ArticlePDF Available

Abstract

We designed nine polymorphic markers for the squirrel glider (Petaurus norfolcensis), an arboreal marsupial in eastern Australia. These markers will assist in the management of isolated populations and the evaluation of wildlife corridors.
Page 1 of 3
This is the accepted, pre-proof version of the manuscript. The final publication is 1
available at Springer via http://dx.doi.org/10.1007/s12686-014-0219-3 2 3
Development of nine polymorphic microsatellite loci in the squirrel glider (Petaurus norfolcensis) 4
K. Soanesab*, S.C. Banksc and R. van der Reea 5
aAustralian Research Centre for Urban Ecology, Royal Botanic Gardens, Melbourne, VIC 3010, Australia 6
b School of Botany, University of Melbourne, VIC 3010, Australia 7
cFenner School for Environment and Society, Australian National University, ACT, 0200, Australia 8
*corresponding author: Phone +61 (03) 8344 0146, Fax +61 (03) 9347 9123, e-mail: 9
k.soanes@pgrad.unimelb.edu.au (K. Soanes) 10
Keywords: squirrel glider, microsatellite, fragmentation, Petaurus norfolcensis 11
Abstract 12
We designed nine polymorphic markers for the squirrel glider (Petaurus norfolcensis), an arboreal marsupial in 13
eastern Australia. These markers will assist in the management of isolated populations and the evaluation of 14
wildlife corridors. 15
Main text 16
The squirrel glider is a small gliding marsupial in Australia. Squirrel gliders are threatened with extinction in the 17
south-eastern parts of their range due to ongoing habitat loss and fragmentation. Much of the species’ habitat in 18
south-eastern Australia is in the form of fragmented linear roadside strips and small patches, and enhancing 19
connectivity by creating corridors or road crossing structures is a key conservation management aim. Molecular 20
genetic techniques are necessary to evaluate the long-term effectiveness of these measures. However, only five 21
microsatellite markers are available for the species (Brown et al. 2004; Mills 2000), three of which are difficult 22
to score reliably. 23
To develop new microsatellites for P. norfolcensis, we extracted DNA from the ear tissue of a single individual 24
(Miller et al. 1988) and sequenced a genomic library prepared from this sample on a Roche Genome Sequencer 25
FLX 454 (half a sequencing plate shared with two other samples) using Roche XL+ sequencing chemistry. We 26
assembled the reads (de novo) with CLC Genomic Workbench 5.1 and searched the resulting contigs for 27
microsatellite motifs between 2 and 6 bp (with a minimum repeat length of 8) in MSATCOMMANDER v. 0.8.2 28
(Faircloth 2008). We identified 1495 contigs containing microsatellite repeats, for which we designed primers 29
for 60 for trial at the Australian Genome Research Facility. Fourteen of the loci were amplified successfully and 30
nine were polymorphic in 20 test samples (additional data provided as Electronic Supplementary Material 1). 31
The polymorphic markers were screened on an additional 29 squirrel gliders (8 male, 21 female) from a single 32
population in south-east Australia (Table 1). Markers were amplified in 6 µl reaction volumes containing 15 ng 33
gDNA, 0.03 uM of fluorescently labelled M13 primer (FAM, NED, PET or VIC), 0.01 uM of M13-labelled 34
forward primer, 0.02 uM of reverse primer, PCR buffer, Immolase DNA polymerase (Bioline), 250 uM dNTPs 35
and 1.5 mM MgCl2. PCR amplification was performed with a 5 minute, 94°C, denaturation step, followed by 41 36
Page 2 of 3
cycles of 94°C for 30 sec, annealing for 45 sec (dropping 0.5°C per cycle from 60°C to 55°C), and 72°C for 45 37
sec, with a final extension of 72°C for 10 min. Allele sizes of the pooled PCR products were scored on an 38
Applied Biosystems 3730 DNA Analyzer and genotying was conducted with GeneMapper v. 4.0. 39
The new loci had a mean expected heterozygosity of 0.47 and allelic diversity of 4.3 (Table 1). No locus showed 40
evidence of null alleles, large allele drop out or stuttering (van Oosterhout et al. 2004). There were no deviations 41
from Hardy-Weinberg equilibrium or evidence of linkage disequilibrium (GENEPOP v. 3.4). In combination 42
with existing markers, these nine loci will enable research into the fine-scale effects of habitat fragmentation on 43
squirrel glider populations and help guide and evaluate restoration efforts. 44
Table 1 Characteristics of polymorphic microsatellite markers for squirrel gliders as estimated in GenAlEx v. 45
6.5. 46
Locus
Primer sequence
Repeat
Size (bp)
Na
Ho
He
Pno5
L: TCATGAGCACAAGTCCCTAC
(AGAT)17
272-284
4
0.59
0.61
R: TTCCCAGCTGTCAGTGTTC
Pno7
L: GGGTACCTTGGAGCCTAGC
(GT)20
354-379
5
0.45
0.40
R: GGATATCGGCAATTCCGGC
Pno12
L: AGCAGCTGAGCCACTTAGG
(AC)16
191-193
2
0.38
0.31
R: GGGCGTTTCTGCAGTTATC
Pno18
L: AGTCACTTAAACTCTGCTTGCC
(AGAT)13
281-293
3
0.59
0.61
R: TGAGGAAACTGAGGCTGAC
Pno31
L: TCCTGAGTTAGGGCATGAGC
(CTT)20
259-317
6
0.72
0.62
R: ACAGGAAGTAGGTAACCGTG
Pno40
L: TGGATCGCTTAACCTCTCGG
(ATCT)13
284-313
5
0.59
0.61
R: TCATCCCAACACTGGAGCC
Pno44
L: GTGTGACCAGGGACATGTTG
(GTT)13
235-257
3
0.17
0.16
R: TCCACTCACGGTTCTTCCC
Pno47
L: AACTGGATTACCATCTTCAGACC
(AC)10
166-169
2
0.07
0.07
R: ACACACACTTATGAATTGGAGG
Pno56
L: AGCCTAAGGTGGTAGATTACAGG
(ATCT)14
477-515
9
0.86
0.84
R: CTGTTTGCATTTCCCTATATGTTG
47
Acknowledgements 48
We thank the Baker Foundation, the Roads and Maritime Service New South Wales, the Australian Research 49
Council Discovery Grant (DP0984876) and the Holsworth Wildlife Research Endowment for funding this 50
research. Thanks to Andrea Taylor, Paul Sunnucks and Melinda Ziino (Australian Genome Research Facility) 51
for advice during this project. 52
References 53
Brown M, Kendal TA, Cooksley H, Saint KM, Taylor AC, Carthew, SM, Cooper SJB (2004). Polymorphic 54 microsatellite markers for the gliding marsupials Petaurus australis and Petaurus breviceps. Mol Ecol Notes 4: 55 704-706. 56 57 Faircloth BC (2008) msatcommander: detection of microsatellite 58 repeat arrays and automated, locus-specific primer design. Mol Ecol Resour 8:9294. 59 60
Page 3 of 3
Miller SA, Dykes DB, Polesky HF. (1988) A simple salting out procedure for extracting DNA from human 61 nucleated cells. Nucleic Acids Res 16:12215. 62 63 Millis AL (2000) Isolation and characterization of microsatellite loci in the marsupial gliders, Petaurus 64 norfolcensis, P. breviceps and P. gracilis Mol Ecol 9:16611686. 65 66 van Oosterhout C, Hutchinson WF, Wills DP, Shipley P (2004) Micro-checker: software for identifying and 67 correcting genotyping errors in microsatellite data. Mol Ecol Notes 4:535538 68
Article
Millions of dollars are spent on wildlife crossing structures intended to reduce the barrier effects of roads on wildlife. However, we know little about the degree to which these structures facilitate dispersal and gene flow. Our study incorporates two elements that are rarely used in the evaluation of wildlife crossing structures: an experimental design including a before and after comparison, and the use of genetic techniques to demonstrate effects on gene flow at both population and individual levels. We evaluated the effect of wildlife crossing structures (canopy bridges and glider poles) on a gliding mammal, the squirrel glider (Petaurus norfolcensis). We genotyped 399 individuals at eight microsatellite markers to analyse population structure, first-generation migrants and parentage relationships. We found that the freeway was not a complete genetic barrier, with a strong effect evident at only one site. We hypothesise that the presence of corridors alongside the freeway and throughout the surrounding landscape facilitated circuitous detours for squirrel gliders. Installing a crossing structure at the location with a strong barrier effect restored gene flow within just five years of mitigation. Synthesis and applications. Our study highlights the importance of using genetic techniques not just to evaluate the success of road crossing structures for wildlife, but also to guide their placement within the landscape. Managers wishing to reduce the effects of linear infrastructure on squirrel gliders and other arboreal mammals should aim to preserve and enhance vegetation along roadsides and within centre medians, as well as mitigate large gaps by implementing wildlife crossing structures.
Article
We investigate the contribution of the Iberian bat fauna to the cryptic diversity in Europe using mitochondrial (cytb and ND1) and nuclear (RAG2) DNA sequences. For each of the 28 bat species known for Iberia, samples covering a wide geographic range within Spain were compared to samples from the rest of Europe. In this general screening, almost 20% of the Iberian species showed important mitochondrial discontinuities (K2P distance values > 5%) either within the Iberian or between Iberian and other European samples. Within Eptesicus serotinus and Myotis nattereri, levels of genetic divergence between lineages exceeded 16%, indicating that these taxa represent a complex of several biological species. Other well-differentiated lineages (K2P distances between 5–10%) appeared within Hypsugo savii, Pipistrellus kuhlii and Plecotus auritus, suggesting the existence of further cryptic diversity. Most unsuspected lineages seem restricted to Iberia, although two have crossed the Pyrenees to reach, at leas...
Article
Habitat destruction is causing population decline of many hollow dependent species such as gliding marsupials of the Family Petauridae. Three petaurid species are now listed in some Australian states as either threatened, rare or vulnerable, precipitating a need for information on their basic biology and population structure. We isolated and characterized three polymorphic microsatellite loci from the yellow-bellied glider (Petaurus australis) and six polymorphic microsatellite loci from the sugar glider (P. breviceps). Per-locus heterozygosities range from 42%–92%, and cross-species amplification studies show that between five and seven loci are polymorphic in the two target species as well as a related species P. norfolcensis.
Article
DNA degradation, low DNA concentrations and primer-site mutations may result in the incorrect assignment of microsatellite genotypes, potentially biasing population genetic analyses. MICRO-CHECKER is WINDOWS(R)-based software that tests the genotyping of microsatellites from diploid populations. The program aids identification of genotyping errors due to nonamplified alleles (null alleles), short allele dominance (large allele dropout) and the scoring of stutter peaks, and also detects typographic errors. MICRO-CHECKER estimates the frequency of null alleles and, importantly, can adjust the allele and genotype frequencies of the amplified alleles, permitting their use in further population genetic analysis.
Article
msatcommander is a platform-independent program designed to search for microsatellite arrays, design primers, and tag primers using an automated routine. msatcommander accepts as input DNA sequence data in single-sequence or concatenated, fasta-formatted files. Search data and locus-specific primers are written to comma-separated value files for subsequent use in spreadsheet or database programs. Binary versions of the graphical interface for msatcommander are available for Apple OS X and Windows XP. Users of other operating systems may run the graphical interface version using the available source code, provided their environment supports at least Python 2.4, Biopython 1.43, and wxPython 2.8. msatcommander is available from http://code.google.com/p/msatcommander/.