ArticlePDF Available

Feeding Effect of an Anabolic Steroid, Nandrolone, on the Male Rat Testis

Authors:

Abstract and Figures

Nandrolone, 19-nortestosterone, is a synthetic androgenic-anabolic steroid promoting muscle growth. Nandrolone is also present in pig meat and sera at non-negligible levels. A number of scientific reports have suggested a positive relationship between incidence of infertility and increased meat consumption in humans. The present study was designed to determine out the effect of feeding nandrolone on the testis of the male reproductive tract. Mixtures of food and nandrolone at different concentrations (0.005 ppm and 0.5 ppm) were supplied to pubertal male rats for 6 weeks. Body weight was recorded every week during the entire experimental period. At the end of the treatment, the testis, epididymis, and epididymal fat were collected and weighted. Sperm numbers in the caudal epididymis were counted. Differential gene or protein expression of steroidogenic enzymes in the testes among experimental groups was determined by semi-quantitative real-time PCR or western blotting analysis, respectively. Histological changes of the testis induced by nandrolone treatment were examined by hematoxylin and eosin staining. Immunohistochemical analysis was employed to detect changes in the localization of steroidogenic enzymes in the testes among experimental animals. There were no significant changes on body, testis, epididymis, and epididymal fat weights among experimental groups. A significant increase of caudal sperm number was found in the 0.5 ppm nandrolone-treated group. Histological examination of the testes noted a high frequency of germ cell sloughing in seminiferous tubules of 0.5 ppm nandrolone-treated rats. Even though transcript levels of -hydroxysteroid dehydrogenase (HSD) I, -HSD4, and -hydroxylase were influenced by nandrolone treatments, protein levels of all molecules examined in the present study were not significantly affected. Immunohistochemical analysis showed no visible changes in the localization of steroidogenic enzymes in the testes among experimental groups. The current study showed that oral intake of nandrolone in male rats for 6 weeks did not cause significant damage to the testis. It is considered that a feeding effect of nandrolone on male fertility would not be remarkable.
Content may be subject to copyright.
1566
INTRODUCTION
Anabolic-androgenic steroids (AAS) are synthetic
analogs of testosterone. Thus, the AAS have structural and
functional similarities with testosterone (Salas-Ramirez et
al., 2008). The AAS promote muscle growth (anabolic
effect) and have masculinizing effects through androgen
receptor and androgen-response element in the target cells,
similarly with testosterone (van Der, 1965). Of AAS,
nandrolone, a.k.a. 19-nortestosterone (C
18
H
26
O
2
), has a
stronger anabolic capacity (about 5 times higher) than
testosterone (Chrousos, 2006). Nandrolone is either
chemically synthesized or naturally found in some
mammals, including human and farm animals (Meyer et al.,
1992; Schwarzenberger et al., 1993; Le Bizec et al., 1999).
Especially, it is well documented that the edible parts of pig
contain significant amount of anabolic steroids, including
nandrolone (van Ginkel et al., 1989; Scarth et al., 2009).
Several researches have reported the presence of
Asian-Aust. J. Anim. Sci.
Vol. 23, No. 12 : 1566 - 1577
December 2010
www.ajas.info
Feeding Effect of an Anabolic Steroid, Nandrolone, on the Male Rat Testis*
Dong-Mok Lee
a
, Taesun Min
1,a
, Inho Choi, Yong-Pil Cheon
2
, Taehoon Chun
3
,
Chang Sik Park
4
and Ki-Ho Lee
5,
**
School of Biotechnology, Yeungnam University, Gyeongsan 712-749, Korea
ABSTRACT :
Nandrolone, 19-nortestosterone, is a synthetic androgenic-anabolic steroid promoting muscle growth. Nandrolone is
also present in pig meat and sera at non-negligible levels. A number of scientific reports have suggested a positive relationship between
incidence of infertility and increased meat consumption in humans. The present study was designed to determine out the effect of
feeding nandrolone on the testis of the male reproductive tract. Mixtures of food and nandrolone at different concentrations (0.005 ppm
and 0.5 ppm) were supplied to pubertal male rats for 6 weeks. Body weight was recorded every week during the entire experimental
period. At the end of the treatment, the testis, epididymis, and epididymal fat were collected and weighted. Sperm numbers in the caudal
epididymis were counted. Differential gene or protein expression of steroidogenic enzymes in the testes among experimental groups was
determined by semi-quantitative real-time PCR or western blotting analysis, respectively. Histological changes of the testis induced by
nandrolone treatment were examined by hematoxylin and eosin staining. Immunohistochemical analysis was employed to detect
changes in the localization of steroidogenic enzymes in the testes among experimental animals. There were no significant changes on
body, testis, epididymis, and epididymal fat weights among experimental groups. A significant increase of caudal s
p
erm number was
found in the 0.5 ppm nandrolone-treated group. Histological examination of the testes noted a high frequency of germ cell sloughing in
seminiferous tubules of 0.5 ppm nandrolone-treated rats. Even though transcript levels of 3β-hydroxysteroid dehydrogenase (HSD) I,
17β-HSD4, and 17α-hydroxylase were influenced by nandrolone treatments, protein levels of all molecules examined in the present
study were not significantly affected. Immunohistochemical analysis showed no visible changes in the localization of steroidogenic
enzymes in the testes among experimental groups. The current study showed that oral intake of nandrolone in male rats for 6 weeks did
not cause significant damage to the testis. It is considered that a feeding effect of nandrolone on male fertility would not be remarkable.
(Key Words : Nandrolone, Testis, Steroidogenic Enzymes, Testosterone, Fertility)
* This work was supported by ARPC (Agricultural R&D Promotion
Center), Ministry for Agriculture, Forestry and Fisheries, Republic o
f
Korea (108089-03-1-SB010) and the National Research Foundation
of Korea (NRF) grants funded by the Korean Government (MEST)
(20100001356 and 201000 16939).
** Corresponding Author : Ki-Ho Lee. Tel: +82-42-259-1643,
Fax: +82-42-259-1649, E-mail: kiholee@eulji.ac.kr
1
National Research Foundation of Korea (NRF), Daejeon 305-350,
Korea.
2
School of Biosciences and Chemistry, Center for NanoBio Applied
Technology, Institute for Basic Sciences, Sungshin Women’s
University, Seoul 136-742, Korea.
3
School of Life Sciences and Biotechnology, Korea University, Seoul
136-701, Korea.
4
Division of Animal Science and Resources, Research Center for
Transgenic Cloned Pig, Chungnam National University, Daejeon 305-
764, Korea.
5
Department of Biochemistry and Molecular Biology and Medical
Sciences Research Institute, College of Medicine, Eulji University,
Daejeon 301-746, Korea.
a
These authors are equally contributed to this work.
Received August 3, 2010; Accepted September 6, 2010
Lee et al. (2010) Asian-Aust. J. Anim. Sci. 23(12):1566-1577
1567
nandrolone-metabolites in human urine after ingestion of
non-castrated boar meat (Pokrywka et al., 2009). These
findings suggest that the intake of pork meat would result in
non-intentional ingestion of exogenous nandrolone.
Nandrolone is frequently used to handle many clinical
symptoms and diseases, such as osteoporosis in men
(Hamdy et al., 1998), HIV-associated muscle wasting
(Cuerda et al., 2005), growth deficiency (Ranke and Bierich,
1986), and anemia associated with chronic kidney failure
(Basaria et al., 2001). In addition, nandrolone is utilized for
testosterone-replacement therapy to treat prostate cancer
and benign prostate hyperplasia (BPH), well known
androgen-dependent diseases, because nandrolone could not
be converted into dihydrotestosterone (DHT), most potent
androgen (Kuhn, 2002). However, despite such therapeutic
beneficial potentials, chronic and unregulated use of
nandrolone result in undesirable outcomes, including
hepatic toxicity (Yu-Yahiro et al., 1989), alternation of
thyroid function (Fortunato et al., 2006), cardiovascular
toxicities (Tseng et al., 1994). Prominent side effects of
nandrolone misuse are also found in the reproduction of
male and female. For examples, prolonged treatment of
nandrolone in the male leads to altered testicular
morphology (Takahashi et al., 2004), a decrease of
testosterone secretion (Bijlsma et al., 1982), and reduction
of sperm quality (Torres-Calleja et al., 2001). In female,
administration of nandrolone causes disruption of estrus
cycle, destruction of follicles in the ovary, morphological
alteration of the uterus, and reduction of reproductive
capacity (Gerez et al., 2005; Mobini Far et al., 2007). It is
suggested that such deleterious effects of nandrolone on the
reproductive tract would be due to a disruption of feedback
regulation on hypothalamic-pituitary-gonadal axis by the
exogenous agent (Karbalay-Doust et al., 2007). Koeva et al.
(2003) have demonstrated that nandrolone treatment results
in a decrease of 3β-hydroxysteroid dehydrogenase
(HSD3B) activity in the testis, leading into a reduction of
testosterone synthesis. However, a detailed mechanism
about how nandrolone affects steroidogenesis in the testis is
largely unknown.
Testosterone is a steroid hormone which plays the most
important role in establishment of male phenotype and
regulation of male reproduction during the development.
Testosterone is mainly synthesized in the Leydig cells and
influences spermatogenesis in the Sertoli cells of the testis.
A number of steroidogenic enzymes are involved in the
production of testosterone, including cytochrome P450 side
chain cleavage (CYP11A1), cytochrome P450 17α-
hydroxylase (CYP17), HSD3B, and 17β-HSD (HSD17B).
Testosterone is metabolized into dihydrotestosterone (DHT)
or 17β-estradiol (E
2
) by the action of 5α-reductase or
cytochrome P450 aromatase (CYP19), respectively. Thus,
any effect on expression and/or function of these enzymes
could affect the production of testosterone and its
metabolites in the testis. As described earlier, nandrolone
could be chemically synthesized and naturally present in
edible parts of pork. Most of published scientific data
demonstrating on the effect of nandrolone on the testis have
been obtained from intramuscular and/or subcutaneous
treatment of nandrolone. However, none of researches has
attempted to evaluate the effect of nandrolone on the testis
via oral ingestion. Interestingly, an increasing number of
recent researches have reported the presence of a closed
correlation between consumption of meat and decreases of
male fertility and semen quality (Swan et al., 2007;
Mendiola et al., 2009).
Thus, the present research was designed to determine if
treatment of nandrolone mixed with food gave an influence
on the male reproduction. The feeding effect of nandrolone
on the testis was evaluated by comparison of mRNA and
protein levels of steroidogenic enzymes using semi-
quantitative real-time PCR and western blotting analysis,
respectively. In addition, immunohistochemical analysis
was utilized to find out alteration of localization of these
enzymes in the testis by feeding treatment of nandrolone.
Moreover, measurement of sperm numbers in the caudal
epididymis was made to assess the ingestional effect of
nandrolone on spermatogenesis.
MATERIALS AND METHODS
Animals and nandrolone treatment
A total of 30 male Sprague Dawley rats at 5 weeks of
age were purchased from Samtako (OSan, Korea). The rats
were randomly divided into three experimental groups,
control (n = 10), low dose nandrolone treatment (0.005
ppm) (n = 10), and high dose nandrolone treatment (0.5
ppm) (n = 10). Rats were individually housed under
controlled conditions during the entire experimental period.
To prepare nandrolone-containing food, the powdered
rodent diet was purchased from Central Laboratory Animal
Inc. (Seoul, Korea), and nandrolone was obtained from
Tokyo Kasei Kogyo Co., Ltd. (Tokyo, Japan). A proper
amount of nandrolone was thoroughly mixed with the
powdered diet, and 100 g of the diet was supplied to each
experimental animal every two days for 6 weeks. Before
changing to a new food, amount of food left was recorded,
and body weights of experimental animals were measured
every week. Experimental animals were free to access to
food and water for the entire experimental duration.
Tissue collection and total RNA and protein isolation
At the end of the experiment, animals were weighted
and then anesthetized by CO
2
stunning. The male
reproductive tract was collected, and wet weights of the
testis, epididymis, and epididymal fat were measured and
Lee et al. (2010) Asian-Aust. J. Anim. Sci. 23(12):1566-1577
1568
recorded. A testis of a rat was fixed in Bouin’s fixative for
histological and immunohistochemical examination. The
other testis of the rat was rapidly frozen in liquid nitrogen
and kept in -80°C until used for total RNA and protein
isolation. A caudal epididymis from each rat was separately
collected, weighted, and stored in -20°C until used for
sperm counting later.
Total RNAs from the testes were isolated by using
Easy-Blue total RNA extraction solution (iNtRON Biotech.,
Sungnam, Korea). The isolated RNA pellets were dissolved
and kept in RNA storage buffer (Ambion, Austin, USA) at
-80°C until used for reverse transcription (RT) reaction. The
quality and quantities of the total RNAs were determined by
gel electrophoresis and an UV spectrophotometer
(Eppendorf, New York, USA), respectively. To isolate
proteins from the testes, the tissues were homogenized in
ProPrep protein extraction solution (iNtRON Biotech.,
Sungnam, Korea). After ultracentrifugation at 16,609×g
(4°C) for 10 min, the supernatant was collected and stored
in -80°C until used for western blotting analysis. The
quantities of the proteins were measured by Bradford
method (BioRad, Hercules, USA), with bovine serum
albumin (BSA) as a standard. Protein samples were stored
at -80°C until used for Western blot analysis.
Sperm counting in the caudal epididymis
The caudal epididymis was dissected out and cut into
small pieces with a sharp knife in phosphate buffered saline
(PBS) solution. Residual sperms remaining in the tissue
pieces were drawn out by repeated pipetting. The PBS
solution was collected in an eppendorf tube and
centrifugated at 2,000 rpm for 10 min. A sperm pellet was
suspended with 1 ml of PBS solution. A total number of
sperm in the caudal epididymis was calculated by Makler
counting chamber (Sefi-Medical Instruments Ltd., Santa
Ana, USA). We repeated this procedure for 5 times to
obtain a mean of total sperm number in a caudal epididymis.
Semi-quantitative real-time PCR analysis
The RT reaction was carried out according to the
instruction in ImProm-II
TM
reverse transcription system
(Promega, Madison, USA). Two micrograms of a total RNA
were utilized for RT reaction in a total volume of 20 μl
having oligo-dT primer. The RT reaction was performed at
25°C for 5 min, 42°C for 1 h, and 72°C for 15 min. The
semi-quantitative real-time PCR was performed according
to the instruction in GoTaq DNA polymerase (Promega,
Madison, USA). Briefly, 1 μl of cDNA generated from the
RT reaction was mixed with 0.75U of GoTaq DNA
polymerase, 5 μl of 5× buffer, 0.2 mM of dNTPs (Promega,
Madison, USA), 2.5 μl of 3000X SYBR Green (BMA,
Rockland, USA), 10 pmols of forward and reverse primers,
and dH
2
O to make a total volume of 25 μl. The PCR was
accomplished an initial pre-denaturation step at 95°C for 5
min, followed by denaturation at 94°C for 30 s, annealing at
T
m
for 30 s, and extension at 72°C for 30 s of cycles. The
final extension step was performed at 72°C for 10 min at
the end of each PCR using the PTC-200 Chromo 4 real-
time system (Bio-Rad Laboratories, Hercules, USA).
Oligonucleotide primers for PCR were obtained by using
Primer 3 software (Whitehead Institute/MIT Center for
Genomes Research, Cambridge, USA;
http://www.bioneer.co.kr/cgi-bin/primer/primer3.cgi). The
information of primers and T
m
is summarized in Table 1.
The sizes of PCR products were checked by fractionation
on 1.0% agarose gel. In this analysis, we used
Glyceraldehyde 3-phosphate dehydrogenase (Gapdh) as an
internal PCR control. Quantifications of the PCR results
were determined by the relative standard curve method to
obtain quantitative values.
Western blot analysis
Forty micrograms of protein for each experimental
animal were used for western blot analysis. The protein was
fractionated on 12% SDS-PAGE polyacrylamide gel
(Invitrogen, Carlsbad, USA) and transferred to a
nitrocellulose membrane (Invitrogen). To block nonspecific
binding of the primary antibody, the membrane was
incubated in TBST (0.2 M Tris, 1.37 M NaCl, 0.05%
Tween-20) with 1% BSA (Sigma, St. Louis, USA) at room
temperature for 1 h. The membrane was immersed in
primary antibody diluted in TBST at 4°C for overnight. The
primary antibodies used for the present study were 1: 2,000
of polyclonal rabbit anti-CYP19 (a kind gift from Dr.
Nobuhiro Harada, Fujita Health University, Japan), 1:4,000
of polyclonal rabbit anti-CYP11A1 (AB1244; Chemicon
International, Inc., Temecula, USA), 1:5,000 of monoclonal
mouse anti-HSD17B4 (a generous gift from Dr. Gabriele
Möller, GSF-Research Center for Environment and Health,
Neuherberg, Germany), 1:1,000 of polyclonal goat anti-
CBR1 (ab4148; Abcam Ltd., Cambridge, United Kingdom),
1:1,000 of polyclonal rabbit anti-CYP17A (a great gift from
Dr. Anita Payne, Stanford University, Stanford, USA),
1:500 of polyclonal rabbit anti-AKR1B1 (a precious gift
from Dr. Motoko Takahashi, Saga University, Saga, Japan),
and 1:1,000 of polyclonal rabbit anti-HSD3B (a benevolent
gift from Dr. Ian Mason, University of Edinburgh,
Edinburgh, United Kingdom). After washing with TBST for
3 times to remove residual primary antibodies, the
membranes were incubated with a goat anti-rabbit or anti-
mouse HRP-conjugated IgG or rabbit anti-goat HRP-
conjugated IgG antibody (Santa Cruz Biotechnology, Inc.,
Santa Cruz, USA) diluted at 1:2,000 in TBST at room
temperature for 1 h. Then, the membranes were washed
with TBST for 4 times, and blotting results were detected
Lee et al. (2010) Asian-Aust. J. Anim. Sci. 23(12):1566-1577
1569
with the enhanced chemiluminescence detection system
(Amersham Biosciences, Pittsburgh, USA). We used
GAPDH (SC-25778; Santa Cruz Biotechnology), as an
internal control for the analysis. The results were analyzed
using Image J, released from the National Institutes of
Health (Bethesda, USA;
http://rsb.info.nih.gov/ij/download,html).
H&E staining and immunohistochemical analysis
The testes were fixed in Bouin’s solution for 22-24 h at
room temperature and transferred into 70% ethanol. The
testes were dehydrated in a series of ethanol (80, 90, 95, and
100% ethanol) and cleared with xylene. Then, the testes
were infiltrated with paraffin at 60°C for 3 h and embedded
in paraffin blocks. Tissue sections were made in 5 μm
thickness. For H&E staining to examine histological and
morphological changes in the testes of nandrolone-treated
animals, tissue sections were deparaffinized in xylene and
then rehydrated in a series of ethanol and water. Tissue
sections were stained with hematoxylin, followed by
counter-staining with eosin. Sections were dehydrated in a
series of ethanol, cleared with xylene, and mounted with
cover glasses. The tissue sections were examined under
light microscopy. Expression and localization of
steroidogenic enzymes and steroid hormone metabolism-
related molecules in the testis were determined by
immunohistochemistry. Antigen retrieval of deparaffinized
and rehydrated tissue sections was performed with
simmering in 0.01 M citrate buffer for 10 min. After cooling
down at room temperature, the sections were immersed in
0.3% H
2
O
2
/methanol for 15 min. Ten percentages of normal
serum, goat (Chemicon International, Temecula, USA) or
rabbit serum (Jackson ImmunoResearch Laboratories Inc.,
West Grove, USA), was applied to sections for 30 min at
room temperature to block non-specific binding of the
primary antibody. The sections were incubated in the
primary antibody in humidified chamber at 4°C for
overnight. We used same antibodies utilized for Western
blot analysis, but at different concentrations; 1:100 for
CYP19, 1:1,000 for CYP11A1, 1:200 for HSD17B4, 1:500
for CBR1, 1:500 for CYP17A, 1:200 for AKRIB1, and
1:500 of HSD3B. The same dilution of normal rabbit,
mouse (Chemicon), or goat serum, in the place of primary
antibody, was applied to negative control sections. Excess
primary antibodies were removed by washing with PBS for
3 times, biotin-conjugated secondary antibody was applied
to the sections at room temperature for 1 h. Unbound excess
secondary antibodies were rinsed in PBS for 3 times, and
elite avidin-biotin peroxidase (Vector Laboratories,
Burlingame, USA) was put on the sections for 30 min. After
washing in PBS for a couple of times, the sections were
treated with a mixture of 3,3’-diaminobenzidine (Sigma),
0.05 M Tris-HCl buffer, and 5% H
2
O
2
to detect color
reaction of the peroxidase. Then the tissue sections were
counterstained with hematoxylin, dehydrated in a series of
ethanol, and mounted with cover glasses. Representative
H&E and immunohistochemistry digital pictures were
captured with Olympus-CoolSNAP cf color/OL camera
(Olympus America, Melville, USA) using RSImage version
1.1 software (Roper Scientific, Duluth, USA) and processes
Table 1. Primer information for real-time PCR
Molecule
Forward primer (5’3’) Reverse primer (5’3’)
T
m
(°C)
Expected
PCR size
(bps)
Cyp19
(M33986)
GCTTCTCATCGCAGAGTATCCGG
(1555-1577)
CAAGGGTAAATTCATTGGGCTTGG
(1821-1844)
62 290
Cyp11a1
(J05156)
AGGTGTAGCTCAGGACTT
(530-547)
AGGAGGCTATAAAGGACACC
(909-928)
52 399
Cbr1
(BC105893)
GGAGAGGAGAGAGGACAAGAT
(740-760)
TTCACCAAGTCAGGATAGAAGG
(953-974)
52 235
Hsd17b4
(NM_024392)
GCAAAGGTTCTTCATGGGG
(1250-1268)
GTCCGTTTTCCACCAAAG
(1450-1467)
55 218
Hsd3b1
(M38178)
CCCATACAGCAAAAGGATGG
(636-655)
GCCGCAAGTATCATGACAGA
(766-785)
55 150
Akr1b1
(BC062034)
CACGCAGAAGTCTGAAGCTG
(960-979)
AGAAAGGCCGAAGAAACTCC
(1140-1159)
55 200
Cyp17
(M31681)
AGATTGACCAGTACGTAGGCTTC
AGCCGAA (1031-1060)
CACATCCAAGTCAAACCTCT
GCAGTAGC (1413-1440)
67 410
Gapdh
(X02231)
CCCCTGGCCAAGGTCATCCATG
ACAACTTT (540-569)
GGCCATGAGGTCCACCACC
CTGTTGCTGTA (1023-1052)
60 513
Cyp19: cytochrome P450 Aromatase, Cyp11a1: cytochrome P450 side chain cleavage, Cbr1: carbonyl reductase 1, Hsd17b4: 17β-hydroxysteroid
dehydrogenase type 4, Hsd3b1: 3-beta-hydroxysteroid dehydrogenase/delta-5-delta-4 isomerase type 1, Akr1b1: aldo-keto reductase family 1, member B1
(aldose reductase), Cyp17: cytochrome P450 17α-hydroxylase, Gapdh: Glyceraldehyde 3-phosphate dehydrogenase.
Lee et al. (2010) Asian-Aust. J. Anim. Sci. 23(12):1566-1577
1570
in PhotoShop software (Adobe Systems, San Jose, USA).
Data analysis and presentation
For semi-quantitative real-time PCR analysis, each
sample was repeated the RT and PCR reactions for 3-4
times to obtain a mean and standard error of an
experimental group. The normalized mean value to Gapdh
mRNA was used for comparison of mRNA expression level
of the molecule. For western blot analysis, we repeated each
sample for 3 times, and a mean value normalized to
GAPDH was used for the final comparison. Data for mRNA
expression levels were expressed relative to Gapdh as
arbitrary units. Abundance of protein was expressed relative
to normalized value of control group as arbitrary units.
Statistical comparison of mean differences among
experimental groups was conducted by 2-way analysis of
variance, followed by Tukey’s test, using SPSS software
(SPSS Inc., Chicago, USA). In all cases, results were
considered significant if p<0.05.
RESULTS
Effects of nandrolone on body, testis, epididymis, and
epididymal fat weights and caudal sperm number
There was no significant change on body weight among
experimental groups after feeding treatment of nandrolone
for 6 weeks, regardless doses of nandrolone treated (Figure
1A). In the male reproductive tract, wet weights of the testis
and epididymis of nandrolone treated groups were not
significantly different with those of control group (Figure
1B). Interestingly, however, caudal sperm number was
significantly increased in a high dose nandrolone treated
group, while no change on the epididymal fat weight among
experimental groups was found (Figure 1C).
Effect of nandrolone on histological change of the testis
and expression of cytochrome P450 side chain cleavage
(CYP11A1)
Feeding treatment of nandrolone at a low concentration
(0.005 ppm) for 6 weeks did not cause visible histological
change in the testis (Figure 2A). Light microscopic
examination revealed that appearance and morphology of
the testis of the low dose nandrolone treated animal were
similar with those in the control animal (Figure 2A). In the
testis of high dose nandrolone treated animal, the Leydig
cell was appeared to be histologically normal (Figure 2A).
However, a high frequency of germ cell sloughing
(detachment of germ cells from the Sertoli cells) in the
seminiferous tubules of the testis was found in nandrolone
treated group at high dose (Figure 2A).
Examination of Cyp11a1 gene expression showed no
significant change among experimental groups (Figure 2B).
A
B
Before After
0
1
2
3
4
4.5
Body weight (×100 g)
C
L
H
0
0.5
1
1.5
2
2.5
CLH CLH
Epididymal fat weight
(g/100 g BW)
Experimental group
0
0.2
0.4
0.6
0.8
1
Testis weight (g / 100 g BW)
0
1
Epididymial weight
(×100 mg/100 g BW)
CLH CLH
2
3
Experimental group
C
0
1
4
Sperm numbers (×10
8
/ml)
4.5
2
3
b
a
a
A
B
Before After
0
1
2
3
4
4.5
Body weight (×100 g)
C
L
H
0
0.5
1
1.5
2
2.5
CLH CLH
Epididymal fat weight
(g/100 g BW)
Experimental group
0
0.2
0.4
0.6
0.8
1
Testis weight (g / 100 g BW)
0
1
Epididymial weight
(×100 mg/100 g BW)
CLH CLH
2
3
Experimental group
C
0
1
4
Sperm numbers (×10
8
/ml)
4.5
2
3
b
a
a
Figure 1. Feeding effects of nandrolone on body, testis, epididymis, and epididymal fat weight and sperm numbers in caudal epididymis.
A) change of body weight, B) changes of the testis and epididymis weights, and C) changes of sperm numbers in the caudal epididymis
and epididymal fat weight. C: Control group, L: Low dose nandrolone feeding group, and H: High dose nandrolone feeding group.
Different letters in graphs indicate significant difference at p<0.05 level.
Lee et al. (2010) Asian-Aust. J. Anim. Sci. 23(12):1566-1577
1571
Also, western blot analysis revealed that CYP11A1 protein
abundance was not significantly different among
experimental groups (Figure 2B). Immunohistochemical
analysis exhibited an exclusive localization of CYP11A1 in
the Leydig cells, while no immuno-reactivity was detected
in the seminiferous tubules of the testis (Figure 2B and
Table 2. Summary of immunohistochemical analysis
Molecule Leydig cells Sertoli cells Germ cells
CYP19 + +/-
b
+/-
a
CYP11A1 + - -
CBR1 + - -
HSD17B4 +
b
- +/-
a
HSD3B1 + - -
AKR1B1 +/- + -
CYP17 + - +/-
a
CYP19: cytochrome P450 Aromatase, CYP11A1: cytochrome P450 side chain cleavage, CBR1: carbonyl reductase 1, HSD17B4: 17β-hydroxysteroid
dehydrogenase type 4, HSD3B1: 3-beta-hydroxysteroid dehydrogenase/delta-5-delta-4 isomerase type 1, AKR1B1: aldo-keto reductase family 1, member
B1 (aldose reductase), CYP17: cytochrome P450 17α-hydroxylase.
a
Indicates germ cells at specific spermatogenic stage.
b
Indicates that all cells are not evenly immuno-positive.
+: positive, +/-: weakly positive, -: negative.
A
Control Low High
L
L
L
B
Control Low High
L
L
L
Arbitrary unit (×10
-2
)
0
1.0
2.0
2.5
CLH
Experimental group
0
0.5
1.0
CLH
Experimental group
CLH
Arbitrary unit
CYP11A1
GAPDH
A
Control Low High
L
L
L
Control Low High
L
L
L
B
Control Low High
L
L
L
Control Low High
L
L
L
Arbitrary unit (×10
-2
)
0
1.0
2.0
2.5
CLH
Experimental group
0
0.5
1.0
CLH
Experimental group
CLH
Arbitrary unit
CYP11A1
GAPDH
Figure 2. Histological examination of the testes and expressional change of cytochrome P450 side chain cleavage in the testis. A) H&E
pictures of the testes and B) comparison of mRNA and protein levels and immunohistochemical localization of CYP11A1 in the testes.
C: Control group, L: Low dose nandrolone feeding group, and H: High dose nandrolone feeding group. An arrow indicates sloughing o
f
epithelial and germ cells in the seminiferous tubules. L: Leydig cell. Bars indicate 100 μm.
Lee et al. (2010) Asian-Aust. J. Anim. Sci. 23(12):1566-1577
1572
Table 2). In addition, there was no visible difference on the
intensity of positive staining of CYP11A1 among
experimental groups (Figure 2B).
Effect of nandrolone on expression of cytochrome
17α-hydroxylase (CYP17) and 3β-hydroxysteroid
dehydrogenase 1 (HSD3B1)
Expression of Cyp17 gene was significantly decreased
with nandrolone feeding at low dose, while expressional
level of Cyp17 mRNA was not affected by high nandrolone
feeding treatment, compared with that of control group
(Figure 3A). However, protein levels of CYP17 among
experimental groups were not significantly different (Figure
3A). Immunohistochemical examination showed a strong
positive staining of CYP17 in the Leydig cells of the testis
(Figure 3A and Table 2). Interestingly, germ cells, but not
Sertoli cells, in the seminiferous tubules were weakly
positive for CYP17 (Figure 3A and Table 2).
A
Arbitrary unit (×10
-2
)
CLH
Experimental group
0
2
a
b
a,b
4
6
Control Low High
L
L
L
0
0.5
1.0
CLH
Experimental group
CLH
Arbitrary unit
CYP17
GAPDH
B
Arbitrary unit (×10
-2
)
CL H
Experimental group
0
0.3
0.6
0.9
a
b
c
1.2
0
0.5
1.0
CLH
Experimental group
CLH
Arbitrary unit
HSD3B1
GAPDH
Control Low High
L
L
L
A
Arbitrary unit (×10
-2
)
CLH
Experimental group
0
2
a
b
a,b
4
6
Control Low High
L
L
L
Control Low High
L
L
L
0
0.5
1.0
CLH
Experimental group
CLH
Arbitrary unit
CYP17
GAPDH
B
Arbitrary unit (×10
-2
)
CL H
Experimental group
0
0.3
0.6
0.9
a
b
c
1.2
0
0.5
1.0
CLH
Experimental group
CLH
Arbitrary unit
HSD3B1
GAPDH
Control Low High
L
L
L
Control Low High
L
L
L
Figure 3. Effect of nandrolone feeding on 17α-hydroxylase and 3
β
-HSD 1 expression in the testis. A) comparison of mRNA and protei
levels and immunohistochemical localization of CYP17 in the testes and B) comparison of mRNA and protein levels an
d
immunohistochemical localization of HSD3B1 in the testes. C: Control group, L: Low dose nandrolone feeding group, and H: High dose
nandrolone feeding group. L: Leydig cell. Bars indicate 100 μm. Arrows indicate positive immuno-reaction in germ cells.
Lee et al. (2010) Asian-Aust. J. Anim. Sci. 23(12):1566-1577
1573
Abundance of Hsd3b1 mRNA was significantly
increased in low nandrolone treated group, compared with
that of control group (Figure 3B). A further significant
increase of Hsd3b1 mRNA level was observed in the testis
of high nandrolone treated group (Figure 3B). However, no
significant change of HSD3B1 protein levels was found
among experimental groups (Figure 3B). A strong immuno-
reaction of HSD3B1 in the testis was exclusively shown in
the Leydig cells, and there was no visible difference in an
intensity of positive-staining of HSD3B1 among
experimental groups (Figure 3B and Table 2). Other cell
types in the testis were immuno-negative for HSD3B1
(Figure 3B and Table 2).
Effect of nandrolone on expression of 17β-hydroxysteroid
dehydrogenase 4 (HSD17B4) and cytochrome P450
aromatase (CYP19)
The level of Hsd17b4 mRNA in a low nandrolone
treated group was not significantly different with that in
control group, while a feeding treatment with nandrolone at
a high dose resulted in a significant increase of Hsd17b4
transcript level (Figure 4A). Like other steroidogenic
enzymes mentioned above, there was no significant change
in protein levels among experimental groups (Figure 4A).
Immunohistochemical analysis of HSD17B4 revealed a
weak positive staining in the Leydig and germ cells, but
immuno-negative in the Sertoli cells of the testis (Figure 4A
and Table 2). Especially, the presence of HSD17 protein in
the seminiferous tubules was restricted in specific types of
germ cells (Figure 4A).
Semi-quantitative real-time PCR analysis showed that
there was no significant expressional change of Cyp19 gene
among experimental groups (Figure 4B). A similar finding
was detected on protein level of CYP19 (Figure 4B). The
localization of CYP19 in the testis was observed in the
Leydig cells, as well as in the Sertoli and certain germ cells
(Figure 4B and Table 2). However, an intensity of immuno-
reactivity of CYP19 was stronger in the Leydig cells than
the Sertoli and germ cells (Figure 4B). There was no
notable difference in immuno-staining quantity among
experimental groups (Figure 4B).
Effect of nandrolone on expression of aldose reductase
(AKB1B1) and carbonyl reductase 1 (CBR1)
Like Cyp19 gene, the feeding treatment of nandrolone
didn’t have an influence on gene expression of Akb1b1 in
the testis (Figure 5A). Similarly, the protein levels of
AKB1B1 were not affected by nandrolone treatment,
compared with that in control group (Figure 5A). However,
unlike other molecules tested in the present study, a strong
immuno-positive reaction of AKB1B1 in the testis was
observed in the Sertoli cells, while the Leydig cells were
weakly positive and germ cells were clearly immuno-
negative (Figure 5A and Table 2). However, there was no
observable difference on immuno-reactivity of AKB1B1
among experimental groups (Figure 5A).
Expression of Cbr1 gene was not affected by
nandrolone treatment (Figure 5B). Also, the levels of CBR1
protein of nandrolone treated groups were not significantly
different with that of control (Figure 5B). However,
localization of CBR1 in the testis was different with
AKB1B1. A strong immuno-reactivity was exclusively
detected in the Leydig cells of the testis (Figure 5B and
Table 2). Neither the Sertoli cells nor the germ cells in the
seminiferous tubules were negative for immuno-staining of
CBR1 (Figure 5B and Table 2).
DISCUSSION
Nandrolone is an anabolic steroid which is present in
the edible parts of pork at non-negligible amounts. The
present study was attempted to determine if nandrolone
ingested orally with food for 6 weeks affects the male
reproductive capacity, especially focused on steroidogenesis
and sperm production in the testis. Results obtained from
the current research are summarized as following; i) no
influence on body, testis, epididymis, and epididymal fat
weights, ii) a significant increase of sperm number in the
caudal epididymis and histological abnormality in the testis
with 0.5 ppm treatment, iii) no significant changes on
mRNA and protein levels of most steroidogenic enzymes,
except Cyp17, Hsd3b1, and Hsd17b4 mRNAs, iv) no
visible changes on localization of steroidogenic enzymes in
the testis, and v) no impact on male and female fertilizing
capacities.
Nandrolone is intramuscularly administrated to treat
various medical symptoms. For example, nandrolone is
used to compensate HIV-associated wasting by increasing
muscle and lean body mass (Corcoran and Grinspoon,
1999). Nandrolone treatment usually causes a significant
decrease of total body weight (Yu-Yahiro et al., 1989;
Takahashi et al., 2004). However, Karbalay-Doust and
Noorafshan (2006) have reported no change on body weight
with nandrolone treatment. These dissimilar observations
would be due to different duration (long or short) and/or
doses (high or low) of nandrolone treatment. In the present
study, feeding treatment of nandrolone didn’t affect on a
change of body weight during postnatal development.
Consumption of pork tissues results in increased levels of
weak nandrolone metabolites, such as 19-norandrosterone
and/or 19-noretiocholanolone, in urine (Le Bizec et al.,
1999). Thus, it is speculated that most of nandrolone
ingested orally would be converted into these metabolites in
the liver and excreted in urine, in prior to giving an
influence to body weight. In addition, we can’t rule out a
possibility that a length of oral nandrolone treatment would
Lee et al. (2010) Asian-Aust. J. Anim. Sci. 23(12):1566-1577
1574
A
Experimental group
Arbitrary unit (×10
-1
)
CLH
0
2
4
5
a
a
b
1
3
0
0.5
1.0
CL H
Experimental group
CLH
Arbitrary unit
HSD17B4
GAPDH
Control Low High
L
L
L
B
0
1.0
2.0
2.5
Arbitrary unit (×10
-4
)
CLH
Experimental group
0
0.5
1.0
CLH
Experimental group
CLH
Arbitrary unit
CYP19
GAPDH
L
L
L
Control Low High
A
Experimental group
Arbitrary unit (×10
-1
)
CLH
0
2
4
5
a
a
b
1
3
0
0.5
1.0
CL H
Experimental group
CLH
Arbitrary unit
HSD17B4
GAPDH
Control Low High
L
L
L
Control Low High
L
L
L
B
0
1.0
2.0
2.5
Arbitrary unit (×10
-4
)
CLH
Experimental group
0
0.5
1.0
CLH
Experimental group
CLH
Arbitrary unit
CYP19
GAPDH
L
L
L
Control Low High
L
L
L
Control Low High
Figure 4. Expressional changes of 17β-HSD 4 and cytochrome P450 aromatase in the testis. A) comparison of mRNA and protein levels
and immunohistochemical localization of HSD17B4 in the testes and B) comparison of mRNA and protein levels an
d
immunohistochemical localization of CYP19 in the testes. C: Control group, L: Low dose nandrolone feeding group, and H: High dose
nandrolone feeding group. L: Leydig cell. Bars indicate 100 μm. Different letters in graph indicate significant difference at p<0.05 level.
Lee et al. (2010) Asian-Aust. J. Anim. Sci. 23(12):1566-1577
1575
A
Control Low High
L
L
L
Arbitrary unit (×10
-2
)
CLH
Experimental group
0
1
2
H
0
0.5
1.0
CLH
Experimental group
CL
Arbitrary unit
AKR1B1
GAPDH
B
Arbitrary unit (×10
-2
)
CLH
Experimental group
0
0.4
0.6
0.8
0.2
0
0.5
1.0
CLH
Experimental group
CLH
Arbitrary unit
CBR1
GAPDH
Control Low High
L
L
L
A
Control Low High
L
L
L
Control Low High
L
L
L
Arbitrary unit (×10
-2
)
CLH
Experimental group
0
1
2
H
0
0.5
1.0
CLH
Experimental group
CL
Arbitrary unit
AKR1B1
GAPDH
B
Arbitrary unit (×10
-2
)
CLH
Experimental group
0
0.4
0.6
0.8
0.2
0
0.5
1.0
CLH
Experimental group
CLH
Arbitrary unit
CBR1
GAPDH
Control Low High
L
L
L
Control Low High
L
L
L
Figure 5. Expressional changes of aldose reductase and carbonyl reductase 1 in the testis after feeding treatment of nandrolone. A)
comparison of mRNA and protein levels and immunohistochemical localization of AKR1B1 in the testes and B) comparison of mRN
A
and protein levels and immunohistochemical localization of CBR1 in the testes. C: Control group, L: Low dose nandrolone feeding
group, and H: High dose nandrolone feeding group. L: Leydig cell. Bars indicate 100 μm. Arrows indicate positive immuno-reaction i
n
the Sertoli cells.
Lee et al. (2010) Asian-Aust. J. Anim. Sci. 23(12):1566-1577
1576
not be sufficient to affect body weight. An effect of
nandrolone ingested orally on change of body weight is
remained to be investigated in a future study.
The adverse effects of nandrolone on the testis have
been demonstrated from a number of researches. Prolonged
and uncontrolled use of nandrolone cause various
histological and morphological abnormalities in the testis,
including reduction of testicular volume and seminiferous
tubule length (Noorafshan et al., 2005), germ and Sertoli
cells’ sloughing (Takahashi et al., 2004), and severe
depletion of Leydig cells in the interstitial compartment
(Nagata et al., 1999). Also, it is well recognized that a long-
term use of nandrolone frequently results in male infertility,
as a predominant side effect (Lombardo et al., 2005).
Moreover, treatment with relatively high doses of
nandrolone leads into decreases of testis and epididymal
weights, sperm number, and sperm motility (Takahashi et
al., 2004; Noorafshan et al., 2005; Karbalay-Doust et al.,
2007). In the present study, we found no change on testis
and epididymal weights and fertilizing capacity in male.
However, feeding treatment of a high dose of nandrolone
resulted in a significant increase of sperm number. This
result is opposite to those shown by other studies
(Karbalay-Doust et al., 2007). There is no clear explanation
to justify the different results at this point. One of
significant differences between the present and other studies
could be the sources of sperms utilized to count the number.
In the present study, sperm number in the caudal epididymis
was counted, while others measured sperm numbers in the
testis. But, this experimental difference could not give an
apparent reason to acquire opposite results in change of
sperm number by nandrolone treatment. This question
would be determined by further detailed examination in the
future. In the testis, even though clear morphological
change on Leydig cells was not observed, sloughing of
Sertoli and germ cells was frequently found with the high
dose treatment of nandrolone. Similar phenomenon is
commonly observed in the testis by nandrolone treatment
(Takahashi et al., 2004). These findings imply that oral
ingestion of nandrolone at high dose could affect histology
of the testis, so thus possibly male fertility if the testis is
exposure to oral-intake nandrolone at high amount for
prolonged period.
Intramuscular administration of nandrolone alters gene
expression and protein levels of various steroidogenic
enzymes in the testis. Nagata et al. (1999) have
demonstrated that nandrolone treatment in the stallion
results in obvious decreases of immune-reactivity of CYP19
and HSD3B in the interstitial compartment of the testis.
Chronic treatment of nandrolone causes a significant
decrease of Hsd17b3 mRNA level, while expression of
other steroidogenic enzymes, Cyp17, Hsd3b, Cyp11a1, and
Cyp19, has not been affected (Alsiö et al., 2009). In the
present study, we found that mRNA levels of Cyp17,
Hsd3b1, and Hsd17b4 were changed by feeding treatment
of nandrolone. In the other hand, gene expression of
Cyp11a1, Cyp19, Akr1b1, and Cbr1 was not affected in the
present research. Especially, an expressional pattern of
Hsd3b1 in the present study was different to that found
from Alsiö et al. (2009). It is speculated that methodological
difference of nandrolone treatment would produce such
different experimental results. In the current research, there
was no change at protein levels of all molecules tested.
However, visible decreases of HSD3B and CYP19 protein
levels have been detected by intramuscular treatment of
nandrolone (Nagata et al., 1999). Such disagreement in the
change of HSD3B protein level with nandrolone treatment
is most likely due to different treatment methods. It is
supposed that nandrolone ingested with food would be
quickly absorbed and delivered to the liver, at which
nandrolone is metabolized into weak anabolic androgenic
steroids, while intramuscularly administrated nandrolone
would directly go to the testis via the bloodstream and
affect gene expression in the testis before nandrolone is
converted into weak metabolites. However, we cannot rule
out a possibility that ingestion of high amounts of
nandrolone could influence protein levels of steroidogenic
enzymes in the testis, so thus male fertility. An additional
research is suggested to examine the feeding effect of
higher nandrolone doses on the testis.
The caviar of the present study is the first attempt to
determine the feeding effect of nandrolone on the testis of
the male reproductive tract. An increasing attention has
been focusing into the relationship between meat
consumption and semen quality (Swan et al., 2007;
Mendiola et al., 2009). These researches reach a common
conclusion, which is that an increasing meat intake may
alter male’s testicular development and function and so thus
male fertility (Swan et al., 2007; Mendiola et al., 2009). As
stated in the introduction, most edible parts of pigs,
including muscle and liver, contain non-negligible amount
of nandrolone, ranged 1.1 to 200 mg/kg (Van Ginkel et al.,
1989). There is no doubt that consumption of pork by
people has been increasing every year. Thus, human being
has more chance to be exposed to higher exogenous
anabolic androgenic steroids present in pork. Even though
the present study has not clearly demonstrated a harmful
effect of oral ingestion of nandrolone on the testis, results
from the current researches would suggest that large
consumption of pork meat could give an influence on the
testis, so thus male fertilizing capacity, in part.
In conclusion, from the present study, it is not
conclusive if oral feeding of nandrolone directly affects the
male fertility at the current point. However, morphological
abnormality and aberrant gene expression in the tests at a
high dose of nandrolone ingested orally may imply a
negative relationship between pork consumption and male
fertility.
Lee et al. (2010) Asian-Aust. J. Anim. Sci. 23(12):1566-1577
1577
REFERENCES
Alsiö, J., B. Carolina, L. Björkblom, P. Isaksson, L. Bergström, H.
B. Schiöth and J Lindblom. 2009. Impact of nandrolone
decanoate on gene expression in endocrine systems related to
the adverse effects of anabolic androgenic steroids. Basic Clin.
Pharmacol. Toxicol. 105:307-314.
Basaria, S., J. T. Wahlstrom and A. S. Dobs. 2001. Clinical review
138: Anabolic-androgenic steroid therapy in the treatment of
chronic diseases. J. Clin. Endocrinol. Metab. 86:5108-5117.
Bijlsma, J. W., S. A. Duursma, J. H. Thijssen and O. Huber. 1982.
Influence of nandrolone decanoate on the pituitary-gonadal
axis in males. Acta Endocrinol. (Copenh.) 101:108-112.
Chrousos, G. P. 2006. The gonadal hormones and inhibitors. In:
Basic and Clinical Pharmacology (Ed. B. G. Katzung).
McGraw-Hill Professional, New York, USA. pp. 674-676.
Corcoran, C. and S. Grinspoon. 1999. The use of testosterone in
the AIDS wasting syndrome. AIDS Clin. Care 11:25-26.
Cuerda, C., A. Zugasti, I. Bretόn, M. Camblor, P. Miralles and P.
Garcίa. 2005. Treatment with nandrolone decanoate and
megestrol acetate in HIV-infected men. Nutr. Clin. Pract.
20:93-97.
Hamdy, R. C., S. W. Moore, K. E. Whalen, C. Landy and J. H.
Quillen. 1998. Nandrolone decanoate for men with
osteoporosis. Am. J. Ther. 5:89-95.
Fortunato, R. S., M. P. Marassi, E. A. Chaves, J. H. M.
Nascimento, D. Rosenthal and D. P. Carvalho. 2006. Chronic
administration of anabolic androgenic steroid alters murine
thyroid function. Med. Sci. Sports Exerc. 38:256-261.
Gerez, J. R., F. Frei and I. C. C. Camargo. 2005. Histological
assessment of ovaries and uterus of rats subjected to
nandrolone decanoate treatment. Contraception 72:77-80.
Karbalay-Doust, S. and A. Noorafshan. 2006. Stereological study
of the effects of nandrolone decanoate on the rat prostate.
Micron 37:617-623.
Karbalay-Doust, S., A. Noorafshan, F. M. Ardekani and H.
Mirkhani. 2007. The reversibility of sperm quality after
discontinuing nandrolone decanoate in adult male rats. Asian J.
Androl. 9:235-239.
Koeva, Y. A., K. N. Georgieva, P. K. Atanassova and S. D.
Delchev. 2003. Effects of submaximal training and anabolic
androgenic steroids administration on steroidogenic enzyme
activity in rat Leydig cells. Folia Med. (Plovdiv). 45:37-40.
Kuhn, C. M. 2002. Anabolic steroids. Recent Prog. Horm. Res.
57:411-434.
Le Bizec, B., F. Monteau, I. Gaudin and F. André. 1999. Evidence
for the presence of endogenouse 19-norandrosterone in human
urine. J. Chromatogr. B. Biomed. Sci. Appl. 723:157-172.
Lombardo, F., P. Sgrò, P. Salacone, B. Gilio, L. Gandini, F.
Dondero, E. A. Jannini and A. Lenzi. 2005. Androgens and
fertility. J. Endocrinol. Invest. 28:51-55.
Mendiola, J., A. M. Torres-Cantero, J. M. Moreno-Grau, J. Ten, M.
Roca, S. Moreno-Grau and R. Bernabeu. 2009. Food intake
and its relationship with semen quality: a case-control study.
Fertil. Steril. 91:812-818.
Meyer, H. H., D. Falckenberg, T. Janowski, M. Rapp, E. F. Rösel,
L. van Look and H. Karg. 1992. Evidence for the presence of
endogenous 19-nortestosterone in the cow peripartum and in
the neonatal calf. Acta Endocrinol. (Copenh). 126:369-373.
Mobini Far, H. R., G. Agren, A. S. Lindqvist, M. Marmendal, C.
Fahlke and I. Thiblin. 2007. Administration of the anabolic
androgenic steroid nandrolone decanoate to female rats causes
alterations in the morphology of their uterus and a reduction in
reproductive capacity. Eur. J. Obstet. Gynecol. Reprod. Biol.
131:189-197.
Nagata, S., M. Kurosawa, K. Mim a , Y. N a m bo , Y. F uj i i , G.
Watanabe and K. Taya. 1999. Effects of anabolic steroid (19-
nortestosterone) on the secretion of testicular hormones in the
stallion. J. Reprod. Fertil. 115:373-379.
Noorafshan, A., S. Karbalay-Doust and F. M. Ardekani. 2005.
High doses of nandrolone decanoate reduce volume of testis
and length of seminiferous tubules in rats. APMIS. 113:122-
125.
Pokrywka, A., D. Kwiatkowska and D. Gorczyca. 2009. Possible
reasons for the presence of nandrolone metabolites in urine.
Arch. Med. Sadowej. Kryminol. 59:1550158.
Ranke, M. B. and J. R. Bierich. 1986. Treatment of growth
hormone deficiency. Clin. Endocrinol. Metab. 15:495-510.
Salas-Ramirez, K. Y., P. R. Montalto and C. L. Sisk. 2008.
Anabolic androgenic steroids differentially affect social
behaviors in adolescent and adult male Syrian hamsters. Horm.
Behav. 53:378-385.
Scarth, J., C. Akre, L. van Ginkel, B. Le Bizec, H. De Brabander,
W. Korth, J. Points, P. Teale and J. Kay. 2009. Presence and
metabolism of endogenous androgenic-anabolic steroid
hormones in meat-producing animals: a review. Food Addit.
Contam, Part A Chem. Anal. Control Expo. Risk Assess.
26:640-671.
Schwarzenberger, F., G. S. Toole, H. L. Christie and J. I. Raeside.
1993. Plasma levels of several androgens and estrogens from
birth to puberty in male domestic pigs. Acta Endocrinol.
128:173-177.
Swan, S. H., F. Liu, J. W. Overstreet, C. Brazil and N. E.
Skakkebaek. 2007. Semen quality of fertile US males in
relation to their mothers' beef consumption during pregnancy.
Hum. Reprod. 22:1497-1502.
Takahashi, M., Y. Tatsugi and T. Kohno. 2004. Endocrinological
and pathological effects of anabolic-androgenic steroid in male
rats. Endocr. J. 51:425-434.
Torres-Calleja, J., M. Gonzalez-Unzaga, R. DeCelis-Carrillo, L.
Calzada-Sanchex and N. Pedron. 2001. Effects of androgenic
anabolic steroids on sperm quality and serum hormone levels
in adult male bodybuilders. Life Sci. 68:1769-1774.
Tseng, Y. T., R. W. Rockhold, B. Hoskins and I. K. Ho. 1994.
Cardiovascular toxicities of nandrolone and cocaine in
spontaneously hypertensive rats. Fundam. Appl. Toxicol.
22:113-121.
van Der, V. J. 1965. On the mechanism of action of nandrolone
phenylpropionate and nandrolone decanoate inrats. Acta
Endocrinol. (Copenh). 49:271-282.
van Ginkel, L. A., R. W. Stephany, P. W. Zoontjes, H. J. van
Rossum, H. van Blitterswijk and J. Zuijdendorp. 1989. The
presence of nortestosterone in edible parts from non-castrated
male pigs. Tijdschr. Diergeneeskd. 114:311-314.
Yu-Yahiro, J., R. H. Michael, D. V. Nasralah and B. Schofield.
1989. Morphologic and histologic abnormalities in female and
male rats treated with anabolic steroids. Am. J. Sports Med.
17:686-689.
... Leydig cells secret intratesticular testosterone in the testicles. Testosterone is a steroid hormone that has an important role in the development of the male phenotype and the regulation of reproduction of males (1). Physiological levels of this hormone are essential for spermatogenesis (2). ...
... ASSs are classified in three categories that the first category is Nandrolone Decanoate (ND) (11). ND is chemically synthesized or naturally existed in some vertebrates such as humans (1). High doses of ND interact with various receptors, such as estrogen, progesterone and testosterone. ...
... If males treated with ND for a long time, sperm quality and testosterone secretion rate is decreased and the testis shape is altered (1). In fact, the use of intramuscular ND (25 mg/week) suppresses fertility in males (14). ...
Article
Full-text available
Background: Most studies on anabolic-androgenic steroids abuse have been done in adult rats, but few data are available to immature. Objective: This study was conducted to assay the effect of Nandrolone Decanoate (ND) on the testis and testosterone concentration in male immature rats compare with mature ones in short and long time. Materials and Methods: 40 mature rats were divided into 4 groups: group A (short term) and group B (long-term) received 10 mg/kg/day ND interaperitoneally for 35 and 70 days, respectively. Group C (control) without any treatment, and group D (vehicle) received dimethyl sulfoxide (DMSO) solution in two periods 35 and 70 days. 40 immature rats were divided into 4 groups same as mature ones. After surgery body weight, testis size, histomorphometry of testis, and serum testosterone level were evaluated. Results: Our results showed that ND decreased the number of Leydig cells in group B (39.9 ±. 919), group A (43.4 ±. 120), and long term (40.6 ±. 299) immature rats, which could result in a reduction of testosterone concentration significantly in all experimental groups except short term mature group. Number of sertoli cells, testis size, and diameter of seminiferous tubules decreased in the long-term immature group. Eventually, the number of sperm was decreased in mature and immature groups, but a severe depletion of sperm was occurred in both mature and immature in long time in comparison to the control group (p< 0.05). Conclusion: This time course study showed that supraphysiological dose of ND may negatively affect the number of Leydig cells, sperm cell, and testosterone concentration of immature rats in the same matter of mature rats. However, the number of sertoli cell, testis size, and seminferous diameter were decreased only in the long immature rats. Key words: Nandrolone Decanoate, Testis, Testosterone, Mature, Immature, Rat
... Leydig cells secret intratesticular testosterone in the testicles. Testosterone is a steroid hormone that has an important role in the development of the male phenotype and the regulation of reproduction of males (1). Physiological levels of this hormone are essential for spermatogenesis (2). ...
... ASSs are classified in three categories that the first category is Nandrolone Decanoate (ND) (11). ND is chemically synthesized or naturally existed in some vertebrates such as humans (1). High doses of ND interact with various receptors, such as estrogen, progesterone and testosterone. ...
... If males treated with ND for a long time, sperm quality and testosterone secretion rate is decreased and the testis shape is altered (1). In fact, the use of intramuscular ND (25 mg/week) suppresses fertility in males (14). ...
Conference Paper
Full-text available
Introduction: Few data are available on immature users because most studies on anabolic-androgenic steroids (AAS) abuse have been done in adults. The long-term effects of AAS abuse on the immature are even more uncommon. Accordingly, this study was conducted the effect of ND on the testis and testosterone concentration in male rats. Materials and Methods: Mature and immature rats were divided into 8 groups. GroupA: control group. Group B: vehicle group received DMSO solution for 35 and 70 days. Group C: short-term mature received 10 mg/kg/day (ND) for 35 days. GroupD: long-term mature received 10 mg/kg/day (ND) for 70days. Immature rats were divided into 4 groups the same as mature rats groups. 48 hours after the last injection, rats were sacrificed and body weight, testis and accessory sex organs morphometery were assessed. Results: There was an increase in the body weight only in first days. Ratio length to width or size of testis was decreased in long-term immature rats. Diameter of Seminiferous tubules changed in Long- term immature among other rats. Level of testosterone was reduced in all rats exception short-term mature rats .Spermatogonia type A, B, primary spermatocytes and spermatids were decreased in long-term mature and in short-term and long-term immature rats.Moreover, sperm was decreased in all rats, and cellular disorders were observed, as well. The number of leydig and sertoli cells was reduced in long-term immature rats. Conclusion: This study showed that suprophysiological dose of ND affects spermatogenesis, testis structure, testosterone and spermatogenic cells were decreased. Leydig and Sertoli cells were reduced. Key words: Nandrolone Decanoate, Testosterone, Testis, Rat.
... This phenomenon might be acceptable if the rate of testis weight gain in 10 mg ND-treated group between the 2-weeks and 6-weeks recovery period is faster than the rate in body weight gain. The histological aberrance in the testis induced by the exposure to ND is frequently detected [11,12,15,22]. The germ cell sloughing following the detachment of germ cells from the seminiferous epithelium is often accompanied with ND administration by not only injection [11,12] but also feeding [22]. ...
... The histological aberrance in the testis induced by the exposure to ND is frequently detected [11,12,15,22]. The germ cell sloughing following the detachment of germ cells from the seminiferous epithelium is often accompanied with ND administration by not only injection [11,12] but also feeding [22]. The loss of germ cells from the seminiferous epithelium is associated with endogenous testosterone level reduction [23]. ...
Article
Full-text available
Anabolic steroids are frequently used to increase the growth rate of meat-producing animals. Exposure to an anabolic-androgenic steroid, nandrolone decanoate (ND), is associated with expressional reduction of testicular steroidogenic enzymes. However, the effect of withdrawal of ND exposure on the expression of these testicular molecules has not been thoroughly explored. The current research investigated expression changes of testicular steroidogenic enzymes in rats at several recovery periods (2, 6, and 12 weeks) after the stop of ND treatment with different doses (2 and 10 mg/kg body weight) for 12 weeks. Body and testis weights were recorded, and transcript levels of molecules were determined by quantitative real-time polymerase chain reaction (PCR). The immunohistochemistry was used to examine the changes of immuno-intensities of molecules. At 6 and 12 weeks of the recovery period, the 10 mg/kg ND-treated rats were lighter than other experimental groups. The interstitial compartment vanished by ND treatment filled up as the recovery period became longer. The expression of steroidogenic acute regulatory protein was returned to the control level at 12 weeks of the recovery period. Expression levels of cytochrome P450 side-chain cleavage and 17a-hydroxylase were increased in 2 mg/kg ND-treated group at 6 weeks of the recovery period, and transcript levels of these molecules in 2 and 10 mg/kg ND-treated groups at 12 weeks of the recovery period were significantly lower than the control. Expression levels of 3β-hydroxysteroid dehydrogenase (HSD) type I and 17β-HSD type 3 in 2 mg/kg ND-treated group were comparable with those of control at 12 weeks of the recovery period, but not in 10 mg/kg ND-treated group. Expression of cytochrome P450 aromatase (Cyp19) was reverted to the control level at 2 weeks of the recovery period. Except for Cyp19, there was a visible increase of immuno-staining intensity of other testicular steroidogenic enzymes in the Leydig cells as the recovery period progressed. This research has demonstrated that the cease of ND administration could restore the expression of testicular steroidogenic enzymes close to the normal level. Nevertheless, a relatively long recovery period, compared to the ND-exposure period would be required to retrieve normal expression levels of testicular steroidogenic enzymes.
... Testosterone is a steroid hormone that has an essential role in the development of the male phenotype and the regulation of reproduction of males. This hormone is effective on puberty, fertility, and sexual function in males [1,2]. ...
Article
Full-text available
Background and Objectives: Androgens play a significant role in the development of male reproductive organs. The clinical use of synthetic testosterone derivatives, such as nandrolone, is focused on maximizing the anabolic effects and minimizing the androgenic ones. Class II anabolic androgenic steroids (AAS), including nandrolone, are rapidly becoming a widespread group of drugs used both clinically and illicitly. The illicit use of AAS is diffused among adolescent and bodybuilders because of their anabolic proprieties and their capacity to increase tolerance to exercise. This systematic review aims to focus on side effects related to illicit AAS abuse, evaluating the scientific literature in order to underline the most frequent side effects on AAS abusers’ bodies. Materials and Methods: A systematic review of the scientific literature was performed using the PubMed database and the keywords “nandrolone decanoate”. The inclusion criteria for articles or abstracts were English language and the presence of the following words: “abuse” or “adverse effects”. After applying the exclusion and inclusion criteria, from a total of 766 articles, only 148 were considered eligible for the study. Results: The most reported adverse effects (found in more than 5% of the studies) were endocrine effects (18 studies, 42%), such as virilization, gynecomastia, hormonal disorders, dyslipidemia, genital alterations, and infertility; cardiovascular dysfunctions (six studies, 14%) such as vascular damage, coagulation disorders, and arteriosus hypertension; skin disorders (five studies, 12%) such as pricking, acne, and skin spots; psychiatric and mood disorders (four studies, 9%) such as aggressiveness, sleep disorders and anxiety; musculoskeletal disorders (two studies, 5%), excretory disorders (two studies, 5%), and gastrointestinal disorders (two studies, 5%). Conclusions: Based on the result of our study, the most common adverse effects secondary to the abuse of nandrolone decanoate (ND) involve the endocrine, cardiovascular, skin, and psychiatric systems. These data could prove useful to healthcare professionals in both sports and clinical settings.
... Anabolic steroid is a synthetic variety of the male sex hormone testosterone. The anabolic-androgenic steroid (AAS) is the expression commonly used for these compounds [1]. They are structurally and functionally similar to testosterone [2]. ...
... In addition, a recent study has reported that the semen quality in humans could be negatively affected by increased intake of meat products [29]. Moreover, our earlier research has also shown that orally consumed nandrolone causes germ cell sloughing and abnormal expression of some steroidogenic enzymes in the testis [30]. Therefore, in order to clarify the impact of nandrolone and/or nandrolone-derivatives on the male reproduction, a diverse of contact means to these anabolic steroids should be considered. ...
Article
Full-text available
Objective: Nandrolone decanoate (ND) is an anabolic-androgenic steroid frequently used for clinical treatment. However, the inappropriate use of ND results in the reduction of serum testosterone level and sperm production. The suppressive effect of ND on testosterone production has not been investigated in detail. The present study was designed to examine the effect of ND on the expression of steroidogenic enzymes in the rat testis. Methods: Male Sprague Dawley rats at 50 days of age were subcutaneously administrated with either 2 or 10 mg of ND/kg body weight/week for 2 or 12 weeks. The changes of transcript and protein levels of steroidogenic enzymes in the testis were determined by real-time PCR and western blotting analyses, respectively. Moreover, immunohistochemical analysis was employed to determine the changes of immunostaining intensity of these enzymes. The steroidogenic enzymes investigated were StAR, CYP11A1, CYP17, HSD3B1, and CYP19. Results: The treatment of ND resulted in depletion of Leydig cells and sloughing of germ cells in the testis. The ND treatment caused significant expressional decreases of steroidogenic enzymes at transcript and protein levels, and the destructive effects of ND on the testis were more apparent with a higher dose and a longer period of the treatment. Evident reduction of immunostaining intensity present in Leydig cells was clearly detected by the ND treatment. Conclusion: The exposure to ND in young male results not only in histological changes of the testis but also in aberrant gene expression of testicular steroidogenic enzymes, consequently leading into the reduction of testosterone production in the testis and thus likely disruption of spermatogenesis.
... Androgens play an important role in male reproductive organs development, and are of major importance in puberty, fertility, and sexual function. Leydig cells secrete intra-testicular testosterone which is a steroid hormone that has a great importance in the development of the male phenotype and regulation of reproduction as it is essential for spermatogenesis [1,2]. ...
... Also, it has increased notably utilization in the therapy of definite diseases as muscle wasting, osteoporosis, growth disorders and control of refractory anemia (Chawla et al., 2009;Saha et al., 2009;Allouh and Rosser, 2010). ND simulates testosterone in its structure yet, it is supposed as a weak androgenic steroid owing to its transformation to dihydronandrolone (DHN) (Mottram and George, 2000;Lee et al., 2010;Purkayastha and Mahanta, 2012). ...
... Nandrolone decanoate is known as a multifaceted substance with both beneficial and harmful properties [31]. For example: in case of postmenopausal osteoporosis [32]; on weight and lean body mass in HIV-infected humans [33]; to treat anemia associated with chronic kidney failure [34]; to treat prostate cancer and benign prostate hyperplasia, because nandrolone could not be converted into dihydrotestosterone, the most potent androgen [35]. ...
Article
Full-text available
The objective was the cytoarchitecture evaluation of known steroid dependent target tissues after administering of testosterone, compared to action of its more active ester, nortestosterone (nandrolone decanoate) in castrated rat males in the aim of Hershberger bio test. Study was performed on 30 castrated male Wistar rats, aged between 35 and 39 days, in peripubertal period, divided into five groups. Androgen doses administration begun at the rats’ age of 49 days. Animals were injected i.m., daily, for 10 consecutive days as follows: Aquatest (Balkan Pharmaceuticals Ltd., Moldova) testosterone aqueous solution: Testosterone I group (0.4 mg/animal); Testosterone II (0.8 mg/animal); (DecaDurabolin, Balkan Pharmaceuticals); nandrolone decanoate oily solution: Nortestosterone I (1.5 mg/kg body weight); Nortestosterone II (7.5 mg/kg body weight) and Control (White sesame oil, Manicos, Romania, 0.1 mL/animal). Gonadectomy (GDX) induced modifications of target tissues wet weight accompanied by important modifications in cytoarchitecture. Changes following exogenous administration of testosterone and nortestosterone decanoate were found in: liver (granular dystrophy, mega-mitochondria, tubular intumescences), prostate (increasing of the structural elements), seminal vesicles (hyalinosis, thickening of cell walls and the hyaline presence), levator ani–bulbocavernosus muscle (muscle fibbers dilacerations), bulbourethral glands (muscular fibbers rarefaction by fluid accumulation) demonstrating the disruptor activity especially for overdosed nandrolone decanoate.
Article
The present study aims of to investigate the effects of low and high doses of nandrolone decanoate (ND) on histopathology and apoptosis of the spermatogenic cells as well as lipid peroxidation, antioxidant enzyme activities, sperm abnormality and DNA fragmentation. Eighteen animals were divided into three groups each group contain six animals. The rats were divided into three groups as following: Group 1 was administered saline (control). Group 2, received nandrolone decanoate (3 mg/kg/weekly) (low dose) with intramuscular injection. Group 3, received intramuscular injection dose of nandrolone decanoate (10 mg/kg/weekly) (high dose). After 8 weeks, caspase-3 assay was used to determine the apoptotic cells. The sperm parameters, lipid peroxidation, antioxidant enzyme activities and testosterone concentration were also investigated in the experimental groups of both low and high dose compared to the control groups. Treated group with high dose showed degenerated germinal epithelial cells sloughed in the lumina of seminiferous tubules, where almost seminiferous tubules were devoid of spermatids and spermatozoa compared to control and group treated with low dose. Also, a significant increase of lipid peroxidation levels and heat shock proteins was observed in two groups administrated with two different doses of ND while, antioxidant enzyme activities, and testosterone concentration was significantly decreased in two treated group when compared with control. Administration of ND at high and low doses leads to deteriorated sperm parameters, DNA fragmentation and testicular apoptosis. In conclusion, the administration ND at high doses more effective on lipid peroxidation, antioxidant enzyme activities, sperm abnormality, histopathology, apoptotic and DNA changes compared to low dose group and to control group.
Article
Full-text available
Unlabelled: BACKGROUND To look at possible long-term risks from anabolic steroids and other xenobiotics in beef, we examined men's semen quality in relation to their mother's self-reported beef consumption during pregnancy. Methods: The study was carried out in five US cities between 1999 and 2005. We used regression analyses to examine semen parameters in 387 partners of pregnant women in relation to the amount of beef their mothers reported eating while pregnant. Mothers' beef consumption was also analysed in relation to the son's history of previous subfertility. RESULTS Sperm concentration was inversely related to mothers' beef meals per week (P = 0.041). In sons of "high beef consumers" (>7 beef meals/week), sperm concentration was 24.3% lower (P = 0.014) and the proportion of men with sperm concentration below 20 x 10(6)/ml was three times higher (17.7 versus 5.7%, P = 0.002) than in men whose mothers ate less beef. A history of previous subfertility was also more frequent among sons of "high beef consumers" (P = 0.015). Sperm concentration was not significantly related to mother's consumption of other meat or to the man's consumption of any meat. CONCLUSIONS These data suggest that maternal beef consumption, and possibly xenobiotics in beef, may alter a man's testicular development in utero and adversely affect his reproductive capacity.
Article
The report presents the case of a sportswoman who accused her coach of having administered to her doping substances. During the judicial proceedings, biological samples of urine and hair were collected from this sportswoman. In the urine sample, a nandrolone metabolite was detected, but the result of hair analysis was negative. The paper presents possible reasons for the presence of 19-norandrosterone in urine, as well as the difficulties associated with interpretation of 19-norandrosterone detection during the doping control.
Article
The presence and metabolism of endogenous steroid hormones in meat-producing animals has been the subject of much research over the past 40 years. While significant data are available, no comprehensive review has yet been performed. Species considered in this review are bovine, porcine, ovine, equine, caprine and cervine, while steroid hormones include the androgenic-anabolic steroids testosterone, nandrolone and boldenone, as well as their precursors and metabolites. Information on endogenous steroid hormone concentrations is primarily useful in two ways: (1) in relation to pathological versus 'normal' physiology and (2) in relation to the detection of the illegal abuse of these hormones in residue surveillance programmes. Since the major focus of this review is on the detection of steroids abuse in animal production, the information gathered to date is used to guide future research. A major deficiency in much of the existing published literature is the lack of standardization and formal validation of experimental approach. Key articles are cited that highlight the huge variation in reported steroid concentrations that can result when samples are analysed by different laboratories under different conditions. These deficiencies are in most cases so fundamental that it is difficult to make reliable comparisons between data sets and hence it is currently impossible to recommend definitive detection strategies. Standardization of the experimental approach would need to involve common experimental protocols and collaboratively validated analytical methods. In particular, standardization would need to cover everything from the demographic of the animal population studied, the method of sample collection and storage (especially the need to sample live versus slaughter sampling since the two methods of surveillance have very different requirements, particularly temporally), sample preparation technique (including mode of extraction, hydrolysis and derivatization), the end-point analytical detection technique, validation protocols, and the statistical methods applied to the resulting data. Although efforts are already underway (at HFL and LABERCA) to produce more definitive data and promote communication among the scientific community on this issue, the convening of a formal European Union working party is recommended.
Article
Elite athletes, body builders and adolescents misuse anabolic-androgenic steroids (AAS) in order to increase muscle mass or to enhance physical endurance and braveness. The high doses misused are associated with numerous adverse effects. The purpose of this study was to evaluate the impact of chronic supratherapeutic AAS treatment on circulating hormones and gene expression in peripheral tissues related to such adverse effects. Quantitative real-time PCR was used to measure expression levels of in total 37 genes (including peptide hormones, cell membrane receptors, nuclear receptors, steroid synthesising enzymes and other enzymes) in the pituitary, testes, adrenals, adipose tissue, kidneys and liver of male Sprague-Dawley rats after 14-day administration of the AAS nandrolone decanoate, 3 or 15 mg/kg. Plasma glucose and levels of adrenocorticotropic hormone (ACTH), adiponectin, corticosterone, ghrelin, insulin and leptin were also measured. We found several expected effects on the hypothalamic-pituitary-gonadal axis, while the treatment also caused a number of other not previously identified changes in circulating factors and gene transcription levels such as the dose-dependent reduction of the beta(3)-adrenergic receptor in adipose tissue, reduction of both circulating and mRNA levels of adiponectin, up-regulation of both hydroxymethylglutaryl-CoA-reductase, the rate-limiting enzyme in de novo synthesis of cholesterol, and the receptor for ACTH in the adrenals. The results provide evidence for wide ranging effects of AAS on the hypothalamic-pituitary-adrenal axis, adipose tissue and substrates of the renal control of blood pressure.
Article
Urine samples were collected from five Brown Swiss cows during the 18 days prior to and 11 days after parturition and were analysed for 19-nortestosterone using an enzyme immunoassay. Nortestosterone concentrations ranged from 70 to 130 nmol/l in all samples taken before parturition. The levels declined within two days, and 11 days post partum no nortestosterone was detectable. In urine from newborn calves, maximal nortestosterone concentrations were determined during the first day of life (10.9-120 nmol/l), declining below 7.3 nmol/l until day 3 in most animals and remaining below the detection limit (less than 3.6 nmol/l) after day 8 in all animals. There was no obvious difference between cows carrying a male or a female calf nor between newborn male or female calves. Using the combined methods high performance liquid chromatography/enzyme immunoassay and high performance liquid chromatography/gas chromatography-mass spectrometry, the immunoreactivity in urine was identified to be 19-nortestosterone-17 alpha. Although there is unequivocal evidence for the endogenous production of nortestosterone in pregnant cows, its function for placenta physiology, pregnancy anabolism and parturition remains unclear. However, new threshold levels for residue control of nortestosterone need to be fixed in accordance with the endocrine status of the animals.
According to the results reported in the literature and from our own experience, the following recommendations for the treatment of children with GHD can be given: In order to start GH replacement therapy in early childhood the diagnosis of GHD should be made as early as possible. The growth hormone dose during prepubertal age should not fall short of 12 IU/m2 per week. During spontaneous or induced puberty, the dose needs to be increased, possibly by a factor of two. Daily subcutaneous injections appear most suitable. Treatment with growth hormone releasing factors in cases with hypothalamic GHD, although a promising alternative to the treatment with hGH (Thorner et al, 1985), must be considered experimental at this point. Thyroxine replacement at a daily dose of 75-100 micrograms/m2 should be given in cases of secondary hypothyroidism. Glucocorticoid replacement, if required, should be given at low doses (e.g. hydrocortisone 10 (to 15) mg/m2 per day in divided doses). In cases with additional gonadotropin deficiency, sex steroids (or anabolic steroids) should be given with frequent monitoring of bone maturity not before the age of 13 in girls or 15 years in boys. In boys depot testosterone starting at low doses (e.g. 50-100 mg/month i.m.) will induce a puberty-like increment in height velocity. Since the effect of oestrogens--even in low doses--on growth is uncertain, their administration before achievement of near-normal adult height should be avoided. With the advancement of diagnostic techniques and with the experience in treatment accumulated over the past 25 years, patients with GHD need no longer become dwarfs.
Article
A two-part study was performed to determine the ef fects of high doses of anabolic steroids on weight, appetite, and organ histology. Initially, 30 white Wistar rats, 15 males and 15 females, were treated weekly with either 0.52 cc of physiologic saline or nandrolone decanoate. After 6 weeks, female treated and control rats had comparable weight gains, but male treated rats were significantly lighter than controls. Rats were sacrificed and organs dissected for histologic prepara tion. Treated male livers had less lipid than control males. The uteri of treated females displayed abnormal vacuolization, stromal edema, and peliosis. In Part 11, 12 male rats, 6 treated and 6 control, were given the drug or saline in a manner identical to that in Part I. Treated rats had lower weights from Weeks 1 through 6 and ate less than controls. Upon sacrifice, treated rats' kidneys were heavier, and testes and liver were lighter compared to controls. Roentgenographic studies of tibias from Parts I and II showed no significant differences in tibial length or height of growth plate between treated and control groups. In summary, when anabolic steroid use is studied in the rat model, numer ous pathological and anatomical changes occur.
Article
Nortestosterone is a major growth-promoting agent in Europe which is often used illegally in various species of meat animal. Recent studies showed that this compound was also present in the urine of young male pigs (boars) to which nortestosterone had not been administered. To determine to which extent nortestosterone may also be present in liver and muscle tissues, samples of the urine, bile, liver and muscle of twenty five boars were analysed. The mean and highest concentrations, detected respectively in muscle were 1.1 and 13 micrograms/kg and were 23 and 200 micrograms/kg in liver. The corresponding concentrations in urine were 55 and 132 micrograms/l and 88 and 212 micrograms/l in bile.
Article
Different anabolic steroids can exercise different effects on the pituitary-gonadal axis in males. During a pilot study regarding the possible beneficial effect of the anabolic steroid nandrolondecanoate (ND) on bone metabolism in patients with rheumatoid arthritis additional endocrinological parameters were studied. A significant decrease was found in the serum levels of testosterone, androstenedione and FSH and the ratio of testosterone/oestradiol. There was a significant increase in the serum levels of oestrone. The levels of oestradiol, SHBG, LH and cortisol remained unchanged. An inhibitory effect of ND on testicular testosterone secretion is assumed. The decrease in androstenedione levels is explained by the diminished testosterone secretion. The rise in oestrone levels is explained by peripheral aromatizing of ND to oestrogens. The presented findings are in accordance with the hypothesis that sex steroids can act directly on the pituitary resulting in selective FSH and LH secretion. The possible role of the ratio testosterone/oestradiol in controlling gonadotrophin output is discussed.