ArticlePDF Available

Toward a stable classification of genera within the Entolomataceae: A phylogenetic re-evaluation of the Rhodocybe-Clitopilus clade

Authors:

Abstract and Figures

Despite the recent molecular systematic analyses of the Entolomataceae (Agaricales, Basidiomycota), a robust classification of genera supported by morphological and phylogenetic evidence remains unresolved for this cosmopolitan family of pink-spored fungi. Here, a phylogenetic analysis for one of the two major clades (Rhodocybe-Clitopilus), was conducted using three nuclear protein-coding gene regions, the mitochondrial ATP synthase subunit 6 (atp6), the nuclear RNA polymerase subunit II (rpb2), and the nuclear translation elongation factor subunit 1-α (tef1). Five monophyletic groups are resolved with strong statistical support and a set of morphological features for delineation of genera is presented. In the revised classification proposed here, Clitopilus is retained, Rhodocybe is emended, two genera previously accepted as synonyms of Rhodocybe (Clitopilopsis and Rhodophana) are resurrected, and Clitocella is described as new.
Content may be subject to copyright.
Toward a stable classification of genera within the Entolomataceae:
a phylogenetic re-evaluation of the Rhodocybe-Clitopilus clade
Kerri L. Kluting
Middle Tennessee State University, Ecology and
Evolutionary Biology Group, Biology Department,
PO Box 60, Murfreesboro, Tennessee 37132
Timothy J. Baroni
Department of Biological Sciences, PO Box 2000, State
University of New York, College at Cortland, Cortland,
New York 13045
Sarah E. Bergemann
1
Middle Tennessee State University, Ecology and
Evolutionary Biology Group, Biology Department,
PO Box 60, Murfreesboro, Tennessee 37132
Abstract
:Despite the recent molecular systematic
analyses of the Entolomataceae (Agaricales, Basidio-
mycota), a robust classification of genera supported
by morphological and phylogenetic evidence remains
unresolved for this cosmopolitan family of pink-
spored fungi. Here, a phylogenetic analysis for one
of the two major clades (Rhodocybe-Clitopilus) was
conducted using three nuclear protein-coding gene
regions, the mitochondrial ATP synthase subunit 6
(
atp6
), the nuclear RNA polymerase subunit II (
rpb2
)
and the nuclear translation elongation factor subunit
1-a(
tef1
). Five monophyletic groups are resolved with
strong statistical support and a set of morphological
features for delineation of genera is presented. In the
revised classification proposed here,
Clitopilus
is
retained,
Rhodocybe
is emended, two genera previous-
ly accepted as synonyms of
Rhodocybe
(
Clitopilopsis
and
Rhodophana
) are resurrected and
Clitocella
is
described as new.
Key words:
Agaricales, Basidiomycota,
Clitocella
,
Clitopilopsis
,
Clitopilus
,
Rhodocybe
,
Rhodophana
, sys-
tematics, taxonomy
INTRODUCTION
The Entolomataceae Kotl. & Pouzar (Agaricales,
Basidiomycota) is one of the three largest euagaric
families and contains nearly 1500 described species
(Co-David et al. 2009, Baroni et al. 2011). This
cosmopolitan family is united by the presence of
basidiospores that: (i) are flesh-colored or pinkish in
mass; (ii) have evenly cyanophilic walls and; (iii)
appear angular in polar view due to ornamentations
arising from the epicorium of the cell wall (Baroni
1981, Singer 1986, Largent 1994, Co-David et al.
2009). These shared microscopic characters suggest
that the family is a natural group, and molecular
phylogenetic analyses support this hypothesis by
demonstrating its monophyly (Matheny et al. 2006,
Co-David et al. 2009, Baroni and Matheny 2011).
Despite the emphasis on molecular phylogenetics to
understand the placement of species within an
evolutionary context, classification of genera corrob-
orated by phylogenetic and morphological evidence
remains unresolved (Co-David et al. 2009, Baroni and
Matheny 2011, Baroni et al. 2011, Kinoshita et al.
2012).
Co-David et al. (2009) conducted the first compre-
hensive phylogenetic analysis of the Entolomataceae
using the nuclear large subunit ribosomal RNA
(nLSU), the nuclear RNA polymerase subunit II
(
rpb2
) and the mitochondrial small subunit (mtSSU)
gene regions. This analysis revealed that the family is
divided into two main monophyletic groups: one
containing the agaric
Entoloma
(Fr. ex Rabenh.) P.
Kumm. s.l. and sequestrate
Richoniella
Costantin &
L.M. Dufour and
Rhodogaster
E. Horak (Entoloma
clade with ca. 1200 species) and the other containing
Clitopilus
(Fr. ex Rabenh.) P. Kumm. and
Rhodocybe
Maire (Rhodocybe-Clitopilus clade with ca. 300
species). Species within the Entoloma clade can be
distinguished from those within the Rhodocybe-
Clitopilus clade by the presence of basidiospores that
are weakly to strongly angular in polar, profile and
face views due to interconnected or broken ridges
that form facets on the spore surface (Singer 1986,
Largent 1994, Co-David et al. 2009, Baroni et al.
2011). In contrast, basidiospores of species within the
Rhodocybe-Clitopilus clade are ornamented with
either longitudinal ridges or scattered and finely to
distinctly pustulate ornamentations respectively and
appear angular in polar view only (Baroni 1981,
Singer 1986).
Although there is support for clear separation of
species in either the Entoloma or the Rhodocybe-
Clitopilus clades, Co-David et al. (2009) show: (i) most
of the generic or infrageneric agaric ranks within
Entoloma
s.l. (e.g. Largent 1994, Noordeloos 2004)
were not monophyletic, (ii) sequestrate taxa such as
Rhodogaster
and
Richoniella
are nested within
Entoloma
s.l. and (iii)
Clitopilus
was nested within
Rhodocybe.
As a
result Co-David et al. (2009) concluded that only two
Submitted 25 Aug 2013; accepted for publication 28 Mar 2013.
1
Corresponding author. sarah.bergemann@mtsu.edu
Mycologia,
106(6), 2014, pp. 1127–1142. DOI: 10.3852/13-270
#2014 by The Mycological Society of America, Lawrence, KS 66044-8897
1127
genera should be recognized within the Entolomata-
ceae:
Entoloma
for all species in the Entoloma clade
and
Clitopilus
for all species in the Rhodocybe-
Clitopilus clade.
Here, the focus is on the classification of genera
within the Rhodocybe-Clitopilus clade. Baroni et al.
(2011) suggested that the taxon sampling of Co-David
et al. (2009) was too limited to substantiate the
recombination of all
Rhodocybe
spp. into Clitopilus.
Baroni and Matheny (2011) proposed that multiple,
segregate genera could be recognized based on an
analysis of a larger subset of species that showed
strong support for four major clades (Clitopilus-
Rhodocybe p. p., Clitopilopsis, Rhodocybe s. str. and
Rhodophana clades). To resolve the conflicts among
the proposed classifications, a phylogeny of the
Rhodocybe-Clitopilus clade was generated with the
goals of this research designed to: (i) augment the
single protein-coding gene (
rpb2
) used in previous
systematic studies of the Entolomataceae (Co-David et
al. 2009, Baroni and Matheny 2011, Baroni et al. 2011,
Kinoshita et al. 2012) by development of an addition-
al set of protein-coding loci (the mitochondrial ATP
synthase subunit 6 [
atp6
] and the nuclear translation
elongation factor subunit 1-a[
tef1
]), (ii) conduct an
in-depth phylogenetic analysis using this set of three
independent protein-coding genes in tandem with
a robust taxon sampling for this group and (iii)
delineate generic boundaries within the Rhodocybe-
Clitopilus clade using a molecular and morphological
framework.
MATERIALS AND METHODS
Taxon and gene sampling.—
For each collection in this
study, this information is provided: collector identifier,
herbarium, herbarium accession number, collector, collec-
tion location and year of sampling (TABLE I). Two hundred
forty-five sequences from 90 collections within Rhodocybe-
Clitopilus clade were generated. The taxon sampling
includes representative species from all infrageneric sec-
tions of
Clitopilus
(Singer 1986) and all but one of the
infrageneric sections of
Rhodocybe
(Baroni 1981, Singer
1986).
Rhodocybe
section
Tomentosi
(Baroni 1981) was
excluded because of the lack of material available for
destructive sampling. Taxa that are closely related to the
Entolomataceae were targeted for outgroup sampling based
on an analysis of the Basidiomycota (Matheny et al. 2006)
and included
Catathelasma imperiale
(Que´l.) Singer,
Mycena
aff.
pura
,
Panellus stipticus
(Bull.) P. Karst.,
Tricholoma
aurantium
(Schaeff.) Ricken and
Tricholoma flavovirens
(Pers.) S. Lundell. The GenBank accession numbers for
each sequence are presented (TABLE I).
Molecular markers.—
Our analyses included partial sequenc-
es of three protein-coding genes commonly used to infer
phylogenetic relationships in fungi: the
atp6
,
rpb2
and
tef1
.
The
rpb2
region was chosen because it had sufficient
nucleotide polymorphism to infer evolutionary relation-
ships in the Entolomataceae (Co-David et al. 2009, Baroni et
al. 2011, Matheny and Baroni 2011, Kinoshita et al. 2012).
The
tef1
gene was chosen based on the relatively high
number of informative sites (Matheny et al. 2007), and the
atp6
was selected primarily because of the availability of
universal primers (Kretzer and Bruns 1999, Binder and
Hibbett 2003). Other gene regions commonly used for
phylogenetic analyses of Fungi, such as the nuclear rDNA
internal transcribed spacer (nITS), the nLSU and the
mtSSU, were avoided. The phylogenies of the Entolomata-
ceae based on nLSU and mtSSU sequences were less
resolved with lower statistical supports compared to the
rpb2
(Co-David et al. 2009, Baroni et al. 2011) and the nITS
gene contains many ambiguous sites that are not easily
aligned (Kinoshita et al. 2012).
DNA isolation, amplification and sequencing.—
Tissues for
each sample were excised from preserved collections with
the protocol in Baumgartner et al. (2010). Tissues were
pulverized with 6.35 mm glass beads in an FP120 FastPrep
instrument (QBiogene, Carlsbad, California) after lyophili-
zation at least 30 min to 2 h. Extractions of DNA were
performed with 23CTAB (cetyl-trimethyl-ammonium-bro-
mide) buffer followed by isolation with phenol-chloroform-
isoamyl alcohol (25:24:1). The DNA was suspended in
Turbo GeneClean GNomic Salt (MP Biomedicals, Solon,
Ohio) and bound to GeneClean Turbo Columns (MP
Biomedicals, Solon, Ohio), washed with 70%EtOH and
were eluted from the columns with 0.13Tris-EDTA (TE).
Polymerase chain reactions (PCR) were performed to
amplify partial sequences from the three partial protein-
coding genes (
atp6
,
rpb2
,
tef1
) with previously published
primer sets and taxon-specific primers designed for this study
using the default parameters in Primer 3 (Rozen and
Skaletsky 2000). The details of primer combinations,
optimized PCR annealing temperatures (
T
a
) and references
for published primers are provided (TABLE II). All sequences
of
atp6
were obtained with primers ATP6-3 (Kretzer and
Bruns 1999) and ATP6-6r (Binder and Hibbett 2003). Several
primer combinations were used to obtain
rpb2
and
tef1
sequences. The forward primer, rpb2-i6f-RhoF1, in combi-
nation with either of the two reverse primers, rpb2-i7r-RhoR1
or rpb2-i7r-RhoR1b, were the most successful primer
combinations developed in this study for PCR amplification
of
rpb2
sequences. In many instances
tef1
sequences were
generated with EF-983F and EF-1953R (Rehner 2001), but
tef1
sequences were obtained more frequently by separate
PCR amplifications and sequencing of two segments of the
gene with two primer combinations: EFA-RhoF1 with EFA-
RhoR1 for the first part of the sequence and EFA-RhoF2 with
EFA-RhoR2 for the second part.
PCR amplifications were performed in 25 mL reaction
volumes with 13GoTaq Buffer (Promega, Madison,
Wisconsin), 2 mM magnesium chloride, 0.2 mM dNTPs,
1–1.5 mM each forward and reverse primer, 0.025 U Taq
polymerase (Promega, Madison Wisconsin), 0.2 mg/mL
bovine serum albumin and 0.5–4.0 mL genomic template
DNA. Amplification of
atp6
sequences used a cycling
1128 MYCOLOGIA
TABLE I. Voucher specimen collection information and GenBank accession numbers for sequences used in phylogenetic analyses
GenBank accession No.
Species Collection ID
Herbarium
accession No. Collector(s), location and year
atp6 rpb2 tef1
Clitopilus apalus
26394 Watling WAT26394
c
R. Watling, Kepong, Forest Research Institute, Malaysia, 1995 KC816738 KC816906 KC816822
C.
cf.
argentinus
Klaus Siepe
Geeste
33-D-46342
MTB4804/2
c
H. Bender, Mo¨nchengladbach, Germany, 2011 KC816739 KC816907 KC816823
C.
‘‘
cinerascens
’’ 8024 TJB 8024 TJB
c
T.J. Baroni, Alachua Co., Florida, USA, 1996 KC816740 KC816908 KC816824
C.
‘‘
cinerascens
’’ 8133 TJB 8133 TJB
c
T.J. Baroni, West Feliciana Parish, Louisiana, USA, 1996 KC816741 KC816909 KC816825
C. crispus
10027 TJB 10027 TJB
c
T.J. Baroni, Chiang Mai Prov., Thailand, 2006 KC816743 KC816911 KC816827
C. crispus
9982 TJB 9982 TJB
c
T.J. Baroni, Chiang Mai Prov., Thailand, 2006 KC816742 KC816910 KC816826
C. hobsonii
DLL9779 D.L. Largent, Danbulla National Park, Kauri Creek Track, rainforest
section, Queensland, Australia, 2010
KC816747 KC816916 KC816831
C. hobsonii
5967 TJB 5967 TJB
c
T.J. Baroni, Hamilton Co., Raquette Lake, New York, USA, 1988 KC816748 KC816917
C.
aff.
hobsonii
TDB-3667 UC1860830
a
N. Nguyen, Mariposa Grove Area, Yosemite National Park, Mariposa
County, California, USA, 2011
KC816759 KC816928 KC816841
C. hobsonii
DLL9586 D.L. Largent, Crater Lakes National Park, Lake Barrine, Queensland,
Australia, 2009
KC816912 KC816828
C. hobsonii
DLL9635 D.L. Largent, Mt. Hypipamee National Park, Queensland, Australia,
2009
KC816744 KC816913 KC816829
C. hobsonii
DLL9643 D.L. Largent, Mt. Hypipamee National Park, Queensland, Australia,
2009
KC816745 KC816914
C. hobsonii
DLL9746 D.L. Largent, Daintree National Park, Tribulation Section, Emmagen
Creek Track, Queensland, Australia, 2010
KC816746 KC816915 KC816830
C. hobsonii
grp. 7051 TJB 7051 TJB
c
T.J. Baroni, Macon Co., Coweeta, North Carolina, USA, 1993 KC816749 KC816918
C. paxilloides
5809 TJB 5809 TJB
c
T.J. Baroni, Mendocino Co., Little River, California, USA, 1987 KC816750 KC816919 KC816832
C. peri
10040 TJB 10040 TJB
c
T.J. Baroni, Chiang Mai Prov., Doi Suthep National Park, Thailand,
2006
KC816752 KC816921 KC816834
C. peri
10033 TJB 10033 TJB
c
T.J. Baroni, Chiang Mai Prov., above Ban Pha Deng Village, Thailand,
2006
KC816751 KC816920 KC816833
C. peri
10041 TJB 10041 TJB
c
T.J. Baroni, Chiang Mai Prov., Doi Suthep National Park, Thailand,
2006
KC816753 KC816922 KC816835
C.
cf.
prunulus
E226 Gates E226
c
G.M. Gates, Kermandie Track, Tasmania, Australia, 1999 KC816758 KC816927 KC816840
C. prunulus
11CA012 11CA012 K.L. Kluting, Big Lagoon Elementary School, Trinidad, Humboldt
County, California, USA, 2011
KC816757 KC816926 KC816839
C. prunulus
8456 R.E.
Halling
REH8456
c
R.E. Halling, Novgorod Region, Valdai District, Valdaiski National
Park, Russia, 2003
KC816754 KC816923 KC816836
C. prunulus
6805 TJB 6805 TJB
c
T.J. Baroni, Erie Co., Orchard Park Township, Chestnut Ridge Park,
New York, USA, 1992
KC816755 KC816924 KC816837
KLUTING ET AL.: PHYLOGENETIC RE-EVALUATION OF RHODOCYBE-CLITOPILUS CLADE 1129
TABLE I. Continued
GenBank accession No.
Species Collection ID
Herbarium
accession No. Collector(s), location and year
atp6 rpb2 tef1
C. prunulus
7003 TJB 7003 TJB
c
T.J. Baroni, Macon Co., Coweeta Hydrological Research Station,
North Carolina, USA, 1992
KC816756 KC816925
C.
sp. 7130 TJB 7130 TJB
c
T.J. Baroni, Hamilton Co., SUNY Cortland Outdoor Education
Facility, Camp Huntington, New York, USA, 1993
KC816760 KC816929
C. venososulcatus
8111 TJB 8111 TJB
c
T.J. Baroni, East Baton Rouge Parish, Louisiana, USA, 1996 KC816761 KC816930
Rhodocybe alutacea
5726 TJB 5726 TJB
c
T.J. Baroni, Haywood Co., Cherokee National Forest, North Carolina,
USA, 1987
KC816762 KC816931 KC816842
R. caelata
6919 TJB 6919 TJB
c
T.J. Baroni, Macon Co., Coweeta Hydrological Research Station,
North Carolina, USA, 1992
KC816764 KC816933 KC816843
R. caelata
J. Parkin J. Parkin
c
J. Parkin, York County, Ontario, Canada, 1988 KC816765 KC816934
R. caelata
3569 R.E.
Halling
REH3569
c
R.E. Halling, Jurmala, Latvia, 1982 KC816763 KC816932
R. caelata
K(M): 158060
d
R.G. Betts, Tyntesfield, Wraxall, North Somerset, England, UK, 2006 KC816802 KC816978 KC816885
R. collybioides
10417 TJB 10417 TJB
c
T.J. Baroni, Jujuy Province, Parque Nacional Calilegua, Argentina,
2011
KC816766 KC816935 KC816844
R. fallax
136 LP K(M): 116541
d
P. Leonard, Camino Real, La Palma, Canary Islands, Spain, 1997 KC816769 KC816938 KC816847
R. fallax
52/85 O-F88953
e
A. Hov and P. Marstad, Valtersborg, Vale, Vestfold County, Norway,
1985
KC816767 KC816936 KC816845
R. fallax
25668OKM 25668OKM
c
O.K. Miller, Jr., Malheur Co., Malheur National Forest, Oregon, USA,
1993
KC816768 KC816937 KC816846
R. formosa
1061015-6 1061015-6
c
F. Caballero and J. Vila, Spain, 2006 KC816939 KC816849
R. fuliginea
E537 Gates E537
c
G.M. Gates and D. Ratkowsky, Waverly Flora Park, Bellerive, Tasmania,
Australia, 1999
KC816770 KC816940 KC816850
R. hirneola
8490 R.E.
Halling
REH8490
c
R.E. Halling, Novgorod Region, Valdai District Valdaiski National Park,
Russia, 2003
KC816904 KC816820
R. hirneola
155 SC 155 SC
c
S. Carpenter, Mt. St. Helens, Polar Star Mine, Washington, USA, 1982 KC816905 KC816821
R. hirneola
PM 247-08 Artsobs. 1376857
e
P. Marstad, Konglungen, Asker, Akershus County, Norway, 2008 KC816977 KC816883
R. hondensis
6103 TJB 6103 TJB
c
T.J. Baroni, Humboldt Co., Largent Property, California, USA, 1988 KC816771 KC816941 KC816851
R. lateritia
E1589 Gates
(ISOTYPE)
E1589
c
G.M. Gates and D. Ratkowsky, Waterworks Reserve, Hobart, Tasmania,
Australia, 2002
KC816772 KC816942 KC816852
R.
luteocinnamomea
Lodge G-162 GUA241
c
D.J. Lodge, Guana Island, Quail Dove Ghut Trail, lower Tamarind
orchard, British Virgin Islands, 1999
KC816773 KC816943 KC816853
R. mellea
6883 TJB 6883 TJB
c
T.J. Baroni, Alachua Co., Sugar Foot Hammock, Florida, USA, 1992 KC816774 KC816944 KC816854
R. melleopallens
K(M): 143160
d
A. Henrici, Pembrey, Tywyn Burrows, Carmarthenshire (Dyfed)
County, Wales, UK, 2006
KC816775 KC816945 KC816855
R. melleopallens
415/83 O-F172919
e
G. Gulden, Bonn., Frogn, Akershus County, Norway, 1983 KC816776 KC816946 KC816856
R. minutispora
1071101-4 1071101-4
c
F. Caballero and J. Vila, Spain, 2007 KC816777 KC816947 KC816857
1130 MYCOLOGIA
TABLE I. Continued
GenBank accession No.
Species Collection ID
Herbarium
accession No. Collector(s), location and year
atp6 rpb2 tef1
R. mundula
7161 TJB 7161 TJB
c
T.J. Baroni, Essex Co., Upper Jay, Styles Brook Rd., New York, USA,
1993
KC816782 KC816952 KC816862
R. mundula
20894 O-F19454
e
J.K. Stordal, Hensvoll, Østre Toten, Oppland County, Norway, 1980 KC816784 KC816954 KC816864
R. mundula
PM 67-95 O-F71544
e
G. Mathiassen and P. Marstad, Lulle, Skibotndalen, Storfjord, Troms
County, Norway, 1995
KC816780 KC816950 KC816860
R. mundula
7599 TJB
AFTOLID 521
7599 TJB
c
T.J. Baroni, Tompkins Co., Ringwood Preserve, New York, USA, 1994 KC816783 KC816953 KC816863
R. mundula
7115 TJB 7115 TJB
c
T.J. Baroni, Hamilton Co., SUNY Cortland Outdoor Education Center,
Camp Marion Swamp, Long Point, New York, USA, 1993
KC816781 KC816951 KC816861
R. mundula
K(M): 164736
d
N. Mahler, Minsmere RSPB Nature Reserve, East Suffolk, Suffolk
County, England, UK, 2009
KC816779 KC816949 KC816859
R. mundula
K(M): 49620
d
J.R. Hawes, Near St. Helier, Jersey, Channel Islands, 1996 KC816778 KC816948 KC816858
R. nitellina
K(M): 132700
d
N.W. Legon, Mildenhall Woods, Mildenhall, West Suffolk County,
England, UK, 2004
KC816960 KC816867
R. nitellina
Artsobs. 1541959
e
P.G. Larsen, Møre og Romsdal, Seljeneset, Stordal, Norway, 2009 KC816790 KC816961 KC816868
R. nitellina
Artsobs. 1553208
e
R. Braathen and E.W. Hanssen, Ormtjern, NedreEiker, Buskerud
County, Norway, 2009
KC816966 KC816873
R. nitellina
O-F291457
e
O. Førland and J.B. Jordal, Hjelmeland, Rogaland County, Norway,
2009
KC816787 KC816957
R. nitellina
6404 TJB 6404 TJB
c
T.J. Baroni, Graubunden Canton, Switzerland, 1990 KC816963 KC816870
R. nitellina
6740 TJB 6740 TJB
c
T.J. Baroni, Mendocino Co., Navarro River, California, USA, 1992 KC816964 KC816871
R. nitellina
7861 TJB 7861 TJB
c
T.J. Baroni, Mendocino Co., Rt. 20 near Chamberlain Creek west of
Willits, California, USA, 1996
KC816789 KC816959 KC816866
R. nitellina
11CA025 11CA025 Location unknown, California, USA, 2011 KC816792 KC816965 KC816872
R. nitellina
HH74/10 O-F293352
e
H. Holien and T.E. Brandrud, Kvam, Steinkjer, Nord-Trøndelag
County, Norway, 2010
KC816788 KC816958 KC816865
R. nitellina
I-LF08-48 O-F285851
e
I.-L. Fonneland and D. Pettersen, Askerøya, Tvedestrand, Aust-Agder
County, Norway, 2008
KC816786 KC816956
R. nitellina
MC3-CAR MC3-CAR
c
M. Contu, Italy, 1995 KC816785 KC816955
R.
aff.
nitellina
5528 TJB 5528 TJB
c
T.J. Baroni, Sevier Co., Cherokee Orchard, Great Smoky Mountain
National Park, Tennessee, USA, 1987
KC816791 KC816962 KC816869
R.
aff.
nitellina
DLL10199 D.L. Largent, Barrington Tops National Park, Williams River Day Use
Area, New South Wales, Australia, 2011
KC816967 KC816874
R. pallidogrisea
E652 Gates E652
c
G.M. Gates and D. Ratkowsky, Mt. Field, Tasmania, Australia, 1999 KC816793 KC816968 KC816875
R. paurii
99/233
Moncalvo
(ISOTYPE)
JM99/233
c
J.-M. Moncalvo, Garhwal Himalaya, Pauri, Nagdev, Uttaranchal, India,
1999
KC816794 KC816969 KC816876
R. popinalis
K(M): 143166
d
R.G. Betts, Bamburgh, Northumberland County, England, UK, 2004 KC816796 KC816971 KC816878
KLUTING ET AL.: PHYLOGENETIC RE-EVALUATION OF RHODOCYBE-CLITOPILUS CLADE 1131
TABLE I. Continued
GenBank accession No.
Species Collection ID
Herbarium
accession No. Collector(s), location and year
atp6 rpb2 tef1
R. popinalis
K(M): 167017
d
E.W. Brown, Palace Lawn, Kew, Royal Botanic Gardens, Surrey
County, England, UK, 2010
KC816797 KC816972 KC816879
R. popinalis
O-F63376
e
J.I. Johnsen, Brusand, Ha˚ , Rogaland County, Norway, 1997 KC816799 KC816974 KC816880
R. popinalis
6378 TJB 6378 TJB
c
T.J. Baroni, Graubunden Canton, Fetan, Switzerland, 1990 KC816801 KC816976 KC816882
R. popinalis
116-2000 O-F105360
e
P. Marstad, Skallvold, Tønsberg, Vestfold County, Norway, 2000 KC816800 KC816975 KC816881
R. popinalis
648/06 K(M): 146162
d
D.J. Savage, Invernaver raised beach, Bettyhill area, West Sutherland,
Scotland, 2006
KC816795 KC816970 KC816877
R. popinalis
MC2-TRENT MC2-TRENT
c
L. Pennone, Trentino, Italy, 2003 KC816798 KC816973
R. pseudopiperita
E1159 Gates E1159
c
G.M. Gates and D. Ratkowsky, Mt. Wellington, Myrtle Gully,
Tasmania, Australia, 2001
KC816803 KC816979 KC816886
R. reticulata
E2183 Gates E2183
c
G.M. Gates and D. Ratkowsky, North West Bay River, Tasmania,
Australia, 2005
KC816804 KC816980 KC816887
R. rhizogena
5551 TJB
(ISOTYPE)
5551 TJB
c
T.J. Baroni, Macon Co., Ellicot Rock Trail, Ammons Creek Area,
North Carolina, USA, 1987
KC816805 KC816981 KC816888
R. roseiavellanea
8130 TJB 8130 TJB
c
T.J. Baroni, East Baton Rouge Parish, LSU campus, Louisiana, USA, 1996 KC816806 KC816982 KC816889
R.
sp. DLL9851 D.L. Largent, Myall Lakes National Park, Seal Rocks road, New South
Wales, Australia, 2010
KC816809 KC816986 KC816893
R.
sp. DLL9846 D.L. Largent, Barrington Tops National Park, Jerusalem Creek track,
New South Wales, Australia, 2010
KC816808 KC816985 KC816892
R.
sp. DLL9860 D.L. Largent, Barrington Tops National Park, Jerusalem Creek,
bottom end of track, New South Wales, Australia, 2010
KC816810 KC816987 KC816894
R.
sp. DLL9952 D.L. Largent, Barrington Tops National Park, Williams River Day Use
Area, end of blue gum track to lion’s rock, New South Wales,
Australia, 2010
KC816811 KC816988 KC816895
R.
sp. DLL9957 D.L. Largent, Myall Lakes National Park, Mungo Brush track, New
South Wales, Australia, 2010
KC816812 KC816989 KC816896
R.
sp. DLL10218 D.L. Largent, Barrington Tops National Park, Jerusalem Creek, lower
parking lot, New South Wales, Australia, 2011
KC816813 KC816990 KC816897
R.
sp. DLL10032 D.L. Largent, Yorkies Knob Beach Forest, northern end,
Queensland, Australia, 2011
KC816814 KC816991 KC816898
R. stangliana
2073 T. Læssøe 2073TL
c
T. Læssøe, East Jutland, Mariager, Hou Skov, Denmark, 1989 KC816992 KC816899
R. stipitata
5523 TJB 5523 TJB
c
T.J. Baroni, Sevier Co., Cherokee Orchard Trail, Great Smoky
Mountain National Park, Tennessee, USA, 1987
KC816815 KC816993
Rhodophana
‘‘
sienna
’’
6167 TJB 6167 TJB
c
T.J. Baroni, Essex Co., Wilmington, New York, USA, 1989 KC816807 KC816983 KC816890
Rhodophana
sp. Hama 434 COFC5029
b
O. Hama, Tamou, Parque Nacional de W. Mekrou, Niger, 2010 KC816984 KC816891
Catathelasma
imperiale
11CA01A 11CA01A
c
K.L. Kluting, Redwood National Park, Orick, Humboldt County,
California, USA, 2011
KC816816 KC816994 KC816900
1132 MYCOLOGIA
protocol of 95 C for 5 min, followed by 40 cycles of 95 C for
30 s, an optimized
T
a
for 2 min, and 72 C for 1 min and a
final extension at 72 C for 10 min (TABLE II). Sequences of
the
rpb2
were amplified with a touchdown protocol with an
initial incubation of 94 C for 5 min, followed by 12 cycles of
94 C for 1 min, 67 C for 1 min, decreasing 1 C each cycle
and 72 C 1.5 min, followed by 36 cycles of 94 C for 45 s, 55 C
for 1 min, 72 C for 1.5 min and followed by a final extension
period at 72 C for 7 min. An alternative protocol with an
optimized
T
a
also was used: 95 C for 4 min, 35 cycles of 95 C
for 30 s, optimized
T
a
for 1 min, 72 C for 1 min and a final
extension period of 72 C for 7 min.
Tef1
sequences were
amplified with either the touchdown protocol described
above or a cycling protocol of 95 C for 3 min, followed by 35
cycles of 95 C for 1 min, optimized
T
a
for 1.5 min, 72 C for
1 min and a final extension period of 72 C for 10 min.
Sequences were generated on an ABI3130
xl
at Middle
Tennessee State University with sequencing protocols
described in Largent et al. (2011). For sequences with
overlapping chromatograms due to nucleotide insertions or
deletions, weak signal strength or contaminants, PCR
amplicons were cloned with the TOPO TA cloning kit U
(Invitrogen, Carlsbad, California) following the procedure
described in Bergemann and Garbelotto (2006).
Phylogenetic analysis.—
Sequences were assembled and
edited with Sequencher 4.2.2 (Gene Codes Corp., Ann
Arbor, Michigan), and multiple sequence alignments were
generated manually with Se-Al 2.0a11 Carbon (Rambaut
2002). Introns were delimited from the
tef1
sequences with
Augustus 2.4 webserver (Stanke et al. 2008) and excluded
before analyses. Alignment lengths of
atp6
,
rpb2
and
tef1
were 471, 906 and 898 bp respectively. The
atp6
,
rpb2
and
tef1
alignments were assembled into a supermatrix (12
atp6
and 13
tef1
sequences were coded as missing data). The
concatenated sequence alignment can be found on
TreeBASE (http://purl.org/phylo/treebase/phylows/
study/TB2:S15480).
Before phylogenetic analysis, models of sequence evolu-
tion were chosen with AIC in TOPALi 2.5 using MrBayes as
the method for tree estimation (Milne et al. 2008). For
Bayesian analyses, a symmetric model with fixed equal base
frequencies and a gamma distribution (SYM+C) was selected
for
tef1
and
rpb2
, and a general time reversible model
(GTR+C) was selected for the
atp6
alignment. The GTR model
with a gamma distribution (GTR+C) was used for all
partitions in maximum likelihood (ML) analyses because
the RAxML manual suggests that a GTR model is the most
appropriate DNA substitution model for this software.
The phylogeny of the Rhodocybe-Clitopilus clade and
levels of support were inferred with an ML analysis and ML
bootstrap values (MLBS) generated with RAxML-HPC
8.0.24 (Stamatakis 2006, Stamatakis 2014) on the CIPRES
gateway (Miller et al. 2010). All trees were viewed with
FigTree 1.4.0 (Rambaut 2012). Each gene region first was
analyzed individually to test for topological incongruence
between them with the program compat.py (Kauff and
Lutzoni 2003). A conflict in tree topologies of individual
genes was considered significant when incongruent
topologies both received MLBS values of 70%or greater.
TABLE I. Continued
GenBank accession No.
Species Collection ID
Herbarium
accession No. Collector(s), location and year
atp6 rpb2 tef1
Mycena
aff.
pura
11CA007 11CA007
c
K.L. Kluting, Redwood National Park, Orick, Humboldt County,
California, USA, 2011
KC816817 KC816995 KC816901
Panellus stipticus
11CA052 11CA052
c
K.L. Kluting, Grays Falls Campground, Trinity County, California,
USA, 2011
KC816818 KC816996 KC816902
Tricholoma
flavovirens
11CA038 11CA038
c
K.L. Kluting, Humboldt County, California, USA, 2011 KC816819 KC816997 KC816903
Tricholoma
aurantium
LCG2308 LCG2308 L.C. Grubisha, British Columbia, Canada JN019434 JN019705 JN019386
a
Jepson Herbarium, University of California, Berkeley, California, USA (JEPS).
b
Herbario, Departamento de Biologı´a Vegetal, Facultad de Ciencias, Universidad de Co´rdoba, 14071 Co´ rdoba, Spain (COFC).
c
State University of New York College at Cortland Herbarium, Cortland, New York, USA (CORT).
d
The Royal Herbarium, Royal Botanic Gardens, Kew, Richmond, Surrey, England, UK (KEW).
e
The Mycological Herbarium, Botanical Museum, University of Oslo, Oslo, Norway (OSLO).
KLUTING ET AL.: PHYLOGENETIC RE-EVALUATION OF RHODOCYBE-CLITOPILUS CLADE 1133
TABLE II. Sequences of primers (using IUPAC ambiguity codes), citations for previously published primers and annealing temperature used for PCR amplification of
sequences generated for this study
Gene
region
Forward
primer Primer sequence (59–39) Reverse primer Primer sequence (59-39)
PCR annealing
temp (C) References
atp6
ATP6-3 TCTCCTTTAGAACAATTTGA ATP6-6r AACTAATARAGGAACTAAAGCTA 40, 42
a
, 44, or 50 Kretzer and Bruns 1999, Binder
and Hibbett 2003
rpb2
rpb2-i6f GAAGGYCAAGCYTGYGGTCT rpb2-i7r ATCATRCTNGGATGRATYTC touchdown Co-David et al. 2009
rpb2
rpb2-i6f-RhoF1 GAAGGNCARGCWTGYGGTCT rpb2-RhoR1 GTGRATYTCRCARTGTGTCCA 56, 58
a
, or 60 this study
rpb2
rpb2-i6f-RhoF1 (see above) rpb2-RhoR1b ATGRATYTCRCARTGTGTCCA 56
a
or 58 this study
rpb2
rpb2-i6f-RhoF1 (see above) rpb2-RhoR3 TGRATYTCRCARTGCGTCCA 56 this study
rpb2
rpb2-i6f-RhoF2 GAAGGNCARGCWTGYGGCCT rpb2-RhoR1b (see above) 50 Liu et al. 1999, Matheny 2005
rpb2
RPB2-5F GAYGAYMGWGATCAYTTYGG bRPB2-7R GAYTGRTTRTGRTCTGGGAAVGG touchdown Liu et al. 1999, Matheny 2005
rpb2
RPB2-5F (see above) bRPB2-7R2 ACYTGRTTRTCNGGRAANGG touchdown Liu et al. 1999, Matheny et al. 2007
rpb2
bRPB2-6F TGGGGYATGGTNTGYCCYGC bRPB2-7.1R CCCATRGCYTGYTTMCCCATDGC 52 Matheny 2005
tef1
EFA-RhoF1 GGYACYGGTGAATTYGARGC EFA-RhoR1
(internal)
GNCCARCCYTTRTACCANG touchdown this study
tef1
EFA-RhoF1 (see above) EFA-RhoR2 ACCRACACACATRGGYTTG touchdown this study
tef1
EFA-RhoF2
(internal)
CNTGGTAYAARGGYTGGNC EFA-RhoR2 (see above) 54
a
or 56 this study
tef1
EFA-RhoF3 GGTGAATTYGARGCYGGTATYT EFA-RhoR2 (see above) 58 this study
tef1
EFA-RhoF4 GCYGGTATYTCNAARGAYGG EFA-RhoR2 (see above) 58 this study
tef1
EF1-983F GCYCCYGGHCAYCGTGAYTTYAT EF1-1953R CCRGCRACRGTRTGTCTCAT 48, 50, or 52
a
Rehner 2001
tef1
EF1-983F (see above) Efgr GCAATGTGGGCRGTRTGRCARTC touchdown Rehner 2001
tef1
EF595F CGTGACTTCATCAAGAACATG Efgr (see above) touchdown Kauserud and Schumacher 2001,
Rehner 2001
a
Annealing temperature most often used.
1134 MYCOLOGIA
Because no major incongruence was detected, the
combined three-locus dataset was analyzed with a parti-
tioned model. The dataset was partitioned across each
gene region and codon position (nine total partitions for
the combined matrix of three protein coding loci
partitioning across codons). ML analyses were conducted
with 1000 MLBS replications using the rapid bootstrap
algorithm (Stamatakis et al. 2008). Further branch
supports were obtained with a Bayesian approach in
MrBayes 3.2.2 (Ronquist et al. 2012) with
Panellus stipticus
specified as outgroup taxon. Analyses of individual gene
regions and the combined three-locus dataset with the
same partitions stated above were conducted with two
separate runs using one cold and 10 heated chains with
default temperatures for two concurrent runs of 1 000 000
generations (
rpb2
, combined matrix of
atp6
+
rpb2
+
tef1
)or
2 000 000 generations (
atp6
,
tef1
). Trees were sampled
every 100 generations employing three swaps per chain
for each generation. The substitution rates, transition/
transversion rate ratios, character state (stationary nucle-
otide frequencies) and the alpha shape parameter were
unlinked so that each parameter was estimated indepen-
dently for each partition. In all analyses the two runs
converged on the same tree topology (standard deviation
split frequencies #0.01). Scatterplots were generated to
determine stationarity and parameter values for the
remaining samples after burn-in were discarded (burn-in
length 550 000 generations for all analyses. Bayesian
posterior probabilities (BPP) and branch lengths were
calculated for a 50%majority rule consensus tree.
Microscopic techniques.—
All light microscopic digital images
were made with DIC optics from revived tissues mounted in
3%KOH. For scanning electron microscopy small pieces of
dried lamella tissue, approximately 1–2 mm
2
, were rehy-
drated in 95%ETOH for 1 min, transferred to 3%KOH
1 min, washed twice in dH
2
O 1 min each. The samples then
were sandwiched between Whatman No. 4 filter papers in
modified BEEM capsules and placed immediately into 10%
ETOH. Dehydration in an ethanol series (10%,30%,50%,
70%,80%,90%,95%, 100%for 2 min each at room
temperature, then 2 min in100%ice-cold ETOH) was
followed by critical point drying of the samples in liquid
CO
2
. The dried tissues were mounted on aluminum stubs
with carbon-impregnated sticky tape and sputter-coated
with approximately 350 A
˚gold. Digital images were
obtained on an ISI DS130C SEM at 10 mm working distance
and 15 Kv accelerating voltage.
RESULTS
Because no topological incongruence was detected
when the three genes were analyzed individually, the
results of the three-gene (
atp6
+
rpb2
+
tef1
) analysis are
presented here. Run files and results for all analyses
available upon request from first author. This
multigene analysis provides strong support values
for all nodes that constitute the backbone of the
phylogeny as well as five well resolved major clades
(FIG. 1A–E).
The terminal Clitopilus clade (MLBS 593, BPP 5
1.0; FIG. 1A) is composed of two internal well
supported sister clades. One of the supported internal
clades includes the pleurotoid species of
Clitopilus
(MLBS 595, BPP 51.0; FIG. 1A1) and the second
clade includes centrally stipitate
Clitopilus
species
(MLBS 5100, BPP 51.0; FIG. 1A2). The Clitocella
clade includes three species formerly classified as
Rhodocybe
(
R. popinalis
[Fr.] Singer,
R. fallax
[Que´l.]
Singer and
R. mundula
[Lasch] Singer) with basidio-
spores obscurely ornamented with pustules (MLBS 5
100, BPP 51.0; FIG. 1B). The Clitopilopsis clade
contains multiple collections of
R. hirneola
(Fr.) P.D.
Orton, a species with an obscurely bumpy ornamen-
tation on thick-walled basidiospores (MLBS 5100,
BPP 51.0; FIG. 1C). The Rhodocybe clade contains a
diverse assemblage of
Rhodocybe
species, including the
type species for the genus,
R. caelata
(Fr.) Maire, that
have prominent pustulate ornamentations arranged
randomly on the basidiospore walls and lack hyphal
clamp connections (MLBS 5100 BPP 51.0;
FIG. 1D). The Rhodophana clade comprises species
classified as
Rhodocybe
that have abundant hyphal
clamp connections and basidiospores with prominent
pustules on the basidiospore walls (MLBS 5100, BPP
51.0; FIG. 1E).
TAXONOMY
Based on the presence of five strongly supported
monophyletic clades with morphological characters
for delineation, we recognize five genera within the
Rhodocybe-Clitopilus clade of the Entolomataceae:
Clitocella
gen. nov.,
Clitopilopsis
,
Clitopilus
,
Rhodocybe
and
Rhodophana
. The necessary taxonomic changes
are made below.
Clitocella Kluting, T.J. Baroni & Bergemann, gen.
nov.
MycoBank MB805406
Diagnosis:
Basidiomata centrally stipitate, clitocy-
boid, white, grayish, gray-brown or purplish gray.
Pileus small or large (30–110 mm), fleshy and
opaque, glabrous, and smooth or matted tomentose
or matted fibrillose, fleshy. Lamellae long-decurrent,
narrow or very narrow (up to 3 mm), and close to
crowded or very crowded with a smooth lamellar
edge. Stipe equal and glabrous, pubescent, floccose
or matted fibrillose. Basidiospores are flesh-pinkish in
deposit, have thin (0.2–0.4 mm), evenly cyanophilic
and inamyloid walls that are minutely and often
obscurely angular in polar view with 7–12 facets and
are ornamented with obscure or sometimes distinct
undulating pustules or minute bumps visible in
KLUTING ET AL.: PHYLOGENETIC RE-EVALUATION OF RHODOCYBE-CLITOPILUS CLADE 1135
FIG. 1. Maximum likelihood phylogram of the Rhodocybe-Clitopilus clade based on combined sequences (
atp6
+
rpb2
+
tef1
). Branches with an asterisk represent those with support values of both 100 and 1.0 for MLBS and BPP respectively.
Both MLBS and BPP support values are reported for nodes A–E, nodes along the backbone of the inferred phylogenetic tree
and for nodes with high branch support values (MLBS $70, BPP $0.95).
1136 MYCOLOGIA
profile and face views under transmitted-light micro-
scope; hymenial cystidia are generally lacking, but if
present then they are rare, arranged in small bunches
along the lamellar edge; pseudocystidia with brightly
colored contents are never present. Hyphal clamp
connections are always absent.
Type: Clitocella popinalis
(Fr.) Kluting, T.J. Baroni &
Bergemann
5
Agaricus popinalis
Fr., Systema Mycologicum
1:194. 1821.
Etymology: Clitocella
, reflecting the morphological simi-
larity and phylogenetic proximity to
Clitopilus
and
Clitopi-
lopsis,
cella, a Latin term referring to a storage place and in
this case for taxa not belonging to
Clitopilus
or
Clitopilopsis
.
Notes:
Macroscopically
Clitocella
closely resembles
centrally stipitate
Clitopilus
forms but differs in the
scattered pustulate basidiospore ornamentation in
contrast to the longitudinally ridged basidiospore
ornamentation of
Clitopilus
.
Clitocella
differs from
Clitopilopsis
by close, narrow, long-decurrent lamellae
and thin-walled basidiospores with pustulate orna-
mentations and minute, obscure angles in polar view.
Clitopilopsis
is differentiated by its basidiospores with
thickened walls (0.5–0.9 mm wide) that have smooth
or barely perceptible undulate bumps even with SEM
imaging and obscure irregular rounded angles of the
basidiospores in polar view.
Rhodocybe
and
Rhodo-
phana
differ from
Clitocella
because both possess
basidiospores with well developed, isolated pustules
on the surface of the basidiospores and distinctly
angular basidiospores in polar view.
Rhodophana
is
further differentiated by the presence of hyphal
clamp connections in the basidiomata.
Clitopilopsis
Maire, Bull. Soc. Hist. Nat. Afrique del N.
28:113. 1937.
Description:
Basidiomata clitocyboid or omphali-
noid, gray or pallid. Lamellae close to subdistant and
decurrent to subdecurrent. Basidiospores are pinkish
in deposit, have thickened walls 0.5–0.8(–0.9) mm)
that are evenly cyanophilic, nearly smooth in all views,
and round or obscurely angular in polar view.
Pseudocystidia and clamp connections are absent.
Type: Clitopilopsis hirneola
(Fr.) Ku¨ hner, Bull. Soc.
Mycol. Fr. 62:138. 1946.
Notes:
The angular spore morphology in polar view,
typical of the Entolomataceae, sometimes may be
difficult to decipher in this genus because not all
basidiospores have the obscure rounded angles, but
at least some do with careful examination under the
light microscope. This obscure angularity may be an
artifact of the thickened spore wall. Only two species
are known, and the colors are either gray (
C. hirneola
)
or pallid (
C. heterospora
).
Clitopilus
(Fr. ex Rabenh.) P. Kumm., Der Fu¨hrer in
die Pilzkunde. 96. 1871.
Description:
Basidiomata are clitocyboid or pleur-
otoid and mostly white, with grayish or brownish
colors present for a few species. Lamellae are long-
decurrent, narrow, and close on centrally stipitate
species, but adnate or adnexed on pleurotoid forms.
Basidiospores are pinkish or flesh pink in deposit,
binucleate, longitudinally ridged in face and profile
views, and angular in polar view with either 5–6 facets
and ridges or in most species and all the pleurotoid
forms, with 7–12 facets and ridges in polar view.
Clamp connections are absent.
Type: Clitopilus prunulus
(Scop.) P. Kumm., Der
Fu¨ hrer in die Pilzkunde. 97. 1871.
Notes:
The distinctive longitudinally ridged basid-
iospores are diagnostic for this genus.
Rhodocybe Maire, Bull. Soc. Mycol. Fr. 40:298. 1924
[1926]. Kluting, T.J. Baroni & Bergemann, emend.
Type: Rhodocybe caelata
(Fr.) Maire, Bull. Soc.
Mycol. Fr. 40:298. 1924 [1926].
Description:
Basidiomata pleurotoid, collybioid, my-
cenoid, clitocyboid or tricholomatoid, variously colored,
white, gray, brown, pinkish, reddish, yellowish or
combinations of these colors. Lamellae variously at-
tached, ranging from adnexed to adnate or subdecur-
rent (but never crowded and long-decurrent). Basidio-
spores are pinkish or dark fleshy pink in deposit,
angular in polar view with 6–12 facets, have thin, evenly
cyanophilic walls and have pronounced undulate-
pustulate ornamentations on the walls in face and
profile views visible under the light microscope.
Hymenial cystidia are present or absent, and when
present they can be pseudocystidia with brightly colored
contents or hyaline leptocystidia found as cheilocystida
and also pleurocystida. Clamp connections are absent.
Notes:
With recognition of
Clitocella
,
Clitopilopsis
and
Rhodophana
as segregate genera, the circum-
scription of the genus
Rhodocybe
has changed
significantly from its recent concept (Baroni 1981,
Singer 1986). With molecular analyses supporting
these three monophyletic genera, it is now possible to
clearly define with a set of morphological features
Clitocella
,
Clitopilopsis
and
Rhodophana
and thus
eliminate the argument that
Rhodocybe
is paraphy-
letic, as conceived (Co-David et al. 2009).
Rhodophana
Ku¨ hner, Bull. Soc. Mycol. Fr. 87:23. 1971.
Description:
Basidiomata are collybioid, mostly
ocher, orange-brown, honey, straw yellow or brownish
or rarely pinkish and mostly hygrophanous. Lamellar
attachment ranges from adnexed to adnate (but never
decurrent). Basidiospores are angular in polar view,
KLUTING ET AL.: PHYLOGENETIC RE-EVALUATION OF RHODOCYBE-CLITOPILUS CLADE 1137
have thin, evenly cyanophilic walls that are pinkish or
flesh pink in deposit and have pronounced scattered
undulate-pustulate ornamentations. Hymenial cystidia
are absent. Clamp connections are present.
Type: Rhodophana nitellina
(Fr.) Ku¨ hner, Bull. Soc.
Mycol. Fr. 87:23.1971.
Notes:
With the transfer of some taxa formerly
placed in section
Rhodophana
of
Rhodocybe
(e.g.
R.
speciosa
Lennox ex T.J. Baroni,
R. priscua
T.J. Baroni
[Baroni 1981], and
R. trachyospora
[Largent] T.J.
Baroni & Largent and its varieties [Baroni and Largent
1989]) now recognized as members of the genus
Entocybe
T.J.Baroni,V.Hofstetter & Largent (Entoloma
clade) based on molecular and morphologic evidence
(Baroni et al. 2011), the genus
Rhodophana
is mono-
phyletic. Species of
Entocybe
, in addition to having large,
obvious clamp connections, are distinguished by their
isodiametric, angular or obscurely angular basidiospores
in profile and face views, where the pustulate ornamen-
tations of the basidiospores are connected by a partial or
incomplete ridge-like pattern as seen under the SEM
(Baroni et al. 2011). The basidiospores of
Rhodophana
species are either ellipsoid or amygdaliform that are only
angular in polar view, and the pustulate ornamentations
are scattered and not interconnected with partial ridges.
Rhodophana
and
Entocybe
, although superficially similar
from a morphological perspective, are phylogenetically
placed in segregate clades.
Clitocella fallax (Que´l.) Kluting, T.J. Baroni &
Bergemann, comb. nov.
MycoBank MB805407
Basionym: Omphalia fallax
Que´l., Comptes Rendus
de l’Association Franc¸aise pour l’Avancement des
Sciences 24: 617. 1896.
Clitocella mundula (Lasch) Kluting, T.J. Baroni &
Bergemann, comb. nov.
MycoBank MB805408
Basionym: Agaricus mundulus
Lasch, Linnaea
4:527. 1829.
Clitocella popinalis (Fr.)Kluting,T.J.Baroni&
Bergemann, comb. nov.
MycoBank MB805409
Basionym: Agaricus popinalis
Fr., Systema Mycolo-
gicum 1:194. 1821.
Clitopilopsis heterospora (Murrill) Kluting, T.J. Bar-
oni & Bergemann, comb. nov.
MycoBank MB805410
Basionym: Eccilia heterospora
Murrill, Lloydia 9:324.
1946.
Rhodophana melleopallens (P.D. Orton) Kluting, T.J.
Baroni & Bergemann, comb. nov.
MycoBank MB805411
Basionym: Rhodocybe melleopallens
P.D. Orton,
Trans. Br. Mycol. Soc. 43:380. 1960.
Rhodophana stangliana (Bresinsky & Pfaff) Vizzini,
comb. nov.
IF550646
Basionym: Squamanita stangliana
Bresinksy & Pfaff,
Zeitschrift fu¨ r Pilzkunde 34:169. 1968 [1969].
DISCUSSION
Several studies have examined the Entolomataceae
on a molecular basis (Moncalvo et al. 2002, Matheny
et al. 2006, Co-David et al. 2009, Baroni and Matheny
2011, Baroni et al. 2011, Kinoshita et al. 2012,
Morgado et al. 2013), however this is the first to
provide a densely sampled systematic treatment of
Clitopilus
and
Rhodocybe
. Traditionally
Clitopilus
and
Rhodocybe
have been treated as segregate genera
based mostly on morphology of the basidiospores
(Baroni 1981, Singer 1986), but molecular analyses
suggest either a single genus (
Clitopilus
) (Co-David et
al. 2009) or at least four segregate genera (Baroni and
Matheny 2011). In the molecular analysis using
partial sequences of the three protein-coding genes
analyzed here, five strongly supported monophyletic
clades are resolved and are classified as distinct
genera:
Clitopilopsis
,
Clitopilus
,
Clitocella
,
Rhodocybe
and
Rhodophana
.
Eachgenusisdefinedwithacombinationof
morphological characters, and in most instances
distinct synapomorphies can be defined on the basis
of basidiospore ornamentation.
Clitopilus
contains
species with either clitocyboid (FIG. 2A) or pleurotoid
stature types (FIG. 2B), and longitudinally ridged
basidiospores (FIG. 2).
Clitocella
includes species with
a clitocyboid stature (FIG. 2C) and basidiospores
ornamented with relatively few or obscure pustules
(FIGS. 2H, 3A) in comparison to the prominently
undulate-pustulate ornamentation of
Rhodocybe
spe-
cies.
Clitopilopsis
includes species with a clitocyboid
stature (FIG. 2D) and basidiospores that have distinct-
ly thickened walls visible with a light microscope
(FIGS. 2I, 3B). These thickened walls obscure the
pustules and render the basidiospores smooth or only
slightly pustulate in a small fraction of the basidio-
spores. The stature of
Rhodocybe
is highly variable
(pleurotoid, collybioid, mycenoid, clitocyboid, tricho-
lomatoid), with lamellar attachment ranging from
adnexed to decurrent (FIG. 2E), and basidiospores
ornamented with prominent pustules (FIG. 2J). The
1138 MYCOLOGIA
FIG. 2. Macro- and microscopic characters used in the delineation of genera within the Rhodocybe-Clitopilus clade. A.
Clitopilus prunulus
basidiome, 9425 TJB, T.J. Baroni. B.
Clitopilus hobsonii
basidiomata, 8490 TJB, T.J. Baroni. C.
Clitocella
mundula
basidiomata, 2737 TJB, T.J. Baroni. D.
Clitopilopsis hirneola
basidiomata, 2370 TJB, T.J. Baroni. E.
Rhodocybe caelata
basidiomata, 3843 TJB, T.J. Baroni. F.
Rhodophana nitellina
basidiomata, 7861 TJB, T.J. Baroni. G.
Clitopilus prunulus
basidiospores, 3213 TJB, T.J. Baroni. H.
Clitocella mundula
basidiospores, 7161 TJB, T.J. Baroni. I.
Clitopilopsis hirneola
basidiospores, REH8490, R.E. Halling. J.
Rhodocybe caelata
basidiospores, REH3569, R.E. Halling. K.
Rhodophana nitellina
basidiospores, 6740 TJB, T.J. Baroni. L.
Rhodophana nitellina
clamp connections (at arrows) 6740 TJB, T.J. Baroni. Bars: A–F 5
10 mm, G–L 55mm.
KLUTING ET AL.: PHYLOGENETIC RE-EVALUATION OF RHODOCYBE-CLITOPILUS CLADE 1139
basal
Rhodophana
includes species with stature types
most often collybioid (FIG. 2F) that have basidio-
spores with prominent undulate-pustulate ornamen-
tations similar to
Rhodocybe
(FIG. 2K). The abundant
hyphal clamp connections found exclusively in
Rhodophana
can be used to distinguish this genus
from
Rhodocybe
(FIG. 2L).
The phylogenetic analysis by Baroni and Matheny
(2011) also highlighted segregate clades for
Clitopi-
lopsis, Rhodocybe
s. str. and
Rhodophana
, but the
terminal clade
Clitopilus
was collapsed with what we
recognize as
Clitocella
. Our analysis additionally
demonstrates that
Clitocella
constitutes a segregate
clade that is nested between
Clitopilus
and
Clitopi-
lopsis
and that
Clitopilus
contains two sister clades:
one with centrally stipitate species (FIG. 1A2) and the
other with pleurotoid statures (FIG. 1A1). The dichot-
omy between the centrally stipitate and the pleur-
otoid
Clitopilus
species will receive further scrutiny in
future studies.
Clitocella
was erected as a new genus to accommo-
date species with crowded, narrow, long-decurrent
lamellae and thin-walled basidiospores that are ob-
scurely pustulate. In general the clitocyboid basidiome
stature of
Clitocella
bears a macroscopic resemblance
to the centrally stipitate species of
Clitopilus
and yet
basidiospore morphology differs between the two
genera. Basidiospores with scattered and inconspicu-
ous pustules or bumpy ornamentations are character-
istic of
Clitocella
(FIG. 3A), whereas basidiospores of
Clitopilus
are ornamented with pustules arranged in
longitudinal ridges. Two
Clitocella
spp. sampled over a
broad geographic region,
C. mundula
and
C. popinalis
,
are often confused because they share many morpho-
logical characters and are separated only by spore size
and habitat preference.
Clitocella popinalis
has broader
basidiospores (5.0–5.5 mm) and is associated with
grasses, whereas
C. mundula
has narrower basidio-
spores (4.0–5.0 mm) and is associated with woodlands
(Baroni 1981). The lack of monophyly for collections
of
C. mundula
and
C. popinalis
borrowed from
herbaria in Europe (as
R. mundula
and
R. popinalis
in TABLE I) is likely due to misidentifications. Because
no attempt was made to carefully examine all
European collections morphologically due to the lack
of field notes, we suggest that
C. mundula
and
C.
popinalis
of Europe and North American should be re-
examined to resolve this taxonomic issue.
In the Clitopilopsis clade, three collections of
Clitopilopsis hirneola
(Fr.) Ku¨ hner from Russia, Nor-
way and the western United States were included in
this study (TABLE Ias
Rhodocybe hirneola
). Based on
the monophyly observed here, it appears that this is a
cohesive species with a widespread geographic distri-
bution.
Clitopilopsis heterospora
has basidiospores that
are morphologically similar to those found in
C.
FIG. 3. Scanning electron micrographic images of basidispores of
Clitocella
and
Clitopilopsis
.A.
Clitocella popinalis
6378
TJB, T.J. Baroni. B.
Clitopilopsis hirneola
155 SC, S. Carpenter. Bars: A, B 51mm.
1140 MYCOLOGIA
hirneola
(Baroni 1981) but differ by color of the
basidiomata and the lack of cystidia.
Clitopilopsis
heterospora
is known only from the type collection and
therefore was not included this study.
Rhodocybe
is the largest and most morphologically
diverse genus in the Rhodocybe-Clitopilus clade and
contains
R. caelata
, the type species of the
Rhodocybe
.
In a revision of the genus that included a study of the
neotype for
R. caelata
, Baroni (1981) recognized that
macro- and micromorphological variation existed
among species collected from different geographic
regions but was unable to determine consistent
characters to substantiate the variation noted.
Rhodo-
cybe caelata
is not a monophyletic species based on the
phylogenetic placement of the four collections
sequenced in this study. A detailed analysis to clarify
the boundaries of these and other similar morpho-
species is necessary.
Rhodophana
most closely resembles
Rhodocybe
in
terms of basidiome stature and basidiospore mor-
phology, but
Rhodophana
is unambiguously differen-
tiated by the presence of abundant hyphal clamp
connections. Ku¨ hner (1947) emphasized this charac-
ter as the basis for recognition of
Rhodophana
,
however his original statement that a new genus
couldberecognizedlackedtherequiredLatin
description and was considered nomen nudum. Later
Rhodophana
was validated when Ku¨hner provided the
Latin diagnosis (Ku¨hner and Lamoure 1971) and
explicitly assigned it a subgenus rank in
Rhodocybe
(
Rhodocybe
subgenus
Rhodophana
Ku¨ hner [Ku¨hner
and Lamoure 1971 p 19, see also Pegler and Young
1975]). As noted however in Indexfungorum.org and
Mycobank.org, the name
Rhodophana
Ku¨hner is
accepted as a valid genus described in 1971, and the
molecular analyses presented in this study support
elevating
Rhodophana
to the rank of genus. In
addition to the presence of clamp connections,
Ku¨ hner and Lamoure (1971) also noted that uninu-
cleate basidiospores are an important feature for
Rhodophana
based on their observation that uninu-
cleate basidiospores are present in
R. nitellina
(the
only species accepted in the genus at the time of
formal description), whereas binucleate basidiospores
are found in
Clitocella popinalis
(as
R. popinalis
) and
R. caelata
. To confirm this feature as a diagnostic
character, the number of nuclei per basidiospore
needs to be evaluated across a broad range of taxa in
future studies.
KEY TO GENERA
1. Basidiospores with pustules organized in longitu-
dinal ridges ......................
Clitopilus
19. Basidiospores lacking longitudinal ridges ....... 2
2. Basidiospores ornamented with obscure pus-
tules or appearing nearly smooth and with
minute or obscure angles in polar view . . . . 3
29. Basidiospores ornamented with prominent,
random isolated pustules in profile and face
views, and distinctly angular in polar view . . . 4
3. Basidiospore wall thin, ,0.5 mm .......
Clitocella
39. Basidiospore wall thick, $0.5 mm ....
Clitopilopsis
4. Hyphal clamp connections absent . . .
Rhodocybe
49. Hyphal clamp connections present . . .
Rhodophana
ACKNOWLEDGMENTS
We thank Dr Katriina Bendiksen, head engineer, Dr Karl-
Henrik Larsson, curator, from the Botanical Garden and
Museum at the University of Oslo (OSLO), Dr Bryn
Dentinger, head of mycology and Dr Elizabeth Woodgyer,
head of collections Management Unit, the Royal Botanical
Gardens (KEW), for preparing herbarium loans of collec-
tions used in this study. We also thank Mr Marco Contu, Dr
David Largent and Dr Thomas Bruns for providing
additional collections. A significant portion of the collec-
tions used in this study were obtained during work on two
previous National Science Foundation grants awarded by
the Biotic Surveys and Inventory Program of the National
Science Foundation to Dr Timothy J. Baroni at the State
University of New York, College at Cortland (DEB9525902,
DEB0103621). In addition we are grateful for financial
support from the National Science Foundation for sequenc-
ing under grant No. DRI 0922922 awarded to Dr Sarah E.
Bergemann.
LITERATURE CITED
Baroni TJ. 1981. A revision of the genus
Rhodocybe
Maire
(Agaricales). Beih Nova Hedwigia 67:1–198.
———, Hofstetter V, Largent DL, Vilgalys R. 2011.
Entocybe
is proposed as a new genus in the Entolomataceae
(Agaricales, Basidiomycota) based on morphological
and molecular evidence. N Am Fungi 6:1–19.
———, Largent DL. 1989. The genus
Rhodocybe
:new
combinations and a revised key to section Rhodophana
in North America. Mycotaxon 34:47–53.
———, Matheny PB. 2011. A re-evaluation of gasteroid and
cyphelloid species of Entolomataceae from Eastern
North America. Harvard Pap Bot 16:293–310,
doi:10.3100/0.25.016.0205
Baumgartner K, Travadon R, Bruhn J, Bergemann SE. 2010.
Contrasting patterns of genetic diversity and popula-
tion structure of
Armillaria mellea
sensu stricto in the
eastern and western United States. Phytopathology 100:
708–718, doi:10.1094/PHYTO-100-7-0708
Bergemann SE, Garbelotto M. 2006. High diversity of fungi
recovered from the roots of mature tanoak (
Lithocar-
pus densiflorus
) in northern California. Can J Bot 84:
1380–1394, doi:10.1139/b06-097
Binder M, Hibbett DS. 2003. Oligonucleotides. http://www.
clarku.edu/faculty/dhibbett/Protocols_Folder/
Primers/Primers.htm, accessed 18 Mar 2012.
KLUTING ET AL.: PHYLOGENETIC RE-EVALUATION OF RHODOCYBE-CLITOPILUS CLADE 1141
Co-David D, Langeveld D, Noordeloos ME. 2009. Molecular
phylogeny and spore evolution of
Entolomataceae
.
Persoonia 23:147–176, doi:10.3767/003158509X480944
Kauff F, Lutzoni F. 2003. Compat.py: a program to detect
topological conflict between supported clades in
phylogenetic trees. Available at http://lutzonilab.org/
downloadable-programs/
Kauserud H, Schumacher T. 2001. Outcrossing or inbreed-
ing: DNA markers provide evidence for type of
reproductive mode in
Phellinus nigrolimitatus
(
Basid-
iomycota
). Mycol Res 105:676–683, doi:10.1017/
S0953756201004191
Kinoshita A, Sasaki H, Nara K. 2012. Multiple origins of
sequestrate basidiomes within
Entoloma
inferred from
molecular phylogenetic analyses. Fungal Biol 116:
1250–1262, doi:10.1016/j.funbio.2012.09.006
Kretzer AM, Bruns TD. 1999. Use of
atp6
in fungal
phylogenetics: an example from the Boletales. Mol
Phylogenet Evol 13:483–492, doi:10.1006/mpev.
1999.0680
Ku¨ hner R. 1947.
Agaricus
(
Clitocybe
)
hirneolus
Fries,
champignon souvent me´connu en France aujourd’hui
et la tribu nouvelles des Orcelle´s.
Bulletin trimestriel de
la Socie´te´ Mycologique de France
62:183–193.
———, Lamoure D. 1971. Agaricales de la zone alpine.
Genre
Rhodocybe
R. Maire. Bull trimestriel Soc Mycol Fr
87:15–23.
Largent DL. 1994. Entolomatoid fungi of the western
United States and Alaska. Eureka, California: Mad
River Press. 516 p.
———, Bergemann SE, Cummings GA, Ryan KL, Abell-
Davis SE, Moore S. 2011.
Pouzarella
(
Agaricales
,
Entolomataceae
) species from New South Wales (Bar-
rington Tops National Park) and northeastern Queens-
land, Australia. Mycotaxon 117:435–483, doi:10.5248/
117.435
Liu YJ, Whelen S, Hall BD. 1999. Phylogenetic relationships
among Ascomycetes: evidence from an RNA polymer-
ase II subunit. Mol Biol Evol 16:1799– 1808,
doi:10.1093/oxfordjournals.molbev.a026092
Matheny PB. 2005. Improving phylogenetic inference of
mushrooms with RPB1 and RPB2 nucleotide sequences
(
Inocybe
; Agaricales). Mol Phylogenet Evol 35:1–20,
doi:10.1016/j.ympev.2004.11.014
———, Curtis JM, Hofstetter V, Aime MC, Moncalvo J-M, Ge
Z-W, Yang Z-L, Slot JC, Ammirati JF, Baroni TJ,
Bougher NL, Hughes KW, Lodge DJ, Kerrigan RW,
Seidl MT, Aanen DK, DeNitis M, Daniele GM,
Desjardin DE, Kropp BR, Norvell LL, Parker A,
Vellinga EC, Vilgalys R, Hibbett DS. 2006. Major clades
of Agaricales: a multilocus phylogenetic overview.
Mycologia 98:982–995, doi:10.3852/mycologia.98.6.982
———, Wang Z, Binder M, Curtis JM, Lim YW, Nilsson RH,
Hughes KW, Hofstetter V, Ammirati JF, Schoch CL,
Langer E, Langer G, McLaughlin DJ, Wilson AW,
Frøslev T, Ge Z-W, Kerrigan RW, Slot JC, Yang Z-L,
Baroni TJ, Fischer M, Hosaka K, Matsuura K, Seidl MT,
Vauras J, Hibbett DS. 2007. Contributions of
rpb2
and
tef1
to the phylogeny of mushrooms and allies
(Basidiomycota, Fungi). Mol Phylogenet Evol 43:430–
451, doi:10.1016/j.ympev.2006.08.024
Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the
CIPRES Science Gateway for inference of large
phylogenetic trees. Proceedings of the Gateway Com-
puting Environments Workshop (GCE), 14 Nov 2010,
New Orleans, Louisiana p 1–8.
Milne I, Linder D, Bayer M, Husmeier D, McGuire G,
Marshall DF, Wright F. 2008. TOPALi 2: a rich
graphical interface for evolutionary analysis of multiple
alignments on HPC clusters and multicore desktops.
Bioinformatics 25:126–127, doi:10.1093/bioinformatics/
btn575
Moncalvo J-M, Vilgalys R, Redhead SA, Johnson JE, James
TY, Aime MC, Hofstetter V, Verduin SJW, Larsson E,
Baroni TJ, Thorn RG, Jacobsson S, Cle´menc¸on H,
Miller Jr OK. 2002. One hundred seventeen clades of
euagarics. Mol Phylogenet Evol 23:357– 400,
doi:10.1016/S1055-7903(02)00027-1
Morgado LN, Noordeloos ME, Lamoureux Y, Geml J. 2013.
Multigene phylogenetic analysis reveals species limits,
phylogenetic patterns and evolutionary histories of key
morphological traits in
Entoloma
(
Agaricales
,
Basidiomycota
).
Persoonia 31:159–178, doi:10.3767/003158513X673521
Noordeloos ME. 2004.
Entoloma
s.l. Fungi Europaei. Vol. 5a.
Alassio, Italy: Edizione Candusso. 618 p.
Pegler DN, Young TWK. 1975. Basidiospore form in the
British species of
Clitopilus
,
Rhodocybe
and
Rhodotus
.
Kew Bull 30:19–32, doi:10.2307/4102870
Rambaut A. 2002. Se-Al: Sequence alignment editor. 2.0a11
Carbon. Available at http://tree.bio.ed.ac.uk/software/seal/
———. 2012. FigTree 1.4.0. http://tree.bio.ed.ac.uk/
software/figtree/
Rehner S. 2001. Primers for elongation factor 1-a(EF1-a).
http://www.aftol.org/pdfs/EF1primer.pdf, accessed 18
Mar 2012.
Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling
A, Ho¨ hna S, Larget B, Liu L, Suchard MA, Huelsenbeck
JP. 2012. MrBayes 3.2: Efficient Bayesian phylogenetic
inference and model choice across a large model space.
Syst Biol 61:539–542, doi:10.1093/sysbio/sys029
Rozen S, Skaletsky H. 2000. Primer3 on the WWW for
general users and for biologist programmers. Methods
Mol Biol 132:365–386.
Singer R. 1986. The Agaricales in modern taxonomy. 4th ed.
Koenigstein, Germany: Koelz Scientific Books. 981 p.
Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood-
based phylogenetic analyses with thousands of taxa and
mixed models. Bioinformatics 22:2688– 2690,
doi:10.1093/bioinformatics/btl446
———. 2014. RAxML 8: a tool for phylogenetic analysis and
post-analysis of large phylogenies. Bioinformatics 30:
1312–1313, doi:10.1093/bioinformatics/btu033
———, Hoover P, Rougemont J. 2008. A rapid bootstrap
algorithm for RAxML web servers. Syst Biol 57:758–771,
doi:10.1080/10635150802429642
Stanke M, Diekhans M, Baertsch R, Haussler D. 2008. Using
native and syntenically mapped cDNA alignments to
improve de novo gene finding. Bioinformatics 24:637–
644, doi:10.1093/bioinformatics/btn013
1142 MYCOLOGIA
... The genus Clitocella Kluting, T.J. Baroni & Bergemann (Entolomataceae, Agaricales), with C. popinalis (Fr.) Kluting, T.J. Baroni & Bergemann as the type species, was established in 2014 (Kluting et al. 2014). The main characteristics of Clitocella are clitocyboid basidiomata, narrow and crowded, long-decurrent lamellae, central to eccentric stipe, thin-walled (<0.5 μm) basidiospores with undulate pustules or minute bumps, clamp connections absent. ...
... The main characteristics of Clitocella are clitocyboid basidiomata, narrow and crowded, long-decurrent lamellae, central to eccentric stipe, thin-walled (<0.5 μm) basidiospores with undulate pustules or minute bumps, clamp connections absent. (Baroni 1981;Kluting et al. 2014;Jian et al. 2020). Previous studies show that Clitocella is phylogenetically closely related to the genera Clitopilus (Fr. ...
... P. Kumm. and Clitopilopsis Maire. Clitopilus differs from Clitocella in its longitudinally ridged basidiospore ornamentation, and Clitopilopsis in its basidiospores with thickened walls (0.5-0.9 μm) and obscure irregular rounded angles of the basidiospores in polar view (Kluting et al. 2014; Baroni et al. 2020;Jian et al. 2020). There are 10 accepted species in Clitocella (Index Fungorum, http://www.Indexfungorum.org/; ...
Article
Full-text available
Two new species of Clitocella are proposed based on morphological and phylogenetic investigations. Clitocella borealichinensis sp. nov. is closely related to C. orientalis but distinguished from the latter by its slightly smaller basidiospores and hyphae of pileipellis with pale brown to brown intracellular or parietal pigment. Clitocella colorata sp. nov. is closely related to C. popinalis and C. mundula in macromorphology but is differentiated from C. popinalis by its slightly smaller basidiospores and the difference in genetic profile, and from C. mundula by its relatively colorful pileus (white to yellowish white, grayish white to grayish brown, pink white). Phylogenetic analyses based on sequence data from five different loci (ITS, nrLSU, tef1 , rpb2 and atp6 ) support the taxonomic position of the two new species in the genus Clitocella . The illustrations and descriptions for the new taxa are provided.
... ex Rabehn.) P. Kumm., Clitopilopsis Maire, Clitocella Kluting, T. J. Baroni & Bergemann, and Rhodophana Kuhner are genera of Entolomataceae that represent a phylogenetic unit currently referred to as the Rhodocybe-Clitopilus clade (Moncalvo et al. 2002;Co-David et al. 2009;Kluting et al. 2014). The Rhodocybe-Clitopilus clade, with approximately 300 species described so far worldwide, is the smaller of the two monophyletic groups that make up the Entolomataceae, i.e., the Entoloma clade and the Rhodocybe-Clitopilus clade. ...
... Members of the Rhodocybe-Clitopilus clade are mainly found as saprotrophs in tropical and/or temperate ecosystems in both hemispheres (Maire 1926;Singer 1947Singer , 1969Singer , 1973Singer and Section Editor: Zhu-Liang Yang Digilio 1952;Dennis 1953Dennis , 1961Pegler 1977Pegler , 1983Moser 1978;Horak 1979aHorak , 1979bHorak [1978; Baroni 1981;Baroni 1988, 2007;Noordeloos 1988Noordeloos , 2012; Baroni and Halling 1992; Baroni and Horak 1994; Baroni and Gates 2006;Yang 2007;Henkel et al. 2010;Raj and Manimohan 2018;Jian et al. 2020). Species of the Rhodocybe-Clitopilus clade are recognized by their attached lamellae, flesh pink or reddish-brown spore deposits, basidiospores ornamented with longitudinally ridged or bumpy-pustulate surface in face view, minutely angled in polar view with 6-12 facets, and with evenly cyanophilic spore walls (Kluting et al. 2014). The basidiospore surface ornamentation for these taxa is typically obvious in transmitted light microscopy, but for some species, it might be quite subtle and only clearly demonstrated under scanning electron microscopy (Baroni 1981;Kluting et al. 2014). ...
... Species of the Rhodocybe-Clitopilus clade are recognized by their attached lamellae, flesh pink or reddish-brown spore deposits, basidiospores ornamented with longitudinally ridged or bumpy-pustulate surface in face view, minutely angled in polar view with 6-12 facets, and with evenly cyanophilic spore walls (Kluting et al. 2014). The basidiospore surface ornamentation for these taxa is typically obvious in transmitted light microscopy, but for some species, it might be quite subtle and only clearly demonstrated under scanning electron microscopy (Baroni 1981;Kluting et al. 2014). ...
Article
Full-text available
Based on morphological and phylogenetic investigations, four new species, Clitocella termitophila, Clitopilus velutinus, Rhodocybe dominicana, and Rhodocybe pseudoalutacea, one new variety, Rhodocybe luteocinnamomea var. fulva, and first reports of Clitopilus prunulus, Rhodocybe mellea, and Rhodocybe roseiavellanea are described and illustrated from the island of Hispaniola. Three protein coding genes, RPB2, TEF1, and ATP6, were used to compare taxa and make phylogenetic inferences about novel species and varieties. Where necessary, because of non-availability of these protein coding gene data for every taxon, ITS sequences were used to confirm uniqueness or species similarity for C. velutinus and R. mellea, respectively. This contribution is a result of and based on numerous expeditions in the Dominican Republic by two different groups over a 20-year period that were designed to gather data on macrofungal biodiversity of this region. The new agaric taxa documented here contribute to the limited but growing knowledge on biodiversity of the Entolomataceae (Agaricales) for the Dominican Republic and the island of Hispaniola.
... Formerly, the genus Clitopilus was a part of Rhodocybe Maire (1924: 298) (Moncalvo et al. 2002;Co-David et al. 2009;Vizzini et al. 2011). However, employment of molecular phylogenetic analyses has led to the separation of Clitopilus from Rhodocybe as well as the related genera, Clitocella Kluting, T.J. Baroni & Bergemann (2014: 1135 and Clitopilopsis Maire (1937: 113) (Kumla et al. 2019). ...
... Clitocella fallax (Quél.) Kluting, T.J. Baroni & Bergemann (2014: 1138 (AF357017 for ITS and AF223166 for LSU) from Italy was used as the outgroup. The dataset for the phylogenetic tree was made by Muscle alignment implemented in SEA VIEW software version 5.0.5 (Gouy et al. 2010) with the following manual adjustment where it was required. ...
Article
A novel mushroom species occurring on loamy soil under Bombax cieba was collected from Chichawatni forest, Punjab, Pakistan. Phylogenetic analyses of the nrDNA ITS and nuLSU regions revealed that it clusters within the genus Clitopilus. Further morpho-anatomical analyses confirmed its uniqueness, which is referred as a new species under the name Clitopilus chichawatniensis. The distinguishing characteristics of this novel taxon are large whitish to light pale, eccentric pleurotoid pileus 50–65 mm wide with lobed and involuted margins, large ovoid to ellipsoid basidiospores 6.2–8.4 × 4.8–6.4 µm with 3–5 longitudinal ridges, absence of cheilocystidia and pleurocystidia. A detailed description of this taxon and a key to all existing species of the genus Clitopilus in Pakistan is provided.
... Decurrentes (Konrad & Maublanc) Singer which encompasses species with a greyish or greyish brown, centrally stipitate basidioma, decurrent to subdecurrent lamellae and absence of both pseudocystidia and clamp-connections (Baroni 1981, Singer 1986, Vizzini et al. 2016a. Kluting et al. (2014) have shown that the genus Rhodocybe, as morphologically delimited (Baroni 1981, Singer 1986, Noordeloos 1988, consisted of four lineages, which should be considered as separate genera: Rhodocybe s.s., Clitocella, Clitopilopsis Maire and Rhodophana (Vizzini et al. 2016b). The phylogenetically delineated genera that were recognized by Kluting et al. (2014) are also recovered in our nrITS analysis. ...
... Kluting et al. (2014) have shown that the genus Rhodocybe, as morphologically delimited (Baroni 1981, Singer 1986, Noordeloos 1988, consisted of four lineages, which should be considered as separate genera: Rhodocybe s.s., Clitocella, Clitopilopsis Maire and Rhodophana (Vizzini et al. 2016b). The phylogenetically delineated genera that were recognized by Kluting et al. (2014) are also recovered in our nrITS analysis. According to our phylogenetic analyses, Rhodocybe cistetorum belongs in Rhodocybe s.s. ...
Article
Based on both morphological and molecular data, Rhodocybe cistetorum sp. nov., found under Cistus creticus, is described as a new species from the Black Sea coast of Turkey. ITS and LSU rDNA sequences obtained from the type specimen did not find any close match in public databases, but the new taxon is phylogenetically nested within Rhodocybe based on the analysis of LSU data from the new species as well as LSU, SSU, rpb2 and tef1 sequences from species of Clitocella, Clitopilus, Clitopilopsis, Rhodocybe and Rhodophana. The new species is well distinguished by a small, slightly umbilicate, creamy to beige pileus, decurrent, whitish to creamy lamellae and somewhat angular to broadly ellipsoid basidiospores. A full description of the species is provided with field photos, micromorphological illustrations, a phylogenetic tree and a short discussion.
... Clitopilus was introduced by (Kummer 1871) and is classified in Entolomataceae (Agaricales, Basidiomycota) (Co- David et al. 2009; Baroni and Matheny 2011). Clitopilus appears phylogenetically related to Rhodocybe as they share unique morphological features including pinkish basidiospores and evenly cyanophilic walls having 5-12 longitudinal ridges, and this was also corroborated by a phylogenetic analysis of the ITS region (Baroni and Matheny 2011;Kluting et al. 2014;Baroni et al. 2020). The taxonomy of pleuromutilin producers had remained obscure for a long time due to varying species concepts that also have affected many other groups of Basidiomycota (see Niego et al. (2021b) for the producers of strobilurins, which are another class of economically important secondary metabolites from Basidiomycota). ...
Article
Full-text available
Fungi are an understudied resource possessing huge potential for developing products that can greatly improve human well-being. In the current paper, we highlight some important discoveries and developments in applied mycology and interdisciplinary Life Science research. These examples concern recently introduced drugs for the treatment of infections and neurological diseases; application of –OMICS techniques and genetic tools in medical mycology and the regulation of mycotoxin production; as well as some highlights of mushroom cultivaton in Asia. Examples for new diagnostic tools in medical mycology and the exploitation of new candidates for therapeutic drugs, are also given. In addition, two entries illustrating the latest developments in the use of fungi for biodegradation and fungal biomaterial production are provided. Some other areas where there have been and/or will be significant developments are also included. It is our hope that this paper will help realise the importance of fungi as a potential industrial resource and see the next two decades bring forward many new fungal and fungus-derived products.
... Baroni (1981), in an extensive study of Rhodocybe collections from herbaria worldwide, divided Rhodocybe into seven sections viz., Crepidotoides Singer, Claudopodes Singer ex Baroni, Decurrentes (Konrad & Maublanc) Singer, Rhodocybe Maire, Rhodophana Kühner, Rufrobrunnea Baroni and Tomentosi Baroni. However, Kluting et al. (2014), raised sect. Rhodophana to generic rank, based on multigene sequence data, and presently there exists only six sections in the genus. ...
Article
We describe a new species of Rhodocybe, R. brunneoaurantiaca, from West Bengal, India. Field photographs of the collected basidiocarps are provided and the new species is compared with its allied taxa based on morphological and molecular (nrITS and nrLSU sequence) data. Rhodocybe brunneoaurantiaca is characterized by clitocyboid basidiomata with a small (25–41 mm), infundibuliform, brownish orange to brown pileus; decurrent, brittle, greyish orange to light brown lamellae; a smooth light brown to brown stipe; ellipsoid to broadly ellipsoid basidiospores; 2–4‐spored basidia; cylindrical to slender clavate, flexuous cheilocystidia; and unique sequences. A full description with illustrations, and phylogenetic trees showing the placement of the new species based on molecular sequence data are provided as well as an artificial key to the reported species of Rhodocybe from India.
Article
Full-text available
Nuc rDNA internal transcribed spacer region ITS1-5.8S-ITS2 (ITS barcode) sequence data from eight type specimens of previously described Squamanita species were obtained. Phylogenetic analysis of ITS and partial nuc 28S rDNA data revealed Squamanita as paraphyletic splitting into two monophyletic groups, which we recognize as the genera Squamanita and Dissoderma. We accept 14 Squamanita and nine Dissoderma species, provide the first sequences of 13 of these, and describe six new species of Squamanita and three new species of Dissoderma. We transfer three species of Squamanita into Dissoderma, one into Cystoderma, and treat S. basii and S. umbilicata as synonyms of D. paradoxum. Squamanita can be distinguished from Dissoderma by the generally larger fleshier basidiomata with a tricholomatoid or amanitoid stature and yellowish to tawny brown pileus and often similarly colored stipe. Most species have cheilo- and pleurocystidia. Species of Dissoderma are small, collybioid or mycenoid, lack cystidia, and the pileus and often upper stipe are purplish gray. Both genera parasitize basidiomata of other agarics.
Article
Full-text available
Species delimitation is one of the most fundamental processes in biology. Biodiversity undertakings, for instance, require explicit species concepts and criteria for species delimitation in order to be relevant and translatable. However, a perfect species concept does not exist for Fungi. Here, we review the species concepts commonly used in Basidiomycota, the second largest phylum of Fungi that contains some of the best known species of mushrooms, rusts, smuts, and jelly fungi. In general, best practice is to delimitate species, publish new taxa, and conduct taxonomic revisions based on as many independent lines of evidence as possible, that is, by applying a so-called unifying (or integrative) conceptual framework. However, the types of data used vary considerably from group to group. For this reason we discuss the different classes of Basidiomycota, and for each provide: (i) a general introduction with difficulties faced in species recognition, (ii) species concepts and methods for species delimitation, and (iii) community recommendations and conclusions.
Article
Full-text available
“Kakishimeji” identified as Tricholoma ustale and belonging to Tricholoma sect. Genuina is a common poisonous mushroom in Japan. Kakishimeji contains the toxic compound ustalic acid and causes digestive trouble. However, this fungus is consumed in some regions of Japan without any digestive issues. We clarified the probable species complex of Kakishimeji based on a phylogenetic analysis. We collected 89 basidioma specimens of Kakishimeji and related species from various forest sites in Japan and conducted phylogenetic analyses using 7 nuclear and mitochondrial gene sequences. Kakishimeji was found to consist of four distinct phylogenetic clades based on all DNA regions tested. Of these, two clades included European T. stans and T. albobrunneum type specimens. Another two clades consisted of sister clades to T. pessundatum and T. ustaloides. In addition, all four phylogenetic clades of Kakishimeji had different spore and basidium sizes. Therefore, we regarded the latter two clades as two new Tricholoma species: T. kakishimeji and T. kakishimejioides.
Article
Full-text available
Extended areas on the island of Cyprus including the vast majority of forested land, are occupied by Pinus brutia, an ecologically important tree forming ectomycorrhizal associations with a wide array of fungi. In this third installment of macromycete inventories from selected ecosystems in Cyprus, the basidiomycete diversity within P. brutia communities is reported following a 12-y-inventory. Two hundred and thirty-one taxa are compiled in an annotated checklist, 95 of which constitute new records for the country. Most notable of these are Clitopilus daamsii, Hygrophorocybe nivea, Lepiota lepida, Leucoagaricus georginae, Rhodocybe matesina, Russula werneri, Tephrocybe striaepilea, Tephroderma fuscopallens, and Tricholoma chrysophyllum, which are rarely reported in published literature. Notes on the altitude, phenology and estimated abundance are provided, accompanied by selected imagery and a review of previously published records.
Article
Full-text available
Species from Entoloma subg. Entoloma are commonly recorded from both the Northern and Southern Hemispheres and, according to literature, most of them have at least Nearctic-Palearctic distributions. However, these records are based on morphological analysis, and studies relating morphology, molecular data and geographical distribution have not been reported. In this study, we used phylogenetic species recognition criteria through gene genealogical concordance (based on nuclear ITS, LSU, rpb2 and mitochondrial SSU) to answer specific questions considering species limits in Entoloma subg. Entoloma and their geographic distribution in Europe, North America and Australasia. The studied morphotaxa belong to sect. Entoloma, namely species like the notorious poisonous E. sinuatum (E. lividum auct.), E. prunuloides (type-species of sect. Entoloma), E. nitidum and the red-listed E. bloxamii. With a few exceptions, our results reveal strong phylogeographical partitions that were previously not known. For example, no collection from Australasia proved to be conspecific with the Northern Hemisphere specimens. Almost all North American collections represent distinct and sister taxa to the European ones. And even within Europe, new lineages were uncovered for the red-listed E. bloxamii, which were previously unknown due to a broad morphological species concept. Our results clearly demonstrate the power of the phylogenetic species concept to reveal evolutionary units, to redefine the morphological limits of the species addressed and to provide insights into the evolutionary history of key morphological characters for Entoloma systematics. New taxa are described, and new combinations are made, including E. fumosobrunneum, E. pseudoprunuloides, E. ochreoprunuloides and E. caesiolamellatum. Epitypes are selected for E. prunuloides and E. bloxamii. In addition, complete descriptions are given of some other taxa used in this study for which modern descriptions are lacking, viz. E. subsinuatum, E. whiteae, E. flavifolium, E. luridum, E. bloxamii, E. madidum, E. corneri, E. callidermum and E. coeruleoviride.
Article
Full-text available
Phylogenies are increasingly used in all fields of medical and biological research. Moreover, because of the next generation sequencing revolution, datasets used for conducting phylogenetic analyses grow at an unprecedented pace. RAxML (Randomized Axelerated Maximum Likelihood) is a popular program for phylogenetic analyses of large datasets under maximum likelihood. Since the last RAxML paper in 2006, it has been continuously maintained and extended to accommodate the increasingly growing input datasets and to serve the needs of the user community. I present some of the most notable new features and extensions of RAxML, such as, a substantial extension of substitution models and supported data types, the introduction of SSE3, AVX, and AVX2 vector intrinsics, techniques for reducing the memory requirements of the code and a plethora of operations for conducting post-analyses on sets of trees. In addition, an up-to-date, 50 page user manual covering all new RAxML options is available. The code is available under GNU GPL at https://github.com/stamatak/standard-RAxML. Alexandros.Stamatakis@h-its.org.
Article
Full-text available
Morphological and molecular characteristics support the recognition of a welldefined taxonomic group within the Entolomataceae. The distinctive basidiospore form and a three locus DNA analysis separate the species that share these characteristics from other species of Entoloma s. l. We propose here a new genus, Entocybe, to accommodate these taxa.
Article
Designing PCR and sequencing primers are essential activities for molecular biologists around the world. This chapter assumes acquaintance with the principles and practice of PCR, as outlined in, for example, refs. 1, 2, 3, 4.
Article
An overview of the phylogeny of the Agaricales is presented based on a multilocus analysis of a six-gene region supermatrix. Bayesian analyses of 5611 nucleotide characters of rpb1, rpb1-intron 2, rpb2 and 18S, 25S, and 5.8S ribosomal RNA genes recovered six major clades, which are recognized informally and labeled the Agaricoid, Tricholomatoid, Marasmioid, Pluteoid, Hygrophoroid and Plicaturopsidoid clades. Each clade is discussed in terms of key morphological and ecological traits. At least 11 origins of the ectomycorrhizal habit appear to have evolved in the Agaricales, with possibly as many as nine origins in the Agaricoid plus Tricholomatoid clade alone. A family-based phylogenetic classification is sketched for the Agaricales, in which 30 families, four unplaced tribes and two informally named clades are recognized.
Book
A European monograph of Entoloma with keys, descriptions, line-drawings, and coloured plates by Vello Liiv
Article
An account is given of spore form and structure in the genera Clitopilus, Rhodocybe and Rhodotus (Agaricales) together with an atlas of transmission and scanning electron micrographs. A revised classification of the British species is presented.