Article

Exploiting extension bias in polymerase chain reaction to improve primer specificity in ensembles of nearly identical DNA templates

Authors:
To read the full-text of this research, you can request a copy directly from the authors.

Abstract

We describe a semi-empirical framework that combines thermodynamic models of primer hybridization with experimentally determined elongation biases introduced by 3′-end mismatches for improving polymerase chain reaction (PCR)-based sequence discrimination. The framework enables rational and automatic design of primers for optimal targeting of one or more sequences in ensembles of nearly identical DNA templates. In situations where optimal targeting is not feasible, the framework accurately predicts non-target sequences that are difficult to distinguish with PCR alone. Based on the synergistic effects of disparate sources of PCR bias, we used our framework to robustly distinguish between two alleles that differ by a single base pair. To demonstrate the applicability to environmental microbiology, we designed primers specific to all recognized archaeal and bacterial genera in the Ribosomal Database Project, and have made these primers available online. We applied these primers experimentally to obtain genus-specific amplification of 16S rRNA genes representing minor constituents of an environmental DNA sample. Our results demonstrate that inherent PCR biases can be reliably employed in an automatic fashion to maximize sequence discrimination and accurately identify potential cross-amplifications. We have made our framework accessible online as a programme for designing primers targeting one group of sequences in a set with many other sequences (http://DECIPHER.cee.wisc.edu).

No full-text available

Request Full-text Paper PDF

To read the full-text of this research,
you can request a copy directly from the authors.

... Much of its popularity is due to its versatile package system, which allows users to share software that others can use, modify or implement into their data analysis pipelines. Within the comprehensive R archive network (CRAN) or Bioconductor [14,15] (the main package repositories for R), two R packages devoted to oligo design (DECIPHER [16,17] and openPrimeR [18]) are currently available. DECIPHER aims to design primers targeting a specific group of sequences of interest while minimising the potential to cross-react with specified sequences of non-interest, whereas openPrimeR is intended for multiplex primer design. ...
... To identify strengths and weaknesses with rprimer, three other freely available tools (Gemi [10], DECIPHER [16,17], and openPrimeR [18]) were selected for comparison. Gemi was identified from a review of primer design programs published in 2020 [30]. ...
... Many available programs are highly specialised to address specific needs, and there was an inevitable risk of bias when comparing a tool we developed ourselves with tools that we had not used previously. With these limitations in mind, we assessed rprimer together with three other freely available programs: Gemi [10], DECIPHER [16,17], and openPrimeR [18] (the two latter are R Fig. 6 Evaluation of rprimer package performance. The violin plots show the time required to perform each step of the oligo design process in assay A and B, on a generic workplace laptop using a multiple DNA sequence alignment of 128 norovirus GI sequences. ...
Article
Full-text available
Background This paper presents a new R/Bioconductor package, rprimer, for design of degenerate oligos and PCR assays for sequence variable viruses. A multiple DNA sequence alignment is used as input data, while the outputs consist of comprehensive tables (data frames) and dashboard-like plots. The workflow can be run directly from the R console or through a graphical user interface (Shiny application). Here, rprimer is demonstrated and evaluated by using it to design two norovirus genogroup I (GI) assays: one RT-qPCR assay for quantitative detection and one RT‑PCR assay for Sanger sequencing and polymerase-capsid based genotyping. Results The assays generated were evaluated using stool samples testing positive for norovirus GI. The RT-qPCR assay accurately amplified and quantified all samples and showed comparable performance to a widely-used standardised assay, while the RT-PCR assay resulted in successful sequencing and genotyping of all samples. Merits and limitations of the package were identified through comparison with three similar freely available software packages. Several features were comparable across the different tools, but important advantages of rprimer were its speed, flexibility in oligo design and capacity for visualisation. Conclusions An R/Bioconductor package, rprimer, was developed and shown to be successful in designing primers and probes for quantitative detection and genotyping of a sequence-variable virus. The package provides an efficient, flexible and visual approach to degenerate oligo design, and can therefore assist in virus research and method development.
... All amoA and pmoA sequences were aligned using the ' AlignSeqs' command in the DECIPHER "R" package (Wright, 2015(Wright, , 2016. This aligned database was then submitted to DECIPHER's Design Primers web tool (Wright et al., 2014). Sequences corresponding to Ca. N. nitrosa, Ca. ...
... After amplification, an amplicon melting curve was recorded in 0.25 • C steps between 65 and 97 • C. Melting peaks were obtained by plotting the negative first derivative of fluorescence against temperature. Although 30 cycles is typically sufficient for quantification of targets in qPCR, the thermal cycling was extended to evaluate potential nonspecific amplification with the newly designed primers (Wright et al., 2014). Finally, amplification of total 16S rRNA was performed using the 16S rRNA-targeted primer pair 341f/785r according to Thijs et al. (2017) (Table 2). ...
... We limited the database to fulllength amoA and pmoA sequences in order to allow for discovery of primer-binding regions outside of the fragments amplified by conventional amoA primer sets (Rotthauwe et al., 1997;Meinhardt et al., 2015). We used the Design Primers option in DECIPHER (Wright et al., 2014) with each one of the candidate species as the target group and other amoA/pmoA sequences entered as closely related groups that should not be amplified. In addition, for all designs, the annealing temperature and PCR conditions were fixed (see Materials and Methods) so that all three species-level primer sets could be simultaneously used in a single thermocycler run. ...
Article
Full-text available
Published PCR primers targeting the ammonia monooxygenase gene (amoA) were applied to samples from activated sludge systems operated with low dissolved oxygen (DO) to quantify total and clade-level Nitrospira that perform complete ammonium oxidation (comammox); however, we found these existing primers resulted in significant artifact-associated non-target amplification. This not only overestimated comammox amoA copies but also resulted in numerous false positive detections in the environmental samples tested, as confirmed by gel electrophoresis. Therefore, instead of attempting to quantify comammox diversity, we focused on accurately quantifying the candidate comammox species. We designed specific and sensitive primers targeting 3 candidate species: Candidatus (Ca.) Nitrospira nitrosa, Ca. N. inopinata, and Ca. N. nitrificans. The primers were tested with amoA templates of these candidate species and used to quantify comammox at the species level in low DO activated sludge systems. We found that comammox related to Ca. N. nitrosa were present and abundant in the majority of samples from low DO bioreactors and were not detected in samples from a high DO system. In addition, the greatest abundance of Ca. N. nitrosa was found in bioreactors operated with a long solids retention time. Ca. N. inopinata and Ca. N. nitrificans were only detected sporadically in these samples, indicating a minor role of these comammox in nitrification under low DO conditions.
... c. Clustered heatmaps for the Full, 1MM, and Compact primer sets showing primer amplification efficiencies calculated using the R package DECIPHER [38] for each primer across each of the 47 unique 3' 20 nucleotides of the human TCRBV FR3 region. Inosines were considered exact matches for the Compact set. ...
... Primer amplification efficiencies for ISEPPI analysis were calculated for the 47 unique FR3 20-mers for the 1MM and Full primer sets using the R package DECIPHER and its CalculateEfficiencyPCR function [38]. For primer usage vectors, we searched for each relevant read associated with a given CDR3 nucleotide sequence obtained from MiXCR within the FASTQ sequencing file and extracted the first 20 nucleotides from each matching read. ...
... We developed a greedy algorithm to automate the design of three candidate sets of primers, each targeting the 47 distinct TCRB FR3 3 0 20-mers (Fig S1): one primer set lacks any universal bases or mismatches ("Full" set), one primer set lacks universal bases but allows a single mismatch to occur ("1MM" set), and one primer set contains parsimonious incorporation of up to 3 universal (inosine) bases and allows one mismatch ("Compact" set). No mismatches were permitted within the five nucleotides of the 3 0 end of the primers, as a precaution to minimize interference with polymerase extension [38,43,44]. The Full set consists of 47 primers (equal to the number of unique FR3 3' 20-mers), the 1MM set consists of 34 primers, and the Compact set consists of 20 primers (Table S1). ...
Article
Full-text available
Background: Myositis, or idiopathic inflammatory myopathy (IIM), is a group disorders of unknown etiology characterized by the inflammation of skeletal muscle. The role of T cells and their antigenic targets in IIM initiation and progression is poorly understood. T cell receptor (TCR) repertoire sequencing is a powerful approach for characterizing complex T cell responses. However, current TCR sequencing methodologies are complex, expensive, or both, greatly limiting the scale of feasible studies. Methods: Here we present Framework Region 3 AmplifiKation sequencing ("FR3AK-seq"), a simplified multiplex PCR-based approach for the ultra-efficient and quantitative analysis of TCR complementarity determining region 3 (CDR3) repertoires. By using minimal primer sets targeting a conserved region immediately upstream of CDR3, undistorted amplicons are analyzed via short read, single-end sequencing. We also introduce the novel algorithm Inferring Sequences via Efficiency Projection and Primer Incorporation ("ISEPPI") for linking CDR3s to their associated variable genes. Findings: We find that FR3AK-seq is sensitive and quantitative, performing comparably to two different industry standards. FR3AK-seq and ISEPPI were used to efficiently and inexpensively characterize the T cell infiltrates of surgical muscle biopsies obtained from 145 patients with IIM and controls. A cluster of closely related TCRs was identified in samples from patients with sporadic inclusion body myositis (IBM). Interpretation: The ease and minimal cost of FR3AK-seq removes critical barriers to routine, large-scale TCR CDR3 repertoire analyses, thereby democratizing the quantitative assessment of human TCR repertoires in disease-relevant target tissues. Importantly, discovery of closely related TCRs in muscle from patients with IBM provides evidence for a shared antigen-driven T cell response in this disease of unknown pathogenesis. Funding: This work was supported by NIH grant U24AI118633 and a Prostate Cancer Foundation Young Investigator Award.
... In agreement with previous studies (12,14,26 ), extension rates for all mismatch types decreased as the position of the mismatch approached the 3= end of the primer. Mismatches inhibited extension as far as 6 nucle-otides from the 3= end and reduced rates by as much as 2 orders of magnitude when placed 2 nucleotides from the 3= end. ...
... Mismatches inhibited extension as far as 6 nucle-otides from the 3= end and reduced rates by as much as 2 orders of magnitude when placed 2 nucleotides from the 3= end. Some 3=-penultimate mismatches (e.g., G ⅐ A) inhibited extension more than some 3= mismatches (e.g., T ⅐ G, A ⅐ C, and T ⅐ C) (14 ). ...
... Consistent with prior reports using model systems (5-7, 26, 27 ) or PCR observations (9,10,(12)(13)(14), 3= mismatches reduced polymerase nucleotide incorporation rates. The amount of inhibition depended on the type of mismatch. ...
Article
Background: Allele-specific PCR is an important diagnostic tool that identifies single-nucleotide variants by preferential amplification of a particular allele, using primers that are mismatched to all but one allele variant. Methods: We applied a fluorescent stopped-flow polymerase assay to measure extension rates from oligonucleotide hairpins to simulate primer-template pairs. Under PCR-applicable conditions, reaction rates were recorded in nucleotides per second per polymerase (nt/s/poly). The effects of temperature, potassium chloride, mismatch type, and position were studied with primarily a deletion mutant ofThermus aquaticus(Taq) DNA polymerase and 135 oligonucleotide sequences. Results: Rates at 65 °C were between 205 ± 11 and 177 ± 8 nt/s/poly for matched templates and between 4.55 ± 0.21 and .008 ± 0.005 nt/s/poly for 3'-mismatched templates. Although extension rates progressively increased with mismatches further away from the 3' end, rates were still reduced by as much as 84% with a C · C mismatch 6 bases from the 3' end. The optimal extension temperature for matched sequences was 70°C, shifting to 55-60°C for 3' mismatches. KCl inhibited mismatch extension. The Michaelis constant (Km) was increased and the unimolecular rate constant (kcat) decreased for 3' mismatches relative to matched templates. Conclusions: Although primer extension of mismatches depends on mismatch type and position, variation also depends on local sequence, KCl concentration, and the type of polymerase. Introduction of 3' mismatches reduces the optimal temperature for extension, suggesting higher annealing temperatures for better allele discrimination. Quantitative descriptions of expected specificity in allele-specific PCR provide additional design direction and suggest when other methods (e.g., high-resolution melting analysis) may be a better choice.
... No mismatches were permitted within the five nucleotides of the 3' end of the primers, as a precaution to minimize interference with polymerase extension. [27][28][29] The Full set consists of 47 primers (equal to the number of unique FR3 3' 20-mers), the 1MM set consists of 34 primers, and the Compact set consists of 20 primers (Table S1). We calculated the expected efficiency for each primer to amplify each FR3 sequence; these efficiencies are visualized in the form of a clustered heatmap (Fig 1c) and are used later for inference of V-gene utilization. ...
... Primer amplification efficiencies for ISEPPI analysis were calculated for the 47 unique FR3 20mers for both the 1MM and Full primer sets using the R package DECIPHER and its CalculateEfficiencyPCR function. 29 For primer usage vectors, we searched for each relevant CDR3 nucleotide sequence obtained from MiXCR within the FASTQ sequencing file and extracted the first 20 nucleotides from each matching read. These sequences were then compared to the corresponding primer sequences and use of each primer was tabulated to generate a vector of length N, where N equals the number of primers used for amplification. ...
Preprint
Full-text available
Immune receptor repertoire (IRR) sequencing has facilitated the unprecedented analysis of adaptive immune responses. Current methods for quantitative IRR analysis, however, are limited by protocol complexity, cost, or both. Here we present Framework Region 3 AmplifiKation sequencing ("FR3AK-seq"), a multiplex PCR-based methodology for the ultra-efficient analysis of IRRs. We demonstrate that this approach is sensitive and quantitative, and generates results comparable to the current industry standard. In addition, we establish its utility for the streamlined and cost-effective analysis of large sample collections. We anticipate that FR3AK-seq will enable the routine and extensive analysis of IRRs, significantly increasing the frequency, scope, and power of such studies.
... Sequences from all species were aligned using Sequencher software (Gene Codes; Ann Arbor, MI). We used the online tool decephir (Wright et al., 2014) to select primers that perfectly match all target species sequences while minimizing amplification of non-target species. decipher uses an algorithm based on empirical data from Wright et al. (2014) to choose primer pairs from target and non-target sequence data that minimize F I G U R E 1 Example of how cleavable blocked RNase H-dependent PCR (rhPCR) primers in the presence of the enzyme RNase-H2 operate to block amplification of non-target species while allowing amplification of target species. ...
... We used the online tool decephir (Wright et al., 2014) to select primers that perfectly match all target species sequences while minimizing amplification of non-target species. decipher uses an algorithm based on empirical data from Wright et al. (2014) to choose primer pairs from target and non-target sequence data that minimize F I G U R E 1 Example of how cleavable blocked RNase H-dependent PCR (rhPCR) primers in the presence of the enzyme RNase-H2 operate to block amplification of non-target species while allowing amplification of target species. This example shows how the Coregonus sardinella rhPCR primer from this study operates when annealed to a sequence from the non-target species C. pidschian versus a sequence from the target species C. sardinella GAGCATGTCTGCTAC AGGGA-C3 the probability of amplification of non-target taxa while also meeting annealing temperature requirements. ...
Article
Full-text available
1.Species‐specific, probe‐based qPCR assays are now commonly used to detect aquatic species from environmental DNA. However, probe‐based qPCR alone does not always provide the specificity needed to distinguish closely related, congeneric species, which may result in amplification of non‐target DNA, causing false positives from eDNA samples. 2.Here, we developed species‐specific qPCR assays using RNase H‐dependent PCR (rhPCR) for detecting closely related fish species from environmental DNA. 3.We found that rhPCR allowed us to achieve specificity that was not possible with TaqMan® qPCR alone, and we used these assays for species detection from eDNA samples. 4.Use of rhPCR will allow species‐specific detection from environmental DNA for a broad range of species including those that occur in sympatry with other closely related, congeneric species, which has not always been possible with probe‐based qPCR alone. This article is protected by copyright. All rights reserved.
... First, by considering the free energy of annealing and the presence of 3′ mismatches. Second, through the use of the thermodynamic model from DECIPHER (Wright et al., 2014) or a recently developed logistic regression model (Döring et al., 2019). Third, by removing coverage events inducing stop codons or amino acid mutations. ...
... Journal of Immunological Methods xxx (xxxx) xxxx mismatches, introduction of stop codons, amino acid substitutions) can be considered (Fig. 2, Table S1). In addition, it is possible to calculate the template coverage through an exact as well as an approximate string matching (with up to 20 mismatches) by using one out of three different models for the prediction of amplification events (Wright et al., 2014;Döring et al., 2019). As a result, tabular and graphical outputs offer a quick overview on whether the primer set covers the region of interest and the required multiplex properties. ...
Article
Full-text available
To study the diversity of immune receptors and pathogens, multiplex PCR has become a central approach in research and diagnostics. However, insufficient primer design against highly diverse templates often prevents amplification and therefore limits the correct understanding of biological processes. Here, we present openPrimeR, an R-based tool for evaluating and designing multiplex PCR primers. openPrimeR provides a functional and intuitive interface and uses either a greedy algorithm or an integer linear program to compute the minimal set of primers that performs full target coverage. As proof of concept, we used openPrimeR to find optimal primer sets for the amplification of highly mutated immunoglobulins. Comprehensive analyses on specifically generated immunoglobulin variable gene segment libraries resulted in the composition of highly effective primer sets (oPR-IGHV, oPR-IGKV and oPR-IGLV) that demonstrated to be particularly suitable for the isolation of novel human antibodies.
... Unfortunately, there is not much information about the flanking 18S rDNA ( Figure S1) to optimize the specific clitellate primers for amplification of the whole ITS region. Still, however, as noted above, Martinsson and Erséus (2014) For primers, in general, even one or a few mismatches between primer and DNA template may jeopardize amplification (Bellemain et al., 2010;Bru, Martin-Laurent, & Philippot, 2008;Huang, Arnheim, & Goodman, 1992;Ihrmark et al., 2012;Wright et al., 2014;Wu, Hong, & Liu, 2009). In addition, especially for clitellates feeding on plant material and fungi (Bonkowski, Griffiths, & Ritz, 2000;Curry & Schmidt, 2006;Uchida et al., 2004), it could be hypothesized that universal primers may amplify fragments of contaminating plant or fungal sequences instead of sequences of clitellates. ...
Article
Full-text available
Nuclear molecular evidence, for example, the rapidly evolving Internal Transcribed Spacer region (ITS), integrated with maternally inherited (mitochondrial) COI barcodes, has provided new insights into the diversity of clitellate annelids. PCR amplification and sequencing of ITS, however, are often hampered by poor specificity of primers used. Therefore, new clitellate-specific primers for amplifying the whole ITS region (ITS: 29F/1084R) and a part of it (ITS2: 606F/1082R) were developed on the basis of a collection of previously published ITS sequences with flanking rDNA coding regions. The specificity of these and other ITS primers used for clitellates were then tested in silico by evaluating their mismatches with all assembled and annotated sequences (STD, version r127) from EMBL, and the new primers were also tested in vitro for a taxonomically broad sample of clitellate species (71 specimens representing 11 families). The in silico analyses showed that the newly designed primers have a better performance than the universal ones when amplifying clitellate ITS sequences. In vitro PCR and sequencing using the new primers were successful, in particular, for the 606F/1082R pair, which worked well for 65 of the 71 specimens. Thus, using this pair for amplifying the ITS2 will facilitate further molecular systematic investigation of various clitellates. The other pair (29F/1084R), will be a useful complement to existing ITS primers, when amplifying ITS as a whole.
... Sequences from all species were aligned using Sequencher software (Gene Codes, Ann Arbor, MI), and we used the online tool DECEPHIR (Wright et al. 2014) to select species specific-primers. We then used ABI primer express software (Applied Biosystems, Foster City, CA) to design a Taqman® Minor Groove Binding qPCR probes and modify primer length to meat melting temperature requirements for qPCR where necessary. ...
Preprint
Full-text available
We developed species-specific quantitative PCR assays for the detection of two freshwater mussel species native to the western North America, Anodonta nuttalliana and Anodonta oregonensis, from environmental DNA. These species have experienced dramatic declines over the last century, and are currently threatened in many portions of their range. Improved tools for detecting and monitoring these species are needed. Species-specificity and sensitivity of the assays was empirically tested in the lab, and both assays were also validated with field collected eDNA samples. We found that the assays we designed are species-specific, sensitive, and are effective for detecting Anodonta nuttalliana and Anodonta oregonensis from environmental DNA samples collected from streams and rivers. These assays will aid in the detection, monitoring, management, and conservation of these threatened species.
... The smallmouth bass COI sequences (n = 38) were from fish originating in Alabama (n = 1), California (n = 1), Illinois (n = 2), Kentucky (n = 2), New Mexico (n = 2), New York (n = 2), Ohio (n = 1), and Pennsylvania (n = 1) in the United States; in Ontario (n = 10) and Quebec (n = 10) in Canada; in two locations in Japan (n = 2); and four of unknown origin. We screened these sequences in silico using the DECIPHER package (Wright et al. 2014) in R v. 3.0.3 (R Core Team 2013) and obtained candidate primers to amplify smallmouth bass DNA. ...
Article
Full-text available
The smallmouth bass (Micropterus dolomieu) is a cool-water fish species native to central North America. Widespread introductions and secondary spread outside of its historical range have led to new recreational fisheries and associated economic benefits in western United States, but have also resulted in a number of ecological impacts to recipient ecosystems, including threats to Pacific salmon. Management of introduced smallmouth bass populations, now and into the future, relies on accurate detection and monitoring of this species. To address this need, we developed an environmental DNA assay that can detect smallmouth bass DNA extracted from filtered water samples in concentrations as low as 2 mtDNA copies per reaction. Field testing demonstrated that eDNA sampling produced results largely consistent with snorkel surveys, a traditional visual assessment, and gained a few additional positive detections. While this assay is robust against non-target detection, including the only other Micropterus in Pacific Northwest streams, largemouth bass (M. salmoides), the high genetic similarity within the sunfish family Centrarchidae made it unable to distinguish smallmouth bass from spotted bass (M. punctulatus) and some Guadalupe bass (M. treculii). The high sensitivity of this method and assay will be particularly useful for identifying the location of non-native smallmouth bass in the Pacific Northwest, quantifying its rate of spread, and aiding management actions.
... The total volume of qPCR reaction was 25 μL (2 μL of extracted DNA, 12.5 μL of Brilliant II SYBR Green qPCR mastermix, 0.15 μL of forward primer (100 μM), 0.15 μL of reverse primer (100 μM) and 10.2 μL of water). The primers used for quantifying the A. aminovorans 16S rRNA gene were: Forward primer (5′-3′) GGCAATCTCGAGTCCGAGAGAG; Reverse primer (5′-3′) CTTCCTCGCGGCTTATCACC [20]. The primers used for quantifying the total bacteria 16S rRNA gene were: forward primer (5′-3′) ACTCCTACGGGAGGCAG, reverse primer (5′-3′) GACTAC CAGGGTATCTAATCC [21]. ...
Article
Full-text available
Background Trimethylamine (TMA) is the main responsible for the odor associated with rotting fish and other annoying odors generated in many industrial activities. Biofiltration has proved to be efficient for treating odorous gaseous emissions. The main objective of this work was to determine the removal capacity of TMA of a biotrickling filter inoculated with Aminobacter aminovorans and to evaluate the effect of H2S on its performance. Results The maximum specific growth rate of A. aminovorans in a liquid culture was 0.15 h⁻¹, with a TMA to biomass yield of 0.10 (g g⁻¹) and a specific consumption rate of 0.062 g·g⁻¹·h⁻¹. The initial specific consumption rate of TMA was highly influenced by the presence of H2S in liquid culture at concentrations of 20 and 69 ppm in heading space of the flasks. A BTF inoculated with A. aminovorans showed removal efficiencies higher than 98% in a range of loading rate of 0.2 to 8 g·m⁻³·h⁻¹ at empty bed residence time (EBRT) of 85 and 180 s. No effect on the elimination capacity and efficiency was detected when H2S was added at 20 and 50 ppm to the inlet gaseous emission, though the fraction of A. aminovorans measured by qPCR in the biofilm decreased. Conclusions A biotrickling filter inoculated with A. aminovorans can remove efficiently the TMA in a gaseous stream. The elimination capacity of TMA can be negatively affected by H2S, but its effect is not notorious when it is forming part of a biofilm, due to its high specific consumption rate of TMA.
... First, we compiled sequences of the cytochrome oxidase subunit I (COI) mitochondrial gene of this species (Mock, Brim Box, Chong, Furnish, & Howard, 2013; Table 1) and 10 other mollusk species (Table 1). We screened the sequences in silico using the DECIPHER package (Wright et al., 2014) in R v. 3.2.3 (R Core Development Team (2015)) and obtained candidate primers unique to western pearlshell. ...
Article
Full-text available
Information on the distribution of multiple species in a common landscape is fundamental to effective conservation and management. However, distribution data are expensive to obtain and often limited to high-profile species in a system. A recently developed technique, environmental DNA (eDNA) sampling, has been shown to be more sensitive than traditional detection methods for many aquatic species. A second and perhaps underappreciated benefit of eDNA sampling is that a sample originally collected to determine the presence of one species can be re-analyzed to detect additional taxa without additional field effort. We developed an eDNA assay for the western pearlshell mussel (Margaritifera falcata) and evaluated its effectiveness by analyzing previously collected eDNA samples that were annotated with information including sample location and deposited in a central repository. The eDNA samples were initially collected to determine habitat occupancy by nonbenthic fish species at sites that were in the vicinity of locations recently occupied by western pearlshell. These repurposed eDNA samples produced results congruent with historical western pearlshell surveys and permitted a more precise delineation of the extent of local populations. That a sampling protocol designed to detect fish was also successful for detecting a freshwater mussel suggests that rapidly accumulating collections of eDNA samples can be repurposed to enhance the efficiency and cost-effectiveness of aquatic biodiversity monitoring.
... Then, multiple A. fischeri DNA extracts were combined and the concentration determined using a Qubit 3.0 (Thermo Fisher Scientific, Waltham, MA, USA). Specific primers for A. fischeri targeting the 16S rRNA gene were designed using DECIPER (Wright et al., 2014) and their predicted target confirmed using Primer3 (Untergasser et al., 2012) and NCBI BLAST (Camacho et al., 2009). The forward and reverse primers selected were: Af-F: 5 0 -GCGGAAACGACTTAACTGAACC-3 0 and Af-R: 5 0 -GAAGGTCCCCCTCTTTGGTC-3 0 , respectively. ...
Article
Biochar additions to soil have, in some cases, been shown to reduce the DNA extraction efficiency, but the mechanisms remain unclear and commonly used high-ash biochars have not been investigated. We studied the effects of pyrolysis temperatures (300 or 700 °C), post-pyrolysis extractable organic carbon (separating acetone extractable C, AeC), and soil incubation on DNA extraction efficiency using high-ash swine manure biochar. We used quantitative PCR to measure the extraction efficiency of an internal DNA standard (Aliivibrio fischeri) added to samples before extraction. DNA extraction efficiency from biochars decreased by 39% as pyrolysis temperature increased from 300 to 700 °C (p < 0.05). AeC from biochar 300 °C increased DNA extraction efficiency for biochars made at both pyrolysis temperatures and when added to biochar 700 °C, the extraction efficiency increased by 52% (p < 0.05). Incubation in soil increased DNA extraction efficiency from isolated biochar particles by up to 28% (main effect p < 0.05). However, biochar-soil mixtures had up to 24% lower DNA extraction efficiency compared to what would be predicted based on a simple mixing model of incubated soil and separated biochars. Biochar pyrolysis temperature, extractable C, and incubation with soil were all associated with changes in DNA extraction efficiency. The differences in DNA extraction efficiency indicated that caution must be exercised when comparing microbial abundance and diversity with different biochar additions, even for high-ash biochars.
... Sequences from all species were aligned using Sequencher software (Gene Codes; Ann Arbor, MI). We used the online tool DECEPHIR (Wright et al. 2014) to select species specific primers that would amplify target species while excluding all sympatric non-target species. For S. alpinus, and S. malma, no primer sites could be identified with enough polymorphism for species specificity due to the fact that these two species have extremely little mitochondrial variation (justification for species delineation is based on morphology, ecology, and nuclear DNA (Taylor et al. 2008)). ...
Article
Full-text available
The North Slope of Alaska contains arctic fish populations that are important for subsistence of local human populations, and are under threat from natural resource extraction and climate change. We designed and evaluated four quantitative PCR assays for the detection of environmental DNA from five Alaskan fish species present on the North Slope of Alaska: burbot (Lota lota), arctic char (Salvelinus alpinus), Dolly Varden (Salvelinus malma), arctic grayling (Thymallus arcticus), and slimy sculpin (Cottus cognatus). All assays were designed and tested for species specificity and sensitivity, and all assays detected target species from filtered water samples collected from the field. These assays will enable efficient and economical detection and monitoring of these species in lakes and rivers. This in turn will provide managers with improved knowledge of current distributions and future range shifts associated with climate and development threats, enabling more timely management.
... PCR amplification is a well-known bias in the molecular biology part of the measurement process. Mismatches in the primer binding regions impact PCR efficiency and are a potential cause for poor feature-specific performance [26]. Additional research is needed before outlier features are attributed to mismatches in the primer binding regions. ...
Preprint
Full-text available
Background Analysis of 16S rRNA marker-gene surveys, used to characterize prokaryotic microbial communities, may be performed by numerous bioinformatic pipelines and downstream analysis methods. However, there is limited guidance on how to decide between methods, appropriate data sets and statistics for assessing these methods are needed. We developed a mixture dataset with real data complexity and an expected value for assessing 16S rRNA bioinformatic pipelines and downstream analysis methods. We generate an assessment dataset using a two-sample titration mixture design. The sequencing data were processed using multiple bioinformatic pipelines, i) DADA2 a sequence inference method, ii) Mothur a de novo clustering method, and iii) QIIME with open-reference clustering. The mixture dataset was used to qualitatively and quantitatively assess count tables generated using the pipelines. Results The qualitative assessment was used to evalute features only present in unmixed samples and titrations. The abundance of Mothur and QIIME features specific to unmixed samples and titrations were explained by sampling alone. However, for DADA2 over a third of the unmixed sample and titration specific feature abundance could not be explained by sampling alone. The quantitative assessment evaluated pipeline performance by comparing observed to expected relative and differential abundance values. Overall the observed relative abundance and differential abundance values were consistent with the expected values. Though outlier features were observed across all pipelines. Conclusions Using a novel mixture dataset and assessment methods we quantitatively and qualitatively evaluated count tables generated using three bioinformatic pipelines. The dataset and methods developed for this study will serve as a valuable community resource for assessing 16S rRNA marker-gene survey bioinformatic methods.
... Location information was not available for walleye sequences. Using the DECIPHER package [22] in R v. 3.0.3 [23], we screened the sequences in silico and obtained candidate primers unique to each target species. ...
Article
Full-text available
Sauger (Sander canadensis) and walleye (S. vitreus) are percid fishes that naturally co-occur throughout much of the eastern United States. The native range of sauger extends into the upper Missouri River drainage where walleye did not historically occur, but have been stocked as a sport fish. Sauger populations have been declining due to habitat loss, fragmentation, and competition with non-native species, such as walleye. To effectively manage sauger populations, it is necessary to identify areas where sauger occur, and particularly where they co-occur with walleye. We developed quantitative PCR assays that can detect sauger and walleye DNA in filtered water samples. Each assay efficiently detected low quantities of target DNA and failed to detect DNA of non-target species with which they commonly co-occur.
... We used the online tool DECEPHIR (Wright et al. 2014) to select species specific primers that would amplify target species while excluding all sympatric non-target species. For S. alpinus, and S. malma, no primer sites could be identified with enough polymorphism for species specificity due to the fact that these two species have extremely little mitochondrial variation (justification for species delineation is based on morphology, ecology, and nuclear DNA (Taylor et al. 2008)). ...
Article
Full-text available
The North Slope of Alaska contains arctic fish populations that are important for subsistence of local human populations, and under threat from natural resource extraction and climate change. We designed and evaluated four quantitative PCR assays for detection of environmental DNA from five Alaskan fish species present on the North Slope of Alaska: burbot (Lota lota), arctic char (Salvelinus alpinus), Dolly Varden (Salvelinus malma), arctic grayling (Thymallus arcticus), and slimy sculpin (Cottus cognatus). All assays were designed and tested for species specificity and sensitivity, and all assays detected target species from filtered water samples collected from the field. These assays will enable efficient and economical detection of the above species from lakes and rivers. This in turn will provide managers with improved knowledge of current distributions and future range shifts associated with climate and development threats, enabling more timely management.
... Ye et al. 2012). For in silico validation, multiple unique bases on each primer and probe are required to prevent cross-amplification when target species are rare or absent (Wilcox et al. 2013), including ≥1 near the 3 0 end for primers (Stadhouders et al. 2010, Wright et al. 2014. In vitro testing involves applying the assay to tissue-derived DNA from target and non-target species, to empirically demonstrate specificity. ...
... Ye et al. 2012). For in silico validation, multiple unique bases on each primer and probe are required to prevent cross-amplification when target species are rare or absent (Wilcox et al. 2013), including ≥1 near the 3 0 end for primers (Stadhouders et al. 2010, Wright et al. 2014. In vitro testing involves applying the assay to tissue-derived DNA from target and non-target species, to empirically demonstrate specificity. ...
... To develop qPCR assays specific to loach minnow and spikedace, we compiled GenBank DNA sequences of the cytochrome b (cytb) mitochondrial gene for both species as well as eleven non-target fish species commonly found in the same region (Table 1). We used the DECIPHER package [15] in R v. 3.0.1 [16] to screen sequences in silico and obtain primers unique to each target species (Table 2). We aligned and visually compared the primers with sequences of each target and non-target species in MEGA 6.0 [17] and optimized annealing temperatures (Tm) by adjusting primer lengths in Primer Express 3.0.1 (Life Technologies; Table 2). ...
Article
Full-text available
Loach minnow (Rhinichthys cobitis) and spikedace (Meda fulgida) are legally protected with the status of Endangered under the U.S. Endangered Species Act and are endemic to the Gila River basin of Arizona and New Mexico. Efficient and sensitive methods for monitoring these species' distributions are critical for prioritizing conservation efforts. We developed quantitative PCR assays for detecting loach minnow and spikedace DNA in environmental samples. Each assay reliably detected low concentrations of target DNA without detection of non-target species, including other cyprinid fishes with which they co-occur.
... For a more specific bacterial identification, we used the sequences obtained from the 454 sequencing to design primers unique to some OTUs to get the full bacterial 16S sequence (Webster et al. 2010). Primers specific to the top three OTUs were designed using the program DECIPHER (Wright et al. 2014) (Table 1). PCRs were performed on larval DNA extractions with the OTU-specific primer and the universal primer R1492 using PuReTaq Ready-To-Go PCR beads (GE Healthcare Life Sciences). ...
Article
Full-text available
Planktotrophic sea star larvae of several species are abundant in oligotrophic waters of the Gulf Stream, western Sargasso Sea, and Caribbean Sea. One abundant larval morphotype at the bipinnaria stage of development is unusual in its ability to constitutively produce clones and in harboring a community of auto-fluorescent bacteria. We hypothesized that the bacterial community would be distinct in these larvae compared to those that do not consistently reproduce clonally. Three sea star larval morphotypes were collected in the Gulf Stream off the coast of Florida. We used DNA-based maximum likelihood phylogenetic analyses to taxonomically classify the larvae and 16S rDNA profiling by deep sequencing to characterize the bacterial communities harbored within. The cloning bipinnaria and non-cloning brachiolaria morphotypes were determined to be a single species of Asteroidea in the family Oreasteridae. The third morphotype, a non-cloning bipinnaria, was identified as Mithrodia clavigera. With bacterial 16S rDNA profiling, we found that the two species of larvae harbor bacterial communities distinct from each other. The Oreasteridae bacterial community at both developmental stages has a photosynthetic Cyanobacteria Synechococcus sp. as the most abundant bacteria. The M. clavigera larvae host a flora consisting primarily of Gammaproteobacteria. The identification of the larval microbiomes is a step toward understanding their host–microbe interactions. Specifically, the association of photosynthetic bacteria with cloning larvae allows for future assessments of whether the bacteria supplement the nutrition of the larvae during extended periods of development and clonal reproduction in open ocean regions where phytoplankton food for the larvae may be in limited supply.
... For the design of new primers, a list of aligned ppk1 sequences retrieved from the clone library and literature was submitted to the DECIPHER's Design Primers web tool (Wright et al., 2014) and using the following parameters: primers length ranging from 17 to 26 nucleotides with up to 2 permutations, PCR product amplicon length between 75 and 400 bp and at least 90% of sequence coverage. All primers were designed to function at the same annealing temperature (64 °C) in the PCR reaction. ...
Article
Lab- and pilot-scale simultaneous nitrification, denitrification and phosphorus removal-sequencing batch reactors were operated under cyclic anaerobic and micro-aerobic conditions. The use of oxygen, nitrite, and nitrate as electron acceptors by Candidatus Accumulibacter phosphatis during the micro-aerobic stage was investigated. A complete clade-level characterization of Accumulibacter in both reactors was performed using newly designed qPCR primers targeting the polyphosphate kinase gene (ppk1). In the lab-scale reactor, limited-oxygen conditions led to an alternated dominance of Clade IID and IC over the other clades. Results from batch tests when Clade IC was dominant (i.e., >92% of Accumulibacter) showed that this clade was capable of using oxygen, nitrite and nitrate as electron acceptors for P uptake. A more heterogeneous distribution of clades was found in the pilot-scale system (Clades IIA, IIB, IIC, IID, IA, and IC), and in this reactor, oxygen, nitrite and nitrate were also used as electron acceptors coupled to phosphorus uptake. However, nitrite was not an efficient electron acceptor in either reactor, and nitrate allowed only partial P removal. The results from the Clade IC dominated reactor indicated that either organisms in this clade can simultaneously use multiple electron acceptors under micro-aerobic conditions, or that the use of multiple electron acceptors by Clade IC is due to significant microdiversity within the Accumulibacter clades defined using the ppk1 gene.
... Multiple alignments of a target species' DNA sequence with sequences from closely-related, co-occurring non-target species are useful (e.g., Takahara et al. 2012), as are assay design programs (e.g., Ye et al. 2012). For in silico validation, multiple unique bases on each primer and probe are required to prevent cross-amplification when target species are rare or absent (Wilcox et al. 2013), including ≥1 near the 3' end for primers (Stadhouders et al. 2010, Wright et al. 2014). In vitro testing involves applying the assay to tissue-derived DNA from target and non-target species, to empirically demonstrate specificity. ...
Article
Full-text available
Species detection using environmental DNA (eDNA) has tremendous potential for contributing to the understanding of the ecology and conservation of aquatic species. Detecting species using eDNA methods, rather than directly sampling the organisms, can reduce impacts on sensitive species and increase the power of field surveys for rare and elusive species. The sensitivity of eDNA methods, however, requires a heightened awareness and attention to quality assurance and quality control protocols. Additionally, the interpretation of eDNA data demands careful consideration of multiple factors. As eDNA methods have grown in application, diverse approaches have been implemented to address these issues. With interest in eDNA continuing to expand, supportive guidelines for undertaking eDNA studies are greatly needed. Environmental DNA researchers from around the world have collaborated to produce this set of guidelines and considerations for implementing eDNA methods to detect aquatic macroorganisms. Critical considerations for study design include preventing contamination in the field and the laboratory, choosing appropriate sample analysis methods, validating assays, testing for sample inhibition and following minimum reporting guidelines. Critical considerations for inference include temporal and spatial processes, limits of correlation of eDNA with abundance, uncertainty of positive and negative results, and potential sources of allochthonous DNA. We present a synthesis of knowledge at this stage for application of this new and powerful detection method. © 2016 The Authors. Methods in Ecology and Evolution published by John Wiley & Sons Ltd on behalf of the British Ecological Society
... First, we compiled DNA sequences published on Gen-Bank of the cytochrome b (cytb) region of the mitochondrial genome for brown trout and 13 other salmonids commonly found in the western U.S. (Table S1). We used these sequences and the DECIPHER package (Wright et al. 2013) in R v. 3.0.1 (R Core Team 2014) to develop a forward and reverse primer set specific to brown trout: forward primer 5 0 -CGCCCGAGGACTCTACTATGGT-3 0 ; reverse primer 5 0 -GGAAGAACGTAGCCCACGAA-3 0 . ...
Article
Brown trout (Salmo trutta) are widely introduced in western North America where their presence has led to declines of several native species. To assist conservation efforts aimed at early detection and eradication of this species, we developed a quantitative PCR marker to detect the presence of brown trout DNA in environmental samples. The marker strongly amplified brown trout eDNA, and produced no amplification of eDNA from 17 other species commonly found in western North America. We field tested this marker and demonstrated positive detections in field samples where brown trout presence was known.
... The quantification assay was conducted in an AriaMX real-time PCR cycler (Agilent) using the following primer sets: Bam-sp9/Bam-asp1 for bamA gene [11] and primers 5′-GAAAGCCTGACCCAGCG-3′ (forward) and 5′-CCCACCTTCCTCCGCATTAA-3′ (reverse) for Syntrophorhabdus genus quantification [20]. Each 20 μl PCR reaction contained 10 μl of Takyon Rox SYBR MasterMix dTTP Blue (Eurogentec), 0.9 μM of each primer and 2 μl of DNA template. ...
Article
Full-text available
Background: Anaerobic digestion is an alternative bioprocess used to treat effluents containing toxic compounds such as phenol and p-cresol. Selection of an adequate sludge as inoculum containing an adapted microbial consortium is a relevant factor to improve the removal of these pollutants. The objective of this study is to identify the key microorganisms involved in the anaerobic digestion of phenol and p-cresol and elucidate the relevance of the bamA gene abundance (a marker gene for aromatic degraders) in the process, in order to establish new strategies for inocula selection and improve the system's performance. Results: Successive batch anaerobic digestion of phenol and p-cresol was performed using granular or suspended sludge. Granular sludge in comparison to suspended sludge showed higher degradation rates both for phenol (11.3 ± 0.7 vs 8.1 ± 1.1 mg l⁻¹ d⁻¹) and p-cresol (7.8 ± 0.4 vs 3.7 ± 1.0 mg l⁻¹ d⁻¹). After three and four re-feedings of phenol and p-cresol, respectively, the microbial structure from both sludges was clearly different from the original sludges. Anaerobic digestion of phenol and p-cresol generated an abundance increase in Syntrophorhabdus genus and bamA gene, together with hydrogenotrophic and aceticlastic archaea. Analysis of results indicates that differences in methanogenic pathways and levels of Syntrophorhabdus and bamA gene in the inocula, could be the causes of dissimilar degradation rates between each sludge. Conclusions: Syntrophorhabdus and bamA gene play relevant roles in anaerobic degradation of phenolics. Estimation of these components could serve as a fast screening tool to find the most acclimatized sludge to efficiently degrade mono-aromatic compounds. How to cite: Franchi O, Rosenkranz F, Chamy R. Key microbial populations involved in anaerobic degradation of phenol and p-cresol using different inocula. Electron J Biotechnol 2018;35. https://doi.org/10.1016/j.ejbt.2018.08.002.
... After initially screening all publically available sequences for western toads and other closely related and sympatric toads, we found that sequences for all species within the western toad species complex were identical or nearly identical in these regions (Table A.1). Consequently, we pursued eDNA markers that would detect all species within the western toad species complex. We obtained candidate primers in silico using the DECIPHER package (Wright et al., 2014) in R v. 3.2.3 (R Core Development Team 2015, and aligned them with the genetic sequence data using MEGA 7.0 (Kumar et al., 2016). ...
Article
Full-text available
Western toads (species complex comprised of Anaxyrus boreas, A. canorus, A. exsul, and A. nelsoni) are widely distributed in the western United States but are declining, particularly in the southeastern extent of their range. The subspecies A. b. boreas is listed as a Species of Greatest Conservation Need in New Mexico, Colorado, Utah, and Wyoming. Reliable and sensitive methods for delineating distributions of western toads are critical for monitoring the status of the species and prioritizing conservation efforts. We developed two qPCR assays for detecting western toad DNA in environmental DNA samples. Both markers efficiently and reliably detect low concentrations of western toad DNA across their range in the conterminous U. S. without detecting non-target, sympatric species. To determine the optimal annual sampling period, we then tested these markers using repeated sampling in ponds where western toads were known to be present. Quantities of collected eDNA varied widely across samples, but sample-level detections across sites exceeded 80% for June sampling. In the later summer, detection dropped off sharply with only a single detection in the ten samples collected throughout August.
... Designing primers or probes for optimal detection of multiple targets in complex and large sets of DNA sequences is a set coverage problem which aims to find a minimal set of primer sequences that cover the input DNA sequences [8]. Various tools have been created for multiplex primer and probe designing, such as the command line based PriMux [9], the web-application PrimerDesign [10], the R package DECIPHER's DesignPrimers and DesignProbes [11], the GUI PrimerMapper [12] and the R package openPrimeR [13]. However, most of these tools no longer appear to be available or functional and/or require significant user intervention via requiring an external options file for the parameters or a file conversion from a FASTA file and/or scale poorly to large input data. ...
Article
Full-text available
Background Designing oligonucleotide primers and probes is one of the key steps of various laboratory experiments such as multiplexed PCR or digital multiplexed ligation assays. When designing multiplexed primers and probes to complex, heterogeneous DNA data sets, an optimization problem can arise where the smallest number of oligonucleotides covering the largest diversity of the input dataset needs to be identified. Tools that provide this optimization in an efficient manner for large input data are currently lacking. Results Here we present Prider, an R package for designing primers and probes with a nearly optimal coverage for complex and large sequence sets. Prider initially prepares a full primer coverage of the input sequences, the complexity of which is subsequently reduced by removing components of high redundancy or narrow coverage. The primers from the resulting near-optimal coverage are easily accessible as data frames and their coverage across the input sequences can be visualised as heatmaps using Prider’s plotting function. Prider permits efficient design of primers to large DNA datasets by scaling linearly to increasing sequence data, regardless of the diversity of the dataset. Conclusions Prider solves a recalcitrant problem in molecular diagnostics: how to cover a maximal sequence diversity with a minimal number of oligonucleotide primers or probes. The combination of Prider with highly scalable molecular quantification techniques will permit an unprecedented molecular screening capability with immediate applicability in fields such as clinical microbiology, epidemic virus surveillance or antimicrobial resistance surveillance.
... https://doi.org/10. 1101/2020 Sequence data from all species were aligned using Sequencher software v5.2 (Gene Codes, Ann Arbor, MI), and species-specific primers were generated with the online tool DECEPHER (Wright et al. 2014). We then used ABI primer express software v3.0.1 (Applied Biosystems, Foster City, CA) to design TaqMan TM Minor-Groove-Binding (MGB) qPCR probes. ...
Preprint
Full-text available
We developed multiplexed, species-specific, quantitative PCR assays for the detection of four freshwater mussel species native to western North America, Gonidea angulata, Margaritifera falcata, Anodonta nuttalliana and Anodonta oregonensis, from environmental DNA (eDNA). These species have experienced dramatic declines over the last century and are currently threatened in many portions of their ranges. Therefore, improved tools for detecting and monitoring these species are needed. Species-specificity and sensitivity of assays were empirically tested in the lab, and multiplex assays were also validated with field collected eDNA samples. All assays were species-specific, sensitive, and effective for detection from eDNA samples collected from streams and rivers. These assays will aid in the detection, monitoring, management, and conservation of these vulnerable species.
... In general, PSQ is highly suitable for genotyping individual SNPs and even SNP combinations. However, PSQ doesn't allow genotyping SNPs in homopolymeric stretches [24]. In addition, it does not provide allele specific information. ...
Article
Full-text available
Due to its cost-efficiency, high resolution melting (HRM) analysis plays an important role in genotyping of candidate single nucleotide polymorphisms (SNPs). Studies indicate that HRM analysis is not only suitable for genotyping individual SNPs, but also allows genotyping of multiple SNPs in one and the same amplicon, although with limited discrimination power. By targeting the three C>T SNPs rs527559815, rs547832288, and rs16906252, located in the promoter of the O6-methylguanine-DNA methyltransferase (MGMT) gene within a distance of 45 bp, we investigated whether the discrimination power can be increased by coupling HRM analysis with pyrosequencing (PSQ). After optimizing polymerase chain reaction (PCR) conditions, PCR products subjected to HRM analysis could directly be used for PSQ. By analyzing oligodeoxynucleotide controls, representing the 36 theoretically possible variant combinations for diploid human cells (8 triple-homozygous, 12 double-homozygous, 12 double-heterozygous and 4 triple-heterozygous combinations), 34 out of the 36 variant combinations could be genotyped unambiguously by combined analysis of HRM and PSQ data, compared to 22 variant combinations by HRM analysis and 16 variant combinations by PSQ. Our approach was successfully applied to genotype stable cell lines of different origin, primary human tumor cell lines from glioma patients, and breast tissue samples.
... The programmability of molecular approaches 18,22 offers a chance to proactively design diagnostic assays, produce optimal assays for new viruses, multiplex across many taxa, and update assays to reflect evolution. While there is a rich history of methods for designing PCR-based diagnostics [23][24][25][26][27][28][29][30][31][32][33] , several shortcomings limit their general use. Many do not account for sequence variation or, if they do, extract long, highly conserved regions to mine that must be identical across all genomes in a species and not match other species; in general, this does not suffice for viruses. ...
Preprint
Full-text available
Harnessing genomic data and predictive models will provide activity-informed diagnostic assays for thousands of viruses and offer rapid design for novel ones. Here we develop and extensively validate new algorithms that design nucleic acid assays having maximal predicted detection activity over a virus’s full genomic diversity with stringent specificity. Focusing on CRISPR-Cas13a detection, we test a library of ~ 19,000 guide-target pairs and construct a convolutional neural network that predicts Cas13a detection activity better than other techniques. We link our methods by building ADAPT, an end-to-end system that automatically leverages the latest viral genome data. We designed optimal species-specific assays for the 1,933 vertebrate-infecting viral species within 2 hours for most species and 24 hours for all but 3. ADAPT’s designs are sensitive and specific down to the lineage-level for the range of taxa we tested, including ones that pose challenges involving genomic diversity and specificity. They also exhibit significantly higher fluorescence and lower limits of detection, across a virus’s full spectrum of genomic diversity, than designs from standard techniques. ADAPT is available in an accessible software package and can be applied to other detection technologies to enhance critically-needed viral diagnostic and surveillance efforts.
... We used Sequencher ® software (version 5.2; Gene Codes, Ann Arbor, Michigan) to align sequence data from all species, and we used the online tool DECIPHER (Wright et al. 2014) to generate species-specific primers. We then used ABI Primer Express ™ software (version 3.0.1; ...
Article
Full-text available
Four freshwater mussel species native to western North America, Gonidea angulata, Margaritifera falcata, Anodonta nuttalliana, and Anodonta oregonensis, have experienced dramatic declines over the last century and are currently threatened in many portions of their ranges. Therefore, improved tools for detecting and monitoring these species are needed. We developed multiplexed, species-specific, quantitative PCR assays for the detection of these species from environmental DNA (eDNA). We empirically tested species specificity and sensitivity of assays in the lab, and we also validated multiplex assays with field-collected eDNA samples. All assays were species specific, sensitive, and effective for detection from eDNA samples collected from streams and rivers. These assays will aid in the detection, monitoring, management, and conservation of these vulnerable mussel species.
... In general, the greater the number of mismatches between primer and nontarget templates, the more specific the primer is, and the importance of maximizing the number of mismatches has been widely recognized (Wilcox et al. 2013, Rees et al. 2014, Fukumoto et al. 2015. Nonetheless, most of the previous studies that have investigated mismatch effects were based on either single or double mismatches (Kwok et al. 1990, Simsek and Adnan 2000, Wu et al. 2009, Wright et al. 2014). It has been well documented that both the type and position of mismatches have differential effects on primer specificity. ...
Article
Full-text available
While high efficiency and cost‐effectiveness are two merits of environmental DNA (eDNA) techniques for detecting aquatic organisms, the difficulty of designing species‐specific primers can result in significant expenditure of time and money. During the in silico stage of primer development, primer specificity is predicted with alignment techniques such as BLAST that is based on the number and position of the primer/nontarget template mismatches. However, we speculate that nonspecific amplification is influenced by additional parameters, which lead to inaccuracies of in silico prediction. We performed in vitro specificity tests for 38 species‐specific primers selected for seven fishes and six turtles, using single‐plex conventional PCR (cPCR). A subset of 12 primer pairs were further tested with SYBR Green‐based or TaqMan‐based single‐plex quantitative PCR (qPCR). We disentangle the relative importance of mismatch properties (types and positions), primer properties (length, GC content, and 3′ end stability), PCR conditions (template concentrations and annealing temperatures), and PCR technique (cPCR, TaqMan‐based, or SYBR Green‐based qPCR) in determining the occurrence of amplifications. We then compared the PCR outcomes with the specificity check under two stringency scenarios based on alignment (i.e., BLAST search). We conducted a total of 679 cPCR and 226 qPCR analyses, with 90% of the reactions tested with nontarget templates. Primer pairs predicted by Primer‐BLAST to be specific rarely showed such specificity during the in vitro testing. BLAST searches correctly predicted the outcomes of around 67% of cPCR and qPCR, but had low sensitivity in detection of nontarget amplification (29–57%). Primer specificity increased significantly with total number of mismatches and annealing temperature, but decreased with higher GC content in the primer sequence. Mismatches that consisted of A‐A, G‐A, and C‐C pairings exerted 56% stronger reduction in nonspecific amplification effects than other mismatches. To conclude, we show that the prediction of primer specificity based only on the number and position of mismatches can be misleading. Our findings can be applied to increase the efficiency of the in silico primer selection process to maintain the relatively high efficiency and cost‐effectiveness of eDNA techniques.
... When searching against all human mtDNA sequences downloaded from NCBI at the 127 time (March 2018), we looked for oligonucleotide sequences that had the most returns with 128 100% identity and full coverage across the oligonucleotide sequence. When searching against 129 downloaded non-human mtDNA sequences, we looked for primer sequences that had the fewest 130 returns with the lowest percent identity and emphasized a lack of identity at the 3' end of the 131 primers to maximize specificity to humans (Wright et al., 2014). Because mismatches between 132 template and oligonucleotides can result in inefficiencies in PCR (Letowski et al., 2004; 133 Stadhouders et al., 2010), we identified two frequently described polymorphisms within the 134 region we were designing in: the 15301 and 15326 positions (Ablimit et al., 2013;Hwa et al., 135 2010; Lee et al., 2002), relative to the revised Cambridge Reference Sequence, rCRS (Bandelt et 136 al., 2014) and avoided these two polymorphisms during the primer and probe design process. ...
Article
Full-text available
Human mitochondrial DNA provides a promising target for fecal source tracking because it is unique and intrinsic to humans. We developed a TaqMan chemistry assay, hCYTB484, targeting the cytochrome b gene of the human mitochondrial genome on a droplet digital PCR (ddPCR) platform and compared the performance of hCYTB484 with the HF183/BacR287 assay, a widely used assay targeting human-associated Bacteroides. For both assays, we defined the analytical limit of detection and analytical lower limit of quantification using frequency of detection and imprecision goals, respectively. We then established these analytical limits using empirical ddPCR data, presenting a novel approach to determining the analytical lower limit of quantification. We evaluated assay sensitivity using individual human feces from US, Bangladesh, and Mozambique and evaluated assay specificity using cow, pig, chicken, and goat samples collected from the US. To compare assay performance across a range of thresholds, we utilized receiver operating characteristic curves. The hCYTB484 marker was detected and quantifiable in 100% of the human feces from the 3 geographical distant regions whereas the HF183/BacR287 marker was detectable and quantifiable in 51% and 31% (respectively) of human feces samples. The hCYTB484 marker also was more specific (97%), having fewer detections in pig, chicken, and goat samples than the HF183/BacR287 marker (80%). The higher performance of the hCYTB484 marker in individual feces from geographically distant regions is desirable in the detection of fecal pollution from sources to which fewer individuals contribute, such as the non-sewered forms of sanitation (e.g. pit latrines and septic tanks) that serve most of Earth's population and carry the highest risk of exposure to fecal-oral pathogens.
... Valencia, CA, USA) following the manufacturer's protocol. PCR products for sequencing were amplified using the ITSI primers (forward: 5' AAAAAGCTTTTGTACACACCGCCCGTCGC 3'; reverse: 5' AGCTTGCTGCGTTTCTTCATCGA 3') and cycling conditions (30 cycles of [94˚C for 1.5 min, 55˚C for 2 min, and 72˚C for 3 min] followed by a final extension at 72˚C for 7 min) described in Pleyte et al. [15], and were cleaned using ExoSAP-IT™ PCR Product Cleanup Reagent (Life Technologies, Grand Island, NY, USA). Sequences were generated on an ABI 3730XL sequencing machine at Eurofins Genomics (Louisville, KY), were processed in Sequencher v 5.4.6 (Gene Codes Corporation, Ann Arbor, MI, USA), and then were trimmed to the approximately 600-nucleotide ITSI region (S1 Table) Candidate primers were obtained in silico by screening the genetic sequence data that we generated (accessions MH341972.1 -MH342001.1; ...
Article
Full-text available
The majority of environmental DNA (eDNA) assays for vertebrate species are based on commonly analyzed regions of the mitochondrial genome. However, the high degree of mitochondrial similarity between two species of charr (Salvelinus spp.), southern Dolly Varden (S. malma lordii) and bull trout (Salvelinus confluentus), precludes the development of a mitochondrial eDNA assay to distinguish them. Presented here is an eDNA assay to detect bull trout based on the first ribosomal internal transcribed spacer (ITSI), a nuclear marker. This assay successfully detects bull trout and avoids detecting Dolly Varden as well as brook trout (S. fontinalis), Arctic char (S. alpinus), and lake trout (S. namaycush). In addition, this assay was compared with an extensively used mitochondrial bull trout assay and it was found that the ITSI-based assay produced higher detectability. Our results suggest this assay should out-perform the published mtDNA assay across the range of bull trout, while the added specificity allows reliable bull trout detection in areas where bull trout co-occur with other charr such as Dolly Varden. While clearly a superior assay in this instance, basing assays on ITSI is not without problems. For vertebrates, there are fewer ITSI sequences available than commonly sequenced regions of the mitochondrial genome. Thus, the initial in silico screening of candidate assays must be preceded by much more extensive sampling and sequencing of sympatric or closely related taxa. Further, all copies of the internal transcribed spacers within an individual may not be identical, which can lead to complications. Lastly, the copy number for ITSI varies widely across taxa; the greater detectability associated with this assay cannot be assumed for other species.
... Received 6 June 2019; Received in revised form 9 February 2020; Accepted 15 April 2020 Horsepox, and Rabbitpox. In order to confirm the absence of CMLV DNA polymerase gene region DNA, individual primer sets specific to the DNA polymerase regions of both CMLV and VACV-MVA were designed using DECIPHER, by inputting the DNA polymerase genes of both species, and keeping the default parameters [9]. The following primer sets were designed for VACV-MVA: VACV DNA POL SP forward-CGG AAAGGATGACGTTGATTTAGCT and VACV DNA POL SP reverse-AAT CAGTCGTTCTAACTCTTTCGC. ...
Article
Full-text available
Camelpox virus is the causative agent of Camelpox, a highly contagious disease of camels. A high passage Camelpox virus strain has previously been reported to contain several genes which more closely resemble Vaccinia, a virus species with no known natural host, encompassing various strains that show high inter-strain genomic variation. In this study, we demonstrate that yet another high passage, live attenuated vaccine, comprising a different strain of Camelpox virus, contains genomic sequences that match a differing strain of Vaccinia virus. These results are discussed in the context of hypotheses put forward to explain the unknown origins of Vaccinia virus, suggesting further studies to elucidate evolutionary trajectories of Orthopoxviruses through passaging.
... Because the HT-qPCR chips used were unable to accommodate mixed bases within primers, a degenerate base within the reverse primer sequence for each assay was converted to a single base (loci indicated in Table 1). These primer modifications could reduce sensitivity of the assays for some haplotypes, but single base mismatches internal to a primer typically have a modest impact on amplification efficiency (Wright et al., 2014). ...
Article
Full-text available
When analyzing environmental samples for DNA from multiple taxa, researchers must usually decide between iterative analyses with single‐taxon assays—which are reliable and sensitive, but also laborious to apply—and approaches such as metabarcoding that can simultaneously target multiple species, but which are less sensitive for detection across taxa. Here, we test an intermediate approach that allows efficient, parallel assessment of taxon‐specific qPCR assays via high‐throughput quantitative PCR (HT‐qPCR). Based on an assessment of over 500 environmental samples, we found that sensitivity and specificity of our HT‐qPCR approach were similar (concordance 0.900–1.000) to values achieved through single‐species qPCR in six out of seven assays tested. Thus, HT‐qPCR may provide analyses of similar quality as single‐species qPCR analyses for environmental DNA, but at a lower cost per taxon. We see this approach as being a valuable addition to the eDNA sampling toolbox, particularly for situations where reliable inferences are needed for a defined suite of rare invasive or imperiled taxa.
... Telomere primers were designed including various mismatches with target sequences (Cawthon, 2002(Cawthon, 2009). Primer mismatches can have a substantial impact on quantification accuracy when target sequences contain nucleotide variations, which is not expected to occur in the highly conserved telomeric sequences (Louis & Vershinin, 2005;Wright et al., 2014). Since the telomere repeats are similar among vertebrates, it is expected that telomere primers will work in most species. ...
Article
Telomere length has been used as a proxy of fitness, aging and lifespan in vertebrates. In the last decade, dozens of articles reporting on telomere dynamics in the fields of ecology and evolution have been published for a wide range of taxa. With this growing interest, it is necessary to ensure the accuracy and reproducibility of telomere length measurement techniques. Real‐time quantitative PCR (qPCR) is routinely applied to measure relative telomere length. However, this technique is highly sensitive to several methodological variables and the optimization of qPCR telomere assays remains highly variable between studies. Therefore, standardized guidelines are required to enable the optimization of robust protocols, and to help in judging the validity of the presented results. This review provides an overview of preanalytical and analytical factors that can lead to qPCR inconsistencies and biases, including (i) sample type, collection and storage; (ii) DNA extraction, storage and quality; (iii) qPCR primers, laboratory reagents, and assay conditions; and (iv) data analysis. We propose a minimum level of information for publication of qPCR telomere assays in evolutionary ecology considering the methodological pitfalls and sources of error. This review highlights the complexity of the optimization and validation of qPCR for telomere measurement per se, demonstrating the importance of transparency and clarity of reporting methodological details required for reliable, reproducible and comparable qPCR telomere assays. We encourage efforts to implement standardized protocols that ensure the rigour and quality of telomere dynamics studies.
... Other sturgeon qPCR protocols (Farrington and Lance 2014;Bergman et al. 2016;Pfleger et al. 2016;Yusishen et al. 2018) focused on North American species and were optimized on the respective local fish community. We designed TaqMan primers (AruF: 5′-TCT ACC GTC ACC CAG GTC AT-3′; AruR: 5′-CGC CTG TTA AGG TTG TGT TCT TTT -3′) and probe (AruPr: 5′-FAM-GAG AGG TAC AGC TCT CTT G-MGB-Q500-3′) in the 16S rRNA gene using the DECIPHER package (Wright et al. 2014;Wright 2015). We utilized the reference database of Lecaudey et al. (2019) containing 150 sequences of 45 native and invasive fishes, covering 19 Palearctic fish families, including sterlet and Russian sturgeon A. gueldenstaedtii (Supplemental 1). ...
Article
Full-text available
A recent eDNA-metabarcoding study assessing fish diversity in the Upper Volga catchment did not detect sterlet at any of the sampled stretches, despite recent sightings that suggest its presence. We designed a TaqMan qPCR protocol to test for sterlet in selected eDNA samples from that study. In-silico and in-vitro tests confirm the protocol’s high sensitivity and specificity to sturgeon taxa and potentially paddlefishes. Using this assay, sterlet were not detected in 26 eDNA samples from the Volga headwaters, agreeing with the metabarcoding results.
... number of mismatches, introduction of stop codons, amino acid substitutions) can be considered ( Figure 2, Table S1). In addition, it is possible to calculate the template coverage through an exact as well as an approximate string matching (with up to 20 mismatches) by using one out of three different models for the prediction of amplification events (Wright et al., 2014;Doring et al., 2019). As a result, tabular and graphical outputs offer a quick overview on whether the primer set covers the region of interest and the required multiplex properties. ...
Preprint
Full-text available
To study the diversity of immune receptors and pathogens, multiplex PCR has become a central approach in research and diagnostics. However, insufficient primer design against highly diverse templates often prevents amplification and therefore limits the correct understanding of biological processes. Here, we present openPrimeR, an R-based tool for evaluating and designing multiplex PCR primers. openPrimeR provides a functional and intuitive interface and uses either a greedy algorithm or an integer linear program to compute the minimal set of primers that performs full target coverage. As proof of concept, we used openPrimeR to find optimal primer sets for the amplification of highly mutated immunoglobulins. Comprehensive analyses on specifically generated immunoglobulin variable gene segment libraries resulted in the composition of highly effective primer sets (oPR-IGHV, oPR-IGKV and oPR-IGLV) that demonstrated to be particularly suitable for the isolation of novel human antibodies.
... FE was selected as baseline model because it relies solely on the free energy of annealing ΔG. The model DE is the thermodynamic model of DECIPHER 8 , which considers the impact of mismatches on the efficiency of polymerase elongation. Since all models provide quantitative outputs, we transformed them to classifiers in the following manner. ...
Article
Full-text available
Successful primer design for polymerase chain reaction (PCR) hinges on the ability to identify primers that efficiently amplify template sequences. Here, we generated a novel Taq PCR data set that reports the amplification status for pairs of primers and templates from a reference set of 47 immunoglobulin heavy chain variable sequences and 20 primers. Using logistic regression, we developed TMM, a model for predicting whether a primer amplifies a template given their nucleotide sequences. The model suggests that the free energy of annealing, ΔG, is the key driver of amplification (p = 7.35e-12) and that 3′ mismatches should be considered in dependence on ΔG and the mismatch closest to the 3′ terminus (p = 1.67e-05). We validated TMM by comparing its estimates with those from the thermodynamic model of DECIPHER (DE) and a model based solely on the free energy of annealing (FE). TMM outperformed the other approaches in terms of the area under the receiver operating characteristic curve (TMM: 0.953, FE: 0.941, DE: 0.896). TMM can improve primer design and is freely available via openPrimeR (http://openPrimeR.mpi-inf.mpg.de).
... An approximate base-pair match between primer and template DNA is required for Taq DNA polymerase to begin an efficient PCR amplification cycle (Watson, 1971;Kwok et al., 1994;Wu et al., 2009;Wright et al., 2014). The taxonomic universality of 18S-CL-F3, the forward primer selected for the single primer pair approach, has been presented previously from taxa in Tylenchida and Dorylaimida (Carta and Li, 2018). ...
Article
Full-text available
Ribosomal DNA has been a reliable source of taxonomic and phylogenetic markers due to its high copy number in the genome and stable variation with few polymorphisms due to the homogenizing effect of concerted evolution. Typically specific regions are amplified through polymerase chain reaction (PCR) with multiple primer pairs that generate often incomplete and overlapping regions between adjacent segments of 18S, ITS1, 5.8S, ITS2, and 28S rDNA nucleotide sequences when combined in tandem. To improve the efficiency of this effort, a strategy for generating all these molecular sequences at once through PCR amplification of a large ribosomal 3.3 to 4.2 kb DNA target was developed using primer 18S-CL-F3 paired with D3B or a new alternative 28S PCR primer (28S-CL-R) and other well-positioned and ribosomal-specific sequencing primers (including novel primers 18S-CL-F7, 18S-CL-R6, 18S-CL-R7, 18S-CL-F8, 5.8S-CL-F1, 5.8S-CL-R1, 28S-CL-F1, 28S-CL-R3, 28S-CL-F3, 28S-CL-R1, and 28S-CL-F2). The D1 region between ITS2 and 28S boundaries and the flanking sequence between 18S and ITS1 boundaries were fully revealed in this large nucleotide segment. To demonstrate the value of this strategy, the long rDNA segment was amplified and directly sequenced in 17 agriculturally important nematodes from the Tylenchida, Aphelenchida, and Dorylaimida. The primers and their positions may be employed with traditional Sanger sequencing and with next-generation sequencing reagents and protocols. Ribosomal DNA has been a reliable source of taxonomic and phylogenetic markers due to its high copy number in the genome and stable variation with few polymorphisms due to the homogenizing effect of concerted evolution. Typically specific regions are amplified through polymerase chain reaction (PCR) with multiple primer pairs that generate often incomplete and overlapping regions between adjacent segments of 18S, ITS1, 5.8S, ITS2, and 28S rDNA nucleotide sequences when combined in tandem. To improve the efficiency of this effort, a strategy for generating all these molecular sequences at once through PCR amplification of a large ribosomal 3.3 to 4.2 kb DNA target was developed using primer 18S-CL-F3 paired with D3B or a new alternative 28S PCR primer (28S-CL-R) and other well-positioned and ribosomal-specific sequencing primers (including novel primers 18S-CL-F7, 18S-CL-R6, 18S-CL-R7, 18S-CL-F8, 5.8S-CL-F1, 5.8S-CL-R1, 28S-CL-F1, 28S-CL-R3, 28S-CL-F3, 28S-CL-R1, and 28S-CL-F2). The D1 region between ITS2 and 28S boundaries and the flanking sequence between 18S and ITS1 boundaries were fully revealed in this large nucleotide segment. To demonstrate the value of this strategy, the long rDNA segment was amplified and directly sequenced in 17 agriculturally important nematodes from the Tylenchida, Aphelenchida, and Dorylaimida. The primers and their positions may be employed with traditional Sanger sequencing and with next-generation sequencing reagents and protocols.
... We further assessed a subset of eight bistable strain pairs using quantitative PCR (Supplementary Table 3), which has a larger dynamic range than highthroughput sequencing. Primers were designed that were specific to each strain using the R 34 package DECIPHER 40 (Supplementary Table 2). The resident and invader were targeted for amplification in two separate PCR reactions for each community, corresponding to 32 different reactions in total. ...
Article
Full-text available
It is largely unknown how the process of microbial community assembly is affected by the order of species arrival, initial species abundances and interactions between species. A minimal way of capturing competitive abilities in a frequency-dependent manner is with an invasibility network specifying whether a species at low abundance can increase in frequency in an environment dominated by another species. Here, using a panel of prolific small-molecule producers and a habitat with feast-and-famine cycles, we show that the most abundant strain can often exclude other strains - resulting in bistability between pairs of strains. Instead of a single winner, the empirically determined invasibility network is ruled by multiple strains that cannot invade each other, and does not contain loops of cyclic dominance. Antibiotic inhibition contributes to bistability by helping producers resist invasions while at high abundance and by reducing producers' ability to invade when at low abundance.
Article
Environmental DNA (eDNA) comprises DNA fragments that have been shed into the environment by organisms, and which can be extracted from environmental samples such as water or soil. Characterization of eDNA can allow researchers to infer the presence or absence of species from a particular site without the need to locate and identify individuals, and therefore may provide an extremely valuable tool for quantifying biodiversity. However, as is often the case with relatively new protocols, methodological challenges remain. A number of earlier reviews have discussed these challenges, but none have provided extensive treatment of the critical decisions surrounding molecular markers and primer development for use in eDNA assays. This review discusses a number of options and approaches that can be used when determining which primers and gene regions are most appropriate for either targeted species detection or metabarcoding macro-organisms from eDNA. The latter represents a new field that is growing rapidly, and which has the potential to revolutionize future assessments of community and ecosystem diversity.
Article
DNA metabarcoding is a technique used to survey biodiversity in many ecological settings, but there are doubts about whether it can provide quantitative results, i.e. the proportions of each species in the mixture as opposed to a species list. While there are several experimental studies that report quantitative metabarcoding results, there are a similar number that fail to do so. Here we provide the rationale to understand under what circumstances the technique can be quantitative. Basically, we simulate a mixture of DNA of S species with a defined initial abundance distribution. In the simulated PCR, each species increases its concentration following a certain amplification efficiency. The final DNA concentration will reflect the initial one when the efficiency is similar for all species; otherwise, the initial and final DNA concentrations would be poorly related. Although there are many known factors that modulate amplification efficiency, we focused on the number of primer‐template mismatches, arguably the most important one. We used 15 common primers pairs targeting the mitochondrial COI region and the mitogenomes of ca. 1200 insect species. The results showed that some primers pairs produced quantitative results under most circumstances, whereas some other primers failed to do so. Many species, and a high diversity within the mixture, helped the metabarcoding to be quantitative. In conclusion, depending on the primer pair used in the PCR amplification and on the characteristics of the mixture analysed (i.e., high species richness, low evenness), DNA metabarcoding can provide a quantitative estimate of the relative abundances of different species. This article is protected by copyright. All rights reserved.
Article
Full-text available
Genetic recombination plays a pivotal role in the appearance of human norovirus recombinants that cause global epidemics. However, the factors responsible for the appearance of these recombinants remains largely unknown. In this study, we revealed a selective pressure that restricts parental combinations leading to the emergence of norovirus recombinants. To investigate traces of emerging novel recombinants and their parents in the human population, we isolated mass nucleotide sequence clones of human norovirus genogroups I and II in sewage-affected waters over a 4-year sampling period. Fourteen different phylogenetic combinations of recombinants and their parents were defined from the dozens of phylogenetic lineages circulating in the human population. To evaluate the probability of these combinations, parental lineages of each recombinant were categorized into two groups as HP (relatively higher-competitiveness parents) and LP (relatively lower-competitiveness parents), according to their relative detection frequency. Strong categorization of HP and LP was confirmed by tests with modified data and additional variables. An algorithm that was developed in this study to visualize the chance of mixed infection between parents revealed that HP lineages have a higher chance of mixed infection than LP lineages in the human population. Three parental pairing types in recombinants were defined: HP-HP, HP-LP, and LP-LP. Among these, most recombinants were identified as HP-LP, despite the prediction of dominant emergence of HP-HP-type recombinants. These results suggest that nature favors recombinants of human norovirus that originate from parental pairing of heterogeneous competitiveness. © 2021. Koo and Jeong. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license. All Rights Reserved.
Article
Full-text available
BACKGROUND Industrial gaseous emissions causing odor nuisance have become a major environmental issue in many countries. Biotrickling filters are suitable for treating mixtures of gaseous compounds with high removal efficiencies. The aim of this work was to determine the vertical distribution of microbial communities stablished in a biotrickling filter treating a mixture of gaseous compounds causing odor nuisance, and to correlate its performance with the spatial and temporal distribution of inoculated bacteria. RESULTS In the long term operation, at day 538, the removal efficiencies were 100% for ammonia and H2S, 73% for methanol, 63% for trimethylamine, 41% for dimethylsulphide and 32% for 2,5‐dimethylpirazyne; and the elimination capacities were 1.5 [g NH3 m‐3bed h‐1], 0.7 [g H2S m‐3bed h‐1], 0.7 [g MeOH m‐3bed h‐1], 3.3 [g TMA m‐3bed h‐1], 0.21 [g DMS m‐3bed h‐1] and 0.6 [g 2,5‐DMP m‐3bed h‐1]. A stratification pattern of pollutants degradation along BTF was identified, where most of the removal of NH3, TMA and H2S occurred at the lower level of the column, the removal of methanol and 2,5‐dimethylpyrazine occurred at low and medium levels, and the removal of dimethylsulphide occurred mainly at the upper levels. High‐throughput DNA sequencing analysis showed a colonization by bacteria genera different from the inoculated and a stratification of these bacteria along the BTF. CONCLUSION There is stratification in the biofilm of a biotrickling filter during its long‐term operation, and a relationship between the stratification of the microbial communities and the removal of the complex mixture of gases was identified. This article is protected by copyright. All rights reserved.
Article
Full-text available
“ Candidatus Accumulibacter phosphatis” is widely found in full-scale wastewater treatment plants, where it has been identified as the key organism for biological removal of phosphorus. Since aeration can account for 50% of the energy use during wastewater treatment, microaerobic conditions for wastewater treatment have emerged as a cost-effective alternative to conventional biological nutrient removal processes. Our report provides strong genomics-based evidence not only that “ Ca . Accumulibacter phosphatis” is the main organism contributing to phosphorus removal under microaerobic conditions but also that this organism simultaneously respires nitrate and oxygen in this environment, consequently removing nitrogen and phosphorus from the wastewater. Such activity could be harnessed in innovative designs for cost-effective and energy-efficient optimization of wastewater treatment systems.
Article
Full-text available
We designed novel quantitative real-time polymerase chain reaction (qPCR) primers for the polyphosphate kinase 1 (ppk1) gene, targeting eight individual “Candidatus Accumulibacter” (referred to as Accumulibacter) clades. An evaluation of primer sets was conducted regarding the coverage, specificity, and PCR efficiency. (i) All primer sets were designed to cover all available sequences of the target clade. (ii) The phylogenetic analysis of the sequences retrieved from the qPCR products by each primer set demonstrated a high level of specificity. (iii) All calibration curves presented high PCR efficiencies in the range of 85–112% (R2 = 0.962–0.998). In addition, the possible interference of non-target amplicons was individually examined using the qPCR assay for 13 Accumulibacter clades, which were either undetected or showed negligible detection. With the primers designed by other research groups, a highly selective and sensitive qPCR-based method was developed to quantify all Accumulibacter clades, with the exception of Clade IE, in one assay, which enables more comprehensive insights into the community dynamics. The applicability to environmental samples was demonstrated by profiling the Accumulibacter clades in activated sludge samples of nine full-scale wastewater treatment plants.
Article
Full-text available
Massively parallel high throughput sequencing technologies allow us to interrogate the microbial composition of biological samples at unprecedented resolution. The typical approach is to perform high-throughout sequencing of 16S rRNA genes, which are then taxonomically classified based on similarity to known sequences in existing databases. Current technologies cause a predicament though, because although they enable deep coverage of samples, they are limited in the length of sequence they can produce. As a result, high-throughout studies of microbial communities often do not sequence the entire 16S rRNA gene. The challenge is to obtain reliable representation of bacterial communities through taxonomic classification of short 16S rRNA gene sequences. In this study we explored properties of different study designs and developed specific recommendations for effective use of short-read sequencing technologies for the purpose of interrogating bacterial communities, with a focus on classification using naïve Bayesian classifiers. To assess precision and coverage of each design, we used a collection of ∼8,500 manually curated 16S rRNA gene sequences from cultured bacteria and a set of over one million bacterial 16S rRNA gene sequences retrieved from environmental samples, respectively. We also tested different configurations of taxonomic classification approaches using short read sequencing data, and provide recommendations for optimal choice of the relevant parameters. We conclude that with a judicious selection of the sequenced region and the corresponding choice of a suitable training set for taxonomic classification, it is possible to explore bacterial communities at great depth using current technologies, with only a minimal loss of taxonomic resolution.
Article
Full-text available
As 16S rRNA gene targeted massively parallel sequencing has become a common tool for microbial diversity investigations, numerous advances have been made to minimize the influence of sequencing and chimeric PCR artifacts through rigorous quality control measures. However, there has been little effort towards understanding the effect of multi-template PCR biases on microbial community structure. In this study, we used three bacterial and three archaeal mock communities consisting of, respectively, 33 bacterial and 24 archaeal 16S rRNA gene sequences combined in different proportions to compare the influences of (1) sequencing depth, (2) sequencing artifacts (sequencing errors and chimeric PCR artifacts), and (3) biases in multi-template PCR, towards the interpretation of community structure in pyrosequencing datasets. We also assessed the influence of each of these three variables on α- and β-diversity metrics that rely on the number of OTUs alone (richness) and those that include both membership and the relative abundance of detected OTUs (diversity). As part of this study, we redesigned bacterial and archaeal primer sets that target the V3-V5 region of the 16S rRNA gene, along with multiplexing barcodes, to permit simultaneous sequencing of PCR products from the two domains. We conclude that the benefits of deeper sequencing efforts extend beyond greater OTU detection and result in higher precision in β-diversity analyses by reducing the variability between replicate libraries, despite the presence of more sequencing artifacts. Additionally, spurious OTUs resulting from sequencing errors have a significant impact on richness or shared-richness based α- and β-diversity metrics, whereas metrics that utilize community structure (including both richness and relative abundance of OTUs) are minimally affected by spurious OTUs. However, the greatest obstacle towards accurately evaluating community structure are the errors in estimated mean relative abundance of each detected OTU due to biases associated with multi-template PCR reactions.
Article
Full-text available
For the past 25 years NIH Image and ImageJ software have been pioneers as open tools for the analysis of scientific images. We discuss the origins, challenges and solutions of these two programs, and how their history can serve to advise and inform other software projects.
Article
Full-text available
Background: Currently, the naïve Bayesian classifier provided by the Ribosomal Database Project (RDP) is one of the most widely used tools to classify 16S rRNA sequences, mainly collected from environmental samples. We show that RDP has 97+% assignment accuracy and is fast for 250 bp and longer reads when the read originates from a taxon known to the database. Because most environmental samples will contain organisms from taxa whose 16S rRNA genes have not been previously sequenced, we aim to benchmark how well the RDP classifier and other competing methods can discriminate these novel taxa from known taxa. Principal findings: Because each fragment is assigned a score (containing likelihood or confidence information such as the boostrap score in the RDP classifier), we "train" a threshold to discriminate between novel and known organisms and observe its performance on a test set. The threshold that we determine tends to be conservative (low sensitivity but high specificity) for naïve Bayesian methods. Nonetheless, our method performs better with the RDP classifier than the other methods tested, measured by the f-measure and the area-under-the-curve on the receiver operating characteristic of the test set. By constraining the database to well-represented genera, sensitivity improves 3-15%. Finally, we show that the detector is a good predictor to determine novel abundant taxa (especially for finer levels of taxonomy where novelty is more likely to be present). Conclusions: We conclude that selecting a read-length appropriate RDP bootstrap score can significantly reduce the search space for identifying novel genera and higher levels in taxonomy. In addition, having a well-represented database significantly improves performance while having genera that are "highly" similar does not make a significant improvement. On a real dataset from an Amazon Terra Preta soil sample, we show that the detector can predict (or correlates to) whether novel sequences will be assigned to new taxa when the RDP database "doubles" in the future.
Article
Full-text available
The Ribosomal Database Project (RDP) provides researchers with quality-controlled bacterial and archaeal small subunit rRNA alignments and analysis tools. An improved alignment strategy uses the Infernal secondary structure aware aligner to provide a more consistent higher quality alignment and faster processing of user sequences. Substantial new analysis features include a new Pyrosequencing Pipeline that provides tools to support analysis of ultra high-throughput rRNA sequencing data. This pipeline offers a collection of tools that automate the data processing and simplify the computationally intensive analysis of large sequencing libraries. In addition, a new Taxomatic visualization tool allows rapid visualization of taxonomic inconsistencies and suggests corrections, and a new class Assignment Generator provides instructors with a lesson plan and individualized teaching materials. Details about RDP data and analytical functions can be found at http://rdp.cme.msu.edu/.
Article
Full-text available
DECIPHER is a new method for finding 16S rRNA chimeric sequences by the use of a search-based approach. The method is based upon detecting short fragments that are uncommon in the phylogenetic group where a query sequence is classified but frequently found in another phylogenetic group. The algorithm was calibrated for full sequences (fs_DECIPHER) and short sequences (ss_DECIPHER) and benchmarked against WigeoN (Pintail), ChimeraSlayer, and Uchime using artificially generated chimeras. Overall, ss_DECIPHER and Uchime provided the highest chimera detection for sequences 100 to 600 nucleotides long (79% and 81%, respectively), but Uchime's performance deteriorated for longer sequences, while ss_DECIPHER maintained a high detection rate (89%). Both methods had low false-positive rates (1.3% and 1.6%). The more conservative fs_DECIPHER, benchmarked only for sequences longer than 600 nucleotides, had an overall detection rate lower than that of ss_DECIPHER (75%) but higher than those of the other programs. In addition, fs_DECIPHER had the lowest false-positive rate among all the benchmarked programs (<0.20%). DECIPHER was outperformed only by ChimeraSlayer and Uchime when chimeras were formed from closely related parents (less than 10% divergence). Given the differences in the programs, it was possible to detect over 89% of all chimeras with just the combination of ss_DECIPHER and Uchime. Using fs_DECIPHER, we detected between 1% and 2% additional chimeras in the RDP, SILVA, and Greengenes databases from which chimeras had already been removed with Pintail or Bellerophon. DECIPHER was implemented in the R programming language and is directly accessible through a webpage or by downloading the program as an R package (http://DECIPHER.cee.wisc.edu).
Article
Full-text available
“Barcode-tagged” PCR primers used for multiplex amplicon sequencing generate a thus-far-overlooked amplification bias that produces variable terminal restriction fragment length polymorphism (T-RFLP) and pyrosequencing data from the same environmental DNA template. We propose a simple two-step PCR approach that increases reproducibility and consistently recovers higher genetic diversity in pyrosequencing libraries.
Article
Full-text available
A long-sought milestone in microfluidics research has been the development of integrated technology for scalable analysis of transcription in single cells. Here we present a fully integrated microfluidic device capable of performing high-precision RT-qPCR measurements of gene expression from hundreds of single cells per run. Our device executes all steps of single-cell processing, including cell capture, cell lysis, reverse transcription, and quantitative PCR. In addition to higher throughput and reduced cost, we show that nanoliter volume processing reduced measurement noise, increased sensitivity, and provided single nucleotide specificity. We apply this technology to 3,300 single-cell measurements of (i) miRNA expression in K562 cells, (ii) coregulation of a miRNA and one of its target transcripts during differentiation in embryonic stem cells, and (iii) single nucleotide variant detection in primary lobular breast cancer cells. The core functionality established here provides the foundation from which a variety of on-chip single-cell transcription analyses will be developed.
Article
Full-text available
A recent genomewide mutational analysis of glioblastomas (World Health Organization [WHO] grade IV glioma) revealed somatic mutations of the isocitrate dehydrogenase 1 gene (IDH1) in a fraction of such tumors, most frequently in tumors that were known to have evolved from lower-grade gliomas (secondary glioblastomas). We determined the sequence of the IDH1 gene and the related IDH2 gene in 445 central nervous system (CNS) tumors and 494 non-CNS tumors. The enzymatic activity of the proteins that were produced from normal and mutant IDH1 and IDH2 genes was determined in cultured glioma cells that were transfected with these genes. We identified mutations that affected amino acid 132 of IDH1 in more than 70% of WHO grade II and III astrocytomas and oligodendrogliomas and in glioblastomas that developed from these lower-grade lesions. Tumors without mutations in IDH1 often had mutations affecting the analogous amino acid (R172) of the IDH2 gene. Tumors with IDH1 or IDH2 mutations had distinctive genetic and clinical characteristics, and patients with such tumors had a better outcome than those with wild-type IDH genes. Each of four tested IDH1 and IDH2 mutations reduced the enzymatic activity of the encoded protein. Mutations of NADP(+)-dependent isocitrate dehydrogenases encoded by IDH1 and IDH2 occur in a majority of several types of malignant gliomas.
Article
Full-text available
The recent introduction of massively parallel pyrosequencers allows rapid, inexpensive analysis of microbial community composition using 16S ribosomal RNA (rRNA) sequences. However, a major challenge is to design a workflow so that taxonomic information can be accurately and rapidly assigned to each read, so that the composition of each community can be linked back to likely ecological roles played by members of each species, genus, family or phylum. Here, we use three large 16S rRNA datasets to test whether taxonomic information based on the full-length sequences can be recaptured by short reads that simulate the pyrosequencer outputs. We find that different taxonomic assignment methods vary radically in their ability to recapture the taxonomic information in full-length 16S rRNA sequences: most methods are sensitive to the region of the 16S rRNA gene that is targeted for sequencing, but many combinations of methods and rRNA regions produce consistent and accurate results. To process large datasets of partial 16S rRNA sequences obtained from surveys of various microbial communities, including those from human body habitats, we recommend the use of Greengenes or RDP classifier with fragments of at least 250 bases, starting from one of the primers R357, R534, R798, F343 or F517.
Article
Full-text available
We have found that under appropriate conditions, an allele-specific polymerase chain reaction (PCR) can achieve a sensitivity suitable for measuring specific, infrequent mutations in single cell systems or in animal tissues. Using the 12th codon GC-to-AT mutation in the rat c-Ha-ras gene as a model system, we have defined conditions that allow for measurement of mutations present at frequencies as low as one in 10(5) gene copies. Our approach involved the use of PCR primers that created a single mismatch with the mutated allele (GAA) but created a double mismatch with the wild-type allele (GGA). Five out of the six such double-mismatch primers we tested permitted amplification of the mutant allele (GAA) with a high degree of specificity. The specificity of the assay was further enhanced by using a two-step PCR cycle consisting of a denaturation step (1 min incubation at 94 degrees C) and an annealing/extension step (1 min incubation at 50 degrees C) in the presence of 10% (vol/vol) glycerol. Reconstruction experiments using genomic DNA demonstrate that this procedure cna measure the presence of 30 copies of the transforming ras allele present amongst 3 x 10(6) copies of the wild-type allele.
Article
Full-text available
We investigated the effects of various primer-template mismatches on DNA amplification of an HIV-1 gag region by the polymerase chain reaction (PCR). Single internal mismatches had no significant effect on PCR product yield while those at the 3′-terminal base had varied effects. A:G, G:A, and C:C mismatches reduced overall PCR product yield about 100-fold, A:A mismatches about 20-fold. All other 3′-terminal mismatches were efflcientiy amplified, although the G:G mismatches appeared to be more sensitive to sequence context and dNTP concentrations than other mismatches. It shouid be noted that mismatches of T with either G, C, or T had a minimal effect on PCR product yield. Double mismatches within the last four bases of a primer-template duplex where one of the mismatches is at the 3′ terminal nucleotide, in general, reduced PCR product yield dramatically. The presence of a mismatched T at the 3′-terminus, however, ailowed significant amplification even when coupled with an adjacent mismatch. Furthermore, even two mismatched Ta at the 3′-terminus allowed efficient ampiification.
Article
Full-text available
We investigated the effects of internal primer-template mismatches on the efficiency of reverse transcription and PCR amplification. As models, RNA transcripts representative of different HIV-1 group M subtypes were evaluated with a previously described gag primer pair system. We observed that the presence of two to four mismatches in the primer-template duplexes did not have a significant effect on RT-PCR. However, the presence of five and six mismatches with the 28 and 30 base primers reduced PCR product yield by ∼22- and 100-fold respectively, relative to the homologous template. The amount of reduction was reproducible from experiment to experiment and was independent of the initial copy number input. Under the conditions used, viral RNA measurements of the more divergent HIV-1 subtypes (A and E) would be underestimated, while isolates of subtypes B, C, D and F-H are expected to be efficiently amplified and accurately measured. The reduced amplification efficiency for targets similar to HIV subtypes A and E can be improved 4- to 10-fold by lowering the annealing temperature and implementing a reverse transcription step that gradually increases in temperature. The additional substitution of either 5-methylcytosine for cytosine throughout or the substitution of inosine at positions of variable bases resulted in a <4-fold difference in product yield between the homologous and most divergent templates.
Article
Full-text available
We compared the efficiency of PCR amplification using primers containing either a nucleotide analog or a mismatch at the 3' base. To determine the distribution of bases inserted opposite eight different analogs, 3' analog primers were used to amplify four different templates. The products from the reactions with the highest amplification efficiency were sequenced. Analogs allowing efficient amplification followed by insertion of a new base at that position are herein termed 'convertides'. The three convertides with the highest amplification efficiency were used to convert sequences containing C, T, G and A bases into products containing the respective three remaining bases. Nine templates were used to generate conversion products, as well as non-conversion control products with no base change. We compared the ability of natural bases to convert specific sites with and without a preconversion step using nucleotide analog primers. Conversion products were identified by a ligation detection reaction using primers specific for the converted sequence. We found that conversions resulting in transitions were easier to accomplish than transversions and that sequence context influences conversion. Specifically, primer slippage appears to be an important mechanism for producing artifacts via polymerase extension of a 3' base or analog transiently base paired to neighboring bases of the template. Nucleotide analogs could often reduce conversion artifacts and increase the yield of the expected product. While new analogs are needed to reliably achieve transversions, the current set have proven effective for creating transition conversions.
Article
Full-text available
The Polymerase Chain Reaction (PCR) has facilitated the detection of unculturable microorganisms in virtually any environmental source and has thus been used extensively in the assessment of environmental microbial diversity. This technique relies on the assumption that the gene sequences present in the environment are complementary to the "universal" primers used in their amplification. The recent discovery of new taxa with 16S rDNA sequences not complementary to standard universal primers suggests that current 16S rDNA libraries are not representative of true prokaryotic biodiversity. Here we re-assess the specificity of commonly used 16S rRNA gene primers and present these data in tabular form designed as a tool to aid simple analysis, selection and implementation. In addition, we present two new primer pairs specifically designed for effective "universal" Archaeal 16S rDNA sequence amplification. These primers are found to amplify sequences from Crenarchaeote and Euryarchaeote type strains and environmental DNA.
Article
Full-text available
Mechanisms that allow replicative DNA polymerases to attain high processivity are often specific to a given polymerase and cannot be generalized to others. Here we report a protein engineering‐based approach to significantly improve the processivity of DNA polymerases by covalently linking the polymerase domain to a sequence non‐specific dsDNA binding protein. Using Sso7d from Sulfolobus solfataricus as the DNA binding protein, we demonstrate that the processivity of both family A and family B polymerases can be significantly enhanced. By introducing point mutations in Sso7d, we show that the dsDNA binding property of Sso7d is essential for the enhancement. We present evidence supporting two novel conclusions. First, the fusion of a heterologous dsDNA binding protein to a polymerase can increase processivity without compromising catalytic activity and enzyme stability. Second, polymerase processivity is limiting for the efficiency of PCR, such that the fusion enzymes exhibit profound advantages over unmodified enzymes in PCR applications. This technology has the potential to broadly improve the performance of nucleic acid modifying enzymes.
Article
Full-text available
rRNA-based studies, which have become the most common method for assessing microbial communities, rely upon faithful amplification of the corresponding genes from the original DNA sample. We report here an analysis and reevaluation of commonly used primers for amplifying the DNA between positions 27 and 1492 of bacterial 16S rRNA genes (numbered according to the Escherichia coli rRNA). We propose a formulation for a forward primer (27f) that includes three sequences not usually present. We compare our proposed formulation to two common alternatives by using linear amplification—providing an assessment that is independent of a reverse primer—and in combination with the 1492 reverse primer (1492r) under the PCR conditions appropriate for making community rRNA gene clone libraries. For analyses of DNA from human vaginal samples, our formulation was better at maintaining the original rRNA gene ratio of Lactobacillus spp. to Gardnerella spp., particularly under stringent amplification conditions. Because our 27f formulation remains relatively simple, having seven distinct primer sequences, there is minimal loss of overall amplification efficiency and specificity.
Book
In the past decade, molecular biology has been transformed from the art of cloning a single gene to a statistical science measuring and calculating properties of entire genomes. New high-throughput methods have been developed for genome sequencing and studying the cell at different systematic levels such as transcriptome, proteome, metabolome and other -omes. At the heart of most high-throughput methods is the technique of polymerase chain reaction (PCR). PCR Primer Design focuses on primer design, which is critical to both the efficiency and the accuracy of the PCR. With intricate descriptions of basic approaches as well as specialized methods, this volume is an exceptional reference for all those involved in studying the genome. In PCR Primer Design, authors describe basic approaches for PCR primer design in addition to specialized methods. These state-of-the-art methods can be used for both genome-scale experiments and for small-scale individual PCR amplifications. This volume will be useful for organizations performing whole genome studies, companies designing instruments that utilize PCR, and individual scientists – geneticists, molecular biologists, molecular geneticists, and more – who routinely use PCR in their research.
Article
Microbial communities associated with the problem of bacterial regrowth in chloraminated drinking water distribution systems (DS) have two main components: the autotrophic nitrifiers growing on ammonia released from chloramine decay and the heterotrophs relying on biodegradable organic material. While nitrifying populations have been extensively studied, microbial ecological knowledge on heterotrophic populations is limited even though some studies have indicated that heterotrophs may be the dominant component, or could even initiate regrowth in DS. The types of heterotrophic organisms inhabiting chloraminated DS can potentially influence disinfection strategies. The objectives of this study were to (i) identify heterotrophic bacteria in pilot- and full-scale DS using culture-independent methods and (ii) comparatively evaluate heterotrophic communities to understand if pilot-scale adequately represents the real scale. Monthly samples were obtained from two parallel pilot-scale DS with high and low chloramine dose, and three full-scale systems at a geographically different location, which included finished water and two separate tanks in downstream DS. Two additional pilot systems were run for a shorter period and sampled for the observation of early community development. Organisms in DS samples were identified based on their 16S rRNA sequences and community fingerprints were generated using automated ribosomal intergenic spacer analysis (ARISA). Most of the retrieved 16S rRNA sequences (>95%) were related to heterotrophic bacteria. Both phylogenetic analyses and community fingerprints showed that the heterotrophic communities in pilot- and full-scale were significantly different. However, a significant number of sequences common to all systems excluding finished water indicated organisms that are well-adapted to chloraminated environments. These included bacteria from the Sphingomonadales order, Mycobacterium and Curvibacter genera, and an uncultured lineage of Rhizobiales. In addition, there were full-scale distribution system sequences, previously not reported in other environments related to drinking water. In conclusion, pilot-scale DS are useful for investigating certain subpopulations of microbiota in chloraminated distribution systems, but are not perfect models that can simulate the overall microbial dynamics in the full-scale. Culture-based methods are needed to determine the potential environmental roles of the chloraminated distribution system organisms discovered in this work using molecular techniques.
Article
Functional RNA elements do not encode proteins, but rather function directly as RNAs. Many different types of RNAs play important roles in a wide range of cellular processes, including protein synthesis, gene regulation, protein transport, splicing, and more. Because important sequence and structural features tend to be evolutionarily conserved, one way to learn about functional RNAs is through comparative sequence analysis - by collecting and aligning examples of homologous RNAs and comparing them. Covariance models (CMs) are powerful computational tools for homology search and alignment that score both the conserved sequence and secondary structure of an RNA family. However, due to the high computational complexity of their search and alignment algorithms, searches against large databases and alignment of large RNAs like small subunit ribosomal RNA (SSU rRNA) are prohibitively slow. Large-scale alignment of SSU rRNA is of particular utility for environmental survey studies of microbial diversity which often use the rRNA as a phylogenetic marker of microorganisms. In this work, we improve CM methods by making them faster and more sensitive to remote homology. To accelerate searches, we introduce a query-dependent banding (QDB) technique that makes scoring sequences more efficient by restricting the possible lengths of structural elements based on their probability given the model. We combine QDB with a complementary filtering method that quickly prunes away database subsequences deemed unlikely to receive high CM scores based on sequence conservation alone. To increase search sensitivity, we apply two model parameterization strategies from protein homology search tools to CMs. As judged by our benchmark, these combined approaches yield about a 250-fold speedup and significant increase in search sensitivity compared with previous implementations. To accelerate alignment, we apply a method that uses a fast sequence-based alignment of a target sequence to determine constraints for the more expensive CM sequence- and structure-based alignment. This technique reduces the time required to align one SSU rRNA sequence from about 15 minutes to 1 second with a negligible effect on alignment accuracy. Collectively, these improvements make CMs more powerful and practical tools for RNA homology search and alignment.
Article
Quantitative PCR (qPCR) is a critical tool for quantifying the abundance of specific organisms and the level or expression of target genes in medically and environmentally relevant systems. However, often the power of this tool has been limited because primer-template mismatches, due to sequence variations of targeted genes, can lead to inaccuracies in measured gene quantities, detection failures, and spurious conclusions. Currently available primer design guidelines for qPCR were developed for pure culture applications, and available primer design strategies for mixed cultures were developed for detection rather than accurate quantification. Furthermore, past studies examining the impact of mismatches have focused only on single mismatches while instances of multiple mismatches are common. There are currently no appropriate solutions to overcome the challenges posed by sequence variations. Here, we report results that provide a comprehensive, quantitative understanding of the impact of multiple primer-template mismatches on qPCR accuracy and demonstrate a multi-primer set approach to accurately quantify a model gene pcrA (encoding perchlorate reductase) that has substantial sequence variation. Results showed that for multiple mismatches (up to 3 mismatches) in primer regions where mismatches were previously considered tolerable (middle and 5'end), quantification accuracies could be as low as ~0.1%. Furthermore, tests were run using a published pcrA primer set with mixtures of genomic DNA from strains known to harbor the target gene, and for some mixtures quantification accuracy was as low as ~0.8% or was non-detect. To overcome these limitations, a multiple primer set assay including minimal degeneracies was developed for pcrA genes. This assay resulted in nearly 100% accurate detection for all mixed microbial communities tested. The multi-primer set approach demonstrated herein can be broadly applied to other genes with known sequences.
Article
As the less familiar cousin of quantitative PCR moves mainstream, researchers have more options to choose from.
Article
Real-time polymerase chain reaction (PCR) is the current method of choice for detection and quantification of nucleic acids, especially for molecular diagnostics. Complementarity between primers and template is often crucial for PCR applications, as mismatches can severely reduce priming efficiency. However, little quantitative data on the effect of these mismatches is available. We quantitatively investigated the effects of primer-template mismatches within the 3'-end primer region on real-time PCR using the 5'-nuclease assay. Our results show that single mismatches instigate a broad variety of effects, ranging from minor (<1.5 cycle threshold, eg, A-C, C-A, T-G, G-T) to severe impact (>7.0 cycle threshold, eg, A-A, G-A, A-G, C-C) on PCR amplification. A clear relationship between specific mismatch types, position, and impact was found, which remained consistent for DNA versus RNA amplifications and Taq/Moloney murine leukemia virus versus rTth based amplifications. The overall size of the impact among the various master mixes used differed substantially (up to sevenfold), and for certain master mixes a reverse or forward primer-specific impact was observed, emphasizing the importance of the experimental conditions used. Taken together these data suggest that mismatch impact follows a consistent pattern and enabled us to formulate several guidelines for predicting primer-template mismatch behavior when using specific 5-nuclease assay master mixes. Our study provides novel insight into mismatch behavior and should allow for more optimized development of real-time PCR assays involving primer-template mismatches.
Article
Single mismatch (MM) present at the region where primer binds onto the template strand can greatly affect the PCR efficacy. Earlier studies revealed that PCR or primer extension is hindered by a single MM at the primer 3' end. The MMs located at other positions within a primer also have similar performance, but to what extent they can decrease the efficiency is not clear. In this study, a modified single base extension assay was used to systematically compare the extension efficiencies between a perfect-matched (PM) primer and its single-MM primers with all possible MM types. The extension efficiencies of single-MM primers, which were generally lower or equivalent to that of the PM primer, were observed to strongly depend on the MM location and/or type. Due to the enzymatic activity, single MMs present at the last 3-4 positions from the primer 3' end exhibited zero or minimal (<3.9%) extension efficiencies. For those MMs at positions 5 onward from primer 3' end where was affected mainly by the primer-target binding stability, an increasing trend in extension efficiency with the highest (i.e., 69.3%) occurring at the primer 5' end was observed to significantly correlate in an inverse relationship with the duplex stability (i.e., difference of melting temperature) under a empirically polynomial equation, y=-0.0731 x(3) + 2.2519 x(2) - 22.617 x + 76.691 (R(2)=0.5318). It was further shown that the extension efficiencies of these MM types could be improved with a factor of 3.25 on average in relation to the decrease in the annealing temperature by 7 degrees C. On the other hand, substitution of a less selective inosine nucleotide did not convincingly improve the extension efficiency. Overall findings obtained could further improve the rational design of oligonucleotide primers in various microbiological studies that involve the use of PCR techniques.
Article
Thermus aquaticus (Taq) DNA polymerase was used to measure the extension efficiency for all configurations of matched and mismatched base pairs at template-primer 3′-termini. The transition mispairs, A(primer)·C, C·A, G·T, and T·G were extended 10−3 to 10−4-fold less efficiently than their correctly paired counterparts. Relative efficiencies for extending transversion mispairs were 10−4 to 10−5 for T·C and T·T, about 10−6 for A·A, and less than 10−6 for G·A, A·G, G·G and C·C. The transversion mispair C(primer)·T was extended with high efficiency, about 10−2 compared to a correct A·T basepair. The unexpected ease of extending the C·T mismatch was not likely to have been caused by primer-template misalignment. Taq polymerase was observed to bind with similar affinities to each of the correctly paired and mispaired primer-template 3′-ends. Thus, the failure of Taq polymerase to extend mismatches efficiently appears to b