 6% sodium hypochlorite. They were
fixed for 20 min at room temperature on an orbital shaker in
glass vials containing 2 mL n-heptane and 1 mL 4% para-
formaldehyde (in PBS) that had been mixed and allowed to
phase separate. The paraformaldehyde subsequently was re-
placed with 3 mL methanol, and the vitelline membrane was
removed by vigorous shaking. Embryos were rinsed three times
in methanol, resuspended in PBT, and immunostained following
the protocol used for wing imaginal discs.
Cuticle Preparations. Drosophila embryos were dechorionated as
describe above and transferred to glass vials containing 2 mL
n-heptane and 3 mL methanol that had been mixed and allowed
to phase separate. The vitelline membrane then was removed by
vigorous shaking. Embryos were washed with methanol and
transferred to microscope slides. Excess methanol was removed,
and embryos were covered in Hoyer’s solution. Slides were in-
cubated for at least 2 h at 60 °C before imaging.
Image Acquisition. Images of whole flies were captured on a Canon
550D digital camera equipped with a Canon 50-mm f1.8 lens
mounted on a Leica MZFLIII stereomicroscope. Manual settings
were used throughout, and the lighting was kept constant during
image acquisition. Flies presented within the same figure were
imaged on the same day. Before imaging, flies were incubated
overnight in 20% glycerol/80% ethanol and on the next day were
mounted in 100% glycerol. Adult wings were mounted in 100%
glycerol and imaged on a Zeiss Axioplan microscope equipped
with a CoolSnap HQ2 camera (Photometrics). Fluorescent images
of wing imaginal discs and embryos were acquired on a Zeiss
LSM710 or LSM780 confocal microscope using the sequential
scanning mode and a 40×/1.3 NA oil or 20×/0.5 NA air objective.
1. Mali P, et al. (2013) RNA-guided human genome engineering via Cas9. Science
339(6121):823–826.
2. Jinek M, et al. (2012) A programmable dual-RNA-guided DNA endonuclease in
adaptive bacterial immunity. Science 337(6096):816–821.
3. Jinek M, et al. (2013) RNA-programmed genome editing in human cells. eLife 2:e00471.
4. Merényi G, Kónya E, Vértessy BG (2010) Drosophila proteins involved in metabolism
of uracil-DNA possess different types of nuclear localization signals. FEBS J 277(9):
2142–2156.
5. Pfeiffer BD, Truman JW, Rubin GM (2012) Using translational enhancers to increase
transgene expression in Drosophila.Proc Natl Acad Sci USA 109(17):6626–6631.
6. Gratz SJ, et al. (2014) Highly specific and efficient CRISPR/Cas9-catalyzed homology-
directed repair in Drosophila.Genetics 196(4):961–971.
7. Heigwer F, Kerr G, Boutros M (2014) E-CRISP: Fast CRISPR target site identification. Nat
Methods 11(2):122–123.
8. Ran FA, et al. (2013) Double nicking by RNA-guided CRISPR Cas9 for enhanced
genome editing specificity. Cell 154(6):1380–1389.
9. Bischof J, Maeda RK, Hediger M, Karch F, Basler K (2007) An optimized transgenesis
system for Drosophila using germ-line-specific phiC31 integrases. Proc Natl Acad Sci
USA 104(9):3312–3317.
10. Port F, et al. (2008) Wingless secretion promotes and requires retromer-dependent
cycling of Wntless. Nat Cell Biol 10(2):178–185.
11. Fu Y, Sander JD, Reyon D, Cascio VM, Joung JK (2014) Improving CRISPR-Cas nuclease
specificity using truncated guide RNAs. Nat Biotechnol 32(3):279–284.
12. Neumann CJ, Cohen SM (1997) Long-range action of Wingless organizes the dorsal-
ventral axis of the Drosophila wing. Development 124(4):871–880.
13. Baena-Lopez LA, Alexandre C, Mitchell A, Pasakarnis L, Vincent J-P (2013) Accelerated
homologous recombination and subsequent genome modification in Drosophila.
Development 140(23):4818–4825.
Port et al. www.pnas.org/cgi/content/short/1405500111 2of10

cas9
♀♂U6:3-gRNA-e, e+
U6:3-gRNA-e, e+
♀cas9
;;
+♂
For details of the various
cas9 transgenes and strains
please refer to Table S1
and Table S3.
Phenotypes of cas9/
gRNA expressing flies
are presented in Fig. 1B.
♀♂progeny screened for presence of e homozygous mutant phenotype (i.e. eCRISPR LOF / e-)
(data presented in Fig. 1D and Table S4).
and
;; e+
e+
cas9
U6:3-gRNA-e, e*
e*
e-
e-
Chr 1 Chr 3 Chr 3
Chr 1 Chr 3 Chr 3
Fig. S1. General crossing scheme used to compare the efficiency of various cas9 strains in the soma and germ line. Only relevant genetic elements are shown
(full genotypes of cas9 and gRNA strains are listed in Table S3). Note that some cas9 transgenes are located on the third chromosome along with a wild-type
eallele. A similar crossing scheme was followed to assess targeting of the ygene (i.e., flies containing the cas9 and U6:3-gRNA-y transgenes were crossed to a
ymutant strain). Chr, chromosome; CRISPR-LOF, loss-of-function CRISPR allele.
nos-cas9 U6:3-gRNA-y
Fig. S2. Further evidence that the nos-cas9 transgene lacks detectable activity when crossed to U6:3-gRNA-y.Anos-cas9 U6:3-gRNA-y male is shown that
inherited a single, wild-type yallele. No yellow cuticle is observed, indicating that this allele is not mutated in cells giving rise to cuticle.
Port et al. www.pnas.org/cgi/content/short/1405500111 3of10

Fig. S3. Cloning strategies to introduce gRNA target sites into pCFD vectors. (A–C) Plasmids pCFD1 (A), pCFD2 (B), and pCFD3 (C) contain two inverted type-IIS
BbsI restriction sites to allow seamless cloning of target sites. The BbsI cassette can be replaced by the desired target sequence by digesting the plasmid
backbone with BbsI and ligating the linear backbone to annealed oligonucleotides with compatible ends (schematized below each cloning site). The G in bold
is the first nucleotide that is transcribed and is necessary for transcription from U6 promoters. If the target site has a 5′G, then the target sequence to be
introduced will be 19 nt long; otherwise, the target sequence will be 20 nt long. There is evidence from mammalian cells that shorter target sequences can be
tolerated and can increase the specificity of CRISPR/Cas (11). Note that the BbsI cassette in pCFD2 (B) is truncated by 1 bp, making it necessary to add a 3′
cytosine to the bottom-strand oligonucleotide. (D) Cloning strategy to introduce two target sites into the tandem gRNA vector pCFD4. Target sites are in-
corporated into the forward and reverse primers, which also contain 3′homology to the pCFD4 backbone to allow PCR amplification, and 5′homology to the
pCFD4 backbone to allow homology-directed cloning. PCR products are cloned into the BbsI-digested pCFD4 backbone by homology-directed cloning (e.g.,
Gibson assembly).
Port et al. www.pnas.org/cgi/content/short/1405500111 4of10

Fig. S4. Efficient incorporation of an exogenous sequence by homology-directed repair (HDR) into the elocus following Cas9-induced DSBs. (A) Schematic of
the donor DNA in relation to the gRNA target site at the elocus. The donor was a single-stranded oligonucleotide with 60-nt homology to the target locus at
either side of the Cas9 cut site and an 11-nt insert (lowercase). This insert introduces an in-frame stop codon (TAA) and a BglII restriction site. The locations of
the primers used for the genotyping PCR in Bare shown below the schematic of the genomic locus. Donor DNA was injected into embryos that were the
progeny of act-cas9 females and U6:3-gRNA-e males. (B) Successful integration of the donor construct could be detected in the offspring of injected embryos by
BglII digestion of PCR products. Agarose gel showing pattern observed in the absence (−) and presence (+) of the HDR. The 700-nt fragment present in both
samples is derived from the wild-type elocus transmitted by the other parent. (C) Summary of results from screening flies for HDR events by PCR and restriction
digest. Note that flies that developed from injected embryos were selected at random, i.e., without consideration for their pigmentation phenotype.(D)
Sequence verification of the precise integration of the donor DNA in the elocus by direct sequencing of a PCR product amplified from a heterozygous fly that
tested positive by BglII restriction digest. Double peaks in the chromatogram represent an overlay of the sequence of the mutant and wild-type ealleles.
Port et al. www.pnas.org/cgi/content/short/1405500111 5of10

Fig. S5. Efficient integration of a GFP tag into the endogenous wg locus by homologous recombination (HR) using nos-cas9 and U6:3-gRNA-wg.(A) Schematic
of the donor plasmid, wg locus, and gRNA-wg target sequence. The donor is designed to introduce an eGFP-coding sequence flanked on either side by se-
quences coding for a short linker peptide from IgG into the first coding exon of wg. The exogenous sequence is flanked by homology arms of 1.4 kb (5′
homology) and 1.7 kb (3′homology). The 5′homology arm contains a synonymous mutation that removes the protospacer-adjacent motif (PAM) sequence for
gRNA-wg to prevent mutagenesis after the integration of donor-derived sequences. The circular donor plasmid was injected into nos-cas9 U6:3-gRNA-wg
embryos. (B) Injected animals were crossed to a balancer strain, and offspring were screened at the third-instar larval stage for the appearance of green
fluorescence in dissected imaginal discs. All six injected animals tested gave rise to GFP
+
offspring, with 17 of the 45 larvae examined showing GFP expression.
In all cases GFP expression was restricted to the Wg-expression domain. In the six crosses, two of nine larvae, six of 11 larvae, three of five larvae, one of five
larvae, three of eight larvae, and two of seven larvae were GFP
+
.(Cand D) Images showing examples of GFP
+
imaginal discs. Each image is a single confocal
section. (C) Low-magnification image showing GFP fluorescence in the Wg expression domains of a wing (WD), leg (LD), and part of a haltere (HD) imaginal
disc. (Scale bar: 150 μm.) (D) A high-magnification view of GFP fluorescence at the dorsal–ventral boundary of a wing imaginal disc. In addition to strong signal
from a stripe of three to four cells, punctate signal is found more distally from this site. This pattern is reminiscent of that observed when endogenousWg
protein is detected using a specific anti-Wg antibody (12). (Scale bar: 50 μm.) (E) Diagnostic PCR to test for ends-out HR of the donor plasmid in offspring of nos-
cas9 U6:3-gRNA-wg embryos injected with the Wg::GFP donor plasmid. After examination of GFP fluorescence in imaginal discs, genomic DNA was extracted
from the remaining material of 10 of the dissected larvae. Five of these larvae had GFP
+
imaginal discs, and five had GFP
−
discs. DNA also was extracted from
anos-cas9 larva, which served as a negative control. PCRs were performed using the primers indicated in the schematic. Note that primers rev1 and fwd2 do not
anneal to the wild-type wg locus. Primers fwd1 and rev2 are located outside the homology arms and thus do not anneal to sequences in the donor plasmid. All
larva with GFP
+
discs tested positive for integration of the GFP sequence at the wg locus; the presence of the 4-kb band from all these larvae using fwd1 and
rev2 primers demonstrates ends-out targeting (i.e., in which the plasmid backbone is not incorporated) of one of the alleles. One of the GFP
−
larvae yielded
a much shorter band with primers fwd1 and rev2, suggesting a large (∼1 kb) CRISPR/Cas-induced deletion. This product presumably amplified more efficiently
than the product from the wild-type allele because of its relatively small size.
Port et al. www.pnas.org/cgi/content/short/1405500111 6of10

A
WgDAPI merge
A’ A’’
Fig. S6. Mutations at the gRNA-wg target site can relocate Wg to the nucleus. A high-magnification view of a third-instar wing imaginal disc from a cas9
gRNA-wg–expressing animal is shown. A presumptive clone of cells with Wg (Wg protein in magenta in A′and A″) mislocalized to the nucleus (DNA in blue in A
and A″) is shown (solid arrowhead) next to tissue that retains wild-type Wg localization (open arrowhead). This image is from a different animal from the one
shown in Fig. 5C. (Scale bar: 20 μm.)
Table S1. Transgenic Cas9 lines used in this study
Name Promoter/3′UTR
Cas9 coding
sequence*
,†
Integration site of cas9
construct (chromosome) Stock numbers
Stocks generated in this study. (www.crisprflydesign.org)
act-cas9 act5C/SV40 Hs_Cas9 (Addgene: 41815) attP-ZH2a (X) CFD1 BL:54590 VDRC: 300000
act-cas9
D10A
act5C/SV40 Hs_Cas9 (Addgene: 41815) attP2 (3L) VDRC: 300008
nos-cas9:GFP nos/nos
‡
Hs_Cas9:GFP (Addgene: 42234) attP-ZH2a (X) N/A
nosG4VP16 UAS-cas9
§
nos(Gal4/UAS)/p10 Dm-Cas9 attP2 (3L) CFD3_nos BL: 54593 VDRC: 300003
nos-cas9 nos/nos
‡
Hs_Cas9 (Addgene:41815) attP-ZH2a (X) CFD2 BL:54591 VDRC: 300001
UAS-cas9 UAS/p10 Dm_Cas9
{
attP2 (3L) CFD3 BL: 54592 VDRC: 300002
UAS-cas9 UAS/p10 Dm_Cas9
{
attP2 (3L) CFD5 BL: 54595 VDRC: 300005
Stocks generated by O’Connor-Giles, Harrison, and Wildonger laboratories (www.flycrispr.molbio.wisc.edu)(6)
vasa-cas9 vasa/vasa
‡
Hs_Cas9 (Addgene:42230) attP-ZH2a (X) BL:51323
vasa-cas9 vasa/vasa
‡
Hs_Cas9 (Addgene:42230) attP-VK00027 (3R) BL:51324
act,actin5C; BL, Bloomington Drosophila Stock Center; Dm, Drosophila melanogaster;Hs,Homo sapiens; N/A, not applicable; nos,nanos; VDRC, Vienna
Drosophila RNAi Center.
*Species refers to codon optimization; all constructs express Streptococcus pyogenes Cas9 protein.
†
cas9 constructs contain different nuclear localization signals (NLS): Hs_Cas9 (Addgene: 41815) contains a single SV40 NLS; Hs_Cas9 (Addgene: 42234) contains
two NLS based on the SV40 NLS; Dm_Cas9 has one Ude1 NLS (4).
‡
nos and vasa 3′UTRs are designed to target protein synthesis to the germ cells.
§
UAS-cas9 from strain CFD3.
{
Lines CFD3 and CFD5 have different codon optimization.
Table S2. Transgenic gRNA lines used in this study
gRNA line Integration site
U6:3-gRNA-y* attP2
U6:1-gRNA-y
†
attP40
U6:2-gRNA-y
†
attP40
U6:3-gRNA-y
†
attP40
U6:3-gRNA-e attP2
U6:3-gRNA-wls attP40
U6:3-gRNA-wg attP40
U6:1-U6:2-U6:3-gRNA-wg
P1–3
attP2
U6:1-gRNA-e U6:3-gRNA-cu attP2
*Used to target yin Fig. 1.
†
Used to target yin Fig. 2.
Port et al. www.pnas.org/cgi/content/short/1405500111 7of10

Table S3. Crosses comparing various Cas9 lines in Fig. 1
Virgin females Males*
WT yalleles in F1
females/ males
WT ealleles in F1
females/ males
Expected frequency of
y[-] flies in F2
†
,%
y[1] act-cas9
ZH-2A
w f;;U6:3-gRNA
attP2, y+
2/1 2/2 25
y[1] vasa-cas9
ZH-2A
w f;;U6:3-gRNA
attP2, y+
2/1 2/2 25
w;; vasa-cas9
VK00027, y+
w f;;U6:3-gRNA
attP2, y+
4/3 2/2 0
y[1] nos-cas9:GFP
ZH-2A
w f;;U6:3-gRNA
attP2, y+
2/1 2/2 25
y[1];; UAS-cas9
attP2, y+
nos-Gal4::VP16 w f;;U6:3-gRNA
attP2, y+
3/2 2/2 0
y[1] nos-cas9
ZH-2A
w f;;U6:3-gRNA
attP2, y+
2/1 2/2 25
*gRNA transgenes contain either the yor etarget site (see Table S5 for sequences).
†
In the absence of CRISPR/Cas mutagenesis. Note that no emutant animals are expected in the gRNA-e experiments without CRISPR/Cas mutagenesis.
Table S4. Collated results of experiments assessing germ-line transmission of loss-of-function mutations in eand yusing fully
transgenic CRISPR/Cas
Cas9 line % founders* (#)
% phenotypically mutant
offspring per cross, mean ±SEM
No. of phenotypically
mutant offspring (total)
Targeting ewith cas9 and U6:3-gRNA-e (data presented in Fig. 1D)
act-cas9 100 (10/10) 54 ±3
†
613 (1,116)
†
vasa-cas9 on X 100 (9/9) 52 ±4
†
534 (1,002)
†
vasa-cas9 on 3 100 (9/9) 48 ±3
†
627 (1,379)
†
nos-cas9:GFP 100 (10/10) 42 ±3
†
611 (1,409)
†
nosG4VP16 UAS-cas9 100 (9/9) 46 ±6
†
426 (887)
†
nos-cas9 100 (8/8) 26 ±3
†
290 (1,109)
†
Targeting ywith cas9 and U6:3-gRNA-y (data presented in Fig. 1E)
act-cas9 100 (10/10) 99 ±0.4
‡
762 (767)
vasa-cas9 on X 100 (5/5) 100 ±0
‡
149 (149)
vasa-cas9 on 3 100 (10/10) 86 ±2
‡
670 (779)
nos-cas9:GFP 100 (10/10) 71 ±3
‡
612 (781)
nosG4VP16 UAS-cas9 100 (4/4) 83 ±7
‡
244 (315)
nos-cas9 100 (7/7) 76 ±6
‡
299 (368)
Comparing U6 promoters driving gRNA-y with nos-cas9 (data presented in Fig. 2C)
U6 promoter
§
U6:1 100 (3/3) 69 ±1
‡
278 (359)
U6:2 100 (3/3) 41 ±3
‡
351 (595)
U6:3 100 (3/3) 99 ±0.3
‡
410 (412)
*Founders are defined as those flies that transmitted nonfunctional alleles to the next generation.
†
Phenotypic screening for emutant alleles does not account for in-frame mutations at the gRNA-e target site that do not disrupt gene function.
‡
Data are normalized to account for phenotypically yellow mutant offspring that arise because of the genetic background (Materials and Methods).
§
U6-gRNA-y constructs are inserted at attP40 in this experiment; U6:3-gRNA-y is inserted at attP2 in the data presented in Fig. 1E.
Port et al. www.pnas.org/cgi/content/short/1405500111 8of10

Table S5. Oligonucleotides and gRNA target sites used in this study
Primers used for cloning (5′–3′)
act5c fwd ATACGAAGTTATGCTAGCGGATCCAAGCTTGCGGCCGCAATTCTATATTC
act5c rev AGCCGCGGCCGCAGATCTGTTAACGAATTCCGGGGATCGATCCTGTAAGC
hCas9Add41815fwd CAGCTTACAGGATCGATCCCCGGGAATTCaccATGGACAAGAAGTACTC
hCas9Add41815rev TCACAAAGATCCTCTAGAGGTACCCTCGAGTCACACCTTCCTCTTCTTCT
act-cas9nickfwd GCAGCTTACAGGATCGATCCCCGGGAATTCACCATGGACAAGAAGTACTCCATTGGGCTCGCTATCG GCACAAACAG
act-cas9nickrev TTAGCGTCGGCGAGGATCACTC
nosPromfwd TATGCTATACGAAGTTATGCTAGCGGATCCAAGCTTCGACCGTTTTAACC
nosPromrev GAGTACTTCTTGTCCATGGCGAAAATCCGGGTCGAAA
nos3′fwd GAAGAGGAAGGTGTGAGCGAATCCAGCTCTGGAGCA
nos3′rev GTGACCTACATCGTCGACACTAGTGGATCCTTCCTGGCCCTTTTCGAGAA
hCas9Add41815fwd2 GACCCGGATTTTCGCCATGGACAAGAAGTACTCCAT
hCas9Add41815rev2 CCAGAGCTGGATTCGCTCACACCTTCCTCTTCTTCT
hCas9Add42234fwd GACCCGGATTTTCGCCATGGACAAGAAGTACAGCAT
hCas9Add42234rev CCAGAGCTGGATTCGCCTACTTGTACAGCTCGTCCA
DmCas9pJFRC81fwd GAGGGTACCAACTTAAAAAAAAAAATCAAAATGGATAAGAAGTATAGCAT
DmCas9pJFRC81rev GTATCTAGATTACTCCTGCTTGCGCTTCT
gRNA core GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT
pCFDbackbonefwd ATAAAATACATTGCATAGATCTGAATTCTATCTAGACTCCCTCGTGCGCTCTCCTG
pCFDbackbonerev GATAGAATTCAGATCTATGCAATGTATTTTATTAAAAACGG
U61promfwd CGTTTTTAATAAAATACATTGCATAGATCTGAATTCATTTTCAACGTCCTCGATAGTA
U61promrev TATTTTAACTTGCTATTTCTAGCTCTAAAACAGGTCTTCTCGAAGACCCCGAAGTTCACCCGGATAT CTT
U62promfwd CGTTTTTAATAAAATACATTGCATAGATCTGAATTCGTTCGACTTGCAGCCTGAAA
U62promrev TTTCTAGCTCTAAAACAGGTCTTCTCGAAGACCCGAAGTATTGAGGAAAACATAC
U63promfwd CGTTTTTAATAAAATACATTGCATAGATCTGAATTCTTTTTTGCTCACCTGTGATTGCTC
U63promrev TATTTTAACTTGCTATTTCTAGCTCTAAAACAGGTCTTCTCGAAGACCCCGACGTTAAATTGAAAAT AGGTCT
gRNAtermfwd GGGTCTTCGAGAAGACCTGTTTTAGAGCTAGAAATAGCA
gRNAtermrev ACACCACAAATATACTGTTGCCGAGCACAATTGTCTAGAATGCATACGCATTAAGCGAAC
pCFD4fwd ATATATAGGAAAGATATCCGGGTGAACTTCGGGGTCTTCGAGAAGACCTGTTTTAGAGCTAGAAATA GCAAG
pCFD4rev TATTTTAACTTGCTATTTCTAGCTCTAAAACAGGTCTTCTCGAAGACCCCGACGTTAAATTGAAAAT AGGTCT
gRNA target sites
gRNA-y target GCGATATAGTTGGAGCCAGC
gRNA-e target GCCACAATTGTCGATCGTCA
gRNA-y offset top CAAGGATCCACCCTTTGTCC
gRNA-y offset bottom TCACCTTGGTGACGCCGTCT
gRNA-wg GCAGCAGTCTCAGCCAAGTCG
gRNA-wls GACCATACTGGAGAACCTGAG
gRNA-wgP
1–3
GCGATCGGATCGGGGATCTC
gRNA-wgP
1–3
GCTGCTGACAAACGCAGAGT
gRNA-wgP
1–3
GCAGCTGCAATGCAGGAGTC
gRNA-cu AGCCGGGGTGCTTAGACCGG
HDR donor
Ebony HDR donor AAAGTATTCCCCACAGTTAATATATCTTCAAGATGGGTTCGCTGCCACAATTGTCGATCGagtaaag atctTCAAGGGTCTGCAGCA
AGACTTCGTGCCTAGAGCTCTGCACCGCATCTTCGAGGAGCAGC
Wls HDR donor AAACCAGTGAGCTCCAAACCTTCGAGCAACCAAGATGTCGGGCACCATACTGGAGAACCTGAGTGCCCGCAAGCTGTCCATA TTGG
TGGCCACTTTGCTGCTCTGCCAGGTGTTGTGCTT
HR donor plasmid
and HR diagnosis
wgGFP5′fwd AGGTCGACGGTATCGATAAGCTTGATATCGCGGAATGCCAAAGTGTGTGGTAAC
wgGFP5′rev CCTTCCGGATTTCTGTTTGCCTTCGACTTGGCTGAGACT
wgGFP3′fwd ATCGCCTCGAAGCCAAAGGGCGCCTCGGTTCGTGCATCCATGTGGTGGTAAGTTCATTGAA
wgGFP3′rev GGAGCTCCACCGCGGTGGCGGCCGCTCTAGGGGCGGTATACGTCAATTGCCGGC
wgGFPGFPfwd CAAGTCGAAGGCAAACAGAAATCCGGAAGGATCGCCTCGAAGCCAAAGGG
wgGFPGFPrev TGCACGAACCGAGGCGCCCTTTGGCTTCGAGGCGATCTTGTACAGCTCGTCCATGCCGAGA
IgG2 linker ATCGCCTCGAAGCCAAAGGGCGCCTCGGTTCGTGCA
wg_genotyping_fwd1 GAAGCGGCCAAGCAATGGATGAGG
wg_genotyping_rev1 CTCGCCCTTGCTCACCATAGATC
wg_genotyping_fwd2 CTCGGCATGGACGAGCTGTACAAG
wg_genotyping_rev2 TCGCTGGGTCCATGTACATGATGGG
Port et al. www.pnas.org/cgi/content/short/1405500111 9of10

Table S6. Additional fly stocks used in this study
Stock Source
Stocks used to generate cas9 lines
y[1] w[67c23] P{y[+t7.7]=nos-phiC31int.NLS}X; P{y[+t7.7]=CaryP}attP2 Gift from Simon Collier, University of Cambridge,
Cambridge, UK
y[1] M{3xP3-RFP.attP}ZH-2A w[*]; M{vas-int.Dm}ZH-102D Bloomington (BL: 24480)
Stocks used to generate gRNA lines
y[1] v[1] P{y[+t7.7]=nos-phiC31int.NLS}X; P{y[+t7.7]=CaryP}attP40 Bloomington (BL: 24709)
y[1] sc[1] v[1] P{y[+t7.7]=nos-phiC31int.NLS}X; P{y[+t7.7]=CaryP}attP2 Bloomington (BL: 25710)
Balancer and marker stocks:
P{ry[+t7.2]=hsFLP}1, y[1] w[1118]; Sp/CyO S.L.B. laboratory stock
P{ry[+t7.2]=hsFLP}1, y[1] w[1118];; MKRS/TM6b e S.L.B. laboratory stock
w[1118];; TM3 e/TM6b e S.L.B. laboratory stock
w[1118], f[1] S.L.B. laboratory stock
Gal4 lines
P{ry[+t7.2]=hsFLP}1, y[1] w[1118]; engrailed-Gal4 tubulin-Gal80
ts
UAS-CD8:GFP/CyO;MKRS/TM6b
Gift from Ryohei Yagi and Konrad Basler, University
of Zurich, Zurich
w[1118];; P{GAL4::VP16-nos.UTR}CG6325
MVD1
Gift from Katja Röper, Medical Research Council
Laboratory of Molecular Biology, Cambridge, UK
Cas9 lines from flyCRISPR
y[1] M{vas-cas9}ZH-2A w[1118]/FM7c Bloomington (BL: 51323)
w[1118]; PBac{y[+mDint2]=vas-cas9}VK00027 Bloomington (BL: 51423)
wg loss-of-function stock used for genetic complementation
w[1118]; wg
TX-Cherry
/CyO Gift from Jean-Paul Vincent, Medical Research Council
National Institute for Medical Research, London (13)
Port et al. www.pnas.org/cgi/content/short/1405500111 10 of 10