A new classification for Lipocarpha and Volkiella as infrageneric taxa of Cyperus s.l. (Cypereae, Cyperoideae, Cyperaceae): Insights from species tree reconstruction supplemented with morphological and floral developmental data

Abstract

Recent molecular phylogenetic analyses showed that Lipocarpha and Volkiella are nested in a paraphyletic Cyperus s.s. and therefore should be viewed as part of a broadly circumscribed genus Cyperus (Cyperaceae). In this paper, molecular phylogenetic analyses of Lipocarpha and Volkiella based on nuclear ribosomal ETS1f and plastid rpl32-trnL and trnH- psbA markers are presented. Separate gene trees as well as a species tree were constructed. Results indicate a polyphyletic Lipocarpha s.l. consisting of a paraphyletic core Lipocarpha s.s in which the monotypic Volkiella is included, and a small non-related clade with species formerly placed in the genus Rikliella. Core Lipocarpha s.s. encompasses six clades, which can be distinguished based on morphological characters. Floral developmental data for Lipocarpha rehmannii (the type of Rikliella) confirms that this species is not a true Lipocarpha s.s. Based on our findings, Lipocarpha s.l. and Volkiella are here included in Cyperus subg. Cyperus. New names and combinations for Lipocarpha s.l. and Volkiella species and a new sectional classification for these species are proposed.

Full text

Accepted by Zhi-Qiang Zhang: 31 Mar 2014; published: 17 Apr. 2014 1
PHYTOTAXA
ISSN 1179-3155 (print edition)
ISSN 1179-3163 (online edition)
Copyright © 2014 Magnolia Press
Phytotaxa 166 (1): 001–032
www.mapress.com/phytotaxa/Article
http://dx.doi.org/10.11646/phytotaxa.166.1.1
A new classification for Lipocarpha and Volkiella as infrageneric taxa of Cyperus
s.l. (Cypereae, Cyperoideae, Cyperaceae): insights from species tree
reconstruction supplemented with morphological and floral developmental data
KENNETH BAUTERS1, ISABEL LARRIDON1, MARC REYNDERS1,2, PIETER ASSELMAN1, ALEXANDER
VRIJDAGHS3, A. MUTHAMA MUASYA4, DAVID A. SIMPSON5 & PAUL GOETGHEBEUR1
1Ghent University, Department of Biology, Research Group Spermatophytes, K.L. Ledegankstraat 35, BE-9000 Ghent, Belgium;
kenneth.bauters@ugent.be, isabel.larridon@ugent.be
2Botanic Garden Meise, Niewelaan 38, BE-1860 Meise, Belgium.
3KU Leuven, Ecology, Evolution and Biodiversity, Kasteelpark Arenberg 31 box 2435, 3001 Leuven, Belgium.
4Department of Botany, University of Cape Town, Private Bag X3, Rondebosch 7701, South Africa.
5Royal Botanic Gardens, Kew, Richmond, Surrey, TW9 3AB, United Kingdom
Abstract
Recent molecular phylogenetic analyses showed that Lipocarpha and Volkiella are nested in a paraphyletic Cyperus s.s.
and therefore should be viewed as part of a broadly circumscribed genus Cyperus (Cyperaceae). In this paper, molecular
phylogenetic analyses of Lipocarpha and Volkiella based on nuclear ribosomal ETS1f and plastid rpl32-trnL and trnH-
psbA markers are presented. Separate gene trees as well as a species tree were constructed. Results indicate a
polyphyletic Lipocarpha s.l. consisting of a paraphyletic core Lipocarpha s.s in which the monotypic Volkiella is
included, and a small non-related clade with species formerly placed in the genus Rikliella. Core Lipocarpha s.s.
encompasses six clades, which can be distinguished based on morphological characters. Floral developmental data for
Lipocarpha rehmannii (the type of Rikliella) confirms that this species is not a true Lipocarpha s.s. Based on our
findings, Lipocarpha s.l. and Volkiella are here included in Cyperus subg. Cyperus. New names and combinations for
Lipocarpha s.l. and Volkiella species and a new sectional classification for these species are proposed.
Introduction
Lipocarpha (Brown 1818: 459) (35 spp., Govaerts et al. 2014) and the monotypic Volkiella (Merxmüller & Czech
1953: 318) (1 sp., Govaerts et al. 2014) are two highly specialised taxa from tribe Cypereae. Cypereae sensu
Goetghebeur (1998) forms a monophyletic group based on recent molecular phylogenetic studies of Cyperaceae
(Simpson et al. 2003, 2007, Muasya et al. 2009a), and is characterised by the Cyperus-type embryo or the similar
Ficinia-type embryo (Van der Veken 1965, Goetghebeur 1986, 1998, Muasya et al. 2009a, b). Usually, the
inflorescence is an anthela of spikelets, but also highly condensed forms of the anthela are common. In some taxa,
such as Lipocarpha and Ascolepis (Steudel 1855: 105, Vrijdaghs et al. 2010), the anthela is reduced to a head of
spikelets. In Cypereae, flowers are usually bisexual and trimerous and subtended by a papery glume. However,
reduction of the number of stamens often occurs, as well as dimerisation of the gynoecium (Reynders & Vrijdaghs
et al. 2012). These glumes may be arranged spirally or distichously, while in some species the number of the
glumes in the spikelet is reduced to one, as is the case in Lipocarpha, or few.
Cypereae consists of two clades, the Ficinia clade and the Cyperus clade (Simpson et al. 2007, Muasya et al.
2009a, b). Recent molecular phylogenetic studies (e.g. Muasya et al. 2002, 2009b, Larridon et al. 2011a, 2013)
showed that Cyperus (Linnaeus 1753: 44) s.s. (Table 1 in this paper, Goetghebeur 1998, Govaerts et al. 2007) is not
monophyletic. The Cyperus clade (Table 1) consists of a C3 Cyperus grade in which the monophyletic C4 Cyperus
clade is nested (Fig. 1A). C3 Cyperus includes three segregate genera, i.e. Courtoisina (Soják 1980: 193),
Kyllingiella (Haines & Lye 1978: 176) and Oxycaryum (Palla 1908: 169), which were recently included in Cyperus

BAUTERS ET AL.2 • Phytotaxa 166 (1) © 2014 Magnolia Press
subg. Anosporum (Pax 1887: 107) (Larridon et al. 2011b). C4 Cyperus includes nine segregate genera (Larridon et
al. 2011a, 2013 (Fig. 1A, B). Larridon et al. (2013) indicated the need to include these C4 Cyperus segregates in
Cyperus subg. Cyperus. For all species of Alinula (Raynal 1977: 43) and for the single species of Queenslandiella
(Domin 1915: 415), Remirea (Aublet 1775: 44) and Sphaerocyperus (Lye 1972: 214), Cyperus names were already
published by other authors. The genera Ascolepis, Kyllinga (Rottbøll 1773: 12) and Pycreus (de Beauvois 1816: 48)
are reduced to Cyperus s.l. (Table 1) in a separate paper (Larridon et al. 2014). In this paper, a more detailed study
of Lipocarpha and Volkiella is presented since the relationships within and between these taxa remain unclear.
TABLE 1: Definitions of taxa names used in this paper.
A large part of the relationships in C4 Cyperus remain unresolved as a consequence of the fast radiation of this
clade after the origin of the C4 photosynthetic pathway (Larridon et al. 2013) (Fig. 1A). Previously, Lipocarpha
was resolved, though poorly supported, as closely related to Ascolepis and Volkiella (Muasya et al. 2002, 2009a).
Larridon et al. (2011a) found that Lipocarpha is more closely related to Queenslandiella. In Larridon et al. (2013),
Alinula, Ascolepis, Lipocarpha, Queenslandiella and Volkiella are resolved among the more basal branches of the
C4 Cyperus clade.
Both Lipocarpha and Volkiella are characterised by highly modified inflorescences, which resulted in their
recognition at generic level. In both genera, the spikelets are reduced to single-flowered cyperoid spikelets. In this
way, the (partial) inflorescence (a spike) takes over the function and gross appearance of a single spikelet. The
genus Lipocarpha is mainly found in the tropics and subtropics with some species extending their range to
temperate regions. In Lipocarpha, the head-like inflorescence is terminal and consists of few to many spikes, or
sometimes a single spike (Fig. 2). The inflorescence is surrounded by bracts, some of them subtending a spike or
empty, and the lowermost bracts are involucral. In some species, a pseudolateral inflorescence is found due to the
upright position of the lowermost bract of the inflorescence (Fig. 2D) (Goetghebeur & Van den Borre 1989). The
spikelets are spirally arranged along the rachis and each spikelet is subtended by a large and deciduous bract (Fig.
2), in this paper referred to as the spikelet bract. The spikelet bract is one of the most important characters to
identify species in Lipocarpha. A typical spikelet consists of usually two hyaline scales: an empty, adaxially
positioned spikelet prophyll and an abaxial glume, which subtends a flower (Reutemann et al. 2014). In some
species, the prophyll and/or the glume can be further reduced or even absent. Species with a reduced prophyll and/
or glume were previously placed in separate genera: Hemicarpha (Nees in Walker-Arnott 1834c: 263) for the
species with a reduced glume, and Rikliella J.Raynal (Raynal 1973: 154) for species lacking both spikelet prophyll
and glume.
Taxon Taxa included
C3 Cyperus All Cyperus s.l. species using C3 photosynthesis
C4 Cyperus All Cyperus s.l. species using C4 photosynthesis
Cyperus s.s. Cyperus sensu Goetghebeur (1998) and Govaerts et al. (2007)
Cyperus s.l. Cyperus including the segregate genera Alinula, Ascolepis, Courtoisina, Kyllinga, Kyllingiella, Lipocarpha,
Oxycaryum, Pycreus, Queenslandiella, Remirea, Sphaerocyperus and Volkiella
Lipocarpha s.s. Lipocarpha excluding Rikliella and including Volkiella
Lipocarpha s.l. Lipocarpha including Rikliella and Volkiella
Hemicarpha Lipocarpha micrantha, L. schomburgkii, L. occidentalis, L. aristulata and L. drummondii
Rikliella Lipocarpha kernii, L. rehmannii and L. squarrosus
Volkiella Volkiella disticha

Phytotaxa 166 (1) © 2014 Magnolia Press • 3
LIPOCARPHA & VOLKIELLA AS INFRAGENERIC TAXA OF CYPERUS S.L.
FIGURE 1: A. Phylogeny of Cyperus s.l., modified from Larridon et al. (2013). Distribution of the segregate genera now included in
Cyperus s.l. An asterisk indicates a bootstrap support higher than 75%; B. The segregate genera of Cyperus s.l.

BAUTERS ET AL.4 • Phytotaxa 166 (1) © 2014 Magnolia Press
FIGURE 2: A. Inflorescence of Lipocarpha chinensis (left) and Ascolepis brasiliensis (right) in Madagascar (picture taken by Marc
Reynders); B. Inflorescences of Lipocarpha nana in Madagascar (picture taken by Marc Reynders); C. Inflorescence of Lipocarpha
prieuriana (© Marco Schmidt, West African plants - A Photo Guide; photo used with permission of Brunken et al. 2008); D.
Lipocarpha micrantha in its natural habitat in the United States (© Arthur Haines, New England Wild Flower Society; photo used with
photographer’s permission).
The genus Hemicarpha was described by Nees (in Walker-Arnott 1834c: 287) as a genus with only one
hypogynous scale (the spikelet prophyll), hence the name of the genus. Several reasons led Goetghebeur & Van den
Borre (1989) to decide that Hemicarpha should be included in Lipocarpha: (1) the type specimen of Hemicarpha
(Hemicarpha isolepis Nees (in Walker-Arnott 1834c: 263), now Lipocarpha hemisphaerica (Roth) Goetgh.)
proved to be a genuine Lipocarpha species with the fruit surrounded by a spikelet prophyll and a glume; (2)
Hemicarpha schomburgkii Friedland (1941: 858) (now L. schomburgkii (Friedland) Tucker) was described with
completely reduced spikelet prophyll and glume; (3) several recognized Lipocarpha species have a more or less
reduced spikelet prophyll and glume (Goetghebeur & Van den Borre 1989). The formal inclusion was published by
Tucker (1987: 410–411).
The first step in recognizing the genus Rikliella was made by Raynal (1968: 94), who suggested that Scirpus
squarrosus L., S. kernii Raymond and S. rehmannii Ridl. could have originated out of Ascolepis or Lipocarpha, by
the loss of the hypogynous scales (Goetghebeur & Van den Borre 1989: 4). Raynal (1973: 155) later argued
Ascolepis to be the closer relative. However, Goetghebeur (1980: 303) suggested that a derivation from Lipocarpha
was much more probable, due to the presence of a spike prophyll in Rikliella and Lipocarpha, and the absence of
this in Ascolepis. Furthermore, Goetghebeur & Van den Borre (1989: 5) argued that “Hemicarpha is a clear
morphological intermediate between those genera [Lipocarpha and Rikliella]”. Therefore, they suggested
recognising only Lipocarpha, including the former Rikliella and Hemicarpha species.
Volkiella, a monotypic taxon from southwestern Africa that grows half buried in the sand, was described as an
intermediate between Cyperus and Lipocarpha, resembling Lipocarpha in having ‘hypogynous scales’ and
Cyperus by its distichously placed ‘glumae’ (Merxmüller & Czech 1953: 318). Hooper (1986) noticed that the

Phytotaxa 166 (1) © 2014 Magnolia Press • 5
LIPOCARPHA & VOLKIELLA AS INFRAGENERIC TAXA OF CYPERUS S.L.
distichy of the ‘glumes’ is not absolute: the lowermost ‘glume’, which subtends a flower, is often at a considerable
angle to others and the spikelet may be curved rather than straight. She also noted that the ‘leathery squamella’ or
adaxial scale is indeed a prophyll, with two hyaline wings partly enveloping the nutlet, while Merxmüller & Czech
(1953) believed this adaxial scale was not comparable with the Lipocarpha spikelet prophyll. Hooper (1986)
concluded that the inflorescence of Volkiella is actually a spike of distichously arranged, highly reduced spikelets.
Both Hooper (1986) and Goetghebeur (1986) considered Volkiella as closely related to Lipocarpha. They
interpreted the Volkiella inflorescence as a spike of one-flowered spikelets, where the distichously placed ‘glumae’
are in fact spikelet bracts, each subtending a spikelet consisting of two hypogynous scales, namely a firm, darkly
coloured prophyll and a glume subtending the single flower (Hooper 1986, Goetghebeur 1986).
Based on morphological data, Van den Borre (1985: 45) presented a hypothesis on the infrageneric
relationships in Lipocarpha. However, until now, no molecular phylogenetic investigations at this level have been
done. Furthermore, it is not clear how Lipocarpha and Volkiella are related to each other and to the other C4
Cyperus taxa. Using molecular phylogenetic data we aim to uncover (1) the relationships between Lipocarpha,
Volkiella and other taxa included in C4 Cyperus taxa, in particular Ascolepis; (2) the infrageneric relationships
within Lipocarpha; and in addition (3), we aim to provide morphological and ontogenetic evidence to test the
affinities deduced from our molecular data. The objective of this paper is to present a new classification for
Lipocarpha and Volkiella as infrageneric taxa of Cyperus. Therefore, in this study, we present new molecular
phylogenetic analyses of Lipocarpha and Volkiella based on sequence data of three molecular markers, the nuclear
ribosomal ETS1f, and the plastid markers rpl32-trnL and trnH-psbA, as well as new morphological and floral
developmental data.
Materials and methods
Plant material and sampling
Out of the 35 Lipocarpha species, 22 were sampled for this study. Appendix 1 lists all taxa included in this study
with voucher information, geographic origin and GenBank accession numbers. Most of the samples for DNA
extraction were collected from herbarium specimens of the Ghent University Herbarium (GENT). Silica gel dried
samples collected in Madagascar and specimens from the Ghent University Botanical Garden were also used.
Additional samples were collected from herbarium material from the United States National Herbarium (US),
Missouri Botanical Gardens (MO) and the National Botanic Garden of Belgium (BR). Where possible, leaf
material was sampled; however, in some cases parts of the culm or the lower involucral bract were used. A total of
41 specimens were newly sampled and used for this study and 27 sequences were used from previous studies by
Larridon et al. (2011a, 2013). The outgroup taxa (Cyperus haspan, C. alternifolius, C. kyllingiella, C. steudneri
(Larridon & Goetghebeur 2013, as C. spiralis, nom illeg. in Larridon et al. 2013b) and C. cuspidatus were chosen
based on the results of previous research in the Cyperus clade (Muasya et al. 2009a, Larridon et al. 2011a, 2013).
DNA extraction
Total DNA was extracted from typically c. 20 mg of dried material using DNeasy Plant Mini Kit (QIAGEN,
Germatown, USA) following the manufacturer’s protocol. The material was first ground using a pestle and a
mortar with the addition of a small amount of sterilised sand. Next, lysis buffer was added. Where necessary, an
alternative protocol was used, transferring the leaf into a collection tube with 0.5 ml lysis buffer. The material was
then ground with a small pestle and stored at 30°C for 12 hours. This method was used when the first procedure
failed.
Markers, PCR amplification, cutting, sequencing and alignments
Based on Larridon et al. (2011a, 2013), a single nuclear marker, ETS1f, and two chloroplast markers, rpl32-trnL
and trnH-psbA, were chosen. PCR was performed in volumes of 25 μl containing a GeneAmp 10× PCR buffer with
100 mM Tris-Hcl, pH 8.3, 500 mM MgCl2, 0.01% (w/v) gelatine (Applied Biosystems), dNTP solution of 10 mM
(5-prime), Taq-polymerase (AmpliTaq® - Applied Biosystems) with 5 U/μl, primer solution with a concentration
of 10 ⎧M, 1 μL bovine serum albumin (BSA) and 2.5 ml of unquantified DNA. For this study, six primers from
previous studies were used and eight new internal primers were developed (see Table 2 for all primers used). PCR

BAUTERS ET AL.6 • Phytotaxa 166 (1) © 2014 Magnolia Press
for ETS1f was performed under the following conditions: initial denaturation (3 min, 94°C) followed by 34 cycles
of melting (30 sec, 94°C), annealing (30 sec, 48°C) and elongation (80 sec, 72°C) and a termination step of 10 min
at 72°C. Thermal cycling parameters for rpl32-trnL and trnH-psbA were an initial denaturation (30 sec, 94°C)
followed by 38 cycles of melting (90 sec, 94°C), annealing (45 sec, 54°C) and elongation (30 sec, 72°C) and a
termination step of 4 min at 72°C. The PCR products were electrophoresed on 1% agarose gels in 1x Tris-acetate-
EDTA (TAE) buffer (pH 8.0) and stained with ethidium bromide to confirm a single product. When two or more
bands showed on the agarose gel, the correct band was cut out by staining DNA in a SYBR® Safe dye-solution
(Life Technologies, California, USA) (1/10000 in 1× TE). For visualising the bands, a light table was built using
the parameters provided by SYBR® Safe. Cut-out fragments were cleaned with Nucleospin Extract II (Macherey-
Nagel, Düren, Germany).
TABLE 2: Primers used in this study
Sequencing was performed using the same primers as in the PCR reactions. Sequencing was run on an Applied
Biosystems ABI 3130XL Genetic Analyser (Life Technologies, California, USA). The chloroplast markers rpl32-
trnL and trnH-psbA were sequenced in both directions while the ETS1F marker was sequenced only in one
direction (18S-R). The sequences were aligned manually in BioEdit 5.0.6. To eliminate ambiguously aligned
positions in the alignment, the online program Gblocks v0.91b (Castresana, 2000) was used. The program was run
with settings allowing for smaller blocks, gaps within these blocks and less strict flanking positions.
Phylogenetic analyses and tree building
Models of DNA sequence evolution were selected with the program MrModeltest 2.3 (Nylander et al. 2008) using
the AIC criterion. For all three individual markers the GTR+GAMMA model was best suited. Bayesian gene tree
analyses were conducted on individual matrices using MrBayes v3.1.2 (Huelsenbeck & Ronquist 2003). Four runs
were conducted for 30,000,000 generations, sampling every 1,000th generation. The results were reviewed in
Tracer v1.5 (Drummond and Rambaut 2007) to check for convergence and to obtain burn-in values. The first 25%
of trees were discarded as burn-in, with remaining trees used to construct a majority rule consensus tree. A
maximum likelihood search and a Rapid Bootstrapping algorithm for 500 replicates were performed on the single
markers with RaxML v7.2.8 (Stamatakis 2006). In RAxML the GTRCAT model is automatically chosen when
using the Rapid Bootstrapping algorithm (Stamatakis 2006, Izquierdo-Carrasco 2011). Resulting trees for Bayesian
analyses and maximum likelihood analyses were visualised in Figtree v1.3.1.
Primer Sequence (5’ to 3’) Source
ETS1f-F CTGTGGCGTCGCATGAGT TG Starr et al. (2003)
18S-R1 CAAACAYCCAATAAGCASTT This study
ETS1f-F2 CGGTTGCCTGTGCKGTCTTACC This study
18S-R AGCAAGCATATGACTACTGGCAGG Starr et al. (2003)
rpl32-F CAGTTCCAAAAAAAGGTACTTC Shaw et al. (2007)
rpl32-F2 TATCTTAGGATTTCAATTACTTA This study
trnL-R1 GCAAAGTTTTTZTCATTTATCTT This study
trnL-R CTGCTTCCTAAGAGCAGCGT Shaw et al. (2007)
Pe-psbA AATGCACACAACTTCCCTCTA Larridon et al. (2011a)
Li-psbA-R1 AAGAACTCATATTACTAAGGATTTT This study
Li-trnH-F2 ATGTCCGYAACCGAARCTCAAAAT This study
Li-psbA-R2 AGAGGATTAATACACTWGATTCTCG This study
Li-trnH-F3 AAAACTGAAAAAATGGAGGAA This study
Pe-trnH ATTCACAATCCACTGCCTTGA T Larridon et al. (2011a)

Phytotaxa 166 (1) © 2014 Magnolia Press • 7
LIPOCARPHA & VOLKIELLA AS INFRAGENERIC TAXA OF CYPERUS S.L.
To estimate a species tree, we used a coalescent-based approach on all three markers. The estimation of a
species tree was performed in *BEAST (Heled and Drummond 2010); this program is implemented in the BEAST
v1.6.2 program package (Drummond and Rambaut 2007). To perform the analyses in *BEAST, species lacking one
of the three markers and represented by only one specimen were removed from the alignment. A BEAST xml file
was generated in BEAUti v1.6.2. In *BEAST, one MCMC chain was run for 30,000,000 generations, sampling
every 3000 generations. The burn-in value was set at 3000, and a majority rule consensus tree was generated from
the remaining trees. Substitution models were the same as in the single marker Bayesian analyses. The species tree
was visualised in FigTree v1.3.1.
For the single marker analyses of rpl32-trnL and trnH-psbA, gaps were coded using the ‘simple indel coding’
method (Simmons & Ochoterena 2000) with the program Indelcoder (Ogden & Rosenberg 2007). All gaps were
checked manually and if necessary, removed from the alignment. Due to the high mutation rate in ETS1F, gaps
were treated as missing data. For the reconstruction of the species tree, indels were considered as missing data and
the indel coding was discarted.
Justification for the use of *BEAST
Research has shown that the common approach of concatenating sequences from multiple genes can generate the
wrong kind of average (Degnan & Rosenberg 2006) and can lead to poor estimation of the species tree. The major
problem with concatenation is that gene trees do not always reflect species relationships well, due to errors in gene
tree estimation, gene paralogy, introgression, and/or deep coalescence (Knowles 2009, Edwards & Rausher 2009,
Driskell et al. 2004). As a consequence, the common practice of concatenation can result in a well supported but
incorrect tree. Concatenation is still a widely used method, but largely because of a lack of alternatives (Heled &
Drummond 2010). *BEAST operates under a Bayesian framework, jointly estimating the posterior distribution of
species trees from the posterior distribution of individual gene trees using a coalescent model. *BEAST allows for
gene tree heterogeneity, attributing gene tree/species tree discordance to deep coalescence. In our study, the single-
locus maximum likelihood analysis revealed different topologies for all three markers. We found this to be enough
evidence to not concatenate the different markers in a supermatrix but to use a species tree approach instead.
Ontogenetic study of Lipocarpha rehmannii and Lipocarpha chinensis
Lipocarpha rehmannii was chosen for floral developmental study based on our own result, in which we find this
species outside of Lipocarpha. This species is also the type of Rikliella. As a true Lipocarpha species to compare
the inflorescence with, L. chinensis, the type of the genus, was chosen. Inflorescences of Lipocarpha rehmannii
and Lipocarpha chinensis were collected in the field (Larridon et al. 2010-320, Madagascar) and subsequently
fixed in FAA (70% ethanol, 100% acetic acid, 40% formaldehyde, 90/5/5). Spikelets and floral buds were dissected
in 70% ethanol under a Wild M3 (Leica Microsystems AG, Wetzlar, Germany) stereo-microscope equipped with a
cold-light source (Schott KL1500; Schott-Fostec LLC, Auburn, NY, USA). The prepared material was washed
twice with 70% ethanol for 5 minutes and then placed in a mixture (1/1) of 70% ethanol and DMM
(dimethoxymethane) for 5 minutes. Subsequently, the material was transferred to 100% DMM for 20 minutes, and
CO2 critical point dried using a CPD 030 critical point dryer (BAL-TEC AG, Balzers, Liechtenstein). The dried
samples were mounted on aluminium stubs using Leit-C and coated with gold with a SPI-ModuleTM Sputter
Coater (SPI Supplies, West-Chester, PA, USA). Images were obtained on a Jeol JSM-6360 (Jeol, Tokyo, Japan) at
the Laboratory of Plant Systematics (K.U. Leuven, Belgium).
Taxonomic and nomenclatural conclusions
We examined a large number (ca. 1500) of herbarium specimens from B, BM, BR, CEBU, GENT, K, L, LISC,
MO, NY, P, SRGH, TA N , UPS, US, WAG and YA (abbreviations according to Holmgren et al., 1900; underlined
herbaria have been visited during this study). Our understanding of the taxa was further supplemented with own
observations in the field, and from collections in the Ghent University Botanical Garden. Additional information
on species and (type) specimens was obtained from literature (incl. protologues) and the databases http://
plants.jstor.org/, http://www.tropicos.org/ and Govaerts et al. (2014). An overview of all published generic and
infrageneric names is available for the Cyperus clade (Huygh et al. 2010, Larridon et al. 2011c, Reynders et al. 2011)
and served as the nomenclatural base for our efforts to construct a modern classification of the taxon Lipocarpha.

BAUTERS ET AL.8 • Phytotaxa 166 (1) © 2014 Magnolia Press
Results
Sequence alignments
The ETS1f alignment included 73 sequences of 469 bases, the rpl32-trnL alignment 64 sequences of 885 bases and
the trnH-psbA alignment 70 sequences of 838 bases. For the *BEAST analysis, the ETS1f alignment included 65
sequences of 472 bases, the rpl32-trnL alignment 62 sequences of 885 bases, and trnH-psbA alignment 65
sequences of 842 bases. For this study no concatenated dataset was created.
Gene tree analyses
The three single-locus maximum likelihood analyses revealed different topologies and bootstrap values (indicated
with asterisks in Fig. 3). For ETS1f, some well-supported clades are found in Lipocarpha (Fig. 3A). These clades
are named as clade 1 to clade 7. In this analysis, Lipocarpha is polyphyletic with the species previously placed in
the genus Rikliella (clade 7) outside Lipocarpha. The core group of Lipocarpha (Lipocarpha s.s) forms a
paraphyletic group with Volkiella disticha included in clade 2 together with L. albiceps and L. comosa. The
position of L. barteri differs greatly from the analyses performed with the chloroplast markers. Here, L. barteri is
sister to clade 3, 4, 5 and 6. Ascolepis is divided in two clades and the species A. protea is clearly paraphyletic.
Relationships between other C4 Cyperus species are poorly resolved with very low bootstrap and posterior
probability support but, as indicated by previous studies, Cyperus cuspidatus is sister to the rest of C4 Cyperus
(Larridon et al. 2011a, 2013).
The rpl32-trnL analysis also resolves Lipocarpha as a polyphyletic genus with a paraphyletic core group (Fig.
3B). The species previously placed in Rikliella are resolved together (clade 7) and are found in the C4 polytomy.
Lipocarpha s.s. can be seen as one group, although support values are low. In this core group, relationships
between different clades are not resolved and some species fall outside these clades e.g. L. hemisphaerica
(Li32hem) and L. constricta. Volkiella disticha is again found in clade 2, which makes this core Lipocarpha group
paraphyletic. Ascolepis is resolved as a monophyletic group comprising two clades and all other C4 Cyperus s.l.
species are found in the C4 Cyperus polytomy.
In the trnH-psbA analyses, only clades 3, 4 and 5 cluster together in a well supported group, while clades 1, 2,
6 and 7 are found in a polytomy with all other C4 Cyperus species (Fig. 3C). The same clades as in ETS1f and
rpl32-trnL are found, although with some differences. Topology within clade 3 differs from the other analyses as
indicated with asterisks. Lipocarpha hemisphaerica is sister to Pycreus polystachyos, which is in contradiction to
other analyses. As is also seen in ETS1f and rpl32-trnL, Volkiella disticha is included in clade 2 of Lipocarpha.
Ascolepis is monophyletic and resolved into two clades with A. protea (As14pro) as sister to the other species.
Other C4 Cyperus species are all found in the large C4 polytomy.
Species tree analysis
The *BEAST analysis resulted in a phylogenetic tree containing 39 species. Lipocarpha is divided into seven
clades (clades 1-7) and is resolved as a polyphyletic genus (Fig. 4). Clade 7, the species previously included in
Rikliella, is not related to Lipocarpha s.s. The core group of Lipocarpha is paraphyletic as the monotypic Volkiella
is included in clade 2 with L. albiceps and L. comosa. Relationships between different clades in the core
Lipocarpha group are well resolved as are most relationships in the clades themselves. Here, Ascolepis contains
only three species, as there was not sufficient data for the other species, and the Ascolepis clade is resolved as sister
genus of Lipocarpha, although weakly supported. Relationships between other C4 Cyperus species are not
supported. Cyperus cuspidatus is found as sister species to all other C4 Cyperus species.
Inflorescence structure and floral development
—Lipocarpha chinensis: The inflorescence is a spike of single-flowered spikelets (Fig. 5A). Each spikelet (Fig.
5A, circled) is subtended by a bract and has a spikelet prophyll and a flower-subtending glume. This structure is
typical of the core group of Lipocarpha.
—Lipocarpha rehmannii (= Rikliella rehmannii (Ridl.) Raynal 1973: 155): The inflorescence in Lipocarpha
rehmannii is here described as a spikelet with a thickened rachilla with spirally arranged glumes (Fig. 5B, Fig. 6).
Rim-like glume primordia originate below the spikelet apex (Fig. 5B). In the axil of each glume, a flower
primordium appears. On the flower primordium, first a single lateral stamen primordium is formed (Fig. 5C). In

Phytotaxa 166 (1) © 2014 Magnolia Press • 9
LIPOCARPHA & VOLKIELLA AS INFRAGENERIC TAXA OF CYPERUS S.L.
some flowers, no stamen primordium is formed. Next, an annular gynoecium wall primordium appears,
surrounding a central meristematic zone from which the single ovule later develops (Fig. 5C). The annular
gynoecium wall develops from the base, forming a bag-like structure around the developing ovule (Fig. 5C, D, F,
G). At this stage, the gynoecium wall and the ovule together form an immature, unilocular, open ovary. Before
closure of the ovary, on the top of the growing gynoecium wall, three stigma primordia appear (Fig. 5D, E, F, G)
which subsequently develop into papillose stigma branches. The ovary is closed when a single style is formed by
the developing gynoecium wall (Fig. 5G, H). Sometimes only two stigma branches are found. The single stamen
primordium develops into a filament and a basifixed, tetrasporangiate, introrse anther with longitudinal slits (Fig.
5D, E). After abscision of the nutlet, no remnants of a spikelet prophyll or glume are present (Fig. 5H).
Table 3 shows a comparison between Lipocarpha chinensis and Lipocarpha rehmannii with for L. rehmannii
the old (lipocarphoid) and new (as genuine Rikliella species) interpretation.
TABLE 3: Comparison between inflorescence of a true Lipocarpha species (L. chinensis) and a Rikliella species (L. rehmannii)
based on floral development of the spikes.
Discussion
Relationships in C4 Cyperus
Within C4 Cyperus, a large polytomy remains. This agrees with previous attempts to resolve the relationships
within C4 Cyperus (e.g. Muasya et al. 2009b, Larridon et al. 2013). We think that with current methods, it is
improbable that the relationships within a fast-radiating taxon can be clarified. Within the resolved part of the
cladogram, the paraphyletic core group of Lipocarpha (Lipocarpha s.s.) is sister to Ascolepis. Although this
relationship is weakly supported, we suggest that the sister relation of Lipocarpha and Ascolepis reflects reality,
based on a previous, not published, concatenated analysis of ETS1f, rpl32-trnL and trnH-psbA (Bauters 2011), and
a study of Muasya et al. (2009b). In the cladogram of Muasya et al. (2009b) and Larridon et al. 2013, the
monotypic Volkiella was also found near Lipocarpha, which is confirmed by our study, with Volkiella is included in
clade 2 of Lipocarpha (Fig. 3, 4). Consequently, Lipocarpha s.s. becomes paraphyletic.
Species formerly placed in Rikliella
The two species, Lipocarpha rehmannii and L. kernii fall outside Lipocarpha s.s. (clade 7). They were previously
placed in the genus Rikliella based on the absence of hypogynous scales (Raynal 1968). This taxon was described
as related to Ascolepis and Lipocarpha.
Our phylogenetic hypothesis supports the inclusion of Hemicarpha in Lipocarpha and indicates that this taxon
arose from the same ancestor as Lipocarpha. In the species formerly included in Hemicarpha, remnants of the
glume are often visible, e.g. in L. micrantha (Goetghebeur & Van den Borre 1989), indicating an origin within
Lipocarpha, as is also confirmed by our phylogenetic analyses. Clade 1 includes most species that were once
described as Hemicarpha.
Character Lipocarpha
Rikliella
Old interpretation New interpretation
Inflorescence Head of several spikes of
spirally arranged spikelets
Head of several spikes of spirally
arranged spikelets
Head of several spikelets of spirally
arranged flowers
Spikelet Single-flowered Single-flowered Multiple spirally arranged flowers
Spikelet prophyll Present Absent Present
Glumes Present (always one) Absent Present (always many)
Flowers per spikelet Always one Always one Always many

BAUTERS ET AL.10 • Phytotaxa 166 (1) © 2014 Magnolia Press
FIGURE 3: MrBayes majority-rule consensus trees with bootstrap values found in the ML analysis (above branch or first number) and posterior probabilities as found in MrBayes (under
branch or second number). A. trnH-psbA chloroplast marker, a black asterisk indicates the different placement of some samples from thos in the rpl32-trnL analyses and a grey asterisk
indicates the differences from ETS1f; B. rpl32-trnL chloroplast marker, a black asterisk indicates the differences from trnH-psbA and a grey asterix indicates the differences with ETS1f;
C. ETS1f nuclear marker, a black asterisk indicates the differences from rpl32-trnL and a grey asterix indicates the differences from trnH-psbA.

Phytotaxa 166 (1) © 2014 Magnolia Press • 11
LIPOCARPHA & VOLKIELLA AS INFRAGENERIC TAXA OF CYPERUS S.L.
FIGURE 4: Estimated species tree with coalescent approaches using two chloroplast markers, trnH-psbA and rpl32-trnL and one
nuclear marker, ETS1F. Lipocarpha is divided in seven clades, as indicated on the figure. All PP values are shown but we only
consider PP values higher then 0.70 as significant. Fig. 4A–E. 3D reconstruction of spikelets (based on Larridon et al. 2013):—A.
Spikelet of clades 3–6, B. Spikelet of clade 2, C. Spikelet of clade 1, D. Spikelet of Ascolepis clade, E. Spikelet of clade 7 (Rikliella
clade). Blue = spikelet bract; pink = prophyll; yellow = glume; red = nutlet.
FIGURE 5: SE micrographs of floral ontogeny. Lipocarpha chinensis:—A. Apical view of the rachilla apex with one spikelet circled.
Lipocarpha rehmannii:—B. Glume primordia subtending floral primordia circled; C. A developing flower with a glume, gynoecium
wall primordium and ovule and stamen primordia; D. Apical-abaxial view of different developmental stages of the flowers, the
growing gynoecium wall and stigma primordia are visible; E. A developing stamen and gynoecium wall with 3 stigma branches; F.
Two different stages of ovary wall development with 3 stigma primordia (circled); G. Apical-abaxial view of a semi-mature flower,
developing stigmas are encircled; H. Glume with the scar of the abscised nutlet circled.
Abbreviations: a: anther; f: filament; F: floral primordium; G: glume (primordium); o: ovule (primordium); ov: gynoecium wall
(primordium); P: prophyll; s: stamen (primordium); sg: stigma (primordium); st: style; *: rachilla apex.

BAUTERS ET AL.12 • Phytotaxa 166 (1) © 2014 Magnolia Press

Phytotaxa 166 (1) © 2014 Magnolia Press • 13
LIPOCARPHA & VOLKIELLA AS INFRAGENERIC TAXA OF CYPERUS S.L.
Rikliella, however, is not nested in Lipocarpha s.s. Moreover, our developmental data on the inflorescence of
L. rehmannii (the type species of Rikliella) show evidence to exclude L. rehmannii from the Lipocarpha clade (Fig.
5B–H). No remnant of a spikelet prophyll nor a glume subtending a flower are visible (Fig. 5H). Such rudiments
would be expected if L. rehmannii truly evolved from a lipocarphoid ancestor (Fig. 6B). Consequently, for L.
rehmannii, and probably also for L. kernii (its development was not examined in detail in this study), it is now more
parsimonious to assume that the reduced spikelets actually are flowers, each subtended by a glume (Fig. 6A).
Consequently, the inflorescence unit consists of a single spikelet with spirally arranged glumes, each subtending a
flower (Fig. 5E, 6A). These glumes resemble the spikelet bracts of core Lipocarpha, but they are in fact different
structures. The glumes of the spikelet of these species have a strongly developed mucro (Fig. 7W, X), a character
which is shared with other C4 Cyperus species. Probably, this character is ancestral for the C4 Cyperus clade
(Larridon et al. 2013). Since spikelets with spirally arranged glumes originated several times in the Cyperus clade,
‘spiral glume arrangement’ is no longer considered valid for generic delimitation (Muasya et al. 2009b; Larridon et
al. 2011b, 2013).
FIGURE 6: A. New interpretation of the inflorescence of Lipocarpha rehmannii inflorescence. The inflorescence consists of a
spikelet of spirally arranged glumes each subtending a flower. B. Old interpretation of the Lipocarpha rehmannii inflorescence
(Goetghebeur & Van den Borre 1989). In that interpretation, the inflorescence consists of a spike of highly reduced spikelets with each
spikelet subtended by a spikelet bract (blue). Near the base of the nutlet, remnants of a prophyll and glume can be found. Blue =
spikelet bract; pink = prophyll; yellow = glume; red = nutlet.
Relationships in Lipocarpha s.s.
Relationships in Lipocarpha s.s. are well resolved in our phylogenetic species tree and we can distinguish six
clades.
Clade 1 is sister to all other clades and consists of four species: L. micrantha, L. occidentalis, L. aristulata, and
L. drummondii (Fig. 4). These species were previously placed in Hemicarpha based on the reduction of the glume.
The absence of the glume in the spikelet is a synapomorphic character for this clade. All species in this clade are
also characterized by two style branches. Clade 1, however, is not totally equivalent with Hemicarpha since
Lipocarpha hemisphaerica is absent from this clade. This species has a normal lipocarphoid inflorescence with a
spikelet prophyll and flower-bearing glume and 3 style branches. In our species tree it is found in clade 5. All
species in clade 1 are small annuals with pseudolateral, ovoid to spherical inflorescences. Their habit (Fig. 2D), the
shape of the spikelet bract (obovate to obtrullate) and nutlets (obovate and rounded on cross section) are similar
(Fig. 7A–D). Goetghebeur & Van den Borre (1989) already considered these species to be related, with the

BAUTERS ET AL.14 • Phytotaxa 166 (1) © 2014 Magnolia Press
reduction of the glume as a synapomorphy (Fig. 4C). In L. micrantha, the prophyll is reduced or absent, a character
also found in the probably closely related L. schomburgkii (Goetghebeur & Van den Borre 1989). All species from
clade 1 occur in the New World with the exception of L. micrantha which also rarely occurs on mainland Africa.
Thus far, it is the only Lipocarpha species occurring in both America and mainland Africa. However, no African
specimen was available for this study.
FIGURE 7: Shape of spikelet bracts of Lipocarpha species used in this study (modified from Goetghebeur & Van den Borre 1989).
Bars: 1mm. A–D. Clade 1:—A. L. aristulata, B. L. drummondii, C. L. micrantha, D. L. micrantha; E–G. Clade 2:—E. L. albiceps, F.
L. comosa, G. Volkiella disticha; H–N. Clade 3:—H. L. microcephala, I. L. filiformis, J. L. cf. filiformis, K. L. salzmannina, L. L.
maculata, M. L. prieuriana, N. L. species; O–P. Clade 4:—O. L. leucaspis, P. L. nana; Q–T. Clade 5:—Q. L. hemisphaerica, R. L.
chinensis, S. L. constricta, T. L. mexicana (Madagascar); U–V. Clade 6:—U. L. barteri, V. L. humboldtiana; W–X. Clade 7 (flower-
bearing glumes instead of spikelet bracts!):—W. L. kernii, X. L. rehmannii.
Abbreviations: ap: apical part of spikelet bract; bp: basal part of spikelet bract.
Clade 2 consists of three species: L. albiceps, L. comosa, and Volkiella disticha, and is sister to clades 3 – 6
(Fig. 4). The morphology of Lipocarpha albiceps and L. comosa corroborates that they are related. In both species,
the bases of the spikelet bracts have the same purplish colour and they are the only two species with confluent
spikes. Moreover, both species have a firm spikelet prophyll, in contrast to the thin hyaline spikelet prophylls found

Phytotaxa 166 (1) © 2014 Magnolia Press • 15
LIPOCARPHA & VOLKIELLA AS INFRAGENERIC TAXA OF CYPERUS S.L.
in other Lipocarpha species. Volkiella disticha is an unexpected member of this clade, having distichously arranged
spikelet bracts. However, as in Lipocarpha, each spikelet has a spikelet prophyll and a glume, subtending a flower.
Also, the spikelet prophyll and glume are smaller than the spikelet bract as in the two other species. Consequently,
Volkiella can be seen as a highly evolved step in the Lipocarpha lineage. Distichous arrangement of the spikelets
may be a secondary, extreme adaptation to protect the flowers from desiccation and sand damage (Hooper 1986).
As in L. albiceps and L. comosa, at maturity of the inflorescence, the proximal part of the rachilla including the
prophyll remains fixed on the rachis, the distal part of the rachilla being caducous (Fig. 4B). The presence of this
rigid prophyll is a synapomorphic character for clade 2. Based on Goetghebeur & Van den Borre (1989), we
suggest that L. comosa evolved from a L. albiceps-like ancestor, possibly due to the atypical ecological preferences
of L. comosa (e.g. “more resistant to droughts than other Lipocarpha species” (Van den Borre, 1985: 62)). Spikelet
bracts are depicted in Fig. 7 (E–G).
The next branch contains a group with clade 3, 4, 5 and 6. Species from these clades share the true lipocarphoid
morphology with dehiscent spikelets and presence of a spikelet prophyll and flower-bearing glume.
Clade 3 is sister to the other clades and includes seven species in our study, L. filiformis, L. cfr. filiformis, L.
crassicuspis, L. prieuriana, L. maculata, L. salzmanniana and L. microcephala. All species in this clade are tufted
annuals with terminal inflorescences with flowers with a single stamen, except L. microcephala, a species with
flowers with sometimes two stamens. Lipocarpha microcephala is sister to all other species in clade 3 and it is
found in Australia and Asia. Only Australian specimens were included in this study. Next, we find a subclade with
L. maculata and L. salzmanniana, two American species. Lipocarpha maculata only occurs in the USA while L.
salzmanniana is found from Mexico to Brazil. Both species are characterised by rather slender obovate spikelet
bracts (Fig. 7K, L), which are slightly broader shouldered in L. salzmanniana (Fig. 7K). In both species, the apical
part of the spikelet bract (Fig. 7A: ap) is acuminate, although much shorter in L. salzmanniana. The nutlet of both
species is slightly constricted at the base, a character also found in L. filiformis and L. mexicana. Since this
constriction is also found in L. constricta this is probably not a good character to identify species and it probably
arose multiple times independently. Next we find L. prieuriana and L. crassicuspis, both species easily recognised
by their broadly obovate, dorsiventrally flattened fruit. The species are very similar and we can clearly understand
why Raynal (1967) described L. crassicuspis as a variety of L. prieuriana (L. prieuriana var. crassicuspis).
Lipocarpha prieuriana (Fig. 2C) has a broadly obovate spikelet bract with a very small apical part (0.1–0.25 mm)
which is shortly rounded, while L. crassicuspis has a broadly obovate to obtrullate spikelet bract with a more
pronounced and conspicuously thickened apical part (Fig. 7M, N). Both L. prieuriana and L. crassicuspis occur in
the Sudano-Zambesian region. The last branch in clade 3 bears two species, L. filiformis and L. cf. filiformis with L.
filiformis occurring on mainland Africa while L. cf. filiformis (Li56mex) is found in Mexico. This Mexican
specimen was labeled in the herbarium (GENT) as L. mexicana but based on its morphology, this is a wrong
determination. The specimen mostly resembles L. filiformis, which agrees with our phylogenetic analyses.
However, no records are known for L. filiformis outside Africa, hence the name L. cf. filiformis. As a consequence,
the specimen might be the first known American L. filiformis, or otherwise a new species. However, we do not
have enough data to investigate this hypothesis. The Mexican specimen and L. filiformis both are tufted annuals
with terminal inflorescences and obovate to obtrullate spikelet bracts with a pale to greenish midnerve. The apical
parts of the spikelet bracts (Fig. 7I, J) are shortly acuminate to triangular. As in L. salzmanniana and L. maculata,
L. filiformis and L. cf. filiformis have a basally slightly constricted nutlet.
Clade 4 consists of two species, L. leucaspis and L. nana both occurring on mainland Africa with L. nana also
in Madagascar (Fig. 2B). Lipocarpha leucaspis is sometimes hard to distinguish from well-developed specimens of
L. nana. However, L. nana has a spikelet bract with an apical part longer than the length of the spikelet, and its
mucro is more recurved (Fig. 7P). In L. leucaspis, the shoulders of the spikelet bracts are more pronounced with a
creamy coloured central band (Fig. 7O).
Clade 5 consists of four species: L. chinensis, L. hemisphaerica, L. mexicana (Madagascar) and L. constricta.
It is an all-African clade apart from L. Mexicana. Lipocarpha mexicana is a species from both America and
Madagascar (Goetghebeur & Van den Borre 1989). Morphologically plants from the two regions do not differ.
Unfortunately, we don’t have any sequences of American samples of L. mexicana, so we cannot make any
conclusion on whether this is one true species or maybe two cryptic ones. In clade 5, L. constricta and L. chinensis
have strikingly similar apical parts of the spikelet bracts, which are shortly rounded to apiculate (Fig. 7R, S). The
phylogenetic position of L. hemisphaerica is doubtful since its topology is different in every single marker

BAUTERS ET AL.16 • Phytotaxa 166 (1) © 2014 Magnolia Press
analysis. It differs from the other species in this clade by having pseudolateral inflorescences, a character also
found in L. monostachya Gross & Mattfeld (1938: 189) and L. thermalis Raynal ex Goetgh. (Goetghebeur & Van
de Borre 1989: 73) (neither included in this study). The relationship between L. chinensis and L. mexicana is
corroborated by their morphology. Based on the similar morphology of the nutlets and bracts subtending the
spikelets, we suggest that L. robinsonii (not included in the cladogram) is also related to clade 5, since the shape of
its nutlets and the spikelet bracts match those of L. constricta and L. chinensis.
The last clade, clade 6, consists of two species: L. barteri and L. humboldtiana, with the formeroccurring on
mainland Africa and the latter restricted to Central and South America. Both are tufted perennials with rather thick
roots (up to 1mm in diameter) and long stems. Leaves are slightly inrolled with blade length up to 30 cm or longer.
Spikelet bracts are obovate to obtrullate with a long, acuminate and recurved apical part in L. barteri and a long,
apiculate apical part in L. humboldtiana (Fig. 7U, V). Both have broadly shouldered spikelet bracts that vary from
pale to dark brown.
Conclusions
Molecular phylogenetic analyses supported by morphological and floral developmental data reveal that
Lipocarpha s.l. is a polyphyletic taxon. Two species previously placed in the genus Rikliella are not related to
Lipocarpha s.s. The core group, Lipocarpha s.s., becomes paraphyletic because of the inclusion of Volkiella
disticha. In Lipocarpha s.s., six morphologically distinct clades are found. Furthermore, Lipocarpha s.l. is nested
in Cyperus s.l. and is therefore included in this genus (see Taxonomic and Nomenclatural Conclusions) as was
already done for some of the other segregate genera of Cyperus. Our floral developmental data for Lipocarpha
rehmannii confirms the position of this species outside the core Lipocarpha group. The inflorescence of this
species should be interpreted as a true spikelet with spirally arranged glumes each subtending a flower.
Taxonomic and nomenclatural conclusions
Here, new combinations and names for Lipocarpha and Volkiella species and a new infrageneric classification in
Cyperus are published. Lipocarpha (including Volkiella but excluding Rikliella) is divided into three separate
sections and two subsections based on the seven clades found in our phylogenetic hypotheses. Based on our results,
the species formerly included in the genus Rikliella are not part of Lipocarpha. These species form a distinct clade
at the base of C4 Cyperus. They can be distinguished by the spirally arranged glumes and the spadix-like rachilla.
Therefore, we propose a new sectional name in Cyperus for these species. Regarding species not included in the
molecular phylogeny, we suggest a classification but they are placed between parentheses. Of all 35 Lipocarpha
species, herbarium material was studied, so these suggestions are based on own observations (all observed
specimens are cited for these species) and on the work of Goetghebeur & Van den Borre (1989).
Sectional divisions of the Lipocarpha and Volkiella clade in Cyperus s.l.
Cyperus sect. Neohemicarpha Bauters, sect. nov. Ty pe: Cyperus subsquarrosus (Muhl.) Bauters.
Description:—Species in this section are all tufted annuals, occurring in America with only Cyperus
subsquarrosus also occurring scattered into Africa. They are characterized by a pseudolateral inflorescence, the
presence of a spikelet prophyll and the absence of the flower-bearing glume, two style branches and an obovate
nutlets, rounded on cross section. In Cyperus subsquarrosus, the prophyll is reduced or sometimes absent.
Species included in this section:—Cyperus aristulatus, Cyperus hemidrummondii, Cyperus hemioccidentalis,
Cyperus subsquarrosus, (Cyperus schomburgkii1).
1Specimen studied: Schomburgk 657 (L!); Davidse & Gonzales 12249A, 12499, 12564, 12576 (MO!), Agostini
1516 (MO!, U!, US!)
Cyperus sect. Volkiella (Merxm. & Czech) Bauters, comb. nov.
Basionym: Volkiella Merxm. & Czech (1953: 318). Type: Volkiella disticha Merxm. & Czech.

Phytotaxa 166 (1) © 2014 Magnolia Press • 17
LIPOCARPHA & VOLKIELLA AS INFRAGENERIC TAXA OF CYPERUS S.L.
Description:—Species in this section are annual or perennial herbs, occurring in West-, Central- and East-
Africa. They are characterized by a terminal inflorescence with distichously or spirally arranged spikelet bracts, the
presence of spikelet prophyll and flower-bearing glume, 3 style branches and obovate nutlets, rounded trigonous on
cross section. All species have mostly dark, firm prophylls that remain on the rachilla.
Species included in this section:—Cyperus distichus, Cyperus lipocomosus, Cyperus purpureoluteus,
(Cyperus echinus1).
1Specimen studied: Robinson 1550 (holotype NY!)
Cyperus subsect. Volkiella (Merxm. & Czech) Bauters, comb. nov.
Basionym: Volkiella Merxm. & Czech (1953: 318). Type: Volkiella disticha Merxm. & Czech.
Description:—This monotypic subsection is characterized by the subdistichously arranged spikelet bracts,
which is a rare character for the Lipocarpha clade. The only species in this subsection, Volkiella disticha, is a small
annual from the northeast of Namibia.
Species included in this subsection:—Cyperus distichus.
Cyperus subsect. Comosi Bauters, subsect. nov. Type: Lipocarpha comosa J.Raynal.
Description:—Species in this subsection are tufted perennials, occurring in West-, Central- and East-Africa.
They are characterized by a terminal inflorescence with confluent spikes. Both spikelet prophyll and flower bearing
glume are present. All species have mostly dark, firm prophylls that remain on the rachilla after the nutlets have
fallen.
Species included in this subsection:—Cyperus lipocomosus; Cyperus purpureoluteus; (Cyperus echinus1).
1Specimen studied: Robinson 1550 (holotype NY).
Cyperus sect. Lipocarpha (R.Br.) Bauters, comb. nov.
Basionym: Lipocarpha R.Br. in J.H.Tuckey (1818: 459). Type: Lipocarpha argentea (Kunth) R.Br.
Description:—Species in this section are annuals or tufted perennials, occurring in tropical and subtropical
areas of Africa, America, Asia and Australia. They are characterized by a terminal inflorescence with clearly
separated spikes. Both spikelet prophyll and flower-bearing glume are present but reduced and hyaline, both falling
off with the maturing nutlet.
Species included in this section:—Cyperus constrictus, Cyperus crassicuspis, Cyperus isolepis, Cyperus
leptocarpus, Cyperus leucaspis, Cyperus lipocarpha, Cyperus lipofiliformis, Cyperus lipomexicanus, Cyperus
liporobinsonii, Cyperus neobarteri, Cyperus neotropicalis, Cyperus persquarrosus, Cyperus prieurianus, Cyperus
salzmannianus, Cyperus sellowianus, (Cyperus abietinus1), (Cyperus ceylanicus2), (Cyperus lipoater3), (Cyperus
lipomonostachyus4), (Cyperus lipopygmaeus5), (Cyperus lipothermalis6), (Cyperus perspicuus7), (Cyperus
raynalianus8), (Cyperus reddyi9).
1Specimens studied: Berhaut 3066 (P!), Bokdam 2877 (BR!, K!, MO!, WAG!), Raynal 21050 (P!), Aké Assi
10751 (K!), Tisserant 1188 (BM!, P!), Audru 1423 (P!), Raynal 10643 (P!), Overlaet 391 (BR!), Reekmans 9749
(BR!, BRVU!, GENT!, LG!), Peter 37325 (B!), Faulkner 16B (LISC!), Biegel & Gibbs 3891 (K!, LISC!, MO!,
SRGH!).
2Specimens studied: Clarke 34451A (G!, K!), Govindarajalu 5362 (L!), Hooper & Gandhi 2384 (K!, MO!,
US!), Mooney 3636 (K!, L!, NY!), Koyama 13998 (C!, K!, NY!), Thwaites 3759 (BM!, BR!, G!, K!, LE!, P!),
Thein Lwin 405 (K!, L!), Put 4294 (BM!, K!, L!).
3Specimens studied: Vollesen 4454 (C!, K!, WAG!), Barbosa & Moreno 12474 (COI!, LISC!), Milne-Redhead
3841 (BM!, BR!, K!, L!, MO!, NY!, P!), Robinson 1463 (BR, K, NY, SRGH), Miller 4335 (K!, NY!, SRGH!),
Tinoco 33 (LISC!).
4Specimens studied: Germain 6267 (BM!, BR!), Greenway & Polhill 11672 (BRVU!, K!, LISC!), Milne-
Redhead & Taylor 9798A (K!), Peter 34123c (B!), Peter 34242b, 34335, 45804b, 34898b, 34934e, 45915b (B!),
Polhill & Paulo 2006 (K!), Schlieben 6399 (BM!, BR!, G!, GENT!, M!, P!, isotype Z!), Stefanescu 437 (K!),
Pawek 14342B (K!), Robinson 4530 (M!, MO!, NY!, SRGH!), Brain 3632 (COI!, MO!), Brain 3713 (SRGH!).
5Specimens studied: Wallace 9211 (BM!, C!, K!, L!), Kerr 2749 (BM!, K!), van Steenis 19587 (K!, L!), Wallich
s.n. (K!).
6Specimen studied: de Witte 5199 (holotype BR!).

BAUTERS ET AL.18 • Phytotaxa 166 (1) © 2014 Magnolia Press
7Specimen studied: Milne-Redhead 4039 (holotype K!).
8Specimens studied: Govindarajalu 5985, 5988, 6070 (L!).
9Specimens studied: Gamble 21559B (K!), Reddy 1232 (holotype K!), Reddy & Rajagopal 219 (K).
Cyperus sect. Rikliella (J.Raynal) Bauters, comb. nov.
Basionym: Rikliella J.Raynal (1973: 154). Type: Rikliella rehmannii (Ridl.) J.Raynal.
Description:—Species in this section are all tufted annuals, occurring in tropical Africa (and Madagascar),
India and from China to Vietnam. All species are characterized by terminal spikelets with spirally arranged flower-
bearing glumes. The glumes have a long apical mucro (sometimes recurved).
Species included in this section:—Cyperus hystricoides, Cyperus kernii, (Cyperus neochinensis1).
1Specimens studied: Hance 10152 (K!, P!, S!), Drummond 24977 (K!), Gamble 20197 (K), Helfer 144 (BR!,
C!, G!, L!, NY!, P!), Fosberg 50711 (NY), Koyama 13373 (K!, NY!), Thwaites 854 (G!, K!, P!), Meebold 14708
(B!), Wallace 9233 (K!, L!), Kerr 2244 (K!), Samarensen 5900 (C!), Smitinand 3861 (L!), Couderc s.n. (K!),
Evrard 130 (P!), Kuntze 3594 (NY!), Sinclair 9369 (K!, L!), 39292 (K!, L!, P!), Purseglove 4047 (K!, L!).
New specific names in Cyperus s.l.
(1) Cyperus abietinus (Goetgh.) Bauters, comb. nov.
Basionym: Lipocarpha abietina Goetgh., Wageningen Agric. Univ. Pap. 89 (1): 19 (Goetghebeur 1989). Type:—BURUNDI. 6
June 1952, Michel 2487 (holotype BR0000005577781!, isotypes K!, MO!, NY!).
Synonym:—Lipocarpha triceps var. latinux Kükenthal (Peter & Kükenthal 1936: 123). Type:—TANZANIA. 1926, Peter
37325 (holotype B100166791!).
Description:—Goetghebeur & Van den Borre (1989: 19).
(2) Cyperus aristulatus (Coville) Bauters, comb. nov.
Basionym: Hemicarpha micrantha var. aristulata Coville, Bull. Torrey Bot. Club 21: 36 (Coville 1894). ≡ Hemicarpha
aristulata (Coville) Smyth (1899: 163). ≡ Hemicarpha aristulata (Coville) Nelson (1902: 400), comb. superfl. ≡
Lipocarpha aristulata (Coville) Tucker (1987: 410). Type:—USA. Texas, 1888, G.C. Neally s.n. (holotype US!).
Synonym:—Hemicarpha intermedia Piper (1901: 36). Type:—USA. Washington: collector unknown s.n. (not located).
Description:—Goetghebeur & Van den Borre (1989: 23).
(3) Cyperus ceylanicus T.Koyama (1960: 438)
Basionym: Hypaelyptum sphacelatum Vahl, Enum. Pl. Obs. 2: 283 (Vahl 1805) ≡ Lipocarpha sphacelata (Vahl) Kunth (1837:
267), non Cyperus sphacelatus Rottbøll (1773: 26). Syntypes:—INDIA. 1774, Koenig s.n. (BM000959103,
BM000959098, C); Rottler s.n. (C, LE, M).
Synonyms:—Hypolytrum gracile Richard (1805: 70) ≡ Lipocarpha gracilis (Rich.) Nees (1834c: 287). Type:—INDIA.
Collector unknown (holotype P)
Tunga triceps Roxburgh (1820: 183) ≡ Hypolytrum triceps (Roxb.) Dietrich (1832: 363) ≡ Lipocarpha triceps (Roxb.) Nees
(1834b: 92), non Cyperus triceps Endlicher (1842: 94). Type:—INDIA, Roxburgh s.n. (holotype K!, isotypes BM, G, L,
LE, P!).
Scirpus monander Willdenow (1797: 311) nom. illeg., non Scirpus monander Rottbøll (1773: 50).
Lipocarpha sphacelata var. gracilis (Rich.) Boeckeler (1871: 116) nom. nud., non Cyperus gracilis Brown (1810: 213).
Hypolytrum ceylanicum Heyne ex Nees (1834a: 288) nom. nud.
Description:—Goetghebeur & Van den Borre (1989: 69).
(4) Cyperus constrictus (Goetgh.) Bauters, comb. nov.
Basionym: Lipocarpha constricta Goetgh., Wageningen Agric. Univ. Pap. 89 (1): 31 (Goetghebeur 1989). Type:—BURUNDI.
Prov. Muramvya: Kisozi, 1950m, 3 April 1980, M. Reekmans 8801 (holotype BR0000006592813!, isotypes
BJA292045829!, BRVU!, GENT!, K000416377!, LG0000090029196!, WAG0000921!).
Description:—Goetghebeur & Van den Borre (1989: 31).
(5) Cyperus crassicuspis (J.Raynal) Bauters, comb. nov.
Basionym: Lipocarpha prieuriana var. crassicuspis J.Raynal, Adansonia, n.s., 7: 86 (Raynal 1967) ≡ Lipocarpha crassicuspis
(J.Raynal) Goetghebeur (1989: 32). Type:—SENEGAL. 1960, J.&A. Raynal 6711 (holotype P!).
Description:—Goetghebeur & Van den Borre (1989: 32).

Phytotaxa 166 (1) © 2014 Magnolia Press • 19
LIPOCARPHA & VOLKIELLA AS INFRAGENERIC TAXA OF CYPERUS S.L.
(6) Cyperus distichus (Merxm. & Czech) Bauters, comb. nov.
Basionym: Volkiella disticha Merxm. & Czech, Mitt. Bot. Staatssamml. München 8: 318 (Merxmüller & Czech 1953). Type:—
NAMIBIA. Runtu, 7 May 1935, Volk 1815 (holotype M0106928!, isotypes BR0000008638748!, K000416390!,
M0106927!, P00466102!, PRE0586700-0!, PRE0101779-0!).
Description:—Merxmüller & Czech (1953: 318).
(7) Cyperus echinus (J.Raynal) Bauters, comb. nov.
Basionym: Lipocarpha echinus J.Raynal, Adansonia, n.s., 13: 159 (Raynal 1973). Type:—ZAMBIA. Chinsali district, 2 June
1956, E.A. Robinson 1550 (holotype NY!, isotype K).
Description:—Goetghebeur & Van den Borre (1989: 34).
(8) Cyperus hemidrummondii Goetgh., nom. nov.
Basionym: Hemicarpha drummondii Nees in C.F.P.von Martius & auct. suc. (eds), Fl. Bras. 2(1): 62 (Nees 1842) ≡
Hemicarpha subsquarrosa var. drummondii (Nees) Gray (1856: 495) ≡ Hemicarpha micrantha var. drummondii (Nees)
Friedland (1941: 860) ≡ Scirpus micranthus var. drummondii (Nees) Mohlenbrock (1963: 22) ≡ Lipocarpha drummondii
(Nees) Tucker (1987: 410), non Cyperus drummondii Torrey & Hooker (1836: 437). Type:—USA. Missouri: 1832,
Drummond s.n. (holotype K000815768!).
Description:—Goetghebeur & Van den Borre (1989: 32).
(9) Cyperus hemioccidentalis Goetgh., nom. nov.
Basionym: Hemicarpha occidentalis A.Gray, Proc. Amer. Acad. Arts 7: 391 (Gray 1868) ≡ Scirpus occidentalis (Gray) Clarke
(1908: 30), nom. illeg. ≡ Lipocarpha occidentalis (Gray) Tucker (1987: 410), non Cyperus occidentalis Torrey (1836:
259). Type:—USA. California, Yosemite Valley, 1866, H.N. Bolander 6223 (holotype GH00027881!, isotypes
BM001042116!, BM001042117!, G, GH00027880!, K!, LE, MO!, NY00051219!, NY00051247!, NY00051216!,
NY00051218!, US00086753!, YU001011!, YU001012!).
Description:—Goetghebeur & Van den Borre (1989: 58).
ȋͳͲȌCyperus hystricoides (B.Nord.) Bauters, comb. nov.
Basionym: Scirpus hystricoides B.Nord., Dinteria 11: 55 (Nordenstam 1974: 55). Type:—NAMIBIA. Distr. Omaruru,
Brandberg, between Königstein and upper Tsisab, 1900m, 31 May 1963, B. Nordenstam 2836 (holotype S-G-6818!,
isotype M0106969!).
Synonyms:—Scirpus rehmannii Ridley (1884: 159) ≡ Isolepis rehmannii (Ridl.) Lye (1971: 479) ≡ Rikliella rehmannii (Ridl.)
Raynal (1973: 155) ≡ Lipocarpha rehmannii (Ridl.) Goetghebeur (1989: 64), non Cyperus rehmannii Boissier (1882: 364).
Syntypes:—SOUTH AFRICA. Natal; Griffins Hill (Eastcourt), 1875-1880, Rehmann 7305 (BM000922668!,
K000416389!); SOUTH AFRICA. Natal; Griffins Hill (Eastcourt), 1875, Rehmann 7315 (K000416388!, Z); ANGOLA.
Lopollo, 1860, Welwitsch 6771 (BM000922667!, BM000922666!, LISU).
Description:—Goetghebeur & Van den Borre (1989: 64).
(11) Cyperus isolepis (Nees) Bauters, comb. nov.
Basionym: Hemicarpha isolepis Nees, Edinburgh New Philos. J. 17: 263 (Nees 1834a) ≡ Scirpus isolepis (Nees) Boeckeler
(1870: 498) ≡ Lipocarpha isolepis (Nees) Haines (Haines & Lye 1971: 476). Type:—INDIA. Peninsula Ind. orientalis,
1856, R. Wight s.n. (holotype not located, isotypes C, G00191774!, K!, LE!, NY!).
Synonyms:—Isolepis minima Schrader (1821: 2068), non Cyperus minimus Linnaeus (1753: 44). Type:—SOUTH AFRICA,
Heyne s.n. (not located).
Scirpus hemisphaericus Roth (1821: 29) ≡ Isolepis hemisphaerica (Roth) A.Dietrich (1832: 109) ≡ Lipocarpha hemisphaerica
(Roth) Goetghebeur (1989: 37). non Cyperus hemisphaericus Boeckeler (1859a: 436). Type:—INDIA. Heyne s.n.
(holotype B).
Hemicarpha schraderi Kunth (1837: 268). Type: not located.
Hemicarpha schraderiana Nees, in Martius (1842: in obs.). Type: not located.
Hemicarpha senegalensis Steudel (1855: 130). Type:—SENEGAL. In humidis, Saint Louis, February 1827, Leprieur 39
(holotype P00758105!, isotypes NY00051220!, P00462786!, P00462787!, P00462788!).
Isolepis bellula Steudel (1855: 318). Type:—INDIA. Bengal, Griffith s.n. (holotype P, isotypes G, NY00051252!) .
Lipocarpha rautanenii Boeckeler ex Schinz (1890: 179). Type:—NAMIBIA. Rautanen 2 (holotype Z).
Lipocarpha monocephala Turrill (1913: 307). Type:—ZIMBABWE. Victory falls, 1524m, April 1909, Rogers F.A. 6024
(holotype K000416384!).
Scirpus setaceus var. monander Willdenow ex Kunth (1837: 268), nom. nud. in syn. Authentic specimen: Willdenow 1198a (B-
W).
Scirpus minimus Willd. ex Kunth (1837: 268), nom. nud. in syn.

BAUTERS ET AL.20 • Phytotaxa 166 (1) © 2014 Magnolia Press
Description:—Goetghebeur & Van den Borre (1989: 37).
(12) Cyperus kernii (Raymond) Bauters, comb. nov.
Basionym: Scirpus kernii Raymond, Naturaliste Canad. 86: 230 (Raymond 1959) ≡ Isolepis kernii (Raymond) Lye (1971: 479)
≡ Rikliella kernii (Raymond) J.Raynal (1973: 155) ≡ Lipocarpha kernii (Raymond) Goetghebeur (1989: 42). Type:—
SENEGAL. Siminti, 12 January 1954, Berhaut 4692 (holotype MT, isotype P!).
Description:—Goetghebeur & Van den Borre (1989: 42).
(13) Cyperus leptocarpus (F.Muell.) Bauters, comb. nov.
Basionym: Scirpus leptocarpus F.Muell., Trans. Philos. Soc. Victoria 1: 109 (Mueller 1855). Syntypes:—AUSTRALIA.
Victoria, On the rocky banks of watercourses between Mayday hills and the Ovens [River], February 1853, F. von Mueller
s.n. (MEL69134!). AUSTRALIA. Victoria. In locis madidis subarenosis glareosisve fl. King [= King River], 11 March
1853, F. von Mueller s.n. (MEL69136!).
Synonyms:—Hypaelyptum microcephalum Brown (1810: 220) ≡ Lipocarpha microcephala (R.Br.) Kunth (1837: 268), non
Cyperus microcephalus Brown (1810: 215). Type:—AUSTRALIA. Arnhem Bay Point, 6 February 1803, R. Brown 5986
(holotype BM000990979!).
Kyllinga squarrosa Steudel (1855: 68) nom. illeg., non Cyperus squarrosus Linnaeus (1756: 6). Type:—INDONESIA. Bourou,
Labillardière s.n. (holotype P, isotypes BM000959108!, G).
Ascolepis kyllingioides Steudel (1855: 105) ≡ Lipocarpha zollingeriana Boeckeler (1859b: 100-101) nom. illeg. ≡ Cyperus
zollingerianus (Boeckeler) Koyama (1960: 438). Non Cyperus kyllingioides Vahl (1805: 312). Type:—INDONESIA.
Java, Makassar ins. Celebes, 7 June 1847, Zollinger 3287 (holotype P, isotypes BM000959109!, BR0000006596637!,
G00191771!, G00191770!, L).
Scirpus dietrichiae Boeckeler (1875: 109) ≡ Scirpus squarrosus var. dietrichiae (Boeckeler) Bentham (1878: 329). Type:—
AUSTRALIA, Queensland, Rockhampton, A.Dietrich 601 (holotype B, isotypes B, BM000990980!, BRI-AQ0341441!,
L, MASS00319753!, MEL2297594!, MO-2114767!, WAG, Z).
Rikliella australiensis Raynal (Govindarajalu & Raynal 1976: 220). Type:—AUSTRALIA. 1962, H.S. McKee 9504 (holotype
P, isotypes BRI, K, NSW).
Description:—Goetghebeur & Van den Borre (1989: 52).
(14) Cyperus leucaspis (J.Raynal) Bauters, comb. nov.
Basionym: Lipocarpha leucaspis J.Raynal, Bull. Mus. Natl. Hist. Nat., II, 41: 978 (Raynal 1970). Type:—BURUNDI. Ruyigi,
Kininya, Kininya Mosso Urundi, 10 July 1952, Michel 3338 (holotype BR0000008639554!, isotypes K000416379!,
WAG0000922!).
Description:—Goetghebeur & Van den Borre (1989: 44).
(15) Cyperus lipoater Goetgh., nom. nov.
Basionym: Lipocarpha atra Ridl., Trans. Linn. Soc. London, Bot. 2: 162 (Ridley 1884), non Cyperus ater Vahl (1805: 335).
Synypes:—ANGOLA. In uliginosis juxta ripas flum. Cacolovar prope Lac. Ivant., February 1869, Welwitsch 6961
(BM000922658!, LISU222631!, LISU222630!, LISU222632); ANGOLA. Lake Ivantala, 1860 Welwitsch s.n. (BM).
Description:—Goetghebeur & Van den Borre (1989: 24).
(16) Cyperus lipocarpha T.Koyama (1960: 438)
Basionym: Scirpus chinensis Osbeck, Dagb. Ostind. Resa: 220 (Osbeck 1757) ≡ Lipocarpha chinensis (Osbeck) Kern (1958:
167), non Cyperus sinensis Debeaux (1877: 14). Type:—CHINA. Osbeck s.n. (holotype S-G-6821).
Synonyms: — Scirpus senegalensis Lamarck (1791: 140) ≡ Hypolytrum senegalense (Lam.) Richard (1805: 70) ≡
Hypaelyptum senegalense (Lam.) Schumann (1895: 127) ≡ Lipocarpha senegalense (Lam.) Durand & Durand (1909:
619). Type:—SENEGAL. 1789, Roussilon s.n. (holotype P-LA, isotypes G00018513!, P).
Hypaelyptum argenteum Vahl (1805: 283) nom. illeg. ≡ Hypolytrum argenteum Kunth (1816: 218) ≡ Lipocarpha argentea
(Kunth) Brown (1818: 477) ≡ Cyperus submaculatus Koyama (1960: 438). Syntypes:—INDIA. König s.n. (C10010538!);
SENEGAL. Dupuis s.n. (C10000621!, C10000620!, G00018512!).
Tunga laevigata Roxburgh (1820: 188) ≡ Hypolytrum laevigatum (Roxb.) Sprengel (1825: 233). Type:—INDIA. Roxburgh s.n.
(holotype K?).
Hypaelyptum albidum Willdenow ex Kunth (1837: 266), nom. inval. in syn. Type:—Willdenow 1446 (holotype B-W).
Kyllinga albescens Steudel (1854: 68). Type:—PHILIPPINES. ante 1841, Cuming 1418 (holotype P, isotypes BM000959105!,
BM000959104!, BM000959106!, G, K, L, LE, MO!, UPS).
Lipocarpha debilis Ridley (1916: 243). Type:—INDONESIA. Dutch New Guinea, Mt Carstensz., ante 1913, Kloss s.n.
(holotype BM000959107!).
Lipocarpha bawangensis Miau (1991: 86). Type:—CHINA. Hainan (not located).

Phytotaxa 166 (1) © 2014 Magnolia Press • 21
LIPOCARPHA & VOLKIELLA AS INFRAGENERIC TAXA OF CYPERUS S.L.
Description:—Goetghebeur & Van den Borre (1989: 29).
(17) Cyperus lipocomosus Goetgh., nom. nov.
Basionym: Lipocarpha comosa J.Raynal, Bull. Mus. Natl. Hist. Nat., II, 41: 974 (Raynal 1970), non Cyperus comosus Smith
(Sibthorp & Smith 1806: 31). Type:—ZAMBIA. Chakwenga Headwaters, 100-129 km. East of Lusaka, 14 February 1965,
E.A. Robinson 6380 (holotype P!, isotypes K000416380!, NY00051304!, P00462789!).
Description:—Goetghebeur & Van den Borre (1989: 31).
(18) Cyperus lipofiliformis Goetgh., nom. nov.
Basionym: Hypaelyptum filiforme Vahl, Enum. Pl. Obs. 2: 284 (Vahl 1805: 284) ≡ Lipocarpha filiformis (Vahl) Kunth (1837:
267). Non Cyperus filiformis Swartz (1788: 20). Type:—GUINEA. Southern part of the country, Thonning s.n. (holotype
C10004012!, isotype LE).
Description:—Goetghebeur & Van den Borre (1989: 35).
(19) Cyperus lipomexicanus Goetgh., nom. nov.
Basionym: Lipocarpha mexicana Liebm., Mexic. Halvgr.: 235 (Liebmann 1850), non Cyperus mexicanus Liebmann (1850:
227). Type:—MEXICO. State of Veracruz, Potrero de Consoquitla near the hacienda Mirador on the E slope of Pico de
Orizaba, October 1841, Liebmann 786 (holotype C10010540!, isotypes G00098457!, K000632070!, L!, LE, P!, S-G-
6615!, UPS).
Description:—Goetghebeur & Van den Borre (1989: 47).
(20) Cyperus lipomonostachyus Goetgh., nom. nov.
Basionym: Lipocarpha monostachya Gross & Mattf., Notizbl. Bot. Gart. Berlin-Dahlem 14: 189 (Gross & Mattfeld 1938), non
Cyperus monostachyos Linnaeus (1771: 180). Type:—TANZANIA. Tangenjika Terr., Bezirk Lindi, 150 km w. Lindi; 440
m.ü.M., Massassi-Umgebung, sumpfige Wiese, Gras in kl. Gruppen dicht am Wasser, 25 April 1935, H.J. Schlieben 6399
(holotype B100166786!, isotypes B100166787, BM000922665!, BR0000008639660!, G00190012!, GENT!, M0106931!,
P!, Z).
Description:—Goetghebeur & Van den Borre (1989: 55).
(21) Cyperus lipopygmaeus Goetgh., nom. nov.
Basionym: Lipocarpha pygmaea J.Kern, Blumea 10: 638 (Kern 1960), non Cyperus pygmaeus Rottbøll (1773: 20). Type:—
CAMBODIA. C. van Steenis 19787 (holotype L!, isotype K!).
Description:—Goetghebeur & Van den Borre (1989: 61).
(22) Cyperus liporobinsonii Goetgh., nom. nov.
Basionym: Lipocarpha robinsonii J.Raynal, Adansonia, n.s., 7: 81 (Raynal 1967), non Cyperus robinsonii Podlech (1961: 111).
Type:—ZAMBIA. Flora of Barotseland, 40 km NE of Mongu, 12 December 1965, E.A. Robinson 6739 (holotype P!,
isotypes K, M0106929!, NY00051306!, P00462791!).
Description:—Goetghebeur & Van den Borre (1989: 66).
(23) Cyperus lipothermalis Goetgh., comb. nov.
Basionym: Lipocarpha thermalis J.Raynal ex Goetgh., Wageningen Agric. Univ. Pap. 89 (1): 73 (Goetghebeur 1989), non
Cyperus thermalis Dumortier (1827: 145). Type:—CONGO. P.N. Upemba, sources chaudes de Kiabukwa, près de
Bukena, sur terrain sablonneux, près de la source, 11 January 1949, G.D. de Witte 5199 (holotype BR0000008645203!).
Description:—Goetghebeur & Van den Borre (1989: 73).
(24) Cyperus neobarteri T.Koyama (1960: 438)
Basionym: Lipocarpha barteri C.B.Clarke in D.Oliver & auct. suc. (eds.), Fl. Trop. Afr. 8: 472 (Clarke 1902) ≡ Lipocarpha
atra var. barteri (C.B.Clarke) Raynal (1967: 85), non Cyperus barteri Boeckeler (1868: 460). Type:—NIGERIA. Nupe,
1857-1859, Barter 1585 (holotype K000416376!, isotypes GH00027890!, LE, P!, S-G-6616!).
Description:—Goetghebeur & Van den Borre (1989: 25).
(25) Cyperus neochinensis (Tang & F.T.Wang) Bauters, comb. nov.
Basionym: Scirpus neochinensis Tang & F.T.Wang, in Fl. Reipubl. Popul. Sin. 11: 223 (Tang & Wang 1961). Type:—CHINA.
Guangdong: Guangzhou, wasteland, 12 November 1952, S.H. Chen 8160 (holotype SCBI).
Synonyms:—Scirpus squarrosus Linnaeus (1771: 181) ≡ Isolepis squarrosa (L.) Kunth (1816: 202) ≡ Rikliella squarrosa (L.)
Raynal (1973: 154) ≡ Lipocarpha squarrosa (L.) Goetghebeur (1989: 71) ≡ Schoenoplectus squarrosus (L.) Yun Liang

BAUTERS ET AL.22 • Phytotaxa 166 (1) © 2014 Magnolia Press
(2009: 269), non Cyperus squarrosus Linnaeus (1756: 6). Type:—INDIA. Koenig s.n. (lectotype LINN-71-49, isotypes
BR0000006596439!, C, S-G-6816!).
Scirpus sinensis Kunth (1837: 202), non Cyperus sinensis Debeaux (1877: 14). Type: not located.
Ascolepis tenuior Steudel (1855: 105), non Cyperus tenuior Engelmann (1856: 492). Type:—INDIA. East Bengal, Griffith
6287, (holotype P00051452!, isotypes G, NY00025053!).
Description:—Goetghebeur & Van den Borre (1989: 72).
(26) Cyperus neotropicalis Alain (1965: 291)
Basionym: Kyllinga maculata Michx., Fl. Bor.-Amer. 1: 29 (Michaux 1803) ≡ Mariscus maculatus (Michx.) Roemer &
Schultes (1817: 243) ≡ Lipocarpha maculata (Michx.) Torrey (1836: 288), non Cyperus maculatus Boeckeler (1864: 539).
Type:—USA. “In Carolina”, Michaux s.n. (holotype P).
Synonyms:—Scirpus cephalotes Walter (1788: 71) nom. illeg. ≡ Dichromena cephalotes Britton (1888: 100). Type:—USA.
“Carolina”, Walter s.n. (holotype BM).
Description:—Goetghebeur & Van den Borre (1989: 45).
(27) Cyperus perspicuus (S.S.Hooper) Bauters, comb. nov.
Basionym: Lipocarpha perspicua S.S.Hooper, Kew Bull. 41: 424 (Hooper 1986). Type:—ANGOLA. District of Moxico, Few
miles W of R. Kaperi (Kapelu), 10 January 1938, E. Milne-Redhead 4039 (holotype K000815777!, isotypes
GENT0000090030895!, NY00548011!).
Description:—Goetghebeur & Van den Borre (1989: 58).
(28) Cyperus persquarrosus T.Koyama (1960: 438)
Basionym: Lipocarpha pulcherrima Ridley (1884: 162) ≡ Hypaelyptum pulcherrimum (Ridl.) Schumann (1895: 127), non
Cyperus pulcherrimus Willdenow ex Kunth (1837: 35). Syntypes:—ANGOLA. December 1856, Welwitsch 6774
(BM000922661!, COI). ANGOLA. In paludes apricas Presidii et prope Quilanga, February 1857, Welwitsch 6774 [sic]
(BM000922662!, LISU222634!). ANGOLA. May 1860, Welwitsch 6775 (BM000922660!, LISU222637!, LISU222638!).
ANGOLA. Pungo Andongo, February 1957, Welwitsch 6785 (BM000922659!, LISU222636!).
Synonyms:—Fuirena nana Richard (1850: 497) ≡ Lipocarpha nana (A.Rich.) Chermezon (1924: 142). ≡ Lipocarpha nana
(A.Rich.) Raynal (1967: 84) comb. superfl., non Cyperus nanus Willdenow (1797: 272). Type:—ETHIOPIA. Quartin-
Dillon & Petit s.n. (holotype P)
Lipocarpha tenera Boeckeler (1888: 21), non Cyperus tener Vahl (1805: 299). Type:—MALAWI. in montibus ad flumen
Schire, J. Buchanan 63 (holotype B, isotype K000416387).
Lipocarpha atropurpurea Boeckeler (1888: 21), non Cyperus atropurpureus Persoon (1805: 60). Type:—MALAWI. in
montibus ad flumen Schire, ante 1885, J. Buchanan 69 (holotype B, isotypes K000416386!, K000416387!, LE,
NY00051303!, P!).
Lipocarpha minima Chermezon (1922: 425) ≡ Cyperus unistamen Koyama (1960: 438), non Cyperus minimus Linnaeus (1753:
44). Type:—MADAGASCAR. “Antsirabé, 1913, Perrier de la Bâthie 2680 (holotype P, isotype P).
Lipocarpha pulcherrima f. luxurians Merxmüller (Suessenguth & Merxmüller 1952: 164). Type:—MOZAMBIQUE. 1952,
Schweickerdt 2319 (holotype M).
Description:—Goetghebeur & Van den Borre (1989: 57).
(29) Cyperus prieurianus (Steud.) T.Koyama (1960: 438)
Basionym: Lipocarpha prieuriana Steud., Syn. Pl. Glumac. 2: 130 (Steudel 1855). Type:—SENEGAL. Leprieur s.n. (holotype
P!, isotypes G00190011!, L0042653!).
Synonyms:—Lipocarpha schweinfurthiana Boeckeler (1879: 567). Type:—SUDAN. 1869, Schweinfurth 197, ser. 3 (holotype
B, isotype K000815778!).
Description:—Goetghebeur & Van den Borre (1989: 60).
(30) Cyperus purpureoluteus (Ridl.) Bauters, comb. nov.
Basionym: Lipocarpha purpureolutea Ridl., Trans. Linn. Soc. London, Bot. 2: 163 (Ridley 1884). Type:—ANGOLA. In
pascuis dumentosis aestate inundatis prope Humpata, March 1860 Welwitsch 6784 (holotype BM000922657!, isotypes
LISU222624!, LISU222625!, LISU222626!).
Synonyms:—Lipocarpha albiceps Ridley (1884: 163) ≡ Hypaelyptum albiceps (Ridl.) Schumann (1895: 127) ≡ Cyperus
echinolepis Koyama (1960: 438), non Cyperus albiceps Ridley (1884: 16). Syntypes:—ANGOLA. Sansamande, march
1857, Welwitsch 6786 (BM000922656). ANGOLA. Catete, March 1857, Welwitsch 6786 [sic] (BM000922655!, COI).
Description:—Goetghebeur & Van den Borre (1989: 22).

Phytotaxa 166 (1) © 2014 Magnolia Press • 23
LIPOCARPHA & VOLKIELLA AS INFRAGENERIC TAXA OF CYPERUS S.L.
(31) Cyperus raynalianus (Govind.) Bauters, comb. nov.
Basionym: Lipocarpha raynaliana Govind., Adansonia, n.s., 20: 369 (Govindarajalu 1981) as ‘Lipocarpha raynaleana’.
Type:—INDIA. Govindarajalu 14948 (holotype PCM, isotypes BLAT, BSI, CAL, DD, MH, PCM).
Description:—Goetghebeur & Van den Borre (1989: 62).
(32) Cyperus reddyi (S.S.Hooper) Bauters, comb. nov.
Basionym: Lipocarpha reddyi S.S.Hooper, Kew Bull. 41: 427 (Hooper 1986). Type: INDIA. Reddy 1232 (holotype
K000815769!).
Description:—Goetghebeur & Van den Borre (1989: 64).
(33) Cyperus salzmannianus (Steud.) Bauters, comb. nov.
Basionym: Lipocarpha salzmanniana Steud., Syn. Pl. Glumac. 2: 129 (Steudel 1855). Type:—BRAZIL. Bahia, 1830,
Salzmann 603 (holotype P!, isotypes G00098453!, G00098452, G00098451!, K000189145!, K000189144!,
LE00000772!, MO!, US!).
Synonym:—Lipocarpha cochleata Grisebach (1866: 241). Type:—CUBA. Pinar del Rio, 1863, C. Wright 3386 (holotype
GOET002889!, isotypes BM, G00098454!, G00098455!, GH00027889!, K000632066!, LE, MA-607196, MO!, P, S05-
5483!, YU001010!).
Scirpus pycnostachys Salzmann ex Steudel (1855: 129) nom. nud. in syn.
Description:—Goetghebeur & Van den Borre (1989: 68).
(34) Cyperus schomburgkii (Friedl.) Bauters, comb. nov.
Basionym: Hemicarpha schomburgkii Friedl., Amer. J. Bot. 28: 858 (Friedland 1941) ≡ Lipocarpha schomburgkii (Friedl.)
Tucker (1987: 410). Type:—GUYANA. 1839, Schomburgk 657 (holotype NY!, isotypes G00098448!, G00098447!,
K000632061!, L!, P!).
Description:—Goetghebeur & Van den Borre (1989: 69).
(35) Cyperus sellowianus (Kunth) T.Koyama (1960: 438)
Basionym: Lipocarpha sellowiana Kunth, Enum. Pl. 2: 267 (Kunth 1837). Type:—BRAZIL, Sellow s.n. (holotype P!, isotypes
G00098460!, K000632065!, LE00000773!, P!).
Synonyms:—Lipocarpha humboldtiana Nees (1834a: 287), non Cyperus humboldtianus Schult (Roemer & Schultes 1824:
100) nom. illeg. Type:—VENEZUELA. S.loc. [Nov. gen. sp. : Crescit in opacatis, irriguis Provinciae Guayanensis in ripa
Orinoci, inter ostia Ventuarii et Conucos de Siquita.], Humboldt & Bonpland s.n. (holotype P00669499!).
Lipocarpha glomerata Nees (1842: 64) ≡ Hypolytrum glomeratum Schrader ex Nees (1842: 64) nom. nud. in syn. Syntypes:—
BRAZIL. Minas Gerais: Martius 119 (M); Bahia: Martius 123 (B, M); Minas Gerais: Pohl s.n. (BR0000006596668!, M).
Ascolepis venezuelensis Schnee (1943: 5). Type:—VENEZUELA. Bolívar. Paso de Cardozo, 10 Km S of ciudad, 27 April
1943, Killip 37666 (holotype VEN23372).
Description:—Goetghebeur & Van den Borre (1989: 41).
(36) Cyperus subsquarrosus (Muhl.) Bauters, comb. nov.
Basionym: Scirpus subsquarrosus Muhl., Descr. Gram.: 39 (Muhlenberg 1817) ≡ Isolepis subsquarrosa (Muhl.) Schrad. ex
Schult. (Roemer & Schultes 1824) ≡ Hemicarpha subsquarrosa (Muhl.) Nees (1842: 61). Type:—USA. Collector
unknown s.n. (holotype PH00031677!).
Synonyms:—Scirpus minimus Pursh (1813: 55) nom. illeg. Type:—USA. Collector unknown s.n. (not located).
Scirpus micranthus Vahl (1805: 254) ≡ Isolepis micrantha (Vahl) Roemer & Schultes (1817: 110) ≡ Hemicarpha micrantha
(Vahl) Pax (1887: 105) ≡ Hemicarpha micrantha (Vahl) Britton (1888: 104) ≡ Lipocarpha micrantha (Vahl) Tucker (1987:
410). Non Cyperus micranthus Schult. (Roemer & Schultes 1824: 121). Type:—FRENCH GUIANA. L.C. Richard s.n.
(holotype C10010479!, isotype P)
Isolepis humboldtii Roemer & Schultes (1817: 112) ≡ Scirpus humboldtii (Roem. & Schult.) Dietrich (1832: 112). Type:—
VENEZUELA. Humboldt & Bonpland s.n. (holotype P).
Scirpus micranthus var. humboldtii Boeckeler (1870: 500) ≡ Hemicarpha micrantha var. humboldtii (Boeckeler) Beetle (1949:
476). Type: not located.
Isolepis subsquarrosa var. minor Schrad. (Roemer & Schultes 1824: 64) ≡ Hemicarpha subsquarrosa var. minor (Schrad.)
Nees (1842: 61) ≡ Hemicarpha micrantha var. minor (Schrad.) Friedland (1942: 860) ≡ Scirpus micranthus var. minor
(Schrad.) Boivin (1992: 55). Ty pe:—BRAZIL. Prince Ser. Max. Neowid. s.n. (holotype GOET).
Scirpus sesquipollicaris Willdenow ex Kunth (1837: 203), nom. inval. in syn. Type:—Willdenow 1200 (B-W).
Isolepis caespitula Liebmann (1850: 237) ≡ Hemicarpha caespitula (Liebm.) Palla (1908: 417). Syntypes:—MEXICO. 1842,
Liebmann 808 (C); 1842, Liebmann s.n. (C10010541!, C10010542!, G00098456!, K000632067!, L, NY00051292!, P, S-
G-6825!, UPS).

BAUTERS ET AL.24 • Phytotaxa 166 (1) © 2014 Magnolia Press
Hypolytrum capillare Schrad. ex Nees (1842: 61), nom. nud. in syn.
Description:—Goetghebeur & Van den Borre (1989: 50).
—Alphabetic list of accepted names and synonyms in Lipocarpha
Ascolepis
kyllingioides (13); tenuior (25); venezuelensis (35);
Cyperus
abietinus (1); aristulatus (2); ceylanicus (3); constrictus (4); crassicuspis (5); distichus (6); echinolepis (30);
echinus (7); hemidrummondii (8); hemioccidentalis (9); hystricoides (10); isolepis (11); kernii (12); leptocarpus
(13); leucaspis (14); lipoater (15); lipocarpha (16); lipocomosus (17); lipofiliformis (18); lipomexicanus (19);
lipomonostachyus (20); lipopygmaeus (21); liporobinsonii (22); lipothermalis (23); neobarteri (24);
neochinensis (25); neotropicalis (26); perspicuus (27); persquarrosus (28); prieurianus (29); purpureoluteus
(30); raynalianus (31); reddyi (32); salzmannianus (33); schomburgkii (34); sellowianus (35); submacullatus
(16); subsquarrosus (36); unistamen (28); zollingerianus (13);
Dichromena
cephalotes (26);
Fuirena
nana (28);
Hemicarpha
aristulata (2); caespitula (36); drummondii (8); intermedia (2); isolepis (11); micrantha (36); micrantha var.
aristulata (2); micrantha var. drummondii (8); micrantha var. humboldtii (36); micrantha var. minor (36);
occidentalis (9); schomburgkii (34); schraderi (11); schraderiana (11); senegalensis (11); subsquarrosa (36);
subsquarrosa var. drummondii (8); subsquarrosa var. minor (36);
Hypaelyptum
albiceps (30); albidum (16); argenteum (16); filiforme (18); microcephalum (13); pulcherrimum (28); senegalense
(16); sphacelatum (3);
Hypolytrum
argenteum (16); capillare (36); glomeratum (35); gracile (3); laevigatum (16); senegalense (16); triceps (3);
Isolepis
bellula (11); caespitula (36); hemisphaerica (11); humboldtii (36); micrantha (36); minima (11); rehmannii (10);
squarrosa (25); subsquarrosa (36); subsquarrosa var. minor (36);
Kyllinga
albescens (16); maculata (26); squarrosa (13);
Lipocarpha
abietina (1); albiceps (30); argentea (16); aristulata (2); atra (15); atra var. barteri (24); atropurpurea (28);
barteri (24); bawangensis (16); chinensis (16); cochleata (33); comosa (17); constricta (4); crassicuspis (5);
debilis (16); drummondii (8); echinus (7); filiformis (18); glomerata (35); gracilis (3); hemisphaerica (11);

Phytotaxa 166 (1) © 2014 Magnolia Press • 25
LIPOCARPHA & VOLKIELLA AS INFRAGENERIC TAXA OF CYPERUS S.L.
humboldtiana (35); isolepis (11); kernii (12); leucaspis (14); maculata (26); mexicana (19); micrantha (36);
microcephala (13); minima (28); monocephala (11); monostachya (20); nana (28); occidentalis (9); perspicua (27);
prieuriana (29); prieuriana var. crassicuspis (5); pulcherrima (28); pulcherrima f. luxurians (28); purpureolutea
(30); pygmaea (21); rautanenii (11); raynaliana (31); reddyi (32); rehmannii (10); robinsonii (22); salzmanniana
(33); schomburgkii (34); schweinfurthiana (29); sellowiana (35); senegalense (16); sphacelata (3) sphacelata var.
gracilis (3); squarrosa (25); tenera (28); thermalis (23); triceps (3); triceps var. latinux (1); zollingeriana (13);
Mariscus
maculatus (26);
Rikliella
australiensis (13); kernii (12); rehmannii (10); squarrosa (25);
Schoenoplectus
squarrosus (25).
Scirpus
cephalotes (26); chinensis (16); dietrichae (13); hystricoides (10); hemisphaericus (11); humboldtii (36); isolepis
(11); kernii (12); micranthus var. drummondii (8); leptocarpus (13); micranthus (36); micranthus var. humboldtii
(36); micranthus var. minor (36); minimus (11 & 36); monander (3); neochinensis (25); occidentalis (9);
pycnostachys (33); rehmannii (10); senegalensis (16); setaceus var. monander (11); sesquipollicaris (36); sinensis
(25); squarrosus (25); squarrosus var. dietrichiae (13); subsquarrosus (36);
Tunga
laevigata (16); triceps (3);
Volkiella
disticha (6).
Acknowledgements
We thank Andy Vierstraete for his helpful suggestions with the lab work and for performing the sequence reactions
(Ghent University, Belgium). We thank MO, US and BR for the permission for destructive sampling of herbarium
material. Kobeke Van de Putte is acknowledged for her help with the use of the High Performance Computer
(Ghent University, Belgium). The phylogenetic analyses were carried out using the Stevin Supercomputer
Infrastructure at Ghent University, funded by Ghent University, the Hercules Foundation and the Flemish
Government – Department EWI.
We express our gratitude to the Department of Environment and Natural Resources (DENR Region 8), for
providing a collecting permit for Cyperaceae in the Philippines. We are grateful for the invitation of the East
African Herbarium (National Museums of Kenya, Nairobi) and the Kenya Wildlife Service for the permission
access and to collect sedges in the protected areas of Kenya and their help organising the expedition. The ANGAP
Madagascar National Parks authority, the general secretariat of the AETFAT congress 2010 and the staff of the
MBG office in Antananarivo are acknowledged for their help in securing collecting permits (N°082/10/MEF/SG/
DGF/DCB.SAP/SLRSE - Isabel Larridon) for Cyperaceae in Madagascar and their help organising the expedition.
This study was financed by the Special Research Fund (BO5622, BO7418, BOF, Ghent University), and the Ghent
University Department of Biology.

BAUTERS ET AL.26 • Phytotaxa 166 (1) © 2014 Magnolia Press
References
Aublet, J.B.C.F. (1775) Histoire des Plantes de la Guiane Françoise 1. Pierre-François Didot jeune, Paris, 976 pp.
http://dx.doi.org/10.5962/bhl.title.48831
Bauters, K. (2011) Molecular phylogeny and systematics of Ascolepis, Lipocarpha and Volkiella (Cyperaceae). MSc
dissertation, Ghent University, 142 pp.
Beauvois, A.M.F.J., Palisot de (1816) Flore d'Oware et de Bénin, en Afrique 2 (15). Imprimerie de Fain, Paris, 95 pp.
Beetle, A.A. (1949) Annotated list of original descriptions in Scirpus. American Midland Naturalist 41: 453–493.
http://dx.doi.org/10.2307/2421725
Bentham, G. (1878) Flora Australiensis 7. Lovell Reeve & Co, London, pp. 246–445.
Boeckeler, O. (1859a) Beschreibungen neuer Cyperaceen, nebst berichtigenden Bemerkungen über einige ältere Cyperus-Arten.
Flora 42: 433–448.
Boeckeler, O. (1859b) ueber die gattung Ascolepis und ihre Arten, wie solche von Steudel in der Synopsis pl. Cyperac.
dargestellt worden sind. Flora 42 (7): 99–101.
Boeckeler, O. (1864) Cyperaceae. In: Peters, W.C.H. (ed.) Naturwissenschaftliche Reise nach Mossambique 2. G.Reimer. Berlin,
539 pp.
Boeckeler, O. (1868) Die Cyperaceen des königlichen Herbarium zu Berlin 1. Die Cypereen, Scirpeen und Hypolytreen.
Linnaea 35 (5): 397–512.
Boeckeler, O. (1870) Die Cyperaceen des königlichen Herbariums zu Berlin 1. Die Cypereen, Scirpeen und Hypolytreen.
Linnaea 36 (3): 271–384.
Boeckeler, O. (1871) Die Cyperaceen des Königlichen Herbariums zu Berlin. Linnaea 37 (1): 1–128.
Boeckeler, O. (1875) Ein Beitrag zur Kenntnis der Cyperaceen-Flora Neuholland's und einiger polynesischer Inseln. Flora 58
(7): 107–112.
Boeckeler, O. (1879) Beitrag zur Kenntnis der Cyperaceen des tropischen Afrika. Flora 62 (35): 545–557.
Boeckeler, O. (1888) Beiträge zur Kenntniss der Cyperaceen 1. Cyperaceae novae. Breitschädel & Vogt, Varel a.d. Jade, 53 pp.
Boissier, P.E. (1882) Flora Orientalis 5. H. Georg, Genève, Basel, Lyon, 428 pp.
Boivin, J.R.B. (1992) The Cyperaceae of Eastern Canada. Provancheria 25: 1–230.
Britton, N.L. (1888) New or Noteworthy American Phanerograms 1. Bulletin of the Torrey Botanical Club 15 (4): 97–104.
Brown R. (1810) Prodromus florae Novae Hollandiae et insulae Van-Diemen. Typis R. Taylor et socii, London, 212–243 pp.
http://dx.doi.org/10.5962/bhl.title.397
Brown, R. (1818) Observations, systematical and geographical, on professor Christian Smith's collection of plants from the
vicinity of the River Congo. In: Tuckey, J.H. (Ed), Narrative of an Expedition to Explore the River Zaire, usually called the
Congo in South Africa. Appendix 5: 420–485.
http://dx.doi.org/10.1017/cbo9781139245746.016
Brunken, U., Schmidt, M., Dressler, S., Janssen, T., Thiombiano, A. & Zizka, G. (2008) West African plants - A Photo Guide.
Forschungsinstitut Senckenberg, Frankfurt am Main, Germany. Available from: http://
www.westafricanplants.senckenberg.de/ (accessed: 27.03.2014).
Castresana, J. (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular
Biology and Evolution 17(4): 540–552.
http://dx.doi.org/10.1093/oxfordjournals.molbev.a026334
Chermezon, H. (1922) Scirpées nouvelles de Madagascar. Bulletin de la Société botanique de France 68: 417–426.
Chermezon, H. (1924) Sur quelques Cypéracées africaines critiques. Bulletin de la Société botanique de France 71: 141–144.
Clarke, C.B. (1902). Cyperaceae 2. In: Thiselton-Dyer WT. (Ed), Flora of Tropical Africa 8. Lovell Reeve & Co., London, 385–
524.
Clarke, C.B. (1908) New Genera and species of Cyperaceae. Bulletin of Miscellaneous Information: Additional Series 8: 1–196.
Coville, F.V. (1894) The genus Hemicarpha in North America. Bulletin of the Torrey Botanical Club 21: 34–37.
Debeaux, J.O. (1877) Florule de Tché-Foû (Province du Chan-Tong). Actes de la Société Linnéenne de Bordeaux 31: 14.
Degnan, J.H. & Rosenberg, N.A. (2006) Discordance of species trees with their most likely gene trees. PLOS Genetics 2 (5):
762–768.
http://dx.doi.org/10.1371/journal.pgen.0020068
Dietrich, A.G. (1832) Cyperaceae. In: Linnaeus C. (eds.) Species Plantarum 2. Imprensis Laurentii Salvii, Stockholm, pp. 109–
112.
Domin, K. (1915) Beiträge zur Flora und Pflanzengeographie Australiens. Bibliotheca Botanica 85: 414–498.
http://dx.doi.org/10.5962/bhl.title.58219
Driskell, A.C., Ane, C., Burleigh, J.G., McMahon, M.M., O’Meara, B.C. & Sanderson, M.J. (2004) Prospects for building the
tree of life from large sequence databases. Science 5699: 1172–1174.
http://dx.doi.org/10.1126/science.1102036
Drummond, A.J. & Rambaut, A. (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology
7: 214.
http://dx.doi.org/10.1186/1471-2148-7-214
Dumortier, B.C.J. (1827) Florula belgica, opera majoris prodromus, auctore B.C. Dumortier. Staminacea, Tornaci Nervicrum,
172 pp.

Phytotaxa 166 (1) © 2014 Magnolia Press • 27
LIPOCARPHA & VOLKIELLA AS INFRAGENERIC TAXA OF CYPERUS S.L.
Durand, T.A. & Durand H. (1909) Sylloge florae congolanae. De Boeck, Brussels, 760 pp.
Edwards, S.V. & Rausher, M. (2009) Is a new and general theory of molecular systematics emerging? Evolution 63 (1): 1–19.
Endlicher, S.F.L. (1842) Catalogus Horti Academici Vindobonensis 1. Vienna, 495 pp.
Engelmann, G. (1856) In: Gray, A. (ed.) A Manual of the Botany of the Northern United States. J. Monroe & Co. Boston &
Cambridge, Massachusetts, 492 pp.
Friedland, S. (1941) The American species of Hemicarpha. American Journal of Botany 28: 855–861.
http://dx.doi.org/10.2307/2436863
Goetghebeur, P. (1980) Studies in Cyperaceae 2. Contributions towards a revision of the mainly African genus Ascolepis Nees ex
Steudel. Adansonia ser. 2, 19: 269–305.
Goetghebeur, P. (1986) Genera Cyperacearum. Een bijdrage tot de kennis van de morfologie, systematiek en fylogenese van de
Cyperaceae-genera. PhD dissertation, Ghent University, 1164 pp.
Goetghebeur, P. (1998) Cyperaceae. In: Kubitzki, F., Huber, H., Rudall, P.J., Stevens, P.S. & Stützel, T. (eds.) The families and
genera of vascular plants 4: 141–190. Springer-Verslag, Berlin.
Goetghebeur, P. & Van den Borre, A. (1989) Studies in Cyperaceae 8. A revision of Lipocarpha, including Hemicarpha and
Rikliella. Wageningen Agricultural University Papers. 89: 1–87.
Govaerts, R., Simpson, D.A., Goetghebeur, P., Wilson, K.L., Egorova, T. & Bruhl, J. (2007) World checklist of Cyperaceae.
Sedges. Kew Publishing, Royal Botanic Gardens, Kew, U.K., 765 pp.
Govaerts, R., Simpson, D.A., Goetghebeur, P., Wilson, K.L., Egorova, T. & Bruhl, J. (2013) World checklist of Cyperaceae. The
Board of Trustees of the Royal Botanic Gardens, Kew. Available from: http://www.kew.org/wcsp/monocots/ (accessed:
28.03.2014).
Govindarajalu, E. (1981) Studies in Cyperaceae. 19. Novelty in Lipocarpha: L. raynaleana and its vegetative anatomy.
Adansonia, ser. 2, 20 (4) : 369–375.
Govindarajalu, E. & Raynal, J. (1976) Notes cypérologiques 28. Compléments sur le genre Rikliella J. Rayn. Adansonia sér. 2,
16 (2): 219-228.
Gray, A. (1856) A Manual of the Botany of the Northern United States, ed. 2. J. Putnam, New York, 739 pp.
Gray, A. (1868) Enumeration of Hawaian Plants. Proceedings of the American Academy of Arts and Sciences 7 (2): 391–392.
Grisebach, A.H.R. (1866) Cyperaceae. Catalogus plantarum cubensium. Engelmann, Leipzig, 301 pp.
http://dx.doi.org/10.5962/bhl.title.177
Gross, R., Mattfeld, J. (1938) Neue Cyperaceen. Notizblatt des Botanischen Gartens und Museums zu Berlin-Dahlem 14: 189–
194.
http://dx.doi.org/10.2307/3994884
Haines, R.W. & Lye, K.A. (1971) Studies in African Cyperaceae 4. Lipocarpha R.Br., Hemicarpha Nees and Isolepis R.Br.
Botaniska Notiser 124: 473–482.
Haines, R.W. & Lye, K.A. (1978) Studies in African Cyperaceae 17. Kyllingiella R.W.Haines & Lye, gen. nov. Botaniska
Notiser 131: 175–177.
Heled, J. & Drummond, A.J. (2010) Bayesian inference of species trees from multilocus data. Molecular Biology and Evolution
27 (3): 570–580.
http://dx.doi.org/10.1093/molbev/msp274
Holmgren, P.K., Holmgren, N.H. & Barnett, L.C. (1990) Index Herbariorum. Part 1: The Herbaria of the World. New York
Botanical Garden, Bronx, NY.
Hooper, S.S. (1986) A concept of the cyperoid spikelet and its terminology, illustrated by new species of Lipocarpha
(Cyperaceae). Kew Bulletin 41: 423–428.
http://dx.doi.org/10.2307/4102953
Huelsenbeck, J.P. & Ronquist, F. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19
(12): 1572–1574.
http://dx.doi.org/10.1093/bioinformatics/btg180
Huygh, W., Larridon, I., Reynders, M., Muasya, A.M., Govaerts, R., Simpson, D.A. & Goetghebeur, P. (2010) Nomenclature
and typification of names of genera and subdivisions of genera in Cypereae (Cyperaceae): 1. Names of genera in the
Cyperus clade. Taxon 59 (6): 1883–1890.
Izquierdo-Carrasco, F., Smith, S.A. & Stamatakis, A. (2011). Algorithms, data structures, and numerics for likelihood-based
phylogenetic inference of huge trees. BMC Bioinformatics 12: 470–483.
http://dx.doi.org/10.1186/1471-2105-12-470
Kern, H.H. (1958) Florae Masesianae praecursores 19. Notes on Malaysian and some SE Asian Cyperaceae VI. Blumea Suppl.
4: 163–169.
Kern, J.H. (1960) Florae Malesianae precursores 25. Notes on Malaysian and some SE Asian Cyperaceae 8. Blumea 10: 635–
651.
Knowles, L.L. (2009) Estimating species trees: methods of phylogenetic analysis when there is incongruence across genes.
Systematic Biology 58: 463–467.
Koyama, T.M. (1960) Some transfers of names related to Cyperaceae. Botanical Magazine Tokyo 73: 438.
Kunth, K.S. (1816) Cyperaceae. In: Humboldt, F.W.H.A. von, Bonpland, A.J.A., Kunth, K.S. (eds.) Nova Genera et Species
Plantarum (quarto edition) 1. Paris, 202, 218–224, 229–233.
Kunth, C.S. (1837) Enumeratio Plantarum 2. Cyperographia synoptica. Sumtibus J.G. Cottae, Stuttgart & Tübingen, 592 pp.

BAUTERS ET AL.28 • Phytotaxa 166 (1) © 2014 Magnolia Press
Lamarck, J.B.A.P. de M. de (1791) Tableau Encyclopédique et Methodique méthodique des trois règnes de la nature. Botanique.
1. Pancoucke, Paris, 200 pp.
http://dx.doi.org/10.5962/bhl.title.11660
Larridon, I., Reynders, M., Huygh, W., Bauters, K., Van De Putte, K., Muasya, M.A., Boeckx, P., Simpson, D.A., Vrijdaghs, A.
& Goetghebeur, P. (2011a) Affinities in C3 Cyperus lineages (Cyperaceae) revealed using molecular phylogenetic data and
carbon isotope analysis. Botanical Journal of the Linnean Society 167 (1): 19–46.
http://dx.doi.org/10.1111/j.1095-8339.2011.01160.x
Larridon, I, Reynders, M., Huygh, W., Bauters, K., Vrijdaghs, A., Leroux, O., Muasya, A.M., Simpson, D.A. & Goetghebeur, P.
(2011b) Taxonomic changes in C3 Cyperus (Cyperaceae) supported by molecular data, morphology, embryography,
ontogeny and anatomy. Plant Ecology and Evolution 144 (3): 327–356.
http://dx.doi.org/10.5091/plecevo.2011.653
Larridon, I., Reynders, M., Huygh, W., Muasya, A.M., Govaerts, R., Simpson, D.A. & Goetghebeur, P. (2011c) Nomenclature
and typification of names of genera and subdivisions of genera in Cypereae (Cyperaceae): 2. Names of subdivisions of
Cyperus. Taxon 60 (3): 868–884.
Larridon, I., Bauters, K., Reynders, M., Huygh, W., Muasya, A.M., Simpson, D.A. & Goetghebeur, P. (2013) Towards a new
classification of the giant paraphyletic genus Cyperus (Cyperaceae): phylogenetic relationships and generic delimitation in
C4 Cyperus. Botanical Journal of the Linnean Society 172 (1): 106–126.
http://dx.doi.org/10.1111/boj.12020
Larridon, I. & Goetghebeur, P. (2013) Cyperus steudneri, a new combination in Cyperus (Cyperaceae). Plant Ecology and
Evolution 146 (1): 138–139.
http://dx.doi.org/10.5091/plecevo.2013.827
Larridon, I., Bauters, K., Reynders, M., Huygh, W. & Goetghebeur, P. (2014) Taxonomic changes in C4 Cyperus (Cypereae,
Cyperoideae, Cyperaceae): reducing the sedge genera Ascolepis, Kyllinga and Pycreus into Cyperus sensu lato. Phytotaxa
166 (1): 33–48.
http://dx.doi.org/10.11646/phytotaxa.166.1.2
Liang, S.Y. (2009) Schoenoplectus. In: Lin, Q. & Fu, L.K. (eds.). Higher Plants of China 12. Qingdao Publishing House,
Qingdao, pp. 249.
Liebmann, F.M. (1850) Mexicos Halvgraes. Det Kongelige Danske Videnskabernes Selskabs Skrifter 5 (2): 189–277.
Linnaeus, C. (1753) Species Plantarum. Stockholm, 560 pp.
Linnaeus, C. (1756) Centuria II. Plantarum. Uppsala, 34 pp.
Linnaeus, C. (1771) Mantissa plantarum altera generum editionis VI et specierum editionis II. Laurentis Salvius, Stockholm,
588 pp.
http://dx.doi.org/10.5962/bhl.title.69083
Lye, K.A. (1971) Studies in African Cyperaceae 4. Lipocarpha R.Br., Hemicarpha Nees and Isolepis R.Br. Botaniska Notiser
124 (4): 473–482.
Lye, K.A. (1972) Studies in African Cyperaceae 5. Sphaerocyperus Lye, gen. nov. Botaniska Notiser 125 (3): 212–216.
Suessenguth, K. & Merxmüller, H. (1952) Cyperaceae und Papilionaceae aus Ostafrika. Mitteilungen der Botanischen
Staatssammlung München 5: 163–166.
Merxmüller, H. & Czech, G. (1953) Eine neue Gattung der Cyperaceae. Mitteilungen aus der Botanischen Staatssammlung
München I (8): 317–323.
Miau, R.H.H. (1991) A systematic taxonomy of Lipocarpha R.Br. from China. Acta Scientiarum Naturalium Universitatis
Sunyatseni 30 (2): 85–87.
Michaux, A. (1803) Flora Boreali-Americana 1: 27–38. Levrault. Paris & Strasbourg.
Mohlenbrock, R.H. (1963) The Cyperaceae of Illinois 7. Scirpus. American Midland Naturalist 70 (1): 1–46.
http://dx.doi.org/10.2307/2422770
Muasya, A.M., Simpson, D.A. & Chase, M.W. (2002) Phylogenetic relationships in Cyperus L. s.l. (Cyperaceae) inferred from
plastid DNA sequences data. Botanical Journal of the Linnean Society 138 (2): 145–153.
http://dx.doi.org/10.1046/j.1095-8339.2002.138002145.x
Muasya, A.M., Simpson, D.A., Verboom, G.A., Goetghebeur, P., Naczi, R.F.C., Chase, M.W. & Smets, E. (2009a) Phylogeny of
Cyperaceae based on DNA sequence data: Current progress and future prospects. Botanical Review 75 (1): 2–21.
http://dx.doi.org/10.1007/s12229-008-9019-3
Muasya, A.M., Vrijdaghs, A., Simpson, D.A., Chase, M.W., Goetghebeur, P. & Smets, E. (2009b) What is a genus in Cypereae:
Phylogeny, character homology assessment and generic circumscription in Cypereae. Botanical Review 75 (1): 52–66.
http://dx.doi.org/10.1007/s12229-008-9018-4
Mueller, F.J.H. von (1855) Descriptive Characters of New Alpine Plants, from Continental Australia. Transactions of the
Philosophical Society of Victoria 1: 96–111.
Muhlenberg, G.H.E. (1817) Descriptio uberior graminum et plantarum calamariarum Americae septentrionalis indigenarum et
cicurum. Conrad, Philadelphia, 295 p.
http://dx.doi.org/10.5962/bhl.title.15506
Nees von Esenbeck, C.G. (1834a) Uebersicht der Cyperaceengattungen. Linnaea 9: 273–306.
Nees von Esenbeck, C.G. (1834b) Cyperaceae Indicae. In: Wright, R. Contributions to the Botany of India. Allen & Co, Parbury,
London, pp. 69–129.

Phytotaxa 166 (1) © 2014 Magnolia Press • 29
LIPOCARPHA & VOLKIELLA AS INFRAGENERIC TAXA OF CYPERUS S.L.
Nees von Esenbeck, C.G. (1834c) Cyperaceae. In Walker-Arnott, G.A. New genera of plants. Edinburgh New Philosophical
Journal 17 (34): 260–267.
Nees von Esenbeck, C.G. (1842) Florae Brasiliensis Cyperographia. In: von Martius, C.F.P. (Ed.), Flora Brasiliensis 2 (1). R.
Oldenbourg, München & Leipzig, pp. 1–226.
Nelson, A. (1902) New plants from Wyoming 14. Bulletin of the Torrey Botanical Club 29: 400–406.
Nordenstam, R.B. (1974) The flora of Brandberg. Dinteria: contributions to the flora of South West Africa 11: 3–67.
Nylander, J.A.A., Olsen, U., Alstrom, S. & Sanmartin, I. (2008) Accounting for phylogenetic uncertainty in biogeography: A
Bayesian approach to dispersal-vicariance analysis of the thrushes (Aves: Turdus). Systematic Biology 57 (2): 257–268.
Ogden, T.H. & Rosenberg M.S. (2007) How should gaps be treated in parsimony? A comparison of approaches using
simulation. Molecular Phylogenetics Evolution 42: 817–826.
http://dx.doi.org/10.1016/j.ympev.2006.07.021
Osbeck, P. (1757) Dagbok öfwer en Ostindisk Resa aren 1750, 1751, 1752. Lor. Ludw. Grefing, Stockholm, 400 pp.
Palla, E. (1908) Über Hemicarpha. Österr. Bot. Zeitschr. 58(11): 417–422.
Palla E. (1908) Cyperaceae. In: von Wettstein R., Schiffner V. (eds) Ergebnisse der botanischen Expedition der kaiserlichen
Akademie der Wissenschaften nach Südbrasilien 1901. 1. Pteridophyta und Anthophyta 1. Denkschriften der
Mathematisch-Naturwissenschaftliche Klasse der Kaiserlichen Akademie in Wien 79: 168–200.
Pax F. (1887) Cyperaceae. In: Engler A., Prantl K. (eds) Naturlichen Pflanzenfamilien 1, 2, 2: 98–126. W. Engelmann, Leipzig.
Peter, A. & Kükenthal, G. (1936) Descriptiones plantarum novarum Africae orientalis. Cyperaceae 1. Repertorium Specierum
Novarum Regni Vegetabilis, Beihefte 40, Anhang 1 (4): 123-128.
Podlech, D. (1961) Cyperaceae Africanae. Mitteilungen der Botanischen Staatssammlung München 4: 107–124.
Persoon, C.H. (1805) Synopsis Plantarum 1. Parisiis Lutetiorum. 546 pp.
Piper, C.V. (1901) Cyperaceae. In: Piper, C.V., Beattie, R.K. The Flora of the Palouse Regions. Pullman.
http://dx.doi.org/10.5962/bhl.title.41381
Pursh, F.T. (1813) Florae Americae Septentrionalis or a Systematic Arrangement and Description of the Plants of North
America. White, Cochrane & Co, London, 54–55 pp.
http://dx.doi.org/10.5962/bhl.title.6122
Raymond, L-F.M. (1959) Additional notes on some S.E. Asiatic Scirpus. Le Naturaliste Canadien 86 (11): 230–232.
Raynal, J. (1967) Notes cypérologiques 7. Sur quelques Lipocarpha africains. Adansonia, sér. 2, 7: 81–87.
Raynal, J. (1968) Notes cypérologiques 11. Sur quelques Scirpus et Ascolepis de l’Ancien Monde. Adansonia, sér. 2, 8: 85–104.
Raynal, J. (1970) Notes cypérologiques 16. Deux nouvelles espèces de Lipocarpha. Bulletin du Muséum national d'histoire
naturelle, sér. 2, 41 (4): 974–979.
Raynal, J. (1973) Notes cypérologiques 19. Contribution à la classification de la sous-famille des Cyperoideae. Adansonia, sér.
2, 13 (2): 145–171.
Raynal, J. (1977) Notes cypérologiques 31. Mélanges nomenclaturaux (Cyperoideae) Adansonia, sér. 2, 17: 43–47.
Reutemann, A.G., Pilatti, V. Guarise, N. & Vegetti, A.C. (2014) Typical cyperoid reproductive structures in Lipocarpha
humboldtiana and Ascolepis brasiliensis (Cypereae - Cyperoideae - Cyperaceae): New evidence from a developmental
perspective. Flora 209: 15–22.
http://dx.doi.org/10.1016/j.flora.2013.11.003
Reynders, M., Huygh, W., Larridon, I., Muasya, A.M., Govaerts, R., Simpson, D.A. & Goetghebeur, P. (2011) Nomenclature and
typification of names of genera and subdivisions of genera in the Cypereae (Cyperaceae): 3. Names in segregate genera of
Cyperus. Taxon 60 (3): 885–895.
Reynders*, M., Vrijdaghs*, A., Larridon, I., Huygh, W., Leroux, O., Muasya, M.A. & Goetghebeur, P. (2012) Gynoecial
anatomy and development in Cyperoideae (Cyperaceae, Poales): congenital fusion of carpels facilitates evolutionary
modifications in pistil structure. Plant Ecology and Evolution 145 (1): 96–125. *Equal contribution.
http://dx.doi.org/10.5091/plecevo.2012.675
Richard, L.C.M. (1805) Cyperaceae. in C.H.Persoon, Synopsis Plantarum 1. Parisiis Lutetiorum, 546 pp.
Richard A. (1850) Tentamen florae abyssinicae 2. Bertrand, Paris.
Ridley, H.N. (1884) The Cyperaceae of the west coast of Africa in the Welwitsch herbarium. Transactions of the Linnean Society
of London. Botany 2: 121–172.
http://dx.doi.org/10.1111/j.1095-8339.1884.tb00007.x
Ridley, H.N. (1884) Cyperaceae novae. Journal of Botony 22: 15–17.
Ridley, H.N. (1916) Report on the Botany of the Wollaston Expedition to Dutch New Guinea, 1912–13. Transactions of the
Linnean Society of London, Botany ser. 2, 9: 1–284.
http://dx.doi.org/10.1111/j.1095-8339.1916.tb00009.x
Roemer J.J. & Schultes, J.A. (1817) Systema Vegetabilium 2. Sumtibus J.G. Cottae, Stuttgart.
Roth, A.W. (1821) Novae Plantarum Species. Vogler, Halberstad, 411 pp.
Rottbøll, C.F. (1773) Descriptionum et Iconum Rariores et pro maxima parte novas plantas illustrantium liber primus.
Copenhagen.
http://dx.doi.org/10.5962/bhl.title.9538
Roxburgh, W. (1820) Flora Indica 1. Mission press, Serampore.
Schinz, H. (1890) Beitrage zur Keentnis der Flora von Deutsch-Südwest-Afrika und der angrenzenden Gebiete. Verhandlungen
des Botanischen Vereins für die Provinz Brandenbrug und die Angrenzenden Länder 31: 179–230.

BAUTERS ET AL.30 • Phytotaxa 166 (1) © 2014 Magnolia Press
Schnee, L. (1943) Las Ciperaceas del Herbario Nacional de Venezuela. Boletin de la Sociedad Venezolana de Ciencias Naturales
9: 1–101.
Schrader, H.A. (1821) Analecta ad floram capensem 2. Goettinger gelehrte Anzeiger 1821(3): 2065–2079.
Schultes, J.A. (1824) Mantissa in Volumen Secundum Systematis vegetabilium Caroli a Linné ex editione Roemer, JJ. &
Schultes, J.A., Stuttgardtiae, 60–71 pp.
http://dx.doi.org/10.5962/bhl.title.552
Schumann, K.M. (1895) Cyperaceae. In: Engler, H.G.A. (ed.) Deutsch-Ost-Afrika 5. Die Pflanzenwelt Ost-Afrikas und der
Nachbargebiete. Theil C. Verzeichnis der bis jetzt aus Ost-Afrika bekannt gewordenen Pflanzen. Dietrich Reimer, Berlin.
433 pp.
Shaw, J., Lickey, E.B., Schilling, E.E. & Small, R.L. (2007) Comparison of whole chloroplast genome sequences to choose
Noncoding regions for phylogenetic studies in angiosperms: The tortoise and the hare III. American Journal of Botany 94:
275–288.
http://dx.doi.org/10.3732/ajb.94.3.275
Simmons, M.P. & Ochoterena, H. (2000) Gaps as characters in sequence-based phylogenetic analyses. Systematic Biology 49
(2): 369–381.
Simpson, D.A., Furness, C.A., Hodkinson, T.R., Muasya, A.M. & Chase, M.W. (2003) Phylogenetic relationships in Cyperaceae
subfamily Mapanioideae inferred from pollen and plastid DNA sequence data. American Journal of Botany 90: 1071–1086.
http://dx.doi.org/10.3732/ajb.90.7.1071
Simpson, D.A., Muasya, A.M., Alves, M., Bruhl, J.J., Dhooge S., Chase, M.W., Furness, C.A., Ghamkhar, K., Goetghebeur, P.,
Hodkinson, T.R., Marchant, A.D., Nieuborg, R., Reznicek, A.A., Roalson, E.H., Smets, E., Starr J.R., Thomas, W.W.,
Wilson, K.L. & Zhang, X. (2007) Phylogeny of Cyperaceae based on DNA sequence data - a new rbcL analysis. In:
Columbus, J.T., Friar, E.A., Porter, J.M., Prince, L.M. & Simpson, M.G. (eds.) Monocots: Comparative biology and
evolution. Aliso 23: 72–83. Claremont, Rancho Santa Ana Botanic Garden.
Sibthorp, J. & Smith, J.E. (1806) Flora Graeca 1 (1). Taylor, London, 50 pp.
Smyth, B.B. (1899) Additions to the flora of Kansas. Transactions of the Kansas Academy of Science. 16: 158–167.
Soják, J. (1979, publ. 1980) Fragmenta phytotaxonomica et nomenclatorica 2. Casopsis Narodniho Musea – rada prirodnovedna
148: 193–197.
Sprengel, C.P.J. (1825) Systema Vegetabilium, editio decima sexta 1. Göttingen.
Stamatakis, A. (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed
models. Bioinformatics 22: 2688–2690.
http://dx.doi.org/10.1093/bioinformatics/btl446
Starr, J.R., Harris, S.A. & Simpson, D.A. (2003) Potential of the 5’ and 3’ ends of the intergenic spacer (IGS) of rDNA in the
Cyperaceae: New sequences for lower-level phylogenies in sedges with an example from Ucinia Pers. International
Journal of Plant Sciences 164(2): 213–227.
http://dx.doi.org/10.1086/346168
Steudel, EG. von (1854–55) Synopsis plantarum glumacearum 2. Cyperaceae. J.B. Metzler, Stuttgart, 348 pp.
http://dx.doi.org/10.5962/bhl.title.471
Swartz, O.P. (1788) Nova Genera & Species Plantarum seu Prodromus Descriptionum Vegetabilium Maximam partem
Incongnitorum que sub Itinere in Indiam Occidentalem. Stockholm.
http://dx.doi.org/10.5962/bhl.title.4400
Tang, T.C.J. & Wang, F.T. (1961) Cyperaceae (Scirpeae-Sclerieae). Flora Reipublicae Popularis Sinicae 11.
Torrey, J., Hooker, W.J. (1836) North American Cyperaceae. Annals of the Lyceum of Natural History of New York 3: 239–448;
addenda.
Tucker, G.C. (1987) The genera of Cyperaceae in the SE United States. Journal of the Arnold Arboretum 68: 361–445.
Turril, W.B. (1913) Diagnoses Africanae - Lipocarpha monocephala. Bulletin of Miscellaneous Information Kew 1913: 307.
http://dx.doi.org/10.2307/4111654
Vahl, M. (1805) Enumeratio plantarum 2. Copenhagen, Impenis auctoris, & prostat apud J.H. Schubothe.
Van den Borre, A. (1985) Een revisie van de genera Lipocarpha, Hemicarpha en Rikliella (Cyperaceae). Dissertation, Ghent
University.
Van der Veken, P. (1965) Contribution à l’embryographie systématique des Cyperaceae-Cyperoideae. Bulletin du Jardin
botanique de l'État à Bruxelles 35 (3): 285–354.
http://dx.doi.org/10.2307/3667185
Vrijdaghs, A., Reynders, M., Larridon, I., Muasya, A.M., Smets, E. & Goetghebeur, P. (2010) Spikelet structure and
development in Cyperoideae (Cyperaceae): a monopodial general model based on ontogenetic evidence. Annals of Botany
105 (4): 555–571.
Walter, T. (1788) Flora Caroliniana. J. Fraser, London, 263 pp.
Willdenow, C. (1797) Caroli a Linné Species Plantarum 1 (1), ed. 4. Nauk, Berlin. 495 pp.

Phytotaxa 166 (1) © 2014 Magnolia Press • 31
LIPOCARPHA & VOLKIELLA AS INFRAGENERIC TAXA OF CYPERUS S.L.
APPENDIX 1: Vouchers information and GenBank accession numbers included in this study.
Abbreviation used for analyses, taxa, collector plus number (herbarium acronym), origin and GenBank accession
numbers (ETS1f, trnH-psbA, rpl32-trnL). Underlined species are new accessions for this study.
Outgroup: Cy025CA Cyperus alternifolius L. Goetgh. 11516 (GENT), BG Ghent, HQ705948/HQ705818/HQ705878;
Cy018CH C. haspan L., Muasya 1269 (GENT), Kenya, HQ705927/HQ705803/HQ705860; Cy094KP C.
kyllingiella Larridon, Muasya 1262 (GENT), Kenya, HQ705952/-/-; Cy027KM C. steudneri Larridon, Muasya
1247 (GENT), Kenya, HQ705953/HQ705822/HQ705883; Ingroup: Cy074ali Alinula paradoxa (Cherm.) Goetgh.
& Vorster, C.Reid 1027 (GENT), South Africa, HQ705964/-/HQ705894; Cy116bra Ascolepis brasiliensis (Kunth)
Benth. ex C.B.Clarke, Larridon & al. 2010-304 (GENT), Madagascar, HE993954/HE993894/HE993685;
Cy115bra A. brasiliensis, Larridon & al. 2010-104 (GENT), Madagascar, HF586591/HF586510/HF586553;
Cy127bra A. brasiliensis, Larridon & al. 2010-106 (GENT), Madagascar, HF586592/HF586511/586554; As02cap
A. capensis (Kunth) Ridl., Hess 52/1760 (GENT), Angola, HF586593/HF586512/HF586555; As29eri A.
eriocauloidis (Steud.) Nees ex Steud., de Wilde 7042 (BR), Ethiopia, HE991955/HE993895/-; As20hem A.
hemisphaerica Peter ex Goetgh., Reekmans 6729 (GENT), Burundi, HE993956/-/-; As14pro A. protea Welw.,
Dyer 937 (GENT), Nigeria, HF586594/HF586513/HF586556; As32pro A. protea, Malaisse & al. 9 (BR), Congo,
HF586595/HF586514/HF586557; As03pro A. protea, Lewalle 4156 (GENT), Burundi, HF586596/-/-; As31pro A.
protea, Malaisse & al. 695 (BR), Democratic Republic of the Congo, HE9939957/HE993896/HE993686; As18pse
A. pseudopeteri Goetgh., E.A.Robinson 5896 (GENT), Zambia, -/HF586552/-; As10pus A. pusilla Ridl., Malaisse
& Goetghebeur 846 (GENT), Congo, HE993958/HE993897/-; Cy124CC Cyperus cuspidatus Kunth, Larridon et
al. 2010-0010, Madagascar, HQ705955/HQ705824/HQ705885; Cy045CE Cyperus esculentus L., Goetghebeur
11303 (GENT), BG Ghent, HQ705960/HQ705828/HQ705890; Cy060CP C. papyrus L., Goetghebeur 5866, BG
Ghent, HQ705962/HQ705830/HQ705892; Cy065CR C. rotundus L., Shaw 890 (K), Hong Kong, HQ705963/
HQ705831/HQ705893; Ky110KN Kyllinga nemoralis (J.R.Forst & G.Forst) Dandy ex Hutch. & Dalziell,
Goetghebeur 11518 (GENT), Phillipines, HQ705965 HQ705832 HQ705895; Li01alb Lipocarpha albiceps Ridl.,
H.&E.Hess 52/195 (GENT), Angola, HE994025/HE993944/HE993748; Li31alb L. albiceps, Dyer 727 (GENT),
Congo, HF586597/HF586515/HF586558; Li44ari L. aristulata (Coville) G.Tucker, Lathrop 1380 (US), USA,
HF586598/HF586516/HF586559; Li58bar L. barteri C.B.Clarke, Geerling & Bokdam 2952 (MO), Chad,
HF586599/HF586517/HF586560; Cy119chi L. chinensis (Osbeck) Kern, Larridon & al. 2010-013 (GENT),
Madagascar, HF586600/HF586518/HF586561; Cy129chi L. chinensis, Larridon & al. 2010-036 (GENT),
Madagascar, HF586601/HF586519/HF586562; Cy130chi L. chinensis, Larridon & al. 2010-051 (GENT),
Madagascar, HF586602/HF586520/HF586563; Cy132chi L. chinensis, Larridon & al. 2010-062B (GENT),
Madagascar, HF586603/HF586521/HF586564; Li39chi L. chinensis, Reynders & Sabulo 26 (GENT), Phillipines,
HE994029/HE993948/HE993752; Li33com L. comosa J.Raynal, A.Mincier 1027 (GENT), Zambia, HE994028/
HE993947/HE993751; Li05com L. comosa, Van der Linden 441 (GENT), Malawi, HF586604/HF586522/
HF586565; Li23con L. constricta Goetgh., Lewalle 5152a (GENT), Burundi, HF586605/HF586523/HF586566;
Li35cra L. crassicuspis (Raynal) Goetgh., Vanden Berghen 3059 (GENT), Senegal, HF586626/HF586544/
HF586586; Li45dru L. drummondii (Nees) Tucker, Stevens 2668 (US), USA, HF586606/HF586524/HF58656;
Li27fil L. filiformis (Vahl) Kunth, Porembski 622 (GENT), Ivory Coast, HF586607/HF586525/HF586568; Li41fil
L. filiformis, Vanden Berghen 7913a (BR), Senegal, HE994030/HE993949/HE993753, Li42fil L. filiformis,
Vanden Berghen 6308a (BR), Senegal, HF586608/HF586526/HF586569; Li08fil L. filiformis, Goetghebeur 6012
(GENT), Congo, HF586609/HF586527/HF586570; Li11hem L. hemisphaerica (Roth) Goetgh., Smith 3722
(GENT), Botswana, HF586632/HF586549/-; Li32hem L. hemisphaerica, Hess 52/1962 (GENT), Angola,
HF586633/HF586551/HF586590; Li29hum L. humboldtiana Nees, Jansen-Jacobs 2704 (GENT), Guyana,
HF586610/HF586528/HF586571; Li30hum L. humboldtiana Nees, Hunt 6147 (GENT), Brazil, HF586611/
HF586529/HF586572; Li10hum L. humboldtiana Nees, Beck 10033 (GENT), Bolivia, HF586612/HF586530/
HF586573; Li24ker L. kernii (Raymond) Goetgh., Laegaard 21195 (GENT), Burkina Faso, HE994026/HE993945/
HE993749; Li17ker L. kernii, Laegaard 21177 (GENT), Burkina Faso, HF586613/HF586531/HF586574;
Li18Leu L. leucaspis J.Raynal, Malaisse 8502 (GENT), Congo, HF586614/HF586532/HF586575; Li12mac L.
maculata (Michx.) Torr., McNeilus 91-1186 (GENT), USA, HF586615/HF586533/HF586576; Cy131mex L.
mexicana Liebm., Larridon & al. 2010-052 (GENT), Madagascar, HF586616/HF586534/HF586577; Cy133mex L.
mexicana, Larridon & al. 2010-072 (GENT), Madagascar, HF586617/HF586535/HF586578; Li56mex L. cf.
filiformis, Miller & al. 296 (MO), Mexico, HF586618/HF586536/HF586579; Li26micr L. micrantha (Vahl)
Tucker, Luceño 186 (GENT), Brazil, HE994032/HE993951/-; Li14micr L. micrantha, Luceño 216 (GENT), Brazil,
HF586619/HF586537/-; Li15MIC L. microcephala (R.BR.) Kunth, Desfayes 9804 (GENT), Australia, HF586620/
HF586538/HF586580; Li25MIC L. microcephala, Bruhl & al. 1253 (GENT), Australia, HF586621/HF586539/
HF586581; Cy090na L. nana (Rich.) Cherm., Larridon & al. 2010-193 (GENT), Madagascar, HF586622/
HF586540/HF586582; Cy120na L. nana, Larridon & al. 2010-041A (GENT), Madagascar, HE994031/HE993950/
HE993754; Cy121na L. nana, Larridon & al. 2010-118 (GENT), Madagascar; HF586623/HF586541/HF586583;

BAUTERS ET AL.32 • Phytotaxa 166 (1) © 2014 Magnolia Press
Cy032na L. nana, Hess 52/1753 (GENT), Angola, HF586624/HF586542/HF586584; Li55occ L. occidentalis
(A.Gray) G.C.Tucker, Mason 11904 (US), USA, HF586625/HF586543/HF586585; Li09pri L. prieuriana Steud.,
Laegaard 21159 (GENT), Burkina Faso, HF586631/HF586549/HF586589; Cy122reh L. rehmannii (Ridl.)
J.Raynal, Larridon & al. 2010-320 (GENT), Madagascar, HE994027/HE993946/HE993750; Li20reh L.
rehmannii, Hess 52/1622 (GENT), Angola, HF586627/HF586545/-; Li40reh L. rehmannii, Baudesson & al. 434
(BR), Zimbabwe, HF586628/HF586546/HF586587; Li43rob L. robinsonii J.Raynal, Symoens 10848 (GENT),
Zambia, HF586629/HF586547/-; Li21sal L. salzmanniana Steud., Luceño 256 (GENT), Brazil, HF586630/
HF586548/HF586588; Li28sal L. salzmanniana, Luceño 28 (GENT), Brazil, HE994033/HE993952/-; Py041PP
Pycreus polystachyos (Rottb.) P.Beauv., Goetghebeur 11519 (GENT), South Africa, HQ705966/HQ705833/
HQ7058; Cy071QH Queenslandiella hyaline (Vahl) Ballard, A.M.Muasya 2490 (GENT), Kenya, HQ705967/
HQ705834/HQ705897; Cy072RM Remirea maritima Aubl., Faden et al. 96/48 (GENT) Tanzania, HQ705968/
HQ705835/HQ705898; Cy073sph Sphaerocyperus erinaceus (Ridl.) Lye, Faden et al. 96/358, (GENT) Tanzania,
HQ705969/HQ705836/HQ705899; Vol01 Volkiella disticha Merxm. & Czech, Müller & Giess 493 (GENT),
Namibia, HE994034/HE993953/HE993755.