Optimization of genetic transformation of Artemisia annua L. Using Agrobacterium for Artemisinin production

Abstract

Background:
Artemisinin, a sesquiterpene lactone endoperoxide isolated from the medicinal plant Artemisia annua L., is a choice and effective drug for malaria treatment. Due to the low yield of artemisinin in plants, there is a need to enhance the production of artemisinin from A. annua and biotechnological technique may be one of the methods that can be used for the purpose.

Aim:
To study the transformation efficiency of Agrobacterium tumefaciens in A. annua that could be applied to enhance the production of artemisinin by means of transgenic plants.

Setting and designs:
The factors influencing Agrobacterium-mediated transformation of A. annua were explored to optimize the transformation system, which included A. tumefaciens strain and effect of organosilicone surfactants. Three strains of A. tumefaciens, that is, LBA4404, GV1301, and AGL1 harboring the binary vector pCAMBIA 1303 have been used for transformation. The evaluation was based on transient β-glucuronidase (GUS).

Materials and methods:
Plant cell cultures were inniatiated from the seeds of A. annua using the germination Murashige and Skoog medium. A. tumefaciens harboring pCAMBIA were tranformed into the leaves of A.annua cultures from 2-week-old-seedling and 2-month-old-seedling for 15 min by vacuum infiltration. Transformation efficiency was determinated by measuring of blue area (GUS expression) on the whole leaves explant using ImageJ 1.43 software. Two organosilicon surfactants, that is, Silwet L-77 and Silwet S-408 were used to improve the transformation efficiency.

Results:
The transformation frequency with AGL1 strain was higher than GV3101 and LBA4404 which were 70.91, 49.25, and 45.45%, respectively. Effect of organosilicone surfactants, that is, Silwet L-77 and Silwet S-408 were tested on A. tumefaciens AGL1 and GV3101 for their level of transient expression, and on A. rhizogenes R1000 for its hairy root induction frequency. For AGL1, Silwet S-408 produced higher level of expression than Silwet L-77, were 2.3- and 1.3-fold, respectively. For GV3101, Silwet L-77 was still higher than Silwet S-408, were 1.5- and 1.4-fold, respectively. However, GV3101 produced higher levels of expression than AGL1. The area of GUS expression spots of AGL1, LBA4404, and GV3101 strains was 53.43%, 41.06%, and 30.51%, respectively.

Conclusion:
A. tumefaciens AGl1 strain was the most effective to be transformed in to A. annua than GV3101 and LBA4404 strain. Surfactant Silwet S-408 produced the highest efficiency of transformation.

Full text

Pharmacognosy Magazine
ISSN : 0973-1296
Phcog.Net - Bringing Medicinal Plant Researchers Together
Publication of Pharmacognosy Network Worldwide
www.phcog.com
January - March 2014 (Supplement) | Volume 10 | Issue 37
CAB Abstracts, Caspur, Chemical Abstracts, CNKI (China National Knowledge Infrastructure), CSA databases, DOAJ, EBSCO Publishing’s Electronic Databases, Excerpta
Medica / EMBASE, Genamics JournalSeek, Google Scholar, Health & Wellness Research Center, Health Reference Center Academic, Hinari, Index Copernicus, Indian
Science Abstracts, Journal Citation Reports, National Science Library, OpenJGate, PrimoCentral, ProQuest, PubMed, Pubmed Central, Science Citation Index Expanded,
Scimago Journal Ranking, SCOLOAR, SCOPUS, SIIC databases, Summon by Serial Solutions, Ulrich’s International Periodical Directory and Web of Science.
Pharmacognosy Magazine • Volume 10 • Issue 37 • January-March 2014 • Pages 00-00**
®
Impact Factor for 2012: 1.525
Included

S176 Pharmacognosy Magazine | January-February 2014 | Vol 10 | Issue 37 (Supplement)
Optimization of genetic transformation of Artemisia
annua L. Using Agrobacterium for Artemisinin
production
Elfahmi, Sony Suhandono1, Agus Chahyadi
Pharmaceutical Biology Research Group, School of Pharmacy, 1Plant Molecular Biology, School of Life Sciences and Technology,
Institut Teknologi Bandung, West Java, Indonesia
Submitted: 01-10-2012 Revised: 11-11-2012 Published: 21-02-2014
Address for correspondence:
Dr. Elfahmi, Pharmaceutical Biology Research Group, School of
Pharmacy, Institute Teknologi Bandung, Ganesha 10, Bandung -
40132, West Java, Indonesia.
E-mail: elfahmi@fa.itb.ac.id
Background: Artemisinin, a sesquiterpene lactone endoperoxide isolated from the medicinal plant
Artemisia annua L., is a choice and effective drug for malaria treatment. Due to the low yield of
artemisinin in plants, there is a need to enhance the production of artemisinin from A. annua and
biotechnological technique may be one of the methods that can be used for the purpose. Aim: To
study the transformation efciency of Agrobacterium tumefaciens in A. annua that could be applied
to enhance the production of artemisinin by means of transgenic plants. Setting and Designs: The
factors inuencing Agrobacterium-mediated transformation of A. annua were explored to optimize
the transformation system, which included A. tumefaciens strain and effect of organosilicone
surfactants. Three strains of A. tumefaciens, that is, LBA4404, GV1301, and AGL1 harboring
the binary vector pCAMBIA 1303 have been used for transformation. The evaluation was based
on transient β-glucuronidase (GUS). Materials and Methods: Plant cell cultures were inniatiated
from the seeds of A. annua using the germination Murashige and Skoog medium. A. tumefaciens
harboring pCAMBIA were tranformed into the leaves of A.annua cultures from 2-week-old-seedling
and 2‑month‑old‑seedling for 15 min by vacuum inltration. Transformation efciency was
determinated by measuring of blue area (GUS expression) on the whole leaves explant using ImageJ
1.43 software. Two organosilicon surfactants, that is, Silwet L-77 and Silwet S-408 were used to
improve the transformation efciency. Results: The transformation frequency with AGL1 strain was
higher than GV3101 and LBA4404 which were 70.91, 49.25, and 45.45%, respectively. Effect of
organosilicone surfactants, that is, Silwet L-77 and Silwet S-408 were tested on A. tumefaciens
AGL1 and GV3101 for their level of transient expression, and on A. rhizogenes R1000 for its
hairy root induction frequency. For AGL1, Silwet S-408 produced higher level of expression than
Silwet L-77, were 2.3- and 1.3-fold, respectively. For GV3101, Silwet L-77 was still higher than
Silwet S-408, were 1.5- and 1.4-fold, respectively. However, GV3101 produced higher levels of
expression than AGL1. The area of GUS expression spots of AGL1, LBA4404, and GV3101 strains
was 53.43%, 41.06%, and 30.51%, respectively. Conclusion: A. tumefaciens AGl1 strain was
the most effective to be transformed in to A. annua than GV3101 and LBA4404 strain. Surfactant
Silwet S‑408 produced the highest efciency of transformation.
Key words: Artemisinin, Artemisia annua L., Agrobacterium transformation, malaria, pCAMBIA
INTRODUCTION
Artemisinin is a sesquiterpene lactone endoperoxide
extracted from Artemisia annua L. (Asteraceae)
and highly effective against multidrug‑resistant
Plasmodium.[1] However, the low level of artemisinin
in the plant (0.01‑1.4% of dry weight) has made
artemisinin‑based drugs relatively expensive because of
its short supply in industry.[2] Currently, plant resources
cannot meet the increasing worldwide demands, while
chemical synthesis is difcult and expensive because
of its endoperoxide bridge.[3] Therefore, biotechnology
approach for increasing of artemisinin level via
metabolic engineering in transgenic A. annua plants and
in genetically modied microbes are sought as novel
means for large‑scale production and cost‑effective
commercialization of artemisinin.[4]
Access this article online
Website:
www.phcog.com
DOI:
10.4103/0973-1296.127372
Quick Response Code:
ABSTRACT
ORIGINAL ARTICLEPHCOG MAG.

Pharmacognosy Magazine | January-February 2014 | Vol 10 | Issue 37 (Supplement) S177
Elfahmi, et al.: Genetic transformation of Artemisia annua L. using Agrobacterium
Numerous efforts focusing on enhancing the production
of artemisinin have been made for a long time. However,
conventional breeding of high artemisinin yielding
plants;[5] tissue and cell cultures via manipulation of
culture conditions, growth media, feeding of precursor,
and elicitation;[6,7] and organ or culture transformation of
A. annua via Agrobacterium (Paniego and Giulietti, 1995)[8‑10] to
increase the yield of artemisinin have not been successful yet.
In recent years, artemisinin biosynthesis has been the
subject of intensive research. Genes‑encoding enzymes
of the pathway, such as farnesyl diphosphate synthase (FDS),
amorpha‑4,11‑diene synthase (ADS), and cytochrome P450
monooxygenase (CYP71AV1), and the genes of the enzymes
relevant to the biosynthesis of artemisinin, such as squalene
synthase (SQS), have been isolated and cloned from A. annua.[11]
Thus, we can enhance of artemisinin production by genetic
engineering in plant or microbe using these enzymes.
Numerous efforts on genetic modication of A. annua have
been made for enhance of artemisinin production. These
efforts include overexpression of FDS[12,13] and isopentenyl
transferase,[14] and inhibition of SQS expression.[15] Besides
in plants, these genes have been transformed and expressed
in microbes through genetic engineering. Artemisinic
acid, a precursor of artemisinin, has been produced using
Saccharomyces cerevisiae which engineered with FDS, ADS, and
CYP71AV1 genes of A. annua. ADS gene which is a key
enzyme in the cyclization of farnesyl pyrophosphate has also
been expressed in Aspergilus nidulans[16] and Escherichia coli[17]
to produce amorphadiene. However, these efforts have not
shown a dramatic increase in the production of artemisinin
and its precursor. Therefore, in this work, we focused on
exploring the factors inuencing Agrobacterium‑mediated
transformation of A. annua to optimize the transformation
system. The optimum transformation system will be used
in our next study to enhance the ADS gene expression in
A. annua through plant genetic engineering.
MATERIALS AND METHODS
Plant materials and tissue culture conditions
Seeds of A. annua L. were collected from medicinal plant
cultivation Manoko, Lembang, Bandung, Indonesia.
Seeds were surface sterilized by soaking in 5% NaOCl
for 20 min after immersing in 70% ethanol for 2 min.
The seeds were rinsed three times with sterile distilled
water and then germinated under sterile conditions in 100
mL ask containing 20 mL germination Murashige and
Skoog (MS) medium[23] [Table 1]. The pH was adjusted to
6.1 with 1 N NaOH before addition of agar. The medium
was autoclaved at 121°C for 20 min. Germination started
within 2 or 3 days using uorescent lamps for 16 h and at
temperature of 25 ± 2°C.
Agrobacterium strains and plant expression vector
Several A. tumefaciens strains (LBA4404, GV3101, and
AGl1) and binary vector pCAMBIA 1303 were tested for
their competence to transform A. annua L. The binary
vector contains the NPT II (npt II) gene conferring for
bacterial kanamycin resistance and hpt II gene for plant
hygromycin selection. This vector has a gusA‑mgfp5‑His6
fusion as reporter genes. These reporter genes were placed
under the control of the CaMV 35S promoter.
Transformation of Agrobacterium tumefaciens
Vector pCAMBIA 1303 was transformed into
A. tumefaciens using heat‑shock method.[18] The transformant
cells of Agrobacterium harboring the binary vector
pCAMBIA were conrmed by crude polymerase chain
reaction (PCR) and electrophoresis. The forward primer
was 5’‑AGTGGCAGTGAAGGGCGAACAGT‑3’ and
reverse 5’‑AATAACGGTTCAGGCAC AGCACA‑3’,
designed according to the sequence of gus gene. The
25 mL of PCR reactions included 0.5 mM forward primer,
0.5 mM reverse primer, 2.5 µl 10 × Taq DNA Polymerase
buffer, 0.2 mM dNTPs, 1 U Taq DNA Polymerase, and
2 mM MgCl2 (Promega). Amplication was performed
in a thermal cycler (Applied Biosystem ‑ 2720 Thermal
cycler) as follows: 1 min at 94°C; 30 cycles of 30 s at
94°C; 30 s at 72°C; followed by 7 min at 72°C. The 989 bp
amplication fragments were electrophoresis on a 0.8%
agarose gel (Boehringer Mannheim) containing ethidium
bromide (Promega) and then observed.
Transformation of Artemisia annua
The A. tumefaciens strains LBA4404, GV3101, and AGl1
harboring the binary vector pCAMBIA 1303 were used
for transformation. These strains were grown in yeast
extract peptone (YEP) medium supplemented with
kanamycin (50 mg/L) and rifampycin (50 mg/L) for LBA4404
and GV3101, and carbenicilin/ampicilin (50 mg/L) for AGl1.
The monoclones were picked out and incubated at 28°C
for 36 h, then 1 mL bacterial suspension was diluted to 50
mL YEP medium followed by being incubated to reach
OD600 ≈ 0.5. The bacterial suspension was centrifuged at 4°C,
4000 rpm for 10 min and then resuspended with 50 mL liquid
Table 1: Media used in our case
Medium Components
MS MS salts, 2 mg/L glycine, 0.1 mg/L thiamine,
0.5 mg/L pyridoxine, 0.5 mg/L nicotinic
acid, 100 mg/L inositol, 3% (w/v) sucrose,
0.8% (w/v) agar, pH 6.1
MS-germination ½ MS salts, 2% (w/v) sucrose, other
components are the same to MS, pH 6.1
MS-infection MS+10 mg/L As, pH 6.1
MS-cocultivation MS, pH 6.1
MS: Murashige & Skoog medium[23]

S178 Pharmacognosy Magazine | January-February 2014 | Vol 10 | Issue 37 (Supplement)
Elfahmi, et al.: Genetic transformation of Artemisia annua L. using Agrobacterium
MS‑infection [Table 1]. They were continually incubated
for 3 h and then used as infection bacterial suspension to
infect the leaves explants from 2‑week‑old‑seedling and
2‑month‑old‑seedling for 15 min by vacuum inltration.
The infected leaves were blotted on sterile lter paper, then
cocultivated on MS‑cocultivation medium [Table 1] in the
dark for 3 days. After cocultivation, the leaves were transferred
to sterile distilled water with cefotaxime (500 mg/L) for
LBA4404 and GV3101, and augmentin (400 mg/L) for AGl1,
to wash and destroy the Agrobacterium cells.
Effect of surfactants on the tranformation efciency
of A. annua was performed using two organosilicon
surfactants, that is, Silwet L‑77 and Silwet S‑408.
Transformation procedure was the same as described above
using leaves explants from 14‑day‑old seedling of A. annua.
Surfactants with concentration 0.002% (v/v) was added
into bacterial suspension for leaves infection. After 3 days
cocultivation, leaves explants were washed with antibiotic
to remove residual bacteria. Transformation efciency was
determinated by measuring of blue area (GUS expression)
on the whole leaf explant using ImageJ 1.43 software.
B‑glucuronidase assay
Β
‑glucuronidase (GUS) assays were performed on
transformant leaves with the pCAMBIA 1303 binary vector
according to the method described by Jefferson (1987).[19]
The amount of transient GUS expression was calculated
based on the ratio of the area of spots or blue area on the
whole leaves area using ImageJ 1.43 software.
RESULTS AND DISCUSSION
Cultivation of A. annua on MS medium from fresh
seeds has been successfully and established in our
laboratory [Figure 1] Previously, callus of A. annua has
also been successfully induced and maintenanced in cell
suspension cultures for artemisinin enhancement via
feeding of precursor and elicitation, but the results showed
there were no enhancement of artemisinin either in calli
or cell suspension cultures (unpublished). Therefore, we
have tried to enhance artemisinin content by plant genetic
engineering via A. tumefaciens‑mediated transformation of
A. annua. The rst step, optimization of transformation
system, has been performed to nd the most effective
strains of A. tumefaciens. Several strains of A. tumefaciens
have been reported successfully to infect the A. annua
with various plant expression vectors.[20,21] However, the
frequency of infection and regeneration of A. annua is
still low.
In this work, we used three A. tumefaciens strains, that
is, LBA4404, GV3101, and AGl1. There have been no
reports on the ability of the last two strains to mediate
transformation of A. annua. These two strains are known
to be powerful to mediate transformation on plants. We
used pCAMBIA 1303 as a binary vector which contain the
NPT II (npt II) gene conferring for bacterial kanamycin
resistance and hpt II gene for plant hygromycin selection.
This vector has a gusA‑mgfp5‑His6 fusion as reporter
genes. All reporter genes were placed under the control
of the CaMV 35S promoter.
The binary vector pCAMBIA 1303 was successfully
transformed into competent cells of A. tumefaciens
using heat‑shock method. The transformant cells of
Agrobacterium were analyzed by PCR [Figure 2]. The
A. tumefaciens strains LBA4404, GV3101, and AGl1
harboring the binary vector pCAMBIA 1303 were used
for transformation on leaves explants of A. annua.
We have adapted Han et al., (2005)[21] method for high
efciency of genetic transformation of A. annua. We
have used transient gus gene expression to monitor the
transformed leaves.
Figure 2: Polymerase chain reaction analysis of pCAMBIA 1303 from
transformant of Agrobacterium tumefaciens strains: LBA4404 (L),
AGl1 (A), GV3101 (G), Marker 1 kb (M) and pCAMBIA 1303 as a
gus‑positive control (C)
1500 pb
1000 pb
800 pb
Figure 1: Artemisia annua L.: 3‑months‑old, (a) flower on
6‑month‑old, (b), seeds, (c) and 1‑month‑old‑seedling on Murashige
and Skoog medium (d and e)
d
c
b
a
e

Pharmacognosy Magazine | January-February 2014 | Vol 10 | Issue 37 (Supplement) S179
Elfahmi, et al.: Genetic transformation of Artemisia annua L. using Agrobacterium
The result in Figure 3 showed the bacterial strains have
important role in plant transformation. Transformation
frequency of AGL1 was 70.91% from the total leaves
explants of A. annua, higher than GV3101 and LBA4404
strains, which were 49.25% and 45.45%, respectively.
These transformation frequencies was calculated based
on the presence of GUS transient expression on leaves
explants. The ability of Agrobacterium to infect the plants is
very dependent on their chromosome and their virulence.
The AGL1, GV3101, and LBA4404 strains are not only
different in their chromosome, but also the level of
genes activation in virulence region. Perhaps this cause
why AGL1, a succinamopine strain was known highly
virulent. It has a higher infection frequency than nopaline
strain (GV3101) and octopine strain (LBA4404).
The surfactants are known to increase the efficiency
of plant transformation using Agrobacterium. The use
of several types of surfactants by Kim et al., (2009)[22]
enhanced the transient expression in Arabidopsis leaves.
In our study, we used surfactant from organosilicon type,
that is, Silwet L‑77 and S‑408. In addition for its function
to decrease the surface tension between two phases, the
surfactants are also able to enhance penetration into the
cuticle, thereby increasing the movement of material
into a plant cell, in this case the genetic material which is
transferred by Agrobacterium.[22] Organosilicon surfactants
which are a nonionic surfactants are less toxic to plant
growth. Surfactant is added in inltration medium at low
concentrations 0.002% (v/v) in order to be able to facilitate
the infection of plant tissues by Agrobacterium cells without
damaging the growth of explants.
The leaves showed several blue spots caused by the transient
GUS expression after 3 days cocultivation [Figure 4].
By contrast, untransformed did not show any blue
staining [Figure 4d‑f]. The results in Figure 3 G‑J showed
the use of surfactants which enhanced the transient
expression compared to transformation without of
surfactants (A‑C). On the AGL1 strain, level of transient
expression with the Silwet S‑408 was 2.3‑fold higher than
Silwet L‑77 which was only 1.3‑fold. While on the GV3101
strain, both of surfactants exhibited transient expression
of GUS in the same level. The expression level of GUS
on the Silwet L‑77 was 1.5‑fold higher than Silwet S‑408.
However, GV3101 strain showed the level of transient
expression higher than AGL1, which can be seen from the
area of GUS expression [Table 2].
CONCLUSION
The transfer of pCAMBIA 1303 via Agrobacterium tumefaciens
and expression of gus reporter gene on leaf of Artemisia
Figure 3: Transformation frequency of Artemisia annua with three
Agrobacterium tumefaciens strain
0
10
20
30
40
50
60
70
80
LBA4404GV3101AGL1
Frequency of
Transformation, %
Strains of
A. tu mefaciens
Tabel 2: Effect of surfactant on the levels
of
β
-glucuronidase transient expression on
Artemisia annua
Strain of
Agrobacterium
tumefaciens
Surfactants Area of GUS
expression
Expression
fold
AGL1 Nonsurfactant 24.93%±1.19 1
Silwet L-77 32.74%±1.86 1.3
Silwet S-408 58.48%±4.94 2.3
GV3101 Non surfactant 45.66%±5.07 1
Silwet L-77 67.89%±9.43 1.5
Silwet S-408 63.98%±8.34 1.4
GUS: β-glucuronidase
Figure 4: Histochemical β‑glucuronidase assays of the transformed
leaf of Artemisia annua: Without surfactants, (a‑c), untransformed, (d‑f)
and with surfactant (g‑j)
d
h ji
c
g
b
f
a
e

S180 Pharmacognosy Magazine | January-February 2014 | Vol 10 | Issue 37 (Supplement)
Elfahmi, et al.: Genetic transformation of Artemisia annua L. using Agrobacterium
annua were successfully performed. Strain of A. tumefaciens
AGl1 was the most effective to be transformed to this plant
than GV3101 and LBA4404 strain. Surfactant Silwet S‑408
produced the highest efciency of transformation.
REFERENCES
1. Ro DK, Paradise EM, Ouellet M, Fisher KJ, Newman KL,
Ndungu JM, et al. Production of the antimalarial drug precursor
artemisinic acid in engineered yeast. Nature 2006;440:940-3.
2. Dewick PM. Medicinal natural products: A biosynthetic approach.
3rd ed. UK: John Wiley and Sons Ltd; 2009.
3. Hong GJ, Hu WL, Li JX, Chen, XY, Wang LJ. Increased
accumulation of artemisinin and anthocyanins in Artemisia
annua expressing the Arabidopsis blue light receptor CRY1.
Plant Mol Biol Rep 2009;27:334-41.
4. Zeng QP, Zeng XM, Yin LL, Yang RY, Feng LL, Yang XQ.
Quantication of three key enzymes inolved in artemisinin
biogenesis in Artemisia annua by policlonal antisera-based
elisa. Plant Mol Biol Rep 2009;27:50-7.
5. Qian Z, Gong K, Zhang L, Jianbing L, Jing F, Wang Y, et al. A simple
and efcient procedure to enhance artemisinin content in Artemisia
annua L. by seeding to salinity stress. AJB 2007;6:1410-3.
6. Putalun W, Luealon W, De-Eknamkul W, Tanaka H, Shoyama Y.
Improvement of artemisinin production by chitosan in hairy root
cultures of Artemisia annua L. Biotechnol Lett 2007;29:1143-6.
7. Baldi A, Dixit VK. Yield enhancement strategies for artemisinin
production by suspension cultures of Artemisia annua. Bioresour
Technol 2008;99:4609-14.
8. Paniego NB, Giulietti AM. Artemisinin production by Artemisia
annua L.‑transformed organ cultures. Enzyme Microb Technol
1996;18:526-30.
9. Ghosh B, Mukherjee S, Jha S. Genetic transformation of
Artemisia annua by Agrobacterium tumefaciens and artemisinin
synthesis in transformed cultures. Plant Sci 1997;122:193-9.
10. Wang JW, Tan RX. Artemisinin Production in Artemisia annua
hairy root cultures with improved growth by altering the nitrogen
source in the medium. Biotechnol Lett 2002;24:1153-6.
11. Covello PS. Making artemisinin. Phytochemistry 2008;69:2881-5.
12. Chen D, Liu C, Ye H, Li G, Liu BY, Meng YL, et al. Ri-mediated
transformation of Artemisia annua with a recombinant farnesyl
diphosphate synthase gene for artemisinin production. Plant
Cell Tissue Organ Cult 1999;57:157-62.
13. Chen D, Ye H, Li G. Expression of a chimeric farnesyl
diphosphate synthase gene in Artemisia annua L. transgenic
plant via Agrobacterium tumefaciens-mediated transformation.
Plant Sci 2000;155:179-85.
14. Sa G, Mi M, He-chun Y, Ben-ye L, Guo-feng L, Kang C. Effects
of ipt gene expression on the physiological and chemical
characteristics of Artemisia annua L. Plant Sci 2001;160:691-8.
15. Zhang L, Jing F, Li F, Li M, Wang Y, Wang G, et al. Development
of transgenic Artemisia annua (Chinese wormwood) plants with
an enhanced content of artemisinin, an effective anti-malarial
drug, by hairpin-RNA-mediated gene silencing. Biotechnol Appl
Biochem 2009;52:199-207.
16. Lubertozzi D, Keasling JD. Expression of a synthetic
Artemisia annua amorphadiene synthase in Aspergillus nidulans
yields altered product distribution. J Ind Mirobiol Biotechnol
2008;35:1191-8.
17. Tsuruta H, Paddon CJ, Eng D, Lenihan JR, Horning T, Anthony LC,
et al. High-level production of amorpha-4.11-diene. A precursor
of the antimalarial agent artemisinin. in Escherichia coli. PLoS
One 2009;4:e4489.
18. Wang K. Methods in molecular biology: Agrobacterium protocols.
2nd ed., vol. 1. New Jersey: Humana Press; 2006.
19. Jefferson RA. Assaying chimeric genes in plants: The GUS gene
fusion system. Plant Mol Biol Rep 1987;5:387-05.
20. Vergauwe A, Van Geldre E, Inzé D, Van Montagu M,
Van den Eeckhout E. Factors inuencing Agrobacterium
tumefaciens-mediated transformation of Artemisia annua L.
Plant Cell Rep 1998;18:105-10.
21. Han JL, Wang H, Ye HC, Liu Y, Li ZQ, Zhang L, et al. High
efciency of genetic tranformation and regeneration of Artemisia
annua L. via Agrobacterium tumefaciens-mediated procedure.
Plant Sci 2005;168:73-80.
22. Kim MJ, Baek K, Park CM. Optimization of conditions for
transient Agrobacterium-mediated gene expression assays in
Arabidopsis. Plant Cell Rep 2009;28:1159-67.
23. Murashige T, Skoog F. A revised medium for rapid growth
and bioassays with tobacco tissue cultures. Physiol Plant
1962;51:473-97.
Cite this article as: Elfahmi, Suhandono S, Chahyadi A. Optimization
of genetic transformation of Artemisia annua L. Using Agrobacterium for
Artemisinin production. Phcog Mag 2014;10:S176-80.
Source of Support: Nil, Conict of Interest: None declared.