ArticlePDF Available

Syncytin-1 and its receptor is present in human gametes

Authors:
  • Vitanova Fertility Center
  • Rigshospitalet, Copenhagen University Hostpital, Denmark

Abstract and Figures

To determine whether the true fusogen Syncytin-1 and its receptor (ASCT-2) is present in human gametes using qRT-PCR, immunoblotting and immunofluorescence. Donated oocytes and spermatozoa, originating from a fertility center in tertiary referral university hospital, underwent qRT-PCR, immunoblotting and immunofluorescence analyzes. Quantitative RT-PCR of sperm samples from sperm donors showed that syncytin-1 is present in all samples, however, protein levels varied between donors. Syncytin-1 immunoreactivity predominates in the sperm head and around the equatorial segment. The receptor ASCT-2 is expressed in the acrosomal region and in the sperm tail. Moreover, ASCT-2, but not syncytin-1, is expressed in oocytes and the mRNA level increases with increasing maturity of the oocytes. Syncytin and its receptor are present in human gametes and localization and temporal appearance is consistent with a possible role in fusion between oocyte and sperm.
Content may be subject to copyright.
GAMETE BIOLOGY
Syncytin-1 and its receptor is present in human gametes
B. Bjerregaard &J. G. Lemmen &M. R. Petersen &
E. Østrup &L. H. Iversen &K. Almstrup &L.-I. Larsson &
S. Ziebe
Received: 30 January 2014 / Accepted: 14 March 2014
#Springer Science+Business Media New York 2014
Abstract
Main purpose and research question To determine whether
the true fusogen Syncytin-1 and its receptor (ASCT-2) is
present in human gametes using qRT-PCR, immunoblotting
and immunofluorescence.
Methods Donated oocytes and spermatozoa, originating
from a fertility center in tertiary referral university hospital,
underwent qRT-PCR, immunoblotting and immunofluores-
cence analyzes.
Results Quantitative RT-PCR of sperm samples from sperm
donors showed that syncytin-1 is present in all samples,
however, protein levels varied between donors. Syncytin-1
immunoreactivity predominates in the sperm head and around
the equatorial segment. The receptor ASCT-2 is expressed in
the acrosomal region and in the sperm tail. Moreover, ASCT-
2, but not syncytin-1, is expressed in oocytes and the mRNA
level increases with increasing maturity of the oocytes.
Conclusions Syncytin and its receptor are present in human
gametes and localization and temporal appearance is consis-
tent with a possible role in fusion between oocyte and sperm.
Keywords ASCT-2 .Fertilization .Oocyte .Sperm .
Syncytin
Introduction
The process of fertilization has been an area of intense research
for decades. Fertilization consists of a multitude of steps in
which mature gametes meet and fuse at the correct time and
place. Spermatozoa and cumulus- oocyte complex interaction
result in adhesion, binding and penetration of the zona pellucida
(ZP) by the spermatozoon. This is followed by interaction,
adhesion and fusion of the inner acrosomal membrane of the
spermatozoon and the oocyte plasma membrane (the oolemma)
allowing genetic material of the haploid gametes to merge and
form the totipotent diploid zygote [1].
The spermatozoa must undergo the process of capacitation,
before they gain the capacity to interact and bind to the ZP.
During capacitation, among other changes, decapacitating
factors are shed and the plasma membrane is remodelled
to form membrane rafts on the apical surface of the sperm
head where ZP-binding proteins are concentrated [2,3].
Parts of this work were presented at an oral presentation at the Danish
Fertility Annual meeting in March 2013. No abstract to this presentation.
Capsule Membrane fusion is an important part of fertilization. Here we
present, for the first time, the presence of a true fusogen Syncytin-1 and its
receptor on human gametes.
This work was conducted at The Fertility Clinic, Rigshospitalet and at the
Faculty of Life Science, University of Copenhagen
B. Bjerregaard :E. Østrup :L.<I. Larsson
Faculty of Life Science, University of Copenhagen, Copenhagen,
Denmark
J. G. Lemmen :M. R. Petersen :L. H. Iversen :S. Ziebe (*)
The Fertility Clinic, Copenhagen University Hospital,
Rigshospitalet, 2100 Copenhagen, Denmark
e-mail: sziebe@rh.dk
K. Almstrup
Department of Growth and Reproduction, Copenhagen University
Hospital, Rigshospitalet, 2100 Copenhagen, Denmark
Present Address:
B. Bjerregaard
Symphogen A/S, Elektrovej, 2800 Lyngby, Denmark
Present Address:
E. Østrup
Department of Biomaterials, University of Oslo, 0455 Oslo, Norway
Present Address:
L.-I. Larsson
Department of Pathology, Copenhagen University Hospital,
Hvidovre, 2650 Hvidovre, Denmark
JAssistReprodGenet
DOI 10.1007/s10815-014-0224-1
Capacitation enables the spermatozoa to perform the acro-
some reaction (AR), in which the plasma membrane and
outer acrosomal membrane fuse to release the acrosomal con-
tent [1]. The fertilization process therefore consists of two
independent membrane fusion events, i.e. the AR and the
fusion between the membrane of the spermatozoon and the
oolemma. While SNARE fusion proteins (SNARE is an acro-
nym derived from SNAP (Soluble NSF Attachment Protein
REceptor)) are involved during membrane fusion in the AR
[4,5], the fusogenic molecules involved in fusion of the
spermatozoon and oocyte have eluded identification [68].
Following ZP penetration the fertilizing spermatozoon ad-
heres in a parallel manner to the oolemma at the equatorial
segment [1]. This is the initial step leading to actual membrane
fusion, hereby establishing cytoplasmic continuity. The adhe-
sion protein Izumo-1 is located on the acrosomal region of the
spermatozoon (demonstrated in mouse and human) and is
only accessible following the AR [9]. Izumo-1 is essential
for gamete adhesion before fusion of the inner acrosomal
membrane and oolemma [9]. On the oolemma the tetraspanins
CD9 and CD81 form tetraspanin webs which interact with
Izumo-1, however only CD9-/- and CD81-/- double knockout
mice are completely infertile, suggesting a capacity for one of
the two to partly compensate for the other [10]. Tetraspanin
webs are, among a multitude of properties, involved in cell-
cell adhesion and viral infections [11], but is not known to
have any membrane fusion capabilities [12].
Besides Izumo-1 and the tetraspanins CD9 and CD81,
several other molecules have been suggested to participate in
membrane fusion, on the oolemma (integrins, glucosyl phos-
phatidylinositol (GPI-1 anchored protein)) and spermatozoon
(disintegrin and a metalloprotease (ADAM) (e.g. the
disintegrins fertilin βand cyritestin)) [68].
The viral envelope protein Syncytin is an example of a
fusogen [12,13]. Syncytins participate in cell fusion in the
placenta (trophoblast cells) [1416], in muscles (myoblasts)
[17], bone marrow (osteoclasts) [18] and in cancer [19,20].
Syncytin-1 (ERVW-1), which is expressed in humans, binds
to a neutral amino acid transporter (the D-type retroviral
receptor: ASCT-2 (SLC1A5)) and employs another transporter
(ASCT-1 (SLC1A4)) as an auxiliary receptor [14,21].
We therefore decided to investigate whether the fusogen
Syncytin-1 and its receptor ASCT-2 were present in human
spermatozoa and oocytes.
Material & methods
Oocytes and semen samples
Oocytes were obtained from patients attending infertility treat-
ment at the fertility clinic of Rigshospitalet, University Hospital
of Copenhagen, Denmark. The inclusion criteria were indication
for IVF or ICSI treatment, female age between 25 and 37 years
(both inclusive) and regular menstrual cycles (2135 days, both
inclusive). Exclusion criteria were: medical or genetic conditions
known to interfere with IVF treatment. The couple or single
woman was informed both orally and with written patient infor-
mation material. The oral information was given no later than
2 days before oocyte pickup. Couples could choose to donate 1)
immature oocytes; MI or GV and/or 2) MII oocytes still not
fertilized on the day of embryo transfer (embryo transfer con-
ducted on day 2 after oocyte pickup). The couple or the donor
woman was informed about all aspects of the study and written
consent was obtained from all participants before inclusion in the
study. Semen samples were obtained from donors with a priori
known normal semen quality. Semen was recovered via a sperm
bank, in which donors received a fee for each sample delivered.
Hormonal treatment of oocyte donors
Long protocols using down-regulation with GnRH-agonists
(Synarela, Pharmacia, Denmark; Suprefact, Aventis Pharma,
Denmark) for at least 14 days or short protocol using GnRH-
antagonists (Orgalutran, Organon, Copenhagen, Denmark;
Cetrotide, MerckSerono, Copenhagen, Denmark) were applied.
Patients were stimulated with recombinant FSH (Puregon, Or-
ganon; Gonal-F, Copenhagen, Serono) or urine derived FSH
(Menopur, Ferring, Copenhagen, Denmark) and ovulation in-
duced by urine derived hCG (Profasi, Serono, Pregnyl, Orga-
non) or Ovitrelle (MerckSerono, Denmark). Oocyte aspiration
was performed according to the standard procedure of the clinic.
Collection of oocytes and sperm cells
Immature oocytes and surplus spermatozoa were donated on
the day of oocyte pickup. Unfertilized oocytes from IVF and
ICSI were donated on the day of transfer, approximately 48 h
after oocyte pickup. For protein analysis, both pooled oocytes,
single oocytes and spermatozoa pellets were placed in
Eppendorf tubes, respectively, with 5200 μl RIPA lysis buffer
andstoredat20 °C until analysis. For RNA analysis both
pooled and single oocytes were placed in microtubes containing
20 μl TRIzol (Invitrogen, Carlsbad, CA, USA) and stored at
20 °C until analysis. Semen samples were centrifuged (5 min
at 16,000 g) and dissolved directly in lysis buffer (Macherey-
Nagel, Düren, Germany). For immunocytochemistry, sperma-
tozoa were spread on SuperFrost plus slides (Thermo Scientific,
Walldorf, Germany), fixed in 1 % paraformaldehyde and stored
in a dark at room temperature until further analysis.
Immunocytochemistry
Fixed spermatozoa were hydrated in PBS and processed for
immunostaining. Initially, samples were blocked with 10 %
goat serum and incubated overnight at 4 °C with mouse
J Assist Reprod Genet
monoclonal anti-syncytin-1 (human, 7E3, 5 μg/ml) [17]or
polyclonal rabbit anti-ASCT2 (10 μg/ml, Abcam, Cambridge,
UK). The following day, samples were washed three times in
PBS and incubated with species-specific antibodies labelled
with Alexa-594 or Alexa-488 (5 μg/ml, Molecular Probes,
Eugene, OR, USA), respectively. Nuclei were stained with
bisbenzimide (Hoechst 33 258; Sigma, St. Louis, MO, USA).
The specimens were mounted on glass slides using DAKO
fluorescent mounting medium (DAKO, Glostrup, Denmark).
Controls, including use of isotype-matched monoclonal anti-
bodies, and pre-absorption of the polyclonal ASCT-2 antibody
as well as conventional staining controls were included.
SDS-PAGE and immunoblotting
Extraction, SDS-PAGE and electroblotting were performed as
described by Mortensen [22]. Antibodies to syncytin-1 (7E3
mouse monoclonal anti-human, 1.5 μg/ml) or ASCT-2 (rabbit
polyclonal anti-human 10 μg/ml) were used in combination
with chemiluminescent detection and the intensities of the
bands were quantitated using NIH Image software [22].
Syncytin-1 protein levels were reported relative to β-actin
protein levels to adjust for loading effects.
RNA purification
Total RNA from oocytes was isolated using TRIzol (Invitrogen)
according to the manufacturers recommendations with a few
modifications. Phase separation was facilitated using the max-
tract High Density tubes (Qiagen, Hilden, Germany), 0.5 μL
glycogen (Roche, Mannheim, Germany) was used as carrier for
the precipitation of RNA, and the dried RNA-pellet was directly
used in the reversed transcription (RT).
Total RNA from spermatozoa was isolated by dissolving a
pellet of sperm directly in lysis buffer and following the
procedure of the Nucleospin® RNA II kit (Macherey-Nagel,
Düren, Germany) using on-column DNA digestion. The RNA
concentration was measured using a NanoDrop instrument
(Thermo Fisher Scientific, Wilmington, USA).
RNA from whole testicular tissue was obtained from com-
mercial vendors (Clonetech, Saint-Germain-en-Laye, France
and Ambion, Paisley, UK).
Quantitative real-time RT-PCR
The RNA-pellet was dissolved in a total volume of 8 μl, con-
taining 16 ng/μL random hexamer primers (Fermentas, St.
Leon, Germany), 8 ng/μL(μM) oligo dT primers (Fermentas),
and 0.05 μL RNase H Minus, Point Mutant (Promega, Madison,
WI, USA). RNA was incubated at 70 °C to denature RNA
secondary structure and then quickly chilled on ice to let the
primers anneal to the RNA. 1× buffer (Promega), 0.5 mM
dNTPs (Fermentas), 200 U M-MLV Reverse Transcriptase
(Promega), and 0.025 μL RNase H Minus, Point Mutant
(Promega) were added to a final volume of 12.5 μL. The reverse
transcription was performed at 42 °C for 1 h and the enzyme was
inactivated at 95 °C for 5 min. Quantitative RT-PCR was per-
formed using LightCycler® Fast Start DNA Master SYBR
Green I and the LightCycler® Real-Time PCR system (Roche,
Mannheim, Germany). Primers used for syncytin-1 were: right:
CCCCATCGTATAGGAGTCTT and left: CCCCATCAGACA
TACCAGTT, producing an amplicon of 207 bp, while primers
for ASCT-2 were: right: CCGCTTCTTCAACTCCTTCAA and
left: ACCCACATCCTCCATCTCCA, producing an amplicon
of 121 bp. The identity of the amplicons was confirmed by
sequencing. Results were normalized to GAPDH (right:
CAGGTGGTCTCCTCTGACTT and left: TGCTGTAGCC
AAATTCGTTGT, producing an amplicon of 127 bp).
BeWo-cells, which have previously been shown to express
syncytin-1 [23], were used as positive control, and a no
template control was made in all runs, using water instead of
cDNA. An intron spanning GAPDH-primer was used in the
qRT-PCR to identify possible genomic DNA contamination.
The relative expression was calculated using the ddCt-
method, with GAPDH as reference gene.
RT-PCR
cDNA synthesis was performed by adding a 4:1 mixture of
oligo-dT20 and random hexamers (0.5 μg/μl), 5× cDNA
synthesis buffer (650 mM TrisHCl pH: 8.3; 25 mM MgCl2;
100 mM KCl2), 25 mM dNTP mix (GE Healthcare, Brondby,
Denmark) and AMV reverse transcriptase (Affymetrix, Cleve-
land, USA) to 1 ug of heat denaturated (65 ° C) RNA. cDNA
synthesis was performed by incubating the samples at 42 ° C
for 1 h. Finally 0.1 % triton X-100 was added and cDNA
denaturated at 95 ° C for 1 min. PCR was performed by
adding 10× DDRT buffer (100 mM TrisHCl pH 8.4;
500 mM KCL; 18 mM MgCl2; 1 % Triton), 2.5 mM dNTP
mix, Taq polymerase (GE Healthcare) and primers at a con-
centration of 1 pmol/μl. Cycle conditions were: 1 cycle of
5 min at 95 °C; 40 cycles of 30 s at 95 ° C, 1 min at 64 ° C,
1 min at 72 ° C and 1 cycle of 5 min at 72 °C. Representative
bands from each primer combination were excised and
sequenced for verification (Eurofins MWG, Germany).
Results
Syncytin-1 and ASCT-2 is expressed in human sperm
Reverse transcriptase-polymerase chain reaction (RT-PCR) of
RNA isolated from eight different donors showed that
syncytin-1 was present in all samples (data not shown). Ge-
nomic contamination was avoided by on-column DNase di-
gestion during RNA purification and the use of intron-
JAssistReprodGenet
spanning primers. The syncytin-1 receptor, ASCT-2, was also
detectable in most donor ejaculates, however in some donors
at a very low level. ASCT-2, but not Syncytin-1 expression
was detected in RNA from whole testicular tissue. The
identity of the bands corresponding to syncytin-1 and ASCT-
2were verified by sequencing.
Immunoblotting using an antiserum against the extracellular
domain of syncytin-1 revealed an immunoreactive band around
60 kDa in extracts of eight different donors corresponding in size
to a syncytin-1 component previously demonstrated to be present
in the placenta [17,15]. The protein level of syncytin-1 varied
among the different semen donors (Fig. 1). ASCT-2 was detected
in all semen samples, but appeared less abundant than syncytin-
1. A similar variation in protein levels between samples was
observed, despite using equal amount of protein in each well.
Syncytin-1 and ASCT-2 is localized at the acrosomal region
and equatorial segment of the spermatozoa
Immunofluorescence staining of fixed spermatozoa from eight
different donors showed that syncytin-1 immunoreactivity
ASCT2
Syncytin-1
B-actin
B-actin
Fig. 1 Expression of syncytin-1 and its receptor ASCT-2 by human
sperm. Western blot showing syncytin-1 and ASCT-2 immunoreactive
bands in samples from eight different sperm donors, respectively. Below,
reprobing for β-actin is shown
Fig. 2 Localizationof syncytin-1in human sperm. Immunofluorescence
images of fixed representative sperm samples from different sperm do-
nors stained with a monoclonal antibody raised to the extracellular
domain of syncytin-1 (ac). Note staining of Syncytin-1 in the head of
the spermatozoa and around the equatorial segment. Slight staining of the
midpiece and tail also noted. d shows an isotype matched control.
(Scalebar 20 μm, objective: 100×/1.30 PL Fluotar)
J Assist Reprod Genet
was predominately present in the acrosomal region of the
spermatozoa (Fig. 2). If the acrosomal region was not stained,
syncytin-1 was localized at the equatorial segment only. Slight
staining of the midpiece and tail was also noted. There was no
obvious difference in the syncytin-1 localisation between the
different donors.
ASCT-2 was predominately localized to the acrosomal
region and in the tail region (Fig. 3). Controls, including use
of type-matched monoclonal antibodies and pre-absorption of
the polyclonal ASCT-2 antibody, as well as conventional
staining controls were all negative.
The receptor ASCT-2 is expressed in human oocytes
A total of 80 oocytes (GV: 20, MI: 25, MII: 35) were included
in the analysis. Quantitative RT-PCR showed that ASCT-2 was
expressed in all of the evaluated stages of oocyte maturation
(Fig. 4). There was significantly higher expression of ASCT-2
in mature MII stage oocytes compared to the immature GV-
stage (p=0.027). However, expression of syncytin-1 was not
detected in any of the oocytes examined.
Fig. 3 Localization of ASCT-2 in human sperm. Immunofluorescence
images of fixed representative sperm samples from different sperm do-
nors stained with an anti-ASCT-2 (ac). Note staining in the acrosomal
region of the spermatozoa and scarce staining of the tail. d shows a control
with pre-absorption of the primary antibody. (Scalebar 20 μm, objective:
100×/1.30 PL Fluotar)
Syncytin expression levels
0
10
20
30
40
50
60
70
GV MI MII
a
b
a,b
Fig. 4 Expression of ASCT-2 in human oocytes. Quantiatative RT-PCR
of ASCT-2 in oocytes at different developmental stages showed that the
mRNA level increases as the oocytesmature. Chi-square test was applied
to evaluate potential statistical significant differences, level of signifi-
cance p0.05. a,bindicates significant difference, p<0.027
JAssistReprodGenet
Discussion
Membrane fusion plays an essential role in mammalian fertil-
ization, however a specific fusogen involved in fertilization
has yet to be identified. Our findings demonstrate the presence
of the fusogen syncytin-1 and its receptor ASCT-2 in human
gametes. Syncytin-1 is predominantly localized at the acroso-
mal region of the spermatozoa. However, in a subset of cells it
is exclusively localized to the equatorial segment. The process
of capacitation and AR can beinduced in vitro during gradient
centrifugation, media exposure etc., however the extent varies
between species [24], and only a smaller fraction of human
spermatozoa will undergo the AR reaction in vitro [25,26].
The observed localization of syncytin-1, equatorial segment or
acrosomal region, respectively could depend upon whether
the spermatozoa had undergone the AR ornot. Localization of
a fusogen at the equatorial segment is supported by electron
microscopy findings demonstrating gamete membrane fusion
being initiated at the equatorial segment [27,1]. Moreover, the
fusogen (syncytin-1) and its receptor (ASCT-2) is expressed
in spermatozoa and oocytes, respectively. In contrast to sper-
matozoa expressing syncytin-1, none of the analyzed oocytes
expressed the fusogen, but only itsreceptor.
Syncytin belongs, as mentioned, to a family of endogenous
retroviruses [13]. Introduction of syncytin expression in a cell
line prevents retrovirus infection [28], suggesting that co-
expression of syncytin and its receptor will block either of
the two [29]. Co-expression of syncytin-1 and ASCT-2 on
spermatozoa could therefore function as a regulator of
syncytin, preventing membrane fusion at the acrosomal region
until the correct time and place.
In oocytes, we find that the ASCT-2 mRNA level signifi-
cantly related to oocyte maturity from the germinal vesicle to
the metaphase 2 stage. Due to shortage of fresh metaphase II
(MII) oocytes we evaluated ASCT-2 mRNA in MII oocytes
48 h after oocyte pickup, which potentially also could affect
expression level. Since syncytin-1 is present and localized at
the right place in spermatozoa and ASCT-2 is present in the
mature oocytes, this suggests that the fusogen syncytin-1 and
its receptor could be involved in membrane fusion of the
human gametes.
Previous studies have demonstrated the essential involve-
ment of the tetraspanins CD9 and CD81 in fertilization [30].
CD9 and CD 81 have been shown also to participate in
membrane fusion during retrovirus infection [31]. All together
the demonstration of syncytin-1 on the equatorial segment of
spermatozoa supports the model suggested by Nixon et al. [6],
linking documented membrane adhesion factors of impor-
tance to membrane fusion during fertilization.
The finding from the present study may potentially have
significant impact on clinical decision making in assisted
reproduction programs. Assuming that the presence of
Syncytin-1 on spermatozoa is a necessity for gamete
membrane fusion during fertilization, analysis for its pres-
ence may directly impact clinical decisions like choice of
treatment strategy. A high level of Syncytin-1, enabling
gamete membrane fusion, would be supportive of insemi-
nation or standard in vitro fertilization, whereas low level
or absence of Syncytin-1 would indicate the use of ICSI
treatment.
Further, the presence of Syncytin-1 may be used as a
diagnostic tool when evaluating a mansreproductivepoten-
tial. Consequently, it may also be used to decide if a man
should be used as sperm donor or not.
The presence of the receptor on the oocytes may be utilized
in pharmaceutical or culture related interventions as an indi-
cator of the developmental competence of the oocytes.
In conclusion, syncytin-1 and ASCT-2 are expressed in
human gametes with localization and temporal appearance
consistent with a possible role in fusion between oocyte and
spermatozoon. Moreover, it is the first time a true fusogen has
been identified in human gametes.
Reduced or total failure of syncytin-1 or ASCT-2 expres-
sion in spermatozoa or oocytes respectively, could potentially
cause fertilization failure, which would be circumvented by
ICSI. However, future functional studies are needed to exam-
ine whether the fusogen syncytin-1 is essential for human
fertilization.
Ethical statement All participating persons gave their informed con-
sent prior inclusion in the study. The Danish Ethical committee approval
was obtained before the study was initiated (J. nr H-B-2008-150).
Conflict of interest The authors declare that they have no conflict of
interest.
References
1. Yanagimachi R. Mammalian fertilization. In: Knobil E, Neill J,
editors. The physiology of reproduction. 2nd ed. New York: Raven;
1994. p. 189317.
2. van Gestel RA, Brewis IA, Ashton PR, Brouwers JF, Gadella BM.
Multiple proteins present in purified porcine sperm apical
plasmamembranes interact with the zona pellucida of the oocyte.
Mol Hum Reprod. 2007;13:44554.
3. Nixon B, Mitchell LA, Anderson AL, Mclaughlin EA, Obryan MK,
Aitken RJ. Proteomic and functional analysis of human sperm deter-
gent resistant membranes. J Cell Physiol. 2011;226:265165.
4. Blas GAD, Roggero CM, Tomes CN, Mayorga LS. Dynamics of
SNARE assembly and disassembly during sperm acrosomal exocy-
tosis. PLoS Biol. 2005;3:e323.
5. Rodriguez F, Bustos MA, Zanetti MN, Ruete MC, Mayorga LS,
Tomes CN. alfa-SNAP prevents docking of the acrosome during
sperm exocytosis because it sequesters monomeric syntaxin. PLoS
One. 2011;6:e21925.
6. Nixon B, Aitken RJ, McLaughlin EA. New insights into the
molecular mechanisms of sperm-egg interaction. Cell Mol Life
Sci. 2007;64:180523.
J Assist Reprod Genet
7. Sutovsky P. Spermegg adhesion and fusion in mammals. Expert
Rev Mol Med. 2009;11:e11.
8. Evans JP. Sperm-egg interaction. Annu Rev Physiol. 2012;74:
477502.
9. Inoue N, Ikawa M, Isotani A, Okabe M. The immunoglobulin
superfamily protein Izumo is required for sperm to fuse with eggs.
Nature. 2005;434:2348.
10. Rubinstein E, Ziyyat A, Prenant M, Wrobel E, Wolf JP, Levy S, et al.
Reduced fertility of female mice lacking CD81. Dev Biol. 2006;290:
3518.
11. Yunta M, Lazo PA. Tetraspanin proteins as organisers of membrane
microdomains and signalling complexes. Cell Signal. 2003;15:
55964.
12. Oren-Suissa M, Podbilewicz B. Cell fusion during development.
Trends Cell Biol. 2007;17:53746.
13. Weissenhorn W, Hinz A, Gaudin Y. Virus membrane fusion. FEBS
Lett. 2007;581:21505.
14. Blond JL, Lavillette D, Cheynet V, Bouton O, Oriol G, Chapel-
Fernandes S. An envelope glycoprotein of the human endogenous
retrovirus HERV-W is expressed in the human placenta and fuses
cells expressing the type D mammalian retrovirus receptor. J Virol.
2000;74:33219.
15. Mi S, Lee X, Li X, Veldman GM, Finnerty H, Racie L, et al. Syncytin
is a captive retroviral envelope protein involved in human placental
morphogenesis. Nature. 2000;403:7859.
16. Dupressoir A, Vernochet C, Bawa O, Harper F, Pierron G, Opolon P,
et al. Syncytin-A knockout mice demonstrate the critical role in
placentation of a fusogenic, endogenous retrovirus-derived, envelope
gene. Proc Natl Acad Sci U S A. 2009;106:1212732.
17. Bjerregaard B, Talts JF, Larsson LI. The endogenous envelope
protein syncytin is involved in myoblast fusion. In: Larsson LI,
editor. Cell fusions, regulation and control. New York: Springer;
2011. p. 26775.
18. Søe K, Andersen TL, Hobolt-Pedersen AS, Bjerregaard B, Larsson LI,
Delaissé JM. Involvement of human endogenous retroviral syncytin-1
in human osteoclast fusion. Bone. 2011;48:83746.
19. Bjerregaard B, Holck S, Christensen IJ, Larsson LI. Syncytin is
involved in breast cancer-endothelial cell fusions. Cell Mol Life
Sci. 2006;63:190611.
20. Strick R, Ackermann S, Langbein M, Swiatek J, Schubert SW,
Hashemolhosseini S, et al. Proliferation and cell-cell fusion of endo-
metrial carcinoma are induced by the human endogenous retroviral
syncytin-1 and regulated by TGF-beta. J Mol Med. 2007;85:2338.
21. Lavillette D, Marin M, Ruggieri A, Mallet F, Cosset FL, Kabat D.
The envelope glycoprotein of human endogenous retrovirus type W
uses a divergent family of amino acid transporters/cell surface recep-
tors. J Virol. 2000;76:644252.
22. Mortensen K, Lichtenberg J, Thomasen PD, Larsen LI. Spontaneous
fusion between cancer cells and endothelial cells. Cell Mol Life Sci.
2004;61:212531.
23. Yu C, Shen K, Lin M, Chen P, Lin C, Chang GD, et al. GCMa
regulates the syncytin-mediated trophoblastic fusion. J Biol Chem.
2002;277:500628.
24. Ikawa M, Inoue N, Benham AM, Okabe M. Fertilization: a sperms
journey to and interaction with the oocyte. J Clin Invest. 2010;120:
98494.
25. Mallet PJ, Stock CE, Fraser LR. Acrosome loss in human sperm
incubated in vitro under capacitating conditions. Int J Androl. 1985;8:
35764.
26. Green S, Fishel S, Rowe P. The incidence of spontaneous acrosome
reaction in homogeneous populations of hyperactivated human sper-
matozoa. Hum Reprod. 1999;14:181922.
27. Bedford JM, Cooper GW. Membrane fusion events in the fertilization of
vertebrate eggs. In: Poste G, Nicholson GL, editors. Cell surface reviews.
Amsterdam: Elsevier/North-Holland Biomedical press; 1978. p. 65125.
28. Ponferrada VG, Mauck BS, Wooley DP. The envelope glycoprotein
of human endogenous retrovirus HERV-W induces cellular resistance
to spleen necrosis virus. Arch Virol. 2003;148:65975.
29. Potgens AJG, Drewlo S, Kokozidou M, Kaufmann P. Syncytin: the
major regulator of trophoblast fusion? Recent developments and
hypotheses on its action. Hum Reprod Update. 2004;10:48796.
30. Rubinstein E, Ziyyat A, Wolf JP, Le Naour F, Boucheix C. The
molecular players of sperm-egg fusion in mammals. Semin Cell
Dev Biol. 2006;17:25463.
31. Gordon-Alonso M, Yañez-Mó M, Barreiro O, Álvarez S, Muñoz-
Fernández MÁ, Valenzuela-Fernández A, et al. Tetraspanins CD9
and CD81 modulate HIV-1-induced membrane fusion. J Immunol.
2006;177:512937.
JAssistReprodGenet
... In the next fusion event, the acrosomal inner membrane fuses with the oolemma, permitting the transfer of sperm genetic material to the egg cytoplasm. Although there are no functional studies supporting this, hypothetically, both of these fusion events may require the fusogenic role of syncytin [47][48][49]. During fertilization, there is a fusion between the sperm and the egg membrane (oolemma). ...
... In the next fusion event, the acrosomal inner membrane fuses with the oolemma, permitting the transfer of sperm genetic material to the egg cytoplasm. Although there are no functional studies supporting this, hypothetically, both of these fusion events may require the fusogenic role of syncytin [47][48][49]. ...
... Quantitative RT-PCR studies of the syncytin-1 expression in the human gametes showed that syncytin-1 is present in the sperm head, while its receptor ASCT-2 is expressed in the acrosome and the sperm tail. The ASCT-2 is also expressed in the oocytes/eggs [47,48]. These findings suggest that the lack or reduced expression of syncytin-1 and its receptor may lead to fertilization failure and open new avenues for the treatment of infertility. ...
Article
Full-text available
Human placenta formation relies on the interaction between fused trophoblast cells of the embryo with uterine endometrium. The fusion between trophoblast cells, first into cytotrophoblast and then into syncytiotrophoblast, is facilitated by the fusogenic protein syncytin. Syncytin derives from an envelope glycoprotein (ENV) of retroviral origin. In exogenous retroviruses, the envelope glycoproteins coded by env genes allow fusion of the viral envelope with the host cell membrane and entry of the virus into a host cell. During mammalian evolution, the env genes have been repeatedly, and independently, captured by various mammalian species to facilitate the formation of the placenta. Such a shift in the function of a gene, or a trait, for a different purpose during evolution is called an exaptation (co-option). We discuss the structure and origin of the placenta, the fusogenic and non-fusogenic functions of syncytin, and the mechanism of cell fusion. We also comment on an alleged danger of the COVID-19 vaccine based on the presupposed similarity between syncytin and the SARS-CoV-2 spike protein.
... Our group recently found Syncytin-1 (ERVW-1) to locate to the equatorial segment of spermatozoa, and its receptor ASCT2, an amino acid transporter, to be expressed by both spermatozoa and oocytes. 9 Syncytin is an endogenous retroviral envelope protein originating from the HERV-W virus family and is involved in the cell-cell fusion in the placenta, bones, muscle and immune system. 10 Another protein located in the equatorial segment is the polypeptide N-acetylgalactosaminyltransferase 3, also known as GalNac-T3. ...
Article
Full-text available
Background: Couples increasingly experience infertility and seek help from assisted reproductive techniques to become pregnant. However, 5%-15% of the couples that are selected for in vitro fertilisation (IVF) experience a total fertilisation failure (TFF), where no zygotes develop despite oocytes and semen parameters appear to be normal. We hypothesise that TFF during IVF could be related to improper membrane fusion of gametes. Objective: To investigate the membrane integrity and fusion proteins in spermatozoa from men in couples experiencing TFF. Materials and methods: A total of 33 infertile couples, 17 of which experienced TFF during IVF and 16 matched control couples with normal IVF fertilisation rates, were selected and the men re-called to deliver an additional semen sample. Proteins involved in gamete membrane fusion on spermatozoa (IZUMO1, SPESP1 and Syncytin-1) as well as O-glycosylation patterns (Tn and GALNT3), were investigated by immunofluorescence. The DNA fragmentation index, acrosomal integrity and viability of spermatozoa were determined by flow and image cytometry. Results: No significant changes in the expression of GALNT3, Tn and Syncytin-1 were observed between the TFF and control groups. The fraction of spermatozoa expressing SPESP1, the median IZUMO1 staining intensity, and the percentage of viable acrosome-intact spermatozoa were significantly lower in the TFF group compared to controls. Furthermore, following progesterone-induced acrosomal exocytosis, a significant difference in the fraction of spermatozoa expressing SPESP1 and the median IZUMO1 staining intensity were observed between the control and TFF group. Discussion and conclusion: Our results indicate that acrosomal exocytosis, IZUMO1 and SPESP1 expression in spermatozoa could play a crucial role in achieving fertilisation during IVF. However, the size of our cohort was quite small, and our results need to be validated with quantitative methods in larger cohorts.
... Regarding single retroviral genes, there is consensus that syncytins play essential roles in placenta formation and embryonic and fetal growth. In particular, SYN1 transcription is selectively preserved in spermatozoa [70] and can bind with its receptor on oocytes [71], presumably to facilitate the fusion between gametes and the first steps of embryonic development, as emerged for HERV-K in preimplantation blastocysts and pluripotent stem cells [72]. SYN1 is expressed in all circulating leucocytes [73]; upon stimulation, it promotes rapid activation of monocytes [22], synthesis of chemokines and cytokines [20,74], and C reactive protein via TLR3/IL-6 pathway [32]. ...
Article
Full-text available
Human endogenous retroviruses (HERVs) are relics of ancestral infections and represent 8% of the human genome. They are no longer infectious, but their activation has been associated with several disorders, including neuropsychiatric conditions. Enhanced expression of HERV-K and HERV-H envelope genes has been found in the blood of autism spectrum disorder (ASD) patients, but no information is available on syncytin 1 (SYN1), SYN2, and multiple sclerosis-associated retrovirus (MSRV), which are thought to be implicated in brain development and immune responses. HERV activation is regulated by TRIM28 and SETDB1, which are part of the epigenetic mechanisms that organize the chromatin architecture in response to external stimuli and are involved in neural cell differentiation and brain inflammation. We assessed, through a PCR realtime Taqman amplification assay, the transcription levels of pol genes of HERV-H, -K, and -W families, of env genes of SYN1, SYN2, and MSRV, as well as of TRIM28 and SETDB1 in the blood of 33 ASD children (28 males, median 3.8 years, 25–75% interquartile range 3.0–6.0 y) and healthy controls (HC). Significantly higher expressions of TRIM28 and SETDB1, as well as of all the HERV genes tested, except for HERV-W-pol, were found in ASD, as compared with HC. Positive correlations were observed between the mRNA levels of TRIM28 or SETDB1 and every HERV gene in ASD patients, but not in HC. Overexpression of TRIM28/SETDB1 and several HERVs in children with ASD and the positive correlations between their transcriptional levels suggest that these may be main players in pathogenetic mechanisms leading to ASD.
... EVs have also been reported to deliver their cargo into target cells via direct membrane fusion with the cell membrane, with EV surface proteins syncytin-1 and syncytin-2 seemingly playing a significant role in this [190][191][192]. Originally found on the plasma membranes of placental trophoblast cells [190,191], gamete cells [190,193] and various cancerous and non-cancerous cells known to fuse directly with other cells [190,[194][195][196][197], these proteins have also been detected on EVs secreted from these cells [190,192]. In light of this, incorporating these surface proteins into EVs to increase their uptake via direct membrane fusion might be a possible way to evade endocytosis and lysosomal degradation completely. ...
Chapter
Full-text available
Most cells secrete vesicles into the extracellular environment to interact with other cells. These extracellular vesicles (EVs), have undergone a paradigm shift upon the discovery that they also transport important material including proteins, lipids and nucleic acids. As natural cargo carriers, EVs are not recognised by the immune system as foreign substances, and consequently evade removal by immune cells. These intrinsic biological properties of EVs have led to further research on utilising EVs as potential diagnostic biomarkers and drug delivery systems (DDSs). However, the internalisation of EVs by target cells is still not fully understood. Moreover, it is unclear whether EVs can cross certain biological membranes like the blood-brain barrier (BBB) naturally, or require genetic modifications to do so. Hence, this review aims to evaluate the relationship between the composition of EVs and their association with different biological membranes they encounter before successfully releasing their cargo into target cells. This review identifies specific biomarkers detected in various EVs and important biological barriers present in the gastrointestinal, placental, immunological, neurological, lymphatic, pulmonary, renal and intracellular environments, and provides a recommendation on how to engineer EVs as potential drug carriers based on key proteins and lipids involved in crossing these barriers.
... Binding to its main receptor SLC1A5, almost exclusively expressed in villous cytotrophoblast, initiates the fusion process to form the syncytiotrophoblast (Lavillette et al., 2002;Roberts et al., 2021). In the female or male reproductive tract, a lower syncytin-1 expression has been described also for oocytes, testes, and spermatozoa (Bjerregaard et al., 2014;Bergallo et al., 2021), but also for adrenal tissue, bone marrow, white blood cells, breast, colon, kidney, ovary, prostate, skin, spleen, thymus, thyroid, brain and trachea (de Parseval et al., 2003). ...
Article
This opinion paper briefly presents arguments that support the unlikelihood of an impact on female fertility from current covid-19 vaccines.
... [8] Bjerregaard et al. first demonstrated the presence of syncytin 1 and its receptor SLC1A5 in human gametes. [9] Syncytin 2 has been found to have an immunosuppressive domain, [10] which may protect the fetus against the maternal immune system. [11] During embryo development, a number of HERVs are transcribed when the genome is first activated [12] and some of these endogenous retroviral elements are expressed in normal tissues, [13] as well as diseased states in later stages of development. ...
... Està present també als gàmets humans. 117,118,119 És ben sabut que els anticossos contra proteïnes placentàries, entre elles la sincitina-1, contra els sincitiotrofoblasts de la superficie fetal, són capaços de prevenir i d'interrompre la gestació. 117,120 Aquesta és la raó per la qual la vaccina ARNm COVID-19 no només és innecessària, sinó que és contraproduent i nociva per a tota dona embarassada, i per a tota la població fèrtil, amb immunocompetència sub-eficient, sub-òptima. ...
Preprint
Full-text available
Resulting from the scientifically confutable, false premise of infectious dishomeorheses' sufficient microbial monocausality, inoculation of an one-size-fits-all, non-individualized, isopathic COVID-19 mRNA or viral vector-based vaccine is a certain source of sub-acute, and chronic inflammatory antigenopathies in individuals with sub-optimal, sub-efficient immunocompetence, and immunosenescence. Fraudulently, it uses molecular photodynamic analogy, i.e. the principle of similitude, as a means to the attainment of partial, transient protective immunogenic effectiveness, in the form of specific homeographic-mirror-image antibodies, while actually aiming at silencing the inherent simplicity in the principle of similitude, the primary source of immune photodynamic homeorhesis which preserves individual biological identity. It thus denies not only the jennerian viral anaprophylaxis, which contributed to the eradication of human smallpox, but above all the most advantageous and convenient available scientific methodology for the effective prevention of all infectious dishomeorheses, i.e. individualized photodynamic homeoprophylaxis, which restores the integrity and optimizes the efficiency of individual immune photodynamic homeorhesis.
... The importance of heterogeneity in CD47 expression between fusion partners was suggested through the work of Hobolt-Pedersen et al. [40], but it was Møller et al. [42] who, through time-lapse, could document that blocking of CD47 selectively inhibited fusion between mononucleated pre-osteoclasts and multinucleated osteoclasts. The opposite result was obtained for syncytin-1, a membrane-bound fusiogen triggering membrane fusion of several human cell types [43][44][45][46][47], including osteoclasts [42,48,49]. The murine variants of syncytin have also been found to trigger membrane fusion of osteoclasts and other cells [50][51][52]. ...
Article
Full-text available
Classically, osteoclast fusion consists of four basic steps: (1) attraction/migration, (2) recognition, (3) cell-cell adhesion, and (4) membrane fusion. In theory, this sounds like a straightforward simple linear process. However, it is not. Osteoclast fusion has to take place in a well-coordinated manner-something that is not simple. In vivo, the complex regulation of osteoclast formation takes place within the bone marrow-in time and space. The present review will focus on considering osteoclast fusion in the context of physiology and pathology. Special attention is given to: (1) regulation of osteoclast fusion in vivo, (2) heterogeneity of osteoclast fusion partners, (3) regulation of multi-nucleation, (4) implications for physiology and pathology, and (5) implications for drug sensitivity and side effects. The review will emphasize that more attention should be given to the human in vivo reality when interpreting the impact of in vitro and animal studies. This should be done in order to improve our understanding of human physiology and pathology, as well as to improve anti-resorptive treatment and reduce side effects.
Article
Full-text available
Metastasis is the leading cause of cancer death and can be realized through the phenomenon of tumor cell fusion. The fusion of tumor cells with other tumor or normal cells leads to the appearance of tumor hybrid cells (THCs) exhibiting novel properties such as increased proliferation and migration, drug resistance, decreased apoptosis rate, and avoiding immune surveillance. Experimental studies showed the association of THCs with a high frequency of cancer metastasis; however, the underlying mechanisms remain unclear. Many other questions also remain to be answered: the role of genetic alterations in tumor cell fusion, the molecular landscape of cells after fusion, the lifetime and fate of different THCs, and the specific markers of THCs, and their correlation with various cancers and clinicopathological parameters. In this review, we discuss the factors and potential mechanisms involved in the occurrence of THCs, the types of THCs, and their role in cancer drug resistance and metastasis, as well as potential therapeutic approaches for the prevention, and targeting of tumor cell fusion. In conclusion, we emphasize the current knowledge gaps in the biology of THCs that should be addressed to develop highly effective therapeutics and strategies for metastasis suppression.
Article
Background Human endogenous retroviruses (HERVs), remnants of ancestral infections, represent 8% of the human genome. HERVs are co-opted for important physiological functions during embryogenesis; however, little is known about their expression in human gametes. We evaluated the transcriptional levels of several retroviral sequences in human spermatozoa.Methods and resultsWe assessed, through a Real-Time PCR assay, the transcription levels of the pol genes of HERV-H, -K and -W families and of env genes of syncytin (Syn)1 and Syn2 in the spermatozoa from 8 normospermic subjects. The entity and distribution of their expressions were compared to values found in white blood cells (WBCs) from 16 healthy volunteers. The level of HERV transcripts was significantly lower in spermatozoa than in WBCs for HERV-H-pol, HERV-K-pol, HERV-W-pol, and Syn2.In contrast, the level of expression of Syn1 in the sperm was similar to that found in WBCs and it was significantly higher than the mRNA concentrations of other HERV genes in spermatozoa.Conclusions Our findings show, for the first time, the presence of several retroviral mRNAs in the sperm, although in low amounts. The higher concentration of Syn1 suggests that it could play a key role in the fusion process between gametes during fertilization and, perhaps, be involved in embryo development. Further studies could clarify whether aberrant HERV expressions, in particular of Syn1, negatively affect fertilization and embryo growth and whether sperm manipulation procedures, such as cryopreservation, may potentially influence HERV transcription in the human male gamete.
Article
Full-text available
α-SNAP has an essential role in membrane fusion that consists of bridging cis SNARE complexes to NSF. α-SNAP stimulates NSF, which releases itself, α-SNAP, and individual SNAREs that subsequently re-engage in the trans arrays indispensable for fusion. α-SNAP also binds monomeric syntaxin and NSF disengages the α-SNAP/syntaxin dimer. Here, we examine why recombinant α-SNAP blocks secretion in permeabilized human sperm despite the fact that the endogenous protein is essential for membrane fusion. The only mammalian organism with a genetically modified α-SNAP is the hyh mouse strain, which bears a M105I point mutation; males are subfertile due to defective sperm exocytosis. We report here that recombinant α-SNAP-M105I has greater affinity for the cytosolic portion of immunoprecipitated syntaxin than the wild type protein and in consequence NSF is less efficient in releasing the mutant. α-SNAP-M105I is a more potent sperm exocytosis blocker than the wild type and requires higher concentrations of NSF to rescue its effect. Unlike other fusion scenarios where SNAREs are subjected to an assembly/disassembly cycle, the fusion machinery in sperm is tuned so that SNAREs progress uni-directionally from a cis configuration in resting cells to monomeric and subsequently trans arrays in cells challenged with exocytosis inducers. By means of functional and indirect immunofluorescense assays, we show that recombinant α-SNAPs--wild type and M105I--inhibit exocytosis because they bind monomeric syntaxin and prevent this SNARE from assembling with its cognates in trans. Sequestration of free syntaxin impedes docking of the acrosome to the plasma membrane assessed by transmission electron microscopy. The N-terminal deletion mutant α-SNAP-(160-295), unable to bind syntaxin, affects neither docking nor secretion. The implications of this study are twofold: our findings explain the fertility defect of hyh mice and indicate that assembly of SNAREs in trans complexes is essential for docking.
Article
The incidence of spontaneous acrosome reaction occurring in 1314 individually selected hyperactivated (HA) human spermatozoa was compared to that occurring in 8226 individually selected non-hyperactivated spermatozoa (non-HA) sampled over an incubation time course to allow for capacitation. Two-way analysis of variance showed a significant difference between HA and non-HA spermatozoa for the mean percent acrosome reacted (R), partially acrosome reacted (PR) and combined total (R+PR) (P < 0.001). One-way analysis showed that among the HA spermatozoa there were marked differences among the proportion showing R+PR at the various time points (P = 0.005). Using the same end point, there was no significant evidence of change with time for the non-HA spermatozoa. The overall data indicated that HA human spermatozoa have a greater propensity for spontaneous acrosomal loss than non-HA spermatozoa during incubation in synthetic culture media.
Article
Representing the 60 trillion cells that build a human body, a sperm and an egg meet, recognize each other, and fuse to form a new generation of life. The factors involved in this important membrane fusion event, fertilization, have been sought for a long time. Recently, CD9 on the egg membrane was found to be essential for fusion, but sperm-related fusion factors remain unknown. Here, by using a fusion-inhibiting monoclonal antibody and gene cloning, we identify a mouse sperm fusion related antigen and show that the antigen is a novel immunoglobulin superfamily protein. We have termed the gene Izumo and produced a gene-disrupted mouse line. Izumo -/- mice were healthy but males were sterile. They produced normal-looking sperm that bound to and penetrated the zona pellucida but were incapable of fusing with eggs. Human sperm also contain Izumo and addition of the antibody against human Izumo left the sperm unable to fuse with zona-free hamster eggs.
Chapter
Development of human skeletal muscle depends upon fusion of myoblast s to form multinucleated muscle fibers . Many factors are important to this process, but, so far, molecules directly mediating fusions have not been identified. In man, the highly conserved endogenous retroviral envelope protein syncytin-1 is the best candidate for a true fusogen. Here, we summarize data showing that syncytin-1 and its receptors ASCT-1 and -2 are expressed in human myoblasts and that syncytin-1 is involved in myoblast fusion. These data suggest a more wide-ranging biological role for this endogenous retroviral envelope gene that hitherto suspected.
Article
A crucial step of fertilization is the sperm-egg interaction that allows the two gametes to fuse and create the zygote. In the mouse, CD9 on the egg and IZUMO1 on the sperm stand out as critical players, as Cd9(-/-) and Izumo1(-/-) mice are healthy but infertile or severely subfertile due to defective sperm-egg interaction. Moreover, work on several nonmammalian organisms has identified some of the most intriguing candidates implicated in sperm-egg interaction. Understanding of gamete membrane interactions is advancing through characterization of in vivo and in vitro fertilization phenotypes, including insights from less robust phenotypes that highlight potential supporting (albeit not absolutely essential) players. An emerging theme is that there are varied roles for gamete molecules that participate in sperm-egg interactions. Such roles include not only functioning as fusogens, or as adhesion molecules for the opposite gamete, but also functioning through interactions in cis with other proteins to regulate membrane order and functionality.
Article
Mammalian spermatozoa attain the ability to fertilize an oocyte as they negotiate the female reproductive tract. This acquisition of functional competence is preceded by an intricate cascade of biochemical and functional changes collectively known as "capacitation." Among the universal correlates of the capacitation process is a remarkable remodeling of the lipid and protein architecture of the sperm plasma membrane. While the mechanisms that underpin this dynamic reorganization remain enigmatic, emerging evidence has raised the prospect that it may be coordinated, in part, by specialized membrane microdomains, or rafts. In the present study we have demonstrated that human spermatozoa express recognized markers of membrane rafts. Further, upon depletion of membrane cholesterol through either physiological (capacitation) or pharmacological (methyl-β-cyclodextrin) intervention, these membrane rafts appear to undergo a polarized redistribution to the peri-acrosomal region of the sperm head. This finding encourages speculation that membrane rafts represent platforms for the organization of proteins involved in sperm-oocyte interactions. Support for this notion rests with the demonstration that membrane rafts isolated on the basis of their biochemical composition in the form of detergent resistant membranes (DRMs), possess the ability to adhere to homologous zona pellucidae. Furthermore a comprehensive proteomic analysis of the DRMs identified a number of proteins known for their affinity for the zona pellucida in addition to other candidates putatively involved in the mediation of downstream binding and/or fusion with the oolemma. Collectively these data afford novel insights into the subcellular localization and potential functions of membrane rafts in human spermatozoa.