Content uploaded by Charles Linkem
Author content
All content in this area was uploaded by Charles Linkem on Jul 21, 2014
Content may be subject to copyright.
Accepted by P. Passos: 23 May 2014; published: 1 Jul. 2014
ZOOTAXA
ISSN 1175-5326 (print edition)
ISSN
1175-5334
(online edition)
Copyright © 2014 Magnolia Press
Zootaxa 3826 (3): 475
–
496
www.mapress.com
/
zootaxa
/
Article
475
http://dx.doi.org/10.11646/zootaxa.3826.3.3
http://zoobank.org/urn:lsid:zoobank.org:pub:8D8FCB6B-E1DC-4A00-9257-BCAB7D06AE22
Multilocus species delimitation in the Crotalus triseriatus species group
(Serpentes: Viperidae: Crotalinae), with the description of two new species
ROBERT W. BRYSON, JR.
1,8
, CHARLES W. LINKEM
1
, MICHAEL E. DORCAS
2
, AMY LATHROP
3
,
JASON M. JONES
4
, JAVIER ALVARADO-DÍAZ
5
, CHRISTOPH I. GRÜNWALD
6
& ROBERT W. MURPHY
3,7
1
Department of Biology & Burke Museum of Natural History and Culture, University of Washington, Box 351800, Seattle, WA 98195-
1800, USA. E-mail: brysonjr@uw.edu
2
Department of Biology, Davidson College, Davidson, NC 28035-7118, USA. E-mail: midorcas@davidson.edu
3
Centre for Biodiversity and Conservation Biology, Royal Ontario Museum, Toronto, Ontario, Canada M5S 2C6.
E-mail: amyl@rom.on.ca; bob.murphy@utoronto.ca
4
16310 Avenida Florencia, Poway, California 92064, USA. E-mail: jasonjones@crotalus.com
5
Instituto de Investigaciones sobre los Recursos Naturales, Universidad Michoacana de San Nicolás de Hidalgo, Av. San Juanito Itzic-
uaro s/n, Col. Nueva Esperanza, C.P. 58337, Morelia, Michoacán, México.
6
Carretera Chapala-Jocotepec Oriente #57-1, Col. Centro, C.P. 45920, Ajijic, Jalisco, México. E-mail: cgruenwald@switaki.com
7
State Key Laboratory of Genetic Resources and Evolution, and Yunnan Laboratory of Molecular Biology of Domestic Animals, Kun-
ming Institute of Zoology, Chinese Academy of Sciences, 32 Jiaochang Donglu, Kunming 250223, Yunnan, China.
E-mail: bob.murphy@utoronto.ca
8
Corresponding author. E-mail: brysonjr@uw.edu
Abstract
Members of the Crotalus triseriatus species group of montane rattlesnakes are widely distributed across the highlands of
Mexico and southwestern USA. Although five species are currently recognized within the group, species limits remain to
be tested. Genetic studies suggest that species may be paraphyletic and that at least one cryptic species may be present.
We generate 3,346 base pairs of DNA sequence data from seven nuclear loci to test competing models of species delimi-
tation in the C. triseriatus group using Bayes factor delimitation. We also examine museum specimens from the Trans-
Mexican Volcanic Belt for evidence of cryptic species. We find strong support for a nine-species model and genetic and
morphological evidence for recognizing two new species within the group, which we formally describe here. Our results
suggest that the current taxonomy of the C. triseriatus species group does not reflect evolutionary history. We suggest sev-
eral conservative taxonomic changes to the group, but future studies are needed to better clarify relationships among spe-
cies and examine genetic patterns and structure within wide-ranging lineages.
Key words: Bayes factor delimitation, cloud forest, Mexico, Trans-Mexican Volcanic Belt
Resumen
Miembros del grupo Crotalus triseriatus se encuentran ampliamente distribuidos en las tierras altas de México y el
suroeste de Estados Unidos. Aunque actualmente se reconocen cinco especies dentro del grupo, los límites entre especies
no han sido formalmente evaluados. Estudios genéticos sugieren que las especies pueden ser parafiléticas y que al menos
una especie criptica puede estar presente. Generamos una secuencia de datos de 3,346 pares de bases de ADN provenientes
de siete loci nucleares para evaluar modelos contrastantes de delimitación de especies en el grupo C. triseriatus usando el
factor de delimitación de Bayes. En la búsqueda de especies cripticas, también examinamos ejemplares de museo prove-
nientes del Eje Neovolcánico. Encontramos fuerte soporte para un modelo de nueve especies y evidencia genética y mor-
fológica para reconocer dos nuevas especies dentro del grupo, las que formalmente describimos aquí. Nuestros resultados
sugieren que la taxonomía actual de las especies del grupo C. triseriatus no refleja la historia evolutiva. Sugerimos varios
cambios taxonómicos conservadores al grupo, requiriéndose de estudios futuros para delinear de manera más fina las rel-
aciones entre especies y para examinar la estructura filogeográfica dentro de linajes de amplia distribución.
Palabras clave: factor de delimitación de Bayes, bosque de niebla, México, Eje Neovolcánico
BRYSON ET AL.
476
·
Zootaxa 3826 (3) © 2014 Magnolia Press
Introduction
Members of the Crotalus triseriatus species group are widely distributed across the highlands of Mexico and the
southwestern USA. Currently the group contains five species (Murphy et al. 2002; Bryson et al. 2011). The
nominate species, C. triseriatus (Wagler 1830), contains the subspecies C. t. triseriatus Klauber 1952 and C. t.
armstrongi Campbell 1979, which occur in mixed pine-oak forests across the Trans-Mexican Volcanic Belt.
Crotalus pusillus Klauber 1952 ranges across the highlands of the Sierra de Coalcomán and the western portion of
the Trans-Mexican Volcanic Belt. Crotalus aquilus Klauber 1952, previously considered a subspecies of C.
triseriatus (Dorcas 1992), occurs north of the Trans-Mexican Volcanic Belt along the Central Mexican Plateau in
mixed pine-oak and rocky mesquite grasslands. Crotalus lepidus (Kennicott 1861) is the widest ranging species in
the group. It contains four subspecies distributed across a variety of habitats in northern Mexico and southwestern
USA. Crotalus l. lepidus occurs in rocky regions of the Chihuahuan Desert and adjacent uplands, C. l. klauberi
Gloyd 1936 inhabits the Sierra Madre Occidental and sky islands of the southwestern USA and northern Mexico,
C. l. morulus Klauber 1952 occurs in the northern Sierra Madre Oriental, and C. l. maculosus Tanner, Dixon &
Harris 1972 occupies the Pacific slopes of the southern Sierra Madre Occidental. Crotalus ravus Cope 1865 was
recently added to the C. triseriatus group (Bryson et al. 2011) and it includes three subspecies, C. r. ravus, C. r.
brunneus (Harris & Simmons 1978), and C. r. exiguus (Campbell & Armstrong 1979), found along the eastern
slopes of the Trans-Mexican Volcanic Belt and Sierra Madre del Sur.
Species composition of the C. triseriatus group has changed several times over the past 70 years (Gloyd 1940;
Smith 1946; Klauber 1952; Brattstrom 1964; Klauber 1972; Dorcas 1992; Murphy et al. 2002; Bryson et al. 2011).
The most recent molecular studies of the group (Castoe & Parkinson 2006; Bryson et al. 2011; Reyes-Velasco et al.
2013) found strong support for a monophyletic assemblage that includes C. triseriatus, C. pusillus, C. aquilus, C.
lepidus, and C. ravus. One of these studies (Bryson et al. 2011) also found evidence that C. triseriatus and C.
lepidus are paraphyletic and that at least one cryptic species was present within the C. triseriatus group (Fig. 1).
Although this study extensively sampled the geographic range of the C. triseriatus group, analyses reconstructed
matrilineal relationships only because of a reliance on mitochondrial DNA (mtDNA). Reliance on single genes and
mtDNA alone can mislead phylogenetic inferences (e.g., Bossu & Near 2009; Bryson et al. 2010; Leaché 2010;
Myers et al. 2013; Ruane et al. 2014).
Despite seven decades of systematic study, no study has tested species limits in the C. triseriatus group.
Species within the group were recognized and classified long ago based on morphology alone (Gloyd 1940; Smith
1946; Klauber 1952; Brattstrom 1964; Klauber 1972). Recent research has focused on reconstructing phylogenies
(Murphy et al. 2002; Reyes-Velasco et al. 2013) or on using phylogenies to address evolutionary and
biogeographic questions (Bryson et al. 2011). However, it is important to explicitly delimit taxa prior to
constructing phylogenies (Myers et al. 2013; Ruane et al. 2014). Unrecognized species diversity can decrease the
accuracy of phylogenetic, phylogeographic, and biogeographic studies (reviewed in Ruane et al. 2014).
Herein, we use data from seven nuclear loci to test competing models of species delimitation in the C.
triseriatus group. We test different models of species delimitation using the recently developed Bayes factor
delimitation (BFD) method, which has a number of advantages over other Bayesian species delimitation
approaches (Grummer et al. 2014; Leaché et al. 2014). We explicitly compare models that reflect historical
taxonomy against models that reflect phylogeographic structure and contain cryptic species. We also examine
museum specimens for morphological congruence to cryptic species along the Trans-Mexican Volcanic Belt
hypothesized in a previous study (Bryson et al. 2011).
Material and methods
Taxon sampling and molecular data assembly. We sequenced 39 samples to cover broadly the geographic range
of the C. triseriatus group (Appendix 1). Each of the eight major mitochondrial lineages in Bryson et al. (2011)
was represented by 3–6 samples (Fig. 1). We also evaluated the deeply divergent and geographically isolated
lineage of C. t. armstrongi from western Jalisco and Colima (Bryson et al. 2011). We grouped the three subspecies
of C. ravus into one lineage and three of the four subspecies of C. lepidus (C. l. lepidus, C. l. klauberi, and C. l.
maculosus) into one lineage for model testing. Genetic structure among these taxa was considerably less
pronounced than among the eight major mitochondrial lineages (Bryson et al. 2011).
Zootaxa 3826 (3) © 2014 Magnolia Press
·
477
SPECIES DEL IMITATION IN THE CROTALUS TRISERIATUS GROUP
FIGURE 1. Simplified phylogeny of the Crotalus triseriatus species group based on Bayesian analysis of 2,408 base pairs of
mitochondrial DNA obtained from 130 snakes (from Bryson et al. 2011).
We sequenced seven nuclear genes, including TATA box-binding protein (TBP), ETS oncogene (ETS),
prolactin receptor and recombination-activating gene 2 (Rag2PY), and three anonymous nuclear loci (Locus25,
Locus23, and Locu A). Five of these genes (TBP, ETS, Locus25, Locus23, and LocusA) were used in previous
research on rattlesnake phylogenetics (Kubatko et al. 2011). We extracted total genomic DNA from liver, shed
skins, or ventral scale clips following methods specified in Bryson et al. (2011). All gene regions were amplified
via polymerase chain reaction (PCR) using previously published primers (Appendix 2) in a 25 µl reaction volume
containing 0.8 µl deoxynucleoside triphosphates (dNTPs) (10 mM), 19.0 µl double-distilled water, 1.0 µl each
primer (10 pM), 2.5 µl 1x PCR buffer (1.5 mM MgCl2; Fisherbrand, Pittsburgh, PA, USA), 0.75 U Taq DNA
polymerase (Fisherbrand), and 1.0 µl template DNA. PCR parameters included denaturation at 94 °C for 2 min,
followed by 39 cycles of: 94 °C for 30 s, 49–55 °C for 45 s (Appendix 2), 72 °C for 45 s. A final extension phase of
72 °C for 7 min terminated the protocol. We visualized the entire 25 µl reaction on a 1% agarose gel containing
BRYSON ET AL.
478
·
Zootaxa 3826 (3) © 2014 Magnolia Press
ethidium bromide. Sharp, clear bands were excised from the gel and placed in a filter tip (Sorenson; 75-30550T).
DNA was collected in a 1.7 ml Eppendorf tube after centrifuging the DNA through the filter tip for 10 min at 16.1
rcf. We sequenced in both directions using the amplification primers and Big Dye Terminator v3.1 cycle
sequencing kit (Applied Biosystems, Foster City, CA, USA). We used 4 µl of the cleaned PCR product in one-
quarter reaction volume of that recommended by ABI (Applied Biosystems). Samples were analyzed with an ABI
Prism 3100 Genetic Analyzer (Applied Biosystems).
Forward and reverse sequences for each individual were edited and manually aligned using BIOEDIT v5.0.9
(Hall 1999). We phased nuclear genes using PHASE v2.1.1 (Stephens et al. 2001; Stephens & Donnelly 2003) and
retained the most probable pair of alleles for each heterozygous individual. To assess the degree of gene tree
discordance among genes, we generated maximum likelihood gene trees for each phased gene using RAxML
v7.2.8 (Stamatakis 2006). We used jModelTest v2.0.2 (Guindon & Gascuel 2003; Darriba et al. 2012) to calculate
best-fit models of evolution for each phased gene, and selected the most parameter-rich model in the AIC 95%
credible set as the best model.
Species delimitation. We used BFD (Grummer et al. 2014) to test competing models of species delimitation.
We preferred this method to other species-delimitation approaches for several reasons, including the ability of BFD
to compare non-nested models that contain different numbers of species and its ability to integrate over species
trees during the delimitation process rather than relying on a specified guide tree (Grummer et al. 2014, Leaché et
al. 2014). Further, obtaining decisive support with BFD for models that incorrectly split weakly diverged species or
species connected by moderate to high gene flow is difficult to obtain (Leaché et al. 2014).
We grouped individuals into 16 alternative hypotheses based on prior taxonomic work and morphological
assessments (Table 1). In general, models with fewer numbers of species reflected historical groupings (e.g.,
Klauber 1952, 1972; Campbell 1979; Dorcas 1992), whereas models with higher numbers of species reflected
matrilineal (mtDNA) structure (Bryson et al. 2011). For each hypothesis, we ran species-tree analyses using the
multi-species coalescent algorithm in *BEAST (Heled & Drummond 2010), a part of the BEAST v1.7.4 package
(Drummond & Rambaut 2007). We assigned genes to their best-fit model of evolution with a strict-molecular clock
in all analyses due to the low complexity of the individual genes sampled and to prevent overparameterization.
Preliminary analyses of individual genes showed no difference in gene tree topology when using a strict or relaxed
clock. Marginal likelihood values based on path-sampling (Lartillot & Philippe 2006) and stepping-stone sampling
(Xie et al. 2011) were calculated for each hypothesis based on the methods of Baele et al. (2012, 2013) and
Grummer et al. (2014). We ran the marginal likelihood analyses for 1 million generations with 100 path steps
(totaling 100 million generations), logging trees and parameter estimates every 20,000 steps. We ranked and
compared the resulting marginal likelihood values for path-sampling and stepping stone sampling using Bayes
factors (BF; Kass & Raftery 1995) and the following BF scale (values indicate 2lnBF): 0–6 = positive support,
6–10 = strong support, and >10 = decisive support (Kass & Raftery 1995).
We used the preferred species model based on BFD in a separate *BEAST analysis to produce a preferred
species tree. We assigned individuals to species according to the preferred BFD model and used best-fit models of
DNA evolution for each gene with a strict molecular clock and a Yule species tree prior and constant population
size for the species tree. We ran analyses twice, each for 200 million generations sampling every 20,000
generations. We assessed convergence between runs in Tracer v1.5 (Rambaut & Drummond 2007), ensuring ESS
values for all parameters were above 200. Topological convergence was assessed with Are We There Yet (AWTY:
Wilgenbush et al. 2004; Nylander et al. 2008) using the compare function. We combined tree files using
LogCombiner v1.7.5 (Drummond & Rambaut 2007) and produced a maximum clade credibility tree using
TreeAnnotator v1.7.5 (Drummond & Rambaut 2007). Finally, we generated a cloudogram of the posterior
distribution of species trees in Densitree v2.1.7 (Bouckaert 2010) to illustrate the uncertainty in the relationships
between species.
Zootaxa 3826 (3) © 2014 Magnolia Press
·
479
SPECIES DEL IMITATION IN THE CROTALUS TRISERIATUS GROUP
BRYSON ET AL.
480
·
Zootaxa 3826 (3) © 2014 Magnolia Press
Morphological data. We examined museum specimens of the C. triseriatus group from along the Trans-
Mexican Volcanic Belt of central Mexico (Appendix 3) for morphological congruence of cryptic species
hypothesized by Bryson et al. (2011). Acronyms used for museum specimens follow Sabaj Pérez (2013) except for
Universidad Michoacana de San Nicolás de Hidalgo, Michoacán, abbreviated HINIRENA. We examined 19
characters historically used for distinguishing species in the C. triseriatus group (Dorcas 1992). We first noted the
number or arrangement of meristic characters, including supralabials, infralabials, upper preoculars, canthals,
intercanthals, prefrontals, ventrals, subcaudals, and rattle-fringe scales. We then measured tail length and proximal
rattle width, and standardized these measurements by dividing them by total length and head length, respectively.
Finally, we examined aspects of color pattern, including dorsal blotches (and interspace between lateral blotches),
tail bands, ventral mottling, tail color (ventrally), proximal rattle color, and postocular stripe. Scale counts and
definitions of external morphological features follow Dorcas (1992). Body and tail lengths were measured using a
meter stick to the nearest mm; all other measurements were made to the nearest 0.01 mm with a digital caliper.
Scale counts were made with the aid of a dissecting microscope. Meristic asymmetry was noted as left/right.
Juvenile snakes less than 300 mm long (Dorcas 1992) were not used in comparisons of tail length, proximal rattle
width and color, and tail color.
Results
Sequence data. We obtained a total of 3,346 aligned base pairs of DNA sequence data from the seven loci (Table
2). The number of variable sites within each phased gene ranged from 5 (Locus25) to 55 (LocusA). Individual gene
trees (not shown) contained few strongly supported nodes.
TABLE 2. Information on the seven nuclear loci used in this study, including length in base pairs (bp) after alignment,
number of variable sites, and model of evolution.
Species delimitation. Bayes factor comparisons of 16 competing models of species delimitation in the C.
triseriatus group decisively favored a model with nine species (M16) over competing models based on both
stepping-stone and path-sampling (Table 1). The 2lnBF score of the nine-species model over the next ranked model
(M9) was > 40. Models that lumped species, particularly into historical classifications (e.g., grouping all of the
former populations of C. triseriatus together, M1; grouping all of the former populations of C. triseriatus together
except for C. aquilus, M3 and M4), consistently ranked low.
The preferred species tree revealed weak support among most species relationships in the C. triseriatus group
(Fig. 2). Three nodes within the group received moderate support. One node supported a large clade that contained
a putative undescribed species (see below), C. pusillus, C. armstrongi, C. triseriatus, C. aquilus, C. morulus, and C.
lepidus (0.85 posterior probability). Within this clade, C. triseriatus was supported as the sister species (1.0
posterior probability) to a subclade containing C. aquilus, C. morulus, and C. lepidus (0.85 posterior probability).
The cloudogram demonstrated uncertainty in species relationships across the posterior distribution of species trees,
and this uncertainty was especially evident near the base of the trees (Fig. 2).
Morphology. No single morphological character distinguished any one of the five species distributed along
the Trans-Mexican Volcanic Belt of central Mexico (Table 3) with one exception: the lack of intercanthals in C.
pusillus was not shared with any other lineage. Notwithstanding, unique combinations of morphological characters
separated most species, particularly the condition of the upper preocular, arrangement of scales in the prefrontal
Locus Aligned length (bp) Variable sites Model
TATA box-binding protein (TBP) 862 19 HKY + G
ETS oncogene (ETS)6617HKY + G
Prolactin Receptor (PRLR) 478 36 HKY + G
Recombination-activating gene 2 (Rag2PYI) 408 21 K80
Anonymous 25 (Locus25) 242 5 K80 + G
Anonymous 63 (Locus63) 449 23 F81 + G
Anonymous A (LocusA) 246 55 K80 + G
Zootaxa 3826 (3) © 2014 Magnolia Press
·
481
SPECIES DEL IMITATION IN THE CROTALUS TRISERIATUS GROUP
region, number of ventrals and subcaudals, tail length and proximal rattle width ratios, number of dorsal and tail
blotches, pale interspaces between dorsal and lateral blotches, shape of the postocular stripe, and color of the
venter, tail, and proximal rattle. The combination of the mean number of ventrals, subcaudals and dorsal blotches,
condition of the upper preocular, and tail length and proximal rattle width ratios separated all species.
Recognition of new species. The species delimitation model with the best marginal likelihood values strongly
supported the recognition of two new species within the C. triseriatus group. These two new species were also
phenotypically distinct from most of their close relatives (Table 3), and the mean number and frequency of
occurrence of morphological characters in both species were unique. Each new species also appeared to be
geographically isolated from similar species (Fig. 3) and to have occupied different habitats (see below).
Collectively, these results suggested that each species represented a distinct lineage with a unique evolutionary
history and independent evolutionary trajectory.
FIGURE 2. Posterior density of species trees (cloudogram) from *BEAST analyses of seven nuclear loci for the Crotalus
triseriatus species group. Darker areas represent regions of tree space where the majority of trees agree in topology. Upper left
inset shows the maximum clade credibility species tree with posterior probability values for each node. Crotalus tlaloci sp. nov.
and Crotalus campbelli sp. nov. indicated by bold font.
BRYSON ET AL.
482
·
Zootaxa 3826 (3) © 2014 Magnolia Press
TABLE 3. Summary of meristic, morphometric, and color pattern characters for members of the Crotalus triseriatus species group distributed across the Trans-
Volcanic Belt. Range followed by mean in parentheses for all characters except for rattle fringe scales, supralabials, infralabials, intercanthals, and tail bands,
where range is followed by mode in parentheses. Ventral and subcaudal counts are shown for males (above) and females (below). Tail length ratio for C. pusillus
from Klauber (1952). Names of species reflect the taxonomy proposed here.
Character C. pusillus (n = 33) C. campbelli sp. nov.
(n = 6)
C. armstrongi
(n = 28)
C. tlaloci sp. nov.
(n = 12)
C. triseriatus (n = 21)
Supralabials 11–14 (12) 11–13 (12) 11–13 (12) 11–14 (12) 11–14 (12)
Infralabials 10–13 (11) 10–13 (12) 9–13 (12) 11–13 (12) 10–13 (11)
Upper preocular (% divided) 0 9.1 14.3 0 9.4
Canthals 2 2 2 2 2
Intercanthals 0 1–3 (1) 1–3 (2) 2 1–3 (2)
Posterior intercanthals 0 0–4 (2, 3) 1–4 (3) 1–2 (2) 1–4 (3)
Prefrontals symmetrical variable variable symmetrical variable
Ventrals 149–160 (154)
147–160 (154)
150–154 (152)
147–152 (149)
130–151 (141)
138–148 (144)
152–164 (156)
156–165 (159)
134–146 (141)
135–147 (142)
Subcaudals 26–32 (31)
25–27 (26)
31–32 (31)
22–26 (24)
24–31 (28)
19–28 (24)
27–33 (30)
22–32 (28)
21–32 (28)
21–26 (24)
Rattle fringe scales 7–10 (8) 8–9 (8) 7–10 (8) 8–10 (8) 8–10 (8)
Tail length ratio 10.5
8.6
9.1–11.0 (10.3)
7.5–8.9 (8.2)
8.8–10.9 (9.7)
5.7–9.9 (8.3)
8.9–11.3 (10.1)
8.0–10.7 (9.2)
8.0–12.1 (10.7)
7.9–9.4 (8.3)
Proximal rattle width ratio 9.4–13.2 (12.5) 11.0–14.6 (13.0) 11.6–15.9 (14.0) 11.1–14.5 (12.8) 14.3–18.0 (15.8)
Dorsal blotches 36–50 (42) 44–53 (48) 32–52 (42) 35–45 (43) 34–53 (46)
Dorsal and lateral blotches separated by
pale interspace
yes yes yes yes no
Tail bands 6–12 (8) 5–9 (9) 4–9 (6) 8–10 (8) 3–10 (7)
Venter mottling heavy heavy variable heavy variable
Tail color dark dark variable dark variable
Proximal rattle color dark dark variable dark variable
Postocular stripe uniform width, rarely
slight taper near eye
uniform width uniform width, rarely
slight taper near eye
distinct narrowing near
eye
uniform width
Zootaxa 3826 (3) © 2014 Magnolia Press
·
483
SPECIES DEL IMITATION IN THE CROTALUS TRISERIATUS GROUP
FIGURE 3. Geographic distribution of species in the Crotalus triseriatus species group distributed across the Trans-Volcanic
Belt. Circled dots indicate type localities. Arrows point to low-elevation depressions that are probable barriers to gene flow.
Names of species reflect our proposed taxonomy.
Crotalus tlaloci sp. nov.
Figs. 4–5, Table 3
Crotalus triseriatus triseriatus—Campbell & Lamar (2004): 527 (Map 90), 593 (in part).
Crotalus triseriatus triseriatus—Flores-Villela & Hernández-García (1989): 16.
Crotalus triseriatus triseriatus—Pérez-Ramos et al. (2000): 34.
Crotalus triseriatus triseriatus—Flores-Villela & Hernández-García (2006): 270.
Holotype. Adult female (MZFC 3666) collected 20 June 1986 by Efrain Hernández-García in “Los Llanos”
(18°36’N, 99°37’W; 2200–2300 m above sea level; asl hereafter), 10 km by road from Taxco to Tetipac, Sierra de
Taxco, municipality of Tetipac, state of Guerrero, Mexico.
Paratypes. 11 specimens. MEXICO: GUERRERO: Cerro del Huizteco, Sierra de Taxco, municipality of
Taxco (18°36'N, 99°36'W; 2300–2520 m asl); collected 22–23 August 1986 by E. Hernández-García (MZFC
3664–3665). “Arroyo las Damas”, Sierra de Taxco, municipality of Tetipac (18°38'N, 99°37'W; 1600–1850 m asl);
collected by E. Hernández-García (MZFC 3666). ESTADO DE MÉXICO: Acatitlán, municipality of Valle de
Bravo; collected 7 September 1988 by T. Hentschel-Maida (MZFC 4324). Los Álamos, municipality of Valle de
Bravo (19°11'20.2"N, 100°03'57.2"; 2201 m asl; NAD27 Mexico); collected 23 May 2008 by J. Jones, C. I.
Grünwald, and R. W. Bryson Jr. (HINIRENA 725–726). Los Álamos, municipality of Valle de Bravo
(19°11'20.2"N, 100°03'57.2"; 2201 m asl; NAD27 Mexico); collected 22 July 2009 by R. W. Bryson Jr. and M.
Torocco (MZFC 25114–25115). MORELOS: Km 12, Carr. Cuernavaca-Ocuilán, municipality of Cuernavaca;
collected 17 March 1990 by M. Torres Chávez (MZFC 4657). Carr. Cuernavaca-Ocuilán, near state border,
municipality of Cuernavaca (18°58'54.43"N, 99°18'20.43"W; 2268 m asl; WGS84); collected 13 June 2009 by J.
Jones, C. I. Grünwald, and R. W. Bryson Jr. (MZFC 25111). MICHOACÁN: N Arroyo Seco, municipality of
Aporo (19°40'28.3"N, 100°22'35.8"W; 2463 m asl; NAD27 Mexico); collected 24 May 2008 by J. Jones, C. I.
Grünwald, and R. W. Bryson Jr. (HINIRENA 724).
BRYSON ET AL.
484
·
Zootaxa 3826 (3) © 2014 Magnolia Press
Diagnosis. Crotalus tlaloci can be distinguished from all members of the C. triseriatus species group by the
combination of the following characters: (1) presence of intercanthals, (2) undivided upper preocular, (3) 152–164
ventrals in males, 156–165 in females, (4) 27–33 subcaudals in males, 22–32 in females, (5) small rattle (proximal
rattle width 11.1–14.5% of head length), (6) long tail (8.9–11.3% of total body length in males, 8.0–10.7% in
females), (7) usually two pairs of symmetrical, similarly sized intercanthals, and (8) dark postocular stripe that
noticeably narrows before reaching the posterior of the eye.
Crotalus tlaloci is most similar to species of the C. triseriatus group distributed along the Trans-Mexican
Volcanic Belt. Crotalus tlaloci is distinguished from these species by the presence of intercanthals (lacking in C.
pusillus), undivided upper preocular (divided 14.3% of the time in C. armstrongi and 9.4% of the time in C.
triseriatus), high number of ventrals (overlapping with C. pusillus, but mean number in C. tlaloci higher than C.
pusillus: 156 vs. 154, respectively), high number of subcaudals (mean number in females higher than in C. pusillus,
C. armstrongi, and C. triseriatus: 28 vs. 26, 24, and 24; in males, higher than in C. armstrongi and C. triseriatus:
30 vs. 28 in both), proportionately small proximal rattle (mean width smaller than in C. armstrongi and C.
triseriatus: 12.8% of head length vs. 14.0% and 15.8%), and proportionately longer tail (mean length in females
higher than in C. pusillus, C. armstrongi, and C. triseriatus: 9.2% of total length vs. 8.6%, 8.3%, and 8.3%). Most
specimens (10/12) possess two pairs of symmetrical, similarly sized intercanthals, creating the appearance of
butterfly wings. Of the 100 specimens in the C. triseriatus group that we examined, this symmetrical paired
arrangement of intercanthal scales in the prefrontal region (“butterfly wings”) was observed in only one other
specimen (C. armstrongi, CNAR 4498). Crotalus tlaloci also possess a dark postocular stripe that noticeably
narrows before reaching the posterior of the eye. In C. pusillus, C. armstrongi, and C. triseriatus, the postocular
stripe is generally of uniform width, although on rare occasions in C. pusillus and C. armstrongi it tapers slightly
before reaching the eye.
Description of the holotype. Rostral broader than high (4.0 x 2.8 mm); two internasals, in medial contact,
wider than long, rectangular, convex through center of scale; two canthals, large, convex, separated by two pairs of
square intercanthals; four large intersupraoculars posterior to intercanthals, followed by multiple rows of small
intersupraoculars. Naris centered between prenasal and postnasal scales, prenasal larger than postnasal and
wrapping around anterior aspect of rostrum; two loreals, lower larger; small upper loreal between canthal,
internasal, postnasal, and lower loreal. Loreal pit midway between eye and naris, below line from middle of eye to
naris, bordered by single prelacunal, postlacunal, lower preocular, and lower loreal; prelacunal contacting second
and third supralabials and a single prefovial (two prefovials on left); two prefovials on right, three on left; single
postfovial contacting postlacunal, lower preocular, first subocular, and fourth supralabial. Two preoculars, upper
large and convex, contacting supraocular and canthal, lower preocular thin and long; three suboculars, anterior
largest and in contact with fourth supralabial; three interoculabials posterior to anterior subocular; two postoculars,
dorsal twice as large as ventral. Supralabials 12/12; infralabials 13/13; first infralabials in medial contact posterior
to triangular mental; genials together resemble a heart shape. Midbody dorsal scale rows 22–23; preventral single;
ventrals 162; subcaudals 27, last subcaudal row divided into three scales; nine rattle fringe scales; tail bearing four
rattle segments.
Coloration significantly faded in preservative with body blotches and bands difficult to discern from ground
color. Ground color gray; occasional black speckling along body. Blotches faded to ground coloration in many
places, approximately 38 blotches visible. Blotches bordered by lighter coloration than ground color, also heavily
faded. Ground color of head gray, heavily stippled with dark brown throughout dorsal and anterior lateral regions
of the head; rostral and supralabials 1–4 heavily stippled, supralabials 5–7 with lighter stippling in the scale center;
infralabials with brown stippling on scale margins with white scale centers, extending to mouth; gular scales lightly
stippled, decreasing in frequency towards the midline of the head. Ventral scutes evenly stippled, increasing in
intensity posterior to mid-body with scutes becoming almost completely brown by the tail. Six dark tail bands, the
first two bordered by white bands; caudal scales dark brown. Proximal rattle black, distal sections brownish.
Zootaxa 3826 (3) © 2014 Magnolia Press
·
485
SPECIES DEL IMITATION IN THE CROTALUS TRISERIATUS GROUP
FIGURE 4. Lateral and dorsal view of the holotype of Crotalus tlaloci sp. nov. (MZFC 3666). The symmetrical paired
arrangement of intercanthal scales, shown here in gray, create the appearance of butterfly wings in the prefrontal region.
FIGURE 5. Crotalus tlaloci sp. nov. in life, (a) MZFC 25114, paratype from Valle de Bravo, Estado de México; (b)
HINIRENA 725, paratype from Valle de Bravo, Estado de México; (c) MZFC 25111, paratype from Cuernavaca-Ocuilán
highway, Morelos; and (d) HINIRENA 724, paratype from Arroyo Seco, Michoacán.
BRYSON ET AL.
486
·
Zootaxa 3826 (3) © 2014 Magnolia Press
Color in life. Color in life varies (Fig. 5), with most specimens vibrantly colored, although one is darkly
pigmented (MZFC 25111; Fig. 5). The holotype is known only from the preserved specimen.
Va ri at io n . Two specimens lack symmetrical paired intercanthals. The first, HINIRENA 725, has one pair of
anterior intercanthals but only a single large posterior intercanthal. The second, HINIRENA 724, has one pair of
anterior intercanthals, one of which is subdivided, followed by a single large posterior intercanthal. Supralabials in
five specimens (MZFC 3664, 3665, 4657, 25111, 25114) are horizontally divided. This split was in the 7
th
, 8
th
, or 9
th
supralabial and when present, occurred in supralabials on both sides of the head. Juveniles (MZFC 3664, 3665,
3667, HINIRENA 726) have cream-colored proximal rattles and pale-colored tails ventrally, typical of juveniles in
other species in the C. triseriatus group. Variation in meristic, morphometric, and color pattern characters within
the type series is listed in Table 3.
Etymology. This species is named for Tláloc, the Aztec god of rain.
Habitat and distribution. Crotalus tlaloci inhabits open areas in cloud forest and humid oak-pine forest along
the lower slopes of the Trans-Mexican Volcanic Belt. Although one record in the Sierra de Taxco (“Arroyo las
Damas”) is at 1850 m (Flores-Villela & Sánchez-H 2003), most records are at around 2000–2400 m asl. This
species is known from the states of Guerrero, Estado de México, Michoacán, and Morelos, and may range into
western Puebla. The vegetation where C. tlaloci is found is characterized by broad-leaf oaks, such as Quercus
candicans and Q. laurina, and dense undergrowth (Fig. 6), and is distinctly different than the drier pine-oak forest
inhabited by C. triseriatus. The distribution of C. tlaloci overlaps the ranges of two alligator lizards, Barisia
herrerae Zaldívar-Riverón & Nieto-Montes de Oca 2002 and B. rudicollis (Wiegmann 1828) (Zaldívar-Riverón &
Nieto-Montes de Oca 2002). Interestingly, both of these alligator lizards occur in similar humid forest habitat at
elevations of 2000–2500 m asl, and appear ecologically isolated from B. imbricata (Wiegmann 1828), which
inhabits the surrounding drier pine-oak forest (Zaldívar-Riverón & Nieto-Montes de Oca 2001, 2002). Specimens
of C. tlaloci are generally found in rocky open forest breaks and edges of cloud or humid oak-pine forest. However,
we found an adult gravid female and juvenile (HINIRENA 725, 726) under logs in a clearing relatively devoid of
rocky habitat.
FIGURE 6. Humid oak-pine forest habitat of Crotalus tlaloci sp. nov. at the paratype localities of (a) Los Álamos, near Valle
de Bravo, Estado de México; and (b) Arroyo Seco, Michoacán.
Crotalus campbelli sp. nov.
Figs. 7–8, Table 3
Crotalus triseriatus—Boulenger (1896): 581 (in part).
Crotalus triseriatus armstrongi—Dorcas (1992): 87 (in part).
Crotalus triseriatus armstrongi—Bryson et al. (2011): 699 (in part).
Crotalus triseriatus armstrongi—Reyes-Velasco et al. (2009): 118.
Zootaxa 3826 (3) © 2014 Magnolia Press
·
487
SPECIES DEL IMITATION IN THE CROTALUS TRISERIATUS GROUP
Crotalus armstrongi—Reyes-Velasco et al. (2013): 528 (in part).
Holotype. Adult female (KU 73649) collected 25 October 1962 by Percy L. Clifton (field number PLC 3216) in
the Sierra de Cuale, 9 km N El Teosinte, municipality of Talpa de Allende, state of Jalisco, Mexico.
Paratypes. 5 specimens. Mexico: JALISCO: same collection data as holotype (KU 73650). Las Playitas, Las
Joyas, Sierra de Manantlán, municipality of Autlán de Navarro; collected September 1985 by E. Fanti-Echegoyen
(UTA R-16352). Las Joyas, Sierra de Manantlán, municipality of Autlán de Navarro; collected September 1985 by
E. Fanti-Echegoyen (UTA R-16353). ca. 25 km SE Autlán, ca. 2.1 km (by dirt road) SE Manantlán; collected 27
July 1975 by G. M. Tilger and R. G. Arndt (AMNH R-113191). Lago de Juanacatlán, Sierra de Mascota,
municipality of Mascota (20°37'30.94"N, 104°43'36.30"W; 2009 m asl; WGS84); collected 10 April 2011 by R. W.
Bryson Jr. and M. Torocco (MZFC 28669).
Diagnosis. Crotalus campbelli can be distinguished from all members of the C. triseriatus species group
except C. armstrongi by the combination of the following characters: (1) presence of intercanthals, (2) infrequently
divided upper preocular (9.1% of the time), (3) 150–154 ventrals in males, 147–152 in females, (4) 31–32
subcaudals in males, 22–26 in females, (5) small rattle (proximal rattle width 11.0–14.6% of head length), (6) long
tail (9.1–11.0% of total body length in males, 7.5–8.9% in females), (7) pale interspaces between dorsal and lateral
blotches, (8) heavy venter mottling, (9) dark proximal rattle and underside of tail, and (10) usually a single large
anterior intercanthal. Crotalus campbelli can be distinguished from C. armstrongi based on higher mean number of
ventrals (152 in males and 149 in females vs. 141 and 144), higher mean number of subcaudals in males (31 vs.
28), less frequently divided upper preocular (9.1% vs. 14.3%), proportionately longer tail in males (10.3% of total
body length vs. 9.7%), smaller mean proximal rattle width (13.0% of head length vs. 14.0%), higher mean number
of dorsal blotches (48 vs. 42), and higher number of tail bands (mode of 9 vs. 6).
Crotalus campbelli is most similar to members of the C. triseriatus group distributed along the Trans-Mexican
Volcanic Belt, including C. pusillus, C. armstrongi, C. triseriatus, and C. tlaloci. Crotalus campbelli is
distinguished from C. pusillus by possessing intercanthals and an infrequently divided upper preocular, from C.
tlaloci by having an infrequently divided upper preocular, variable number of intercanthals, fewer ventrals (in
females, 147–152 vs. 156–165; in males, mean number 152 vs. 156), lower mean number of subcaudals in females
(24 vs. 28), proportionately shorter tail in females (8.2% of total length vs. 9.2%), and higher mean number of
dorsal blotches (48 vs. 43), and from C. triseriatus by a higher number of ventrals (in males, 150–154 vs. 134–146;
in females, mean number higher: 149 vs. 142), higher mean number of subcaudals in males (31 vs. 28),
proportionately smaller proximal rattle (13.0% of head length vs. 15.8%), and by having pale interspaces between
dorsal and lateral blotches. Crotalus campbelli is most similar in general appearance to C. armstrongi, but can be
distinguished from this species by characters mentioned above. Half of the specimens of C. campbelli also possess
a single, large anterior intercanthal. This scale arrangement is rarely seen in C. armstrongi and C. triseriatus.
Crotalus campbelli is easily distinguished from C. ravus by the lack of large head plates in the parietal region.
Description of the holotype. Rostral broader than high (3.7 x 2.6 mm); two internasals, in medial contact,
slightly wider than long, convex through center of scale; two canthals, large, convex, circular, separated by a
single, large, convex intercanthal bordered anteriorly by three small scales; four large intersupraoculars posterior to
intercanthals, followed by multiple rows of small intersupraoculars. Nostril centered between prenasal and
postnasal scales, prenasal larger than postnasal and wrapping around anterior aspect of rostrum; single loreal.
Loreal pit midway between eye and naris, below line from middle of eye to naris, bordered by single prelacunal,
postlacunal, lower preocular; prelacunal contacting second and third supralabials and two prefovials; three
prefovials; single postfovial contacting postlacunal, lower preocular, first subocular, and fourth supralabial. Two
preoculars, upper large and convex, contacting supraocular and canthal, lower preocular thin and long; three
suboculars, anterior largest and in contact with fourth supralabial; three interoculabials posterior to anterior
subocular; two postoculars, upper twice as large as lower. Supralabials 13/13; infralabials 11/12; first infralabials in
medial contact posterior to triangular mental; genials together resemble wings. Midbody dorsal scale rows 23–25;
preventral single; ventrals 152; subcaudals 22, nondivided; eight rattle fringe scales; tail bearing three rattle
segments.
BRYSON ET AL.
488
·
Zootaxa 3826 (3) © 2014 Magnolia Press
FIGURE 7. Lateral and dorsal view of the holotype of Crotalus campbelli sp. nov. (KU 73649).
FIGURE 8. Crotalus campbelli sp. nov. in life, (a) MZFC 28669, paratype from the Sierra de Mascota, Jalisco; and (b)
specimen in the wild, Sierra de Manantlán, Colima.
Zootaxa 3826 (3) © 2014 Magnolia Press
·
489
SPECIES DEL IMITATION IN THE CROTALUS TRISERIATUS GROUP
Ground color, in preservative, light brown with 54 dark dorsal body blotches, irregularly edged in black with a
very thin light outer edge on most blotches, blotches wider than long, interspaces between blotches 1–2 scales long;
smaller, vertically elongated auxiliary blotches evident laterally below the dorsal blotches, often separated from the
dorsal blotches by white scales. Head marked with parallel rows of small irregular blotches across prefrontals,
supraoculars, and much of the occipital area, terminated by paired occipital blotches; supralabials and infralabials
ground color white, stippled with dark brown spots; distinct dark postocular stripe, uniform in width, extending
from posterior of eye to above the angle of the mouth and then downwards to jawline; postocular stripe bordered by
a darker band on both dorsal and ventral margins, dorsally a narrow region of light brown extends from the
posterior axis of the eye along the dorsal margin of the postocular band, ventral to the postocular band is a region of
white with brown stippling, supralabial 8 is nearly completely white, with moderate stippling but no postocular
band, supralabials 8–13 are divided by the postocular band; two large dark brown blotches are on the borders of
supralabials 5–7; scale margins of infralabials with dark brown regions making for a series of dark bands, bands do
not extend beyond infralabials; gular scales stippled with no pattern; ventral scutes stippled, more heavily on
posterior half of scales, with total stippling intensifying past midbody; distal 1/3 ventral scutes become dark brown
with a lighter band along the midline, continuing to the vent. Subcaudal scales dark brown to black; eight dark
brown tail bands; proximal rattle black, distal sections brown.
Color in life. Color in life within the type series is only known for one paratype (MZFC 28669), shown in Fig. 8.
Va ri at io n . Three of the six specimens lack a single, large anterior intercanthal. The holotype, KU 73649, has a
single large intercanthal bordered anteriorly by three small, seemingly anomalous scales (Fig. 7). Similarly, UTA
R-16353 has paired anterior intercanthals separated by a small but elongated scale. The third specimen, AMNH R-
113191, has paired anterior intercanthals. The single juvenile (AMNH R-113191) has a cream-colored proximal
rattle and pale-colored tail ventrally. Variation in meristic, morphometric, and color pattern characters within the
type series is listed in Table 3.
Etymology. The specific epithet is a patronym honoring Jonathan A. Campbell for his many years of field
research on Mexican rattlesnakes and for his decades of unwavering support to students of Mexican herpetology.
Habitat and distribution. Crotalus campbelli is found in rocky open breaks within montane forest (Fig. 9)
along the far western regions of the Trans-Mexican Volcanic Belt. Much of this forest is covered with remnant
patches of cloud forest (Ponce-Reyes et al. 2012). This species is known from western Jalisco and the Sierra de
Manantlán in southern Jalisco/northwestern Colima. A narrow low-elevation valley appears to separate the range
of C. campbelli from C. armstrongi to the east (Fig. 3).
FIGURE 9. Humid montane forest habitat of Crotalus campbelli sp. nov. at the paratype localities of (a) Sierra de Mascota,
Jalisco; and (b) Sierra de Manantlán, Colima.
BRYSON ET AL.
490
·
Zootaxa 3826 (3) © 2014 Magnolia Press
Discussion
Taxonomy of the Crotalus triseriatus species group. The main goal of our study is to identify historically distinct
evolutionary lineages within the C. triseriatus species group, a view consistent with modern taxonomy and both the
evolutionary and general lineage species concepts (Wiley 1978; de Queiroz 1998, 2007). Our results suggest that
the current taxonomy of the C. triseriatus group is in need of revision to reflect evolutionary history. Groupings
based on historical taxonomic arrangements are among the lowest ranked of our 16 models (Table 1).
We suggest that the C. triseriatus species group is comprised of nine species. We add C. campbelli and C.
tlaloci to the group. Crotalus pusillus and C. aquilus should be recognized as full species, consistent with previous
suggestions (Klauber 1952; Dorcas 1992). We also recommend elevating the subspecies C. t. triseriatus and C. t.
armstrongi to full species (as C. triseriatus and C. armstrongi), a taxonomic arrangement already in use (Reyes-
Ve la s co et al. 2013). A previous study suggesting a close relationship between these two taxa based on morphology
(Dorcas 1992) grouped C. armstrongi from Michoacán with C. triseriatus from the central and eastern regions of
the Trans-Mexican Volcanic Belt as C. t. triseriatus sensu lato, and this grouping undoubtedly skewed cladistic
analyses.
Crotalus lepidus currently contains four putative subspecies (Campbell & Lamar 2004). We tested models that
split C. l. morulus from a lineage of C. lepidus containing the remaining three subspecies to capture the deep
matrilineal divergence between these two lineages (Bryson et al. 2011). We tentatively suggest that C. l. morulus
be elevated to full species (C. morulus) given the distinct phylogenetic placement of this species based on mtDNA
(Fig. 1) and the Bayes factors score of our best-ranked BFD model over alternative models (2lnBF > 40; Table 1)
based on 3,346 base pairs of DNA from seven nuclear loci. However, we feel it is important to note that our second
and third-ranked models combine the two lineages (Table 1), and the northern distribution of C. morulus remains
uncertain (Campbell & Lamar 2004). More research involving a larger number of samples of each of the remaining
subspecies of C. lepidus and the addition of faster-evolving nuclear genes is needed to make further taxonomic
decisions about their status. For taxonomic stability, we suggest continuing to recognize the subspecies C. l.
lepidus, C. l. klauberi, and C. l. maculosus rather than lumping them into a single taxon.
We united the subspecies C. r. ravus, C. r. brunneus, and C. r. exiguus into a single C. ravus lineage for our
model testing. Genetic structure among these subspecies was less pronounced than among major mitochondrial
lineages within the C. triseriatus group (Bryson et al. 2011), which were the focus of our study here. However,
mitochondrial haplogroups within C. ravus conform to subspecies boundaries and appear to be separated by strong
biogeographic barriers (Bryson et al. 2011). Future research using more samples of each subspecies and faster-
evolving nuclear genes will probably find that each subspecies of C. ravus represents independent evolutionary
unities. Pending this research, we suggest continuing to recognize C. r. ravus, C. r. brunneus, and C. r. exiguus.
Finally, although our species delimitations are robust based on BFD analyses, the species tree is poorly
resolved and, thus, the relationships among species are uncertain (Fig. 2). Our analyses only recover three
moderately supported clades (> 0.85 posterior support), including one containing C. tlaloci, C. pusillus, C.
armstrongi, C. triseriatus, C. aquilus, C. morulus, and C. lepidus, and two additional subclades within this clade.
Similar low levels of support exist for relationships within species tree analyses based mostly on mtDNA
sequences for the group (Reyes-Velasco et al. 2013). We attribute this low support to a combination of factors,
including low levels of phylogenetically informative characters in our nuclear genes (Table 2) and a probable rapid
radiation during the early diversification of this group (Bryson et al. 2011). This radiation may have coincided with
rapid uplifting of the Trans-Mexican Volcanic Belt near the end of the Neogene period (Gómez-Tuena et al. 2007).
During a rapid radiation, coalescent patterns contained within individual gene trees may not match the true pattern
of speciation because of incomplete lineage sorting and subsequent retention of ancestral polymorphisms (Degnan
& Rosenberg 2006; Knowles 2009). Although we employ a coalescent-based method of species tree inference,
which can accommodate gene tree discordance as a result of incomplete lineage sorting (Anderson et al. 2012), our
seven nuclear loci may lack enough informative sites to resolve relationships for each gene, which makes
estimating the species tree difficult. Sampling of more individuals and genes with more informative sites may
improve the resolution of species relationships.
Conservation implications. Four of the five currently recognized species in the C. triseriatus group receive
different levels of protection by the Mexican government (NOM-059-SEMARNAT-2010). Two are considered
Zootaxa 3826 (3) © 2014 Magnolia Press
·
491
SPECIES DEL IMITATION IN THE CROTALUS TRISERIATUS GROUP
threatened (C. ravus and C. pusillus) and two receive special protection (C. aquilus and C. lepidus). The fifth
species, C. triseriatus, is not listed. Given our proposed taxonomic changes, we recommend that the conservation
status of Crotalus triseriatus sensu lato be reevaluated. Crotalus triseriatus sensu stricto is restricted to populations
along the Trans-Mexican Volcanic Belt in eastern Michoacán, Estado de México, Morelos, Distrito Federal,
Hidalgo, Tlaxcala, Puebla, and Veracruz. Populations from central and western Michoacán and eastern Jalisco
represent C. armstrongi. Both species occupy forested regions of the Trans-Mexican Volcanic Belt heavily
impacted by destructive land-use practices (Vázquez et al. 2009).
Crotalus tlaloci and C. campbelli arguably represent two of the most threatened species in the C. triseriatus
group. Both species have relatively small distributions (Fig. 3) and are closely associated with highly endangered
remnant patches of cloud forest and humid oak-pine forest (Figueroa-Rangel et al. 2010; Vargas-Rodriguez et al.
2010; Ponce-Reyes et al. 2012). The entire known distribution of C. tlaloci lies within 125 km of one of the world’s
largest metropolitan areas. This region of Mexico has seen explosive urban settlement comparable to settlement
rates in the mountains of Ethiopia (Gallcia & García-Romero 2007). Populations of C. tlaloci might reside in
several of the fragmented protected areas across the region, such as Corredor Biológico Chichinautzin in Morelos
and Reserva de la Biosfera Mariposa Monarca in Michoacán and Estado de México. However, all specimens of C.
tlaloci came from outside of these areas (Appendix 3). Crotalus campbelli is closely associated with remnant
patches of cloud forest scattered across the far western regions of the Trans-Mexican Volcanic Belt. Part of their
distribution lies within the Reserva de la Biosfera Sierra de Manantlán in Jalisco and Colima. The rest of the range
to the west lies largely within remote yet unprotected habitat.
Future research. We cannot confidently assign several museum specimens from the mountains of southern
Nayarit and adjacent Jalisco to species (KU 29500–02, USNM 46465). Although scale counts for these four
specimens fall within the range of C. armstrongi, they are likely geographically isolated from this species and from
C. campbelli by the low-elevation Río Ameca drainage (Fig. 3). We tentatively assign these specimens to C.
armstrongi, but future genetic studies are needed to clarify the relationships of these snakes to C. campbelli and
other C. armstrongi.
Additional species may be present within the C. triseriatus group. Here we focused on the most divergent
mitochondrial lineages identified by Bryson et al. (2011). However, geographic structuring is evident within
several of these lineages. Crotalus lepidus, for example, contains five haplogroups (Bryson et al. 2011), several of
which may be morphologically distinct (Dorcas 1992; Campbell & Lamar 2004). Our study is the first (and
overdue) quantitative revision of species limits in the C. triseriatus group using multilocus DNA data. We
encourage other researchers to continue to explore species boundaries within this widespread group of montane
rattlesnakes and update taxonomy as new data become available.
Acknowledgments
We thank the following institutions for specimen loans: American Museum of Natural History; Colección Nacional
de Anfibios y Reptiles, UNAM; Field Museum of Natural History; University of Kansas; Natural History Museum
of Los Angeles County; Louisiana State University; Museo de Zoología, Facultad de Ciencias, UNAM; Texas
Cooperative Wildlife Collection; University of Illinois Natural History Museum; University of Michigan Museum
of Zoology; United States National Museum; and University of Texas at Arlington. We thank W. Horner and C.
Whitney for valuable information on an early specimen from Valle de Bravo. Additional assistance was provided
by M. Torocco, U.O. Garcia, A. Nieto-Montes de Oca, O. Flores-Villela, J. Alvarado-Díaz, A. Kardon, D. Lazcano,
R. Mendoza-Paz, the late F. Mendoza-Quijano, and R. W. Hansen. Special thanks to S.E. Bryson and M.A. Bryson
for their support and patience. This paper is based in part upon work supported by the National Science Foundation
grants DEB- 1257785 and DEB- 1258205 and by Natural Sciences and Engineering Research Council (Canada)
Discovery Grant 3148.
BRYSON ET AL.
492
·
Zootaxa 3826 (3) © 2014 Magnolia Press
References
Anderson, C.N., Liu, L., Pearl, D. & Edwards, S.V. (2012) Tangled trees: the challenge of inferring species trees from
coalescent and noncoalescent genes. Methods in Molecular Biology, 856, 3–28.
http://dx.doi.org/10.1007/978-1-61779-585-5_1
Baele, G., Lemey, P., Bedford, T., Rambaut, A., Suchard, M.A. & Alekseyenko, A.V. (2012) Improving the accuracy of
demographic and molecular clock model comparison while accommodating phylogenetic uncertainty. Molecular Biology
and Evolution, 29, 2157–2167.
http://dx.doi.org/10.1093/molbev/mss084
Baele, G., Li, W.L.S., Drummond, A.J., Suchard, M.A. & Lemey, P. (2013) Accurate model selection of relaxed molecular
clocks in Bayesian phylogenetics. Molecular Biology and Evolution, 30, 239–243.
http://dx.doi.org/10.1093/molbev/mss243
Bossu, C.M. & Near, T.J. (2009) Gene trees reveal repeated instances of mitochondrial DNA introgression in Orangethroat
Darters (Percidae: Etheostoma). Systematic Biology, 58, 114–129.
http://dx.doi.org/10.1093/sysbio/syp014
Bouckaert, R.R. (2010) DensiTree: making sense of sets of phylogenetic trees. Bioinformatics, 26, 1372–1373.
http://dx.doi.org/10.1093/bioinformatics/btq110
Boulenger, G.A. (1896) Catalogue of the Snakes in the British Museum (Natural History). Vol. III. Trustees of the British
Museum, London, xiv + 727 pp., 15 plates.
Brattstrom, B.H. (1964) Evolution of the pit vipers. Transactions of the San Diego Society of Natural History, 13, 185–268.
Bryson, R.W., Nieto-Montes de Oca, A., Jaeger, J.R. & Riddle, B.R. (2010) Elucidation of cryptic diversity in a widespread
Nearctic treefrog reveals episodes of mitochondrial gene capture as frogs diversified across a dynamic landscape.
Evolution, 64, 2315–2330.
http://dx.doi.org/10.1111/j.1558-5646.2010.01014.x
Bryson, R.W., Murphy, R.W., Lathrop, A. & Lazcano-Villareal, D. (2011) Evolutionary drivers of phylogeographical diversity
in the highlands of Mexico: a case study of the Crotalus triseriatus species group of montane rattlesnakes. Journal of
Biogeography, 38, 697–710.
http://dx.doi.org/10.1111/j.1365-2699.2010.02431.x
Campbell, J.A. (1979) A new rattlesnake (Reptilia, Serpentes, Viperidae) from Jalisco, Mexico. Transactions of the Kansas
Academy of Science, 81 (4), 365–370.
Campbell, J.A. & Lamar, W.W. (2004) Venomous Reptiles of the Western Hemisphere. Cornell University Press, Ithaca, New
York, 976 pp.
Castoe, T.A. & Parkinson, C.L. (2006) Bayesian mixed models and the phylogeny of pitvipers (Serpentes: Viperidae).
Molecular Phylogenetics and Evolution, 39, 91–110.
http://dx.doi.org/10.1016/j.ympev.2005.12.014
Darriba, D., Taboada, G.L., Doallo, R. & Posada, D. (2012) jModelTest 2: more models, new heuristics and parallel computing.
Nature Methods, 9, 772.
http://dx.doi.org/10.1038/nmeth.2109
de Queiroz, K. (1998) The general lineage concept of species, species criteria, and the process of speciation. In: Howard, D.J. &
Berlocher, S.H. (Eds.), Endless Form: Species and Speciation. Oxford University Press, New York, pp. 57–75.
de Queiroz, K. (2007) Species concepts and species delimitation. Systematic Biology, 56, 879–886.
http://dx.doi.org/10.1080/10635150701701083
Degnan, J.H. & Rosenberg, N.A. (2006) Discordance of species trees with their most likely gene trees. PLoS Genetics, 2 (5),
e68.
http://dx.doi.org/10.1371/journal.pgen.0020068
Dolman, G. & Phillips, B. (2004) Single copy nuclear DNA markers characterized for comparative phylogeography in
Australian wet tropics rainforest skinks. Molecular Ecology, 4, 185–187.
http://dx.doi.org/10.1111/j.1471-8286.2004.00609.x
Dorcas, M.E. (1992) Relationships among montane populations of Crotalus lepidus and Crotalus triseriatus. In: Campbell, J.A.
& Brodie Jr., E.D. (Eds.), Biology of the Pitvipers. Selva, Tyler, Texas, pp. 71–88.
Drummond, A.J. & Rambaut, A. (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary
Biology, 7, 214.
http://dx.doi.org/10.1186/1471-2148-7-214
Figueroa-Rangel, B.L., Willis, K.J. & Olvera-Vargas, M. (2010) Cloud forest dynamics in the Mexican Neotropics during the
last 1300 years. Global Change Biology, 16, 1689–1704.
http://dx.doi.org/10.1111/j.1365-2486.2009.02024.x
Flores-Villela, O. & Hernandez-Garcia, E. (1989) New state records from northern Guerrero, Mexico. Herpetological Review,
20, 15–16.
Flores-Villela, O. & Sánchez-H, O. (2003) A new species of Abronia (Squamata: Anguidae) from the Sierra Madre del Sur of
Guerrero, Mexico, with comments on Abronia deppii. Herpetologica, 59, 524–531.
http://dx.doi.org/10.1655/02-39
Zootaxa 3826 (3) © 2014 Magnolia Press
·
493
SPECIES DEL IMITATION IN THE CROTALUS TRISERIATUS GROUP
Flores-Villela, O. & Hernández-García, E. (2006) Herpetofauna de la Sierra de Taxco, Guerrero. Publicaciones de la Sociedad
Herpetológica Mexicana, 3, 266–282.
Gallcia, L. & García-Romero, A. (2007) Land use and land cover change in highland temperate forests in the Izta-Popo
National Park, central Mexico. Mountain Research and Development, 27, 48–57.
http://dx.doi.org/10.1659/0276-4741(2007)27[48:lualcc]2.0.co;2
Gamble, T., Bauer, A.M., Greenbaum, E. & Jackman, T.R. (2007) Evidence for Gondwanan vicariance in an ancient clade of
gecko lizards. Journal of Biogeography, 35, 88–104.
http://dx.doi.org/10.1111/j.1365-2699.2007.01770.x
Gibbs, H.L. & Diaz, J. (2010) Identification of single copy nuclear DNA markers for North American pit vipers. Molecular
Ecology Resources, 10, 177–180.
http://dx.doi.org/10.1111/j.1755-0998.2009.02707.x
Gloyd, H.K. (1940) The rattlesnakes, genera Sistrurus and Crotalus. A study in zoogeography and evolution. Special
Publication of the Chicago Academy of Sciences, 4, 1–270.
Gómez-Tuena, A., Orozco-Esquivel, Ma T. & Ferrari, L. (2007) Igneous petrogenesis of the Trans-Mexican Volcanic Belt.
Geological Society of America, Special Paper, 422, 129–181.
Grummer, J.A., Bryson, R.W. & Reeder, T.W. (2014) Species delimitation using Bayes factors: simulations and application to
the Sceloporus scalaris species group (Squamata: Phrynosomatidae). Systematic Biology, 63, 119–133.
http://dx.doi.org/10.1093/sysbio/syt069
Guindon, S. & Gascuel, O. (2003) A simple, fast and accurate method to estimate large phylogenies by maximum-likelihood.
Systematic Biology, 52, 696–704.
http://dx.doi.org/10.1080/10635150390235520
Hall, T.A. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT.
Nucleic Acids Symposium Series, 41, 95–98.
Heled, J. & Drummond, A.J. (2010) Bayesian inference of species trees from multilocus data. Molecular Biology and
Evolution, 27, 570–580.
http://dx.doi.org/10.1093/molbev/msp274
Kass, R.E. & Raftery, A.E. (1995) Bayes factors. Journal of the American Statistics Association, 90 (430), 773–795.
http://dx.doi.org/10.1080/01621459.1995.10476572
Klauber, L.M. (1952) Taxonomic studies of the rattlesnakes of mainland Mexico. Bulletin of the Zoological Society of San
Diego, 26, 1–143.
Klauber, L.M. (1972) Rattlesnakes: Their Habits, Life Histories and Influence on Mankind. 2
nd
Edition. University of California
Press, Berkeley and Los Angeles, California, 400 pp.
Knowles, L.L. (2009) Estimating species trees: methods of phylogenetic analysis when there is incongruence across genes.
Systematic Biology, 58, 463–467.
http://dx.doi.org/10.1093/sysbio/syp061
Kubatko, L.S., Gibbs, H.L. & Bloomquist, E.W. (2011) Inferring species-level phylogenies and taxonomic distinctiveness
using multilocus data in Sistrurus rattlesnakes. Systematic Biology, 60, 393–409.
http://dx.doi.org/10.1093/sysbio/syr011
Lartillot N. & Philippe, H. (2006) Computing Bayes factors using thermodynamic integration. Systematic Biology, 55,
195–207.
http://dx.doi.org/10.1080/10635150500433722
Leaché A.D. (2010) Species trees for spiny lizards (genus Sceloporus): Identifying points of concordance and conflict between
nuclear and mitochondrial data. Molecular Phylogenetics and Evolution, 54, 162–171.
http://dx.doi.org/10.1016/j.ympev.2009.09.006
Leaché, A.D., Fujita, M.K., Minin, V. & Bouckaert R. (2014) Species delimitation using genome-wide SNP data. Systematic
Biology, 63, 534–542.
http://dx.doi.org/10.1093/sysbio/syu018
Murphy, R.W., Fu, J., Lathrop, A., Feltham, J.V. & Kovak, V. (2002) Phylogeny of the rattlesnakes (Crotalus and Sistrurus)
inferred from sequences of five mitochondrial DNA genes. In: Schuett, G.W., Hôggren, M., Douglas, M.E. & Greene,
H.W. (Eds.), Biology of the Vipers. Eagle Mountain Publishing, Eagle Mountain, UT, USA, pp. 69–92.
Myers, E.A., Rodríguez-Robles, J.A., DeNardo, D.F., Staub, R.E., Stropoli, A., Ruane, S. & Burbrink, F.T. (2013) Multilocus
phylogeographic assessment of the California Mountain Kingsnake (Lampropeltis zonata) suggests alternative patterns of
diversification for the California Floristic Province. Molecular Ecology, 22, 5418–5429.
http://dx.doi.org/10.1111/mec.12478
Nylander, J.A.A., Wilgenbusch, J.C., Warren, D.L. & Swofford, D.L. (2008) AWTY (are we there yet?): a system for graphical
exploration of MCMC convergence in Bayesian phylogenetics. Bioinformatics, 24, 581–583.
http://dx.doi.org/10.1093/bioinformatics/btm388
Pérez-Ramos, E., Saldaña de la Riva, L. & Uribe-Peña, Z. (2000) A checklist of the reptiles and amphibians of Guerrero,
México. Anales del Instituto de Biología Universidad Nacional Autónoma de México, Serie Zoología, 71, 21–40.
Ponce-Reyes, R., Reynoso-Rosales, V.-H., Watson, J.E.M., VanDerWal, J., Fuller, R.A., Pressey, R.L. & Possingham, H.P.
(2012) Vulnerability of cloud forest reserves in Mexico to climate change. Nature Climate Change, 2, 448–452.
BRYSON ET AL.
494
·
Zootaxa 3826 (3) © 2014 Magnolia Press
Rambaut, A. & Drummond, A.J. (2007) Tracer v1.5. Available from: http://beast.bio.ed.ac.uk/Tracer (Accessed 17 October
2012)
Reyes-Velasco, J., Hermosillo-Lopez, I.A., Grünwald, C.I. & Avila-Lopez, O.A. (2009) New state records for amphibians and
reptiles from Colima, Mexico. Herpetological Review, 40, 117–120.
Reyes-Velasco, J., Meik, J.M., Smith, E.N. & Castoe, T.A. (2013) Phylogenetic relationships of the enigmatic longtailed
rattlesnakes (Crotalus ericsmithi, C. lannomi, and C. stejnegeri). Molecular Phylogenetics and Evolution, 69, 524–534.
http://dx.doi.org/10.1016/j.ympev.2013.07.025
Ruane, S., Bryson, R.W., Pyron, R.A. & Burbrink, F.T. (2014) Coalescent species delimitation in milksnakes (genus
Lampropeltis) and impacts on phylogenetic comparative analyses. Systematic Biology, 63, 231–250.
http://dx.doi.org/10.1093/sysbio/syt099
Sabaj Pérez, M.H. (Ed.) (2010) Standard symbolic codes for institutional resource collections in herpetology and ichthyology:
an Online Reference. Version 4.0. American Society of Ichthyologists and Herpetologists, Washington, DC. Available
from: http://www.asih.org/ (accessed 7 May 2014)
Smith, H.M. (1946) Preliminary notes and speculations on the Triseriatus group of rattlesnakes in Mexico. University of
Kansas Science Bulletin, 31, 75–101.
Stamatakis, A. (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed
models. Bioinformatics, 22, 2688–2690.
http://dx.doi.org/10.1093/bioinformatics/btl446
Stephens, M. & Donnelly, P. (2003) A comparison of Bayesian methods for haplotype reconstruction. American Journal of
Human Genetics, 73, 1162–1169.
http://dx.doi.org/10.1086/379378
Stephens, M., Smith, N.J. & Donnelly, P. (2001) A new statistical method for haplotype reconstruction from population data.
American Journal of Human Genetics, 68, 978–989.
http://dx.doi.org/10.1086/319501
Townsend, T.M., Alegre, R.E., Kelley, S.T., Wiens, J.J. & Reeder, T.W. (2008) Rapid development of multiple nuclear loci for
phylogenetic analysis using genomic resources: an example from squamate reptiles. Molecular Phylogenetics and
Evolution, 47, 129–142.
http://dx.doi.org/10.1016/j.ympev.2008.01.008
Vargas-Rodriguez, Y.L., Platt, W.J., Vázquez-García, J.A. & Boqiun, G. (2010) Selecting relict montane cloud forests for
conservation priorities: the case of western Mexico. Natural Areas Journal, 30, 156–174.
http://dx.doi.org/10.3375/043.030.0204
Vázquez, L., Bustamante-Rodríguez, C. & Bahena-Arce, D.G. (2009) Area selection for conservation of Mexican mammals.
Animal Biodiversity and Conservation, 32, 29–39.
Wiley, E.O. (1978) The evolutionary species concept reconsidered. Systematic Zoology, 27, 17–26.
http://dx.doi.org/10.2307/2412809
Wilgenbusch, J.C., Warren, D.L. & Swofford, D.L. (2004) AWTY: a system for graphical exploration of MCMC convergence
in Bayesian phylogenetic inference. Bioinformatics, 24 (4), 681–583.
http://dx.doi.org/10.1093/bioinformatics/btm388
Xie, W.G., Lewis, P.O., Fan, Y., Kuo, L. & Chen, M.H. (2011) Improving marginal likelihood estimation for Bayesian
phylogenetic model selection. Systematic Biology, 60, 150–160.
http://dx.doi.org/10.1093/sysbio/syq085
Zaldívar-Riverón, A. & Nieto-Montes de Oca, A. (2001) Natural history and distribution of the lizard Barisia rudicollis
(Anguidae). The Southwestern Naturalist, 46, 391–396.
http://dx.doi.org/10.1111/j.1439-0469.2005.00308.x
Zaldívar-Riverón, A. & Nieto-Montes de Oca, A. (2002) Variation in the rare lizard Barisia rudicollis (Anguidae) (Wiegmann)
with the description of a new species from Central Mexico. Herpetologica, 58, 313–326.
http://dx.doi.org/10.1655/0018-0831(2002)058[0313:VITRLB]2.0.CO;2
Zootaxa 3826 (3) © 2014 Magnolia Press
·
495
SPECIES DEL IMITATION IN THE CROTALUS TRISERIATUS GROUP
APPENDIX 1. Collection and voucher data for genetic samples of the Crotalus triseriatus species group used in this
study and deposited in the Royal Ontario Museum (ROM). Names of species reflect the taxonomy proposed here.
Taxon Locality Voucher Number
C. aquilus Mexico: Querétaro: Cerro el Zamorano ROM 42623
C. aquilus Mexico: Querétaro: Valle de Guadalupe ROM 47042
C. aquilus Mexico: Michoacán: San
José de Gracia ROM 47064
C. aquilus Mexico: Michoacán: San José de Gracia ROM 47008
C. aquilus Mexico: Estado de México: Acambay ROM 47031
C. armstrongi Mexico: Jalisco: Nevado de Colima ROM 47023
C. armstrongi Mexico: Michoacán: Cerro Tancítaro ROM 47072
C. armstrongi Mexico: Michoacán: Tacámbaro ROM 47019
C. armstrongi Mexico: Michoacán: Cerro Tancítaro ROM 48030
C. lepidus klauberi Mexico: Chihuahua: Sierra Manzanillas ROM 42414
C. lepidus klauberi Mexico: Durango: Rancho Santa Barbara ROM 47002
C. lepidus klauberi Mexico: Jalisco: Volcán Tequila ROM 47021
C. lepidus lepidus USA: Texas: Davis Mountains ROM 42415
C. lepidus maculosus Mexico: Durango: Los Bancos ROM 42404
C. lepidus maculosus Mexico: Nayarit: Santa Teresa ROM 47071
C. morulus Mexico: Tamaulipas: Jaumave ROM 42400
C. morulus Mexico: Tamaulipas: Miquihuana ROM 42401
C. morulus Mexico: Nuevo León: La Huasteca ROM 42411
C. morulus Mexico: Nuevo León: Sierra Peña Nevada ROM 42417
C. morulus Mexico: Tamaulipas: Bustamante ROM 45244
C. pusillus Mexico: Michoacán: Sierra de Coalcomán ROM 47056
C. pusillus Mexico: Michoacán: Sierra de Coalcomán ROM 47055
C. pusillus Mexico: Michoacán: Tancítaro ROM FC271
C. ravus exiguus Mexico: Guerrero: Omiltemi ROM 47053
C. ravus exiguus Mexico: Guerrero: Carrizal del Bravo ROM 47052
C. ravus brunneus Mexico: Oaxaca: Mitla ROM 47039
C. ravus ravus Mexico: Puebla: Zacatepec ROM FC228
C. triseriatus Mexico: Puebla: Zacatlán ROM 47045
C. triseriatus Mexico: Puebla: Volcán Iztaccihuatl ROM 47026
C. triseriatus Mexico: Veracruz: Las Vigas ROM 47015
C. triseriatus Mexico: Michoacán: San Angangueo ROM 47067
C. triseriatus Mexico: Michoacán: SE Aporo ROM 47034
Crotalus campbelli sp. nov. Mexico: Jalisco: La Mascota highway ROM 47028
Crotalus campbelli sp. nov. Mexico: Colima: Sierra de Manantlán ROM 47025
Crotalus campbelli sp. nov. Mexico: Jalisco: Sierra de Mascota (paratype) ROM 48027
Crotalus tlaloci sp. nov. Mexico: Estado de México: Valle de Bravo (paratype) ROM 47035
Crotalus tlaloci sp. nov.
Mexico: Morelos: Cuernavaca-
Ocuilán highway (paratype)
ROM 48028
Crotalus tlaloci sp. nov. Mexico: Estado de México: Valle de Bravo (paratype) ROM 48029
Crotalus tlaloci sp. nov. Mexico: Estado de México: Valle de Bravo (paratype) ROM 48031
BRYSON ET AL.
496
·
Zootaxa 3826 (3) © 2014 Magnolia Press
APPENDIX 2 . Information on the seven nuclear loci and primers used in this study, including annealing temperature
(T
a
) and reference.
APPENDIX 3. Specimens examined.
Crotalus armstrongi. 28 specimens. MEXICO: MICHOACÁN: Tancítaro (FMNH 39106, 39110–11, 39124, 40823, MZFC
25113). Puerto Garnica (AMNH 98846). Mil Cumbres (UINHM 26225). 5 miles S Pátzcuaro nr road to Tacambaro
(UMMZ 98941). 2.3 miles N Opopeo (UMMZ 121523). Tacambaro (HINIRENA 361, 689). JALISCO: Atemajac de
Brizuela, 6.4 km E (KU 106290). Tapalpa, 1.5 miles NW, Rancho San Francisco (UTA R-4909, 7232, 7937). Tapalpa, 2.4
km NW, Rancho San Francisco (UTA R-5893, 6257–60, 7739, 12589–91). Nevado de Colima, east slope (UMMZ
101550). Nevado de Colima, Refugio de Montaña (UTA R-53327). Sierra de Quila (MZFC 28668).
Crotalus cf. armstrongi. 4 specimens. MEXICO: NAYARIT: Ixtlán del Río, 6 mi S (KU 29500–02). JALISCO: Ameca
(USNM 046465).
Crotalus campbelli sp. nov. 6 specimens. MEXICO: JALISCO: Sierra de Cuale, municipality of Tapla de Allende (KU
73649–73650). Las Playitas, Las Joyas, Sierra de Manantlán, municipality of Autlán de Navarro (UTA R-16352). Las
Joyas, Sierra de Manantlán, municipality of Autlán de Navarro (UTA R-16353). Manantlán, ca. 2.1 km SE by dirt road, ca.
25 km SE Autlán (AMNH R-113191). Lago de Juanacatlán, Sierra de Mascota, municipality of Mascota (MZFC 28669).
Crotalus pusillus. 33 specimens. MEXICO: MICHOACÁN: Acuaro de las Lleguas, W of Rancho Barolosa (UMMZ
112566–67). Dos Aguas and vicinity (UMMZ 118591–99, 118601, 121512, 121513; UTA R-4530–31, 5846, 6119, 9358).
Tancítaro (FMNH 37042, 37048, 39095, 39097, 39112–13, 39117, 39120–21, 39127, 40818–19, 40824–25).
Crotalus tlaloci sp. nov. 12 specimens. MEXICO: GUERRERO: “Los Llanos”, 10 km by road from Taxco to Tetipac, Sierra de
Taxco, municipality of Tetipac (MZFC 3666). Cerro del Huizteco, Sierra de Taxco, municipality of Taxco (MZFC
3664–3665). “Arroyo las Damas”, Sierra de Taxco, municipality of Tetipac (MZFC 3666). ESTADO DE MÉXICO:
Acatitlán, municipality of Valle de Bravo (MZFC 4324). Los Álamos, municipality of Valle de Bravo (MZFC
25114–25115). Los Álamos, municipality of Valle de Bravo (HINIRENA 725–726). MORELOS: Km 12, Carr.
Cuernavaca-Ocuilán, municipality of Cuernavaca (MZFC 4657). Carr. Cuernavaca-Ocuilán, near state border,
municipality of Cuernavaca (MZFC 25111). MICHOACÁN: N Arroyo Seco, municipality of de Aporo (HINIRENA 724).
Crotalus triseriatus. 21 specimens. MEXICO: ESTADO DE MÉXICO: San Cayetano, municipality of Villa de Allende
(CNAR 1015, 6969a, 6969b). Nevado de Toluca, carr. Toluca-Sultepec, km 10 (CNAR 3799). Rancho Viejo (CNAR
3997). Calimaya, municipality of Calimaya (CNAR 13145). Santiago Oxtotitlan El Potrero, municipality of Villa Guerrero
(CNAR 13147). 0.7–2.8 mi from hwy between Valle de Bravo and Temescaltepec-Toluca Hwy, 6.4 mi NW jct Mex 134
(LACM 154837–38). MICHOACÁN: near Aporo (HINIRENA 723). MORELOS: Laguna de Zempoala (LSU 28557,
UTA R-7286, 7398, 8142, 12599). environs of Huitzilac (UTA R-12600, 14519). Chapultepec, 3.9 km SSE Mexicalcingo
(UTA R-12604). VERACRUZ: 4.5 mi WNW Altotonga (LSU 11014). 10 km SE Cofre de Perote (TCWC 820). Between
Gutiérrez Zamora and Papantla (UIMNH 42860).
Locus Primer sequence 5’–3’ T
a
(C) Reference
TATA box-binding protein
(TBP)
F CCTTTACCAGGAACCACACC
R CGAAGGGCAATGGTTTTTAG
55 Gibbs & Diaz (2010)
ETS oncogene (ETS) F CCATCAACAGACACACAGG
R GTCTGCTTTTTACTTTGCG
50 Dolman & Phillips (2004),
Friesen et al. unpublished
Prolactin Receptor (PRLR) F GACARYGARGACCAGCAACTRATGCC
R GACYTTGTGRACTTCYACRTAATCCAT
50 Townsend et al. (2008)
Recombination-activating
gene 2 (Rag2PYI)
F CCCTGAGTTTGGATGCTGTACTT
R AACTGCCTRTTGTCCCCTGGTAT
49 Gamble et al. (2007)
Anonymous 25 (Locus25) F ACCTTTCTCTTTTGTTCAGCA
R ATGTCTCTGTTTCCCAAAATG
50 Gibbs & Diaz (2010)
Anonymous 63 (Locus63) F ATTAGCCCAGAACTGTGCTTA
R AAAGATTCTGGGAAGCCAAA
50 Gibbs & Diaz (2010)
Anonymous A (LocusA) F AGAATTGAGCTCCCGTCCTTT
R GGGAGCAATGCCTAGACCAAG
50 Gibbs & Diaz (2010)
