Syncytin-1 and its receptor is present in human gametes

Abstract

To determine whether the true fusogen Syncytin-1 and its receptor (ASCT-2) is present in human gametes using qRT-PCR, immunoblotting and immunofluorescence.
Donated oocytes and spermatozoa, originating from a fertility center in tertiary referral university hospital, underwent qRT-PCR, immunoblotting and immunofluorescence analyzes.
Quantitative RT-PCR of sperm samples from sperm donors showed that syncytin-1 is present in all samples, however, protein levels varied between donors. Syncytin-1 immunoreactivity predominates in the sperm head and around the equatorial segment. The receptor ASCT-2 is expressed in the acrosomal region and in the sperm tail. Moreover, ASCT-2, but not syncytin-1, is expressed in oocytes and the mRNA level increases with increasing maturity of the oocytes.
Syncytin and its receptor are present in human gametes and localization and temporal appearance is consistent with a possible role in fusion between oocyte and sperm.

Full text

GAMETE BIOLOGY
Syncytin-1 and its receptor is present in human gametes
B. Bjerregaard &J. G. Lemmen &M. R. Petersen &
E. Østrup &L. H. Iversen &K. Almstrup &L.-I. Larsson &
S. Ziebe
Received: 30 January 2014 / Accepted: 14 March 2014
#Springer Science+Business Media New York 2014
Abstract
Main purpose and research question To determine whether
the true fusogen Syncytin-1 and its receptor (ASCT-2) is
present in human gametes using qRT-PCR, immunoblotting
and immunofluorescence.
Methods Donated oocytes and spermatozoa, originating
from a fertility center in tertiary referral university hospital,
underwent qRT-PCR, immunoblotting and immunofluores-
cence analyzes.
Results Quantitative RT-PCR of sperm samples from sperm
donors showed that syncytin-1 is present in all samples,
however, protein levels varied between donors. Syncytin-1
immunoreactivity predominates in the sperm head and around
the equatorial segment. The receptor ASCT-2 is expressed in
the acrosomal region and in the sperm tail. Moreover, ASCT-
2, but not syncytin-1, is expressed in oocytes and the mRNA
level increases with increasing maturity of the oocytes.
Conclusions Syncytin and its receptor are present in human
gametes and localization and temporal appearance is consis-
tent with a possible role in fusion between oocyte and sperm.
Keywords ASCT-2 .Fertilization .Oocyte .Sperm .
Syncytin
Introduction
The process of fertilization has been an area of intense research
for decades. Fertilization consists of a multitude of steps in
which mature gametes meet and fuse at the correct time and
place. Spermatozoa and cumulus- oocyte complex interaction
result in adhesion, binding and penetration of the zona pellucida
(ZP) by the spermatozoon. This is followed by interaction,
adhesion and fusion of the inner acrosomal membrane of the
spermatozoon and the oocyte plasma membrane (the oolemma)
allowing genetic material of the haploid gametes to merge and
form the totipotent diploid zygote [1].
The spermatozoa must undergo the process of capacitation,
before they gain the capacity to interact and bind to the ZP.
During capacitation, among other changes, decapacitating
factors are shed and the plasma membrane is remodelled
to form membrane rafts on the apical surface of the sperm
head where ZP-binding proteins are concentrated [2,3].
Parts of this work were presented at an oral presentation at the Danish
Fertility Annual meeting in March 2013. No abstract to this presentation.
Capsule Membrane fusion is an important part of fertilization. Here we
present, for the first time, the presence of a true fusogen Syncytin-1 and its
receptor on human gametes.
This work was conducted at The Fertility Clinic, Rigshospitalet and at the
Faculty of Life Science, University of Copenhagen
B. Bjerregaard :E. Østrup :L.<I. Larsson
Faculty of Life Science, University of Copenhagen, Copenhagen,
Denmark
J. G. Lemmen :M. R. Petersen :L. H. Iversen :S. Ziebe (*)
The Fertility Clinic, Copenhagen University Hospital,
Rigshospitalet, 2100 Copenhagen, Denmark
e-mail: sziebe@rh.dk
K. Almstrup
Department of Growth and Reproduction, Copenhagen University
Hospital, Rigshospitalet, 2100 Copenhagen, Denmark
Present Address:
B. Bjerregaard
Symphogen A/S, Elektrovej, 2800 Lyngby, Denmark
Present Address:
E. Østrup
Department of Biomaterials, University of Oslo, 0455 Oslo, Norway
Present Address:
L.-I. Larsson
Department of Pathology, Copenhagen University Hospital,
Hvidovre, 2650 Hvidovre, Denmark
JAssistReprodGenet
DOI 10.1007/s10815-014-0224-1

Capacitation enables the spermatozoa to perform the acro-
some reaction (AR), in which the plasma membrane and
outer acrosomal membrane fuse to release the acrosomal con-
tent [1]. The fertilization process therefore consists of two
independent membrane fusion events, i.e. the AR and the
fusion between the membrane of the spermatozoon and the
oolemma. While SNARE fusion proteins (SNARE is an acro-
nym derived from “SNAP (Soluble NSF Attachment Protein
REceptor”)) are involved during membrane fusion in the AR
[4,5], the fusogenic molecules involved in fusion of the
spermatozoon and oocyte have eluded identification [6–8].
Following ZP penetration the fertilizing spermatozoon ad-
heres in a parallel manner to the oolemma at the equatorial
segment [1]. This is the initial step leading to actual membrane
fusion, hereby establishing cytoplasmic continuity. The adhe-
sion protein Izumo-1 is located on the acrosomal region of the
spermatozoon (demonstrated in mouse and human) and is
only accessible following the AR [9]. Izumo-1 is essential
for gamete adhesion before fusion of the inner acrosomal
membrane and oolemma [9]. On the oolemma the tetraspanins
CD9 and CD81 form tetraspanin webs which interact with
Izumo-1, however only CD9-/- and CD81-/- double knockout
mice are completely infertile, suggesting a capacity for one of
the two to partly compensate for the other [10]. Tetraspanin
webs are, among a multitude of properties, involved in cell-
cell adhesion and viral infections [11], but is not known to
have any membrane fusion capabilities [12].
Besides Izumo-1 and the tetraspanins CD9 and CD81,
several other molecules have been suggested to participate in
membrane fusion, on the oolemma (integrins, glucosyl phos-
phatidylinositol (GPI-1 anchored protein)) and spermatozoon
(disintegrin and a metalloprotease (ADAM) (e.g. the
disintegrins fertilin βand cyritestin)) [6–8].
The viral envelope protein Syncytin is an example of a
fusogen [12,13]. Syncytins participate in cell fusion in the
placenta (trophoblast cells) [14–16], in muscles (myoblasts)
[17], bone marrow (osteoclasts) [18] and in cancer [19,20].
Syncytin-1 (ERVW-1), which is expressed in humans, binds
to a neutral amino acid transporter (the D-type retroviral
receptor: ASCT-2 (SLC1A5)) and employs another transporter
(ASCT-1 (SLC1A4)) as an auxiliary receptor [14,21].
We therefore decided to investigate whether the fusogen
Syncytin-1 and its receptor ASCT-2 were present in human
spermatozoa and oocytes.
Material & methods
Oocytes and semen samples
Oocytes were obtained from patients attending infertility treat-
ment at the fertility clinic of Rigshospitalet, University Hospital
of Copenhagen, Denmark. The inclusion criteria were indication
for IVF or ICSI treatment, female age between 25 and 37 years
(both inclusive) and regular menstrual cycles (21–35 days, both
inclusive). Exclusion criteria were: medical or genetic conditions
known to interfere with IVF treatment. The couple or single
woman was informed both orally and with written patient infor-
mation material. The oral information was given no later than
2 days before oocyte pickup. Couples could choose to donate 1)
immature oocytes; MI or GV and/or 2) MII oocytes still not
fertilized on the day of embryo transfer (embryo transfer con-
ducted on day 2 after oocyte pickup). The couple or the donor
woman was informed about all aspects of the study and written
consent was obtained from all participants before inclusion in the
study. Semen samples were obtained from donors with a priori
known normal semen quality. Semen was recovered via a sperm
bank, in which donors received a fee for each sample delivered.
Hormonal treatment of oocyte donors
Long protocols using down-regulation with GnRH-agonists
(Synarela, Pharmacia, Denmark; Suprefact, Aventis Pharma,
Denmark) for at least 14 days or short protocol using GnRH-
antagonists (Orgalutran, Organon, Copenhagen, Denmark;
Cetrotide, MerckSerono, Copenhagen, Denmark) were applied.
Patients were stimulated with recombinant FSH (Puregon, Or-
ganon; Gonal-F, Copenhagen, Serono) or urine derived FSH
(Menopur, Ferring, Copenhagen, Denmark) and ovulation in-
duced by urine derived hCG (Profasi, Serono, Pregnyl, Orga-
non) or Ovitrelle (MerckSerono, Denmark). Oocyte aspiration
was performed according to the standard procedure of the clinic.
Collection of oocytes and sperm cells
Immature oocytes and surplus spermatozoa were donated on
the day of oocyte pickup. Unfertilized oocytes from IVF and
ICSI were donated on the day of transfer, approximately 48 h
after oocyte pickup. For protein analysis, both pooled oocytes,
single oocytes and spermatozoa pellets were placed in
Eppendorf tubes, respectively, with 5–200 μl RIPA lysis buffer
andstoredat−20 °C until analysis. For RNA analysis both
pooled and single oocytes were placed in microtubes containing
20 μl TRIzol (Invitrogen, Carlsbad, CA, USA) and stored at
−20 °C until analysis. Semen samples were centrifuged (5 min
at 16,000 g) and dissolved directly in lysis buffer (Macherey-
Nagel, Düren, Germany). For immunocytochemistry, sperma-
tozoa were spread on SuperFrost plus slides (Thermo Scientific,
Walldorf, Germany), fixed in 1 % paraformaldehyde and stored
in a dark at room temperature until further analysis.
Immunocytochemistry
Fixed spermatozoa were hydrated in PBS and processed for
immunostaining. Initially, samples were blocked with 10 %
goat serum and incubated overnight at 4 °C with mouse
J Assist Reprod Genet

monoclonal anti-syncytin-1 (human, 7E3, 5 μg/ml) [17]or
polyclonal rabbit anti-ASCT2 (10 μg/ml, Abcam, Cambridge,
UK). The following day, samples were washed three times in
PBS and incubated with species-specific antibodies labelled
with Alexa-594 or Alexa-488 (5 μg/ml, Molecular Probes,
Eugene, OR, USA), respectively. Nuclei were stained with
bisbenzimide (Hoechst 33 258; Sigma, St. Louis, MO, USA).
The specimens were mounted on glass slides using DAKO
fluorescent mounting medium (DAKO, Glostrup, Denmark).
Controls, including use of isotype-matched monoclonal anti-
bodies, and pre-absorption of the polyclonal ASCT-2 antibody
as well as conventional staining controls were included.
SDS-PAGE and immunoblotting
Extraction, SDS-PAGE and electroblotting were performed as
described by Mortensen [22]. Antibodies to syncytin-1 (7E3
mouse monoclonal anti-human, 1.5 μg/ml) or ASCT-2 (rabbit
polyclonal anti-human 10 μg/ml) were used in combination
with chemiluminescent detection and the intensities of the
bands were quantitated using NIH Image software [22].
Syncytin-1 protein levels were reported relative to β-actin
protein levels to adjust for loading effects.
RNA purification
Total RNA from oocytes was isolated using TRIzol (Invitrogen)
according to the manufacturer’s recommendations with a few
modifications. Phase separation was facilitated using the max-
tract High Density tubes (Qiagen, Hilden, Germany), 0.5 μL
glycogen (Roche, Mannheim, Germany) was used as carrier for
the precipitation of RNA, and the dried RNA-pellet was directly
used in the reversed transcription (RT).
Total RNA from spermatozoa was isolated by dissolving a
pellet of sperm directly in lysis buffer and following the
procedure of the Nucleospin® RNA II kit (Macherey-Nagel,
Düren, Germany) using on-column DNA digestion. The RNA
concentration was measured using a NanoDrop instrument
(Thermo Fisher Scientific, Wilmington, USA).
RNA from whole testicular tissue was obtained from com-
mercial vendors (Clonetech, Saint-Germain-en-Laye, France
and Ambion, Paisley, UK).
Quantitative real-time RT-PCR
The RNA-pellet was dissolved in a total volume of 8 μl, con-
taining 16 ng/μL random hexamer primers (Fermentas, St.
Leon, Germany), 8 ng/μL(μM) oligo dT primers (Fermentas),
and 0.05 μL RNase H Minus, Point Mutant (Promega, Madison,
WI, USA). RNA was incubated at 70 °C to denature RNA
secondary structure and then quickly chilled on ice to let the
primers anneal to the RNA. 1× buffer (Promega), 0.5 mM
dNTPs (Fermentas), 200 U M-MLV Reverse Transcriptase
(Promega), and 0.025 μL RNase H Minus, Point Mutant
(Promega) were added to a final volume of 12.5 μL. The reverse
transcription was performed at 42 °C for 1 h and the enzyme was
inactivated at 95 °C for 5 min. Quantitative RT-PCR was per-
formed using LightCycler® Fast Start DNA Master SYBR
Green I and the LightCycler® Real-Time PCR system (Roche,
Mannheim, Germany). Primers used for syncytin-1 were: right:
CCCCATCGTATAGGAGTCTT and left: CCCCATCAGACA
TACCAGTT, producing an amplicon of 207 bp, while primers
for ASCT-2 were: right: CCGCTTCTTCAACTCCTTCAA and
left: ACCCACATCCTCCATCTCCA, producing an amplicon
of 121 bp. The identity of the amplicons was confirmed by
sequencing. Results were normalized to GAPDH (right:
CAGGTGGTCTCCTCTGACTT and left: TGCTGTAGCC
AAATTCGTTGT, producing an amplicon of 127 bp).
BeWo-cells, which have previously been shown to express
syncytin-1 [23], were used as positive control, and a no
template control was made in all runs, using water instead of
cDNA. An intron spanning GAPDH-primer was used in the
qRT-PCR to identify possible genomic DNA contamination.
The relative expression was calculated using the ddCt-
method, with GAPDH as reference gene.
RT-PCR
cDNA synthesis was performed by adding a 4:1 mixture of
oligo-dT20 and random hexamers (0.5 μg/μl), 5× cDNA
synthesis buffer (650 mM Tris–HCl pH: 8.3; 25 mM MgCl2;
100 mM KCl2), 25 mM dNTP mix (GE Healthcare, Brondby,
Denmark) and AMV reverse transcriptase (Affymetrix, Cleve-
land, USA) to 1 ug of heat denaturated (65 ° C) RNA. cDNA
synthesis was performed by incubating the samples at 42 ° C
for 1 h. Finally 0.1 % triton X-100 was added and cDNA
denaturated at 95 ° C for 1 min. PCR was performed by
adding 10× DDRT buffer (100 mM Tris–HCl pH 8.4;
500 mM KCL; 18 mM MgCl2; 1 % Triton), 2.5 mM dNTP
mix, Taq polymerase (GE Healthcare) and primers at a con-
centration of 1 pmol/μl. Cycle conditions were: 1 cycle of
5 min at 95 °C; 40 cycles of 30 s at 95 ° C, 1 min at 64 ° C,
1 min at 72 ° C and 1 cycle of 5 min at 72 °C. Representative
bands from each primer combination were excised and
sequenced for verification (Eurofins MWG, Germany).
Results
Syncytin-1 and ASCT-2 is expressed in human sperm
Reverse transcriptase-polymerase chain reaction (RT-PCR) of
RNA isolated from eight different donors showed that
syncytin-1 was present in all samples (data not shown). Ge-
nomic contamination was avoided by on-column DNase di-
gestion during RNA purification and the use of intron-
JAssistReprodGenet

spanning primers. The syncytin-1 receptor, ASCT-2, was also
detectable in most donor ejaculates, however in some donors
at a very low level. ASCT-2, but not Syncytin-1 expression
was detected in RNA from whole testicular tissue. The
identity of the bands corresponding to syncytin-1 and ASCT-
2were verified by sequencing.
Immunoblotting using an antiserum against the extracellular
domain of syncytin-1 revealed an immunoreactive band around
60 kDa in extracts of eight different donors corresponding in size
to a syncytin-1 component previously demonstrated to be present
in the placenta [17,15]. The protein level of syncytin-1 varied
among the different semen donors (Fig. 1). ASCT-2 was detected
in all semen samples, but appeared less abundant than syncytin-
1. A similar variation in protein levels between samples was
observed, despite using equal amount of protein in each well.
Syncytin-1 and ASCT-2 is localized at the acrosomal region
and equatorial segment of the spermatozoa
Immunofluorescence staining of fixed spermatozoa from eight
different donors showed that syncytin-1 immunoreactivity
ASCT2
Syncytin-1
B-actin
B-actin
Fig. 1 Expression of syncytin-1 and its receptor ASCT-2 by human
sperm. Western blot showing syncytin-1 and ASCT-2 immunoreactive
bands in samples from eight different sperm donors, respectively. Below,
reprobing for β-actin is shown
Fig. 2 Localizationof syncytin-1in human sperm. Immunofluorescence
images of fixed representative sperm samples from different sperm do-
nors stained with a monoclonal antibody raised to the extracellular
domain of syncytin-1 (a–c). Note staining of Syncytin-1 in the head of
the spermatozoa and around the equatorial segment. Slight staining of the
midpiece and tail also noted. d shows an isotype matched control.
(Scalebar 20 μm, objective: 100×/1.30 PL Fluotar)
J Assist Reprod Genet

was predominately present in the acrosomal region of the
spermatozoa (Fig. 2). If the acrosomal region was not stained,
syncytin-1 was localized at the equatorial segment only. Slight
staining of the midpiece and tail was also noted. There was no
obvious difference in the syncytin-1 localisation between the
different donors.
ASCT-2 was predominately localized to the acrosomal
region and in the tail region (Fig. 3). Controls, including use
of type-matched monoclonal antibodies and pre-absorption of
the polyclonal ASCT-2 antibody, as well as conventional
staining controls were all negative.
The receptor ASCT-2 is expressed in human oocytes
A total of 80 oocytes (GV: 20, MI: 25, MII: 35) were included
in the analysis. Quantitative RT-PCR showed that ASCT-2 was
expressed in all of the evaluated stages of oocyte maturation
(Fig. 4). There was significantly higher expression of ASCT-2
in mature MII stage oocytes compared to the immature GV-
stage (p=0.027). However, expression of syncytin-1 was not
detected in any of the oocytes examined.
Fig. 3 Localization of ASCT-2 in human sperm. Immunofluorescence
images of fixed representative sperm samples from different sperm do-
nors stained with an anti-ASCT-2 (a–c). Note staining in the acrosomal
region of the spermatozoa and scarce staining of the tail. d shows a control
with pre-absorption of the primary antibody. (Scalebar 20 μm, objective:
100×/1.30 PL Fluotar)
Syncytin expression levels
0
10
20
30
40
50
60
70
GV MI MII
a
b
a,b
Fig. 4 Expression of ASCT-2 in human oocytes. Quantiatative RT-PCR
of ASCT-2 in oocytes at different developmental stages showed that the
mRNA level increases as the oocytesmature. Chi-square test was applied
to evaluate potential statistical significant differences, level of signifi-
cance p≤0.05. a,bindicates significant difference, p<0.027
JAssistReprodGenet

Discussion
Membrane fusion plays an essential role in mammalian fertil-
ization, however a specific fusogen involved in fertilization
has yet to be identified. Our findings demonstrate the presence
of the fusogen syncytin-1 and its receptor ASCT-2 in human
gametes. Syncytin-1 is predominantly localized at the acroso-
mal region of the spermatozoa. However, in a subset of cells it
is exclusively localized to the equatorial segment. The process
of capacitation and AR can beinduced in vitro during gradient
centrifugation, media exposure etc., however the extent varies
between species [24], and only a smaller fraction of human
spermatozoa will undergo the AR reaction in vitro [25,26].
The observed localization of syncytin-1, equatorial segment or
acrosomal region, respectively could depend upon whether
the spermatozoa had undergone the AR ornot. Localization of
a fusogen at the equatorial segment is supported by electron
microscopy findings demonstrating gamete membrane fusion
being initiated at the equatorial segment [27,1]. Moreover, the
fusogen (syncytin-1) and it’s receptor (ASCT-2) is expressed
in spermatozoa and oocytes, respectively. In contrast to sper-
matozoa expressing syncytin-1, none of the analyzed oocytes
expressed the fusogen, but only it’sreceptor.
Syncytin belongs, as mentioned, to a family of endogenous
retroviruses [13]. Introduction of syncytin expression in a cell
line prevents retrovirus infection [28], suggesting that co-
expression of syncytin and its receptor will block either of
the two [29]. Co-expression of syncytin-1 and ASCT-2 on
spermatozoa could therefore function as a regulator of
syncytin, preventing membrane fusion at the acrosomal region
until the correct time and place.
In oocytes, we find that the ASCT-2 mRNA level signifi-
cantly related to oocyte maturity from the germinal vesicle to
the metaphase 2 stage. Due to shortage of fresh metaphase II
(MII) oocytes we evaluated ASCT-2 mRNA in MII oocytes
48 h after oocyte pickup, which potentially also could affect
expression level. Since syncytin-1 is present and localized at
the right place in spermatozoa and ASCT-2 is present in the
mature oocytes, this suggests that the fusogen syncytin-1 and
its receptor could be involved in membrane fusion of the
human gametes.
Previous studies have demonstrated the essential involve-
ment of the tetraspanins CD9 and CD81 in fertilization [30].
CD9 and CD 81 have been shown also to participate in
membrane fusion during retrovirus infection [31]. All together
the demonstration of syncytin-1 on the equatorial segment of
spermatozoa supports the model suggested by Nixon et al. [6],
linking documented membrane adhesion factors of impor-
tance to membrane fusion during fertilization.
The finding from the present study may potentially have
significant impact on clinical decision making in assisted
reproduction programs. Assuming that the presence of
Syncytin-1 on spermatozoa is a necessity for gamete
membrane fusion during fertilization, analysis for its pres-
ence may directly impact clinical decisions like choice of
treatment strategy. A high level of Syncytin-1, enabling
gamete membrane fusion, would be supportive of insemi-
nation or standard in vitro fertilization, whereas low level
or absence of Syncytin-1 would indicate the use of ICSI
treatment.
Further, the presence of Syncytin-1 may be used as a
diagnostic tool when evaluating a man’sreproductivepoten-
tial. Consequently, it may also be used to decide if a man
should be used as sperm donor or not.
The presence of the receptor on the oocytes may be utilized
in pharmaceutical or culture related interventions as an indi-
cator of the developmental competence of the oocytes.
In conclusion, syncytin-1 and ASCT-2 are expressed in
human gametes with localization and temporal appearance
consistent with a possible role in fusion between oocyte and
spermatozoon. Moreover, it is the first time a true fusogen has
been identified in human gametes.
Reduced or total failure of syncytin-1 or ASCT-2 expres-
sion in spermatozoa or oocytes respectively, could potentially
cause fertilization failure, which would be circumvented by
ICSI. However, future functional studies are needed to exam-
ine whether the fusogen syncytin-1 is essential for human
fertilization.
Ethical statement All participating persons gave their informed con-
sent prior inclusion in the study. The Danish Ethical committee approval
was obtained before the study was initiated (J. nr H-B-2008-150).
Conflict of interest The authors declare that they have no conflict of
interest.
References
1. Yanagimachi R. Mammalian fertilization. In: Knobil E, Neill J,
editors. The physiology of reproduction. 2nd ed. New York: Raven;
1994. p. 189–317.
2. van Gestel RA, Brewis IA, Ashton PR, Brouwers JF, Gadella BM.
Multiple proteins present in purified porcine sperm apical
plasmamembranes interact with the zona pellucida of the oocyte.
Mol Hum Reprod. 2007;13:445–54.
3. Nixon B, Mitchell LA, Anderson AL, Mclaughlin EA, O’bryan MK,
Aitken RJ. Proteomic and functional analysis of human sperm deter-
gent resistant membranes. J Cell Physiol. 2011;226:2651–65.
4. Blas GAD, Roggero CM, Tomes CN, Mayorga LS. Dynamics of
SNARE assembly and disassembly during sperm acrosomal exocy-
tosis. PLoS Biol. 2005;3:e323.
5. Rodriguez F, Bustos MA, Zanetti MN, Ruete MC, Mayorga LS,
Tomes CN. alfa-SNAP prevents docking of the acrosome during
sperm exocytosis because it sequesters monomeric syntaxin. PLoS
One. 2011;6:e21925.
6. Nixon B, Aitken RJ, McLaughlin EA. New insights into the
molecular mechanisms of sperm-egg interaction. Cell Mol Life
Sci. 2007;64:1805–23.
J Assist Reprod Genet

7. Sutovsky P. Sperm–egg adhesion and fusion in mammals. Expert
Rev Mol Med. 2009;11:e11.
8. Evans JP. Sperm-egg interaction. Annu Rev Physiol. 2012;74:
477–502.
9. Inoue N, Ikawa M, Isotani A, Okabe M. The immunoglobulin
superfamily protein Izumo is required for sperm to fuse with eggs.
Nature. 2005;434:234–8.
10. Rubinstein E, Ziyyat A, Prenant M, Wrobel E, Wolf JP, Levy S, et al.
Reduced fertility of female mice lacking CD81. Dev Biol. 2006;290:
351–8.
11. Yunta M, Lazo PA. Tetraspanin proteins as organisers of membrane
microdomains and signalling complexes. Cell Signal. 2003;15:
559–64.
12. Oren-Suissa M, Podbilewicz B. Cell fusion during development.
Trends Cell Biol. 2007;17:537–46.
13. Weissenhorn W, Hinz A, Gaudin Y. Virus membrane fusion. FEBS
Lett. 2007;581:2150–5.
14. Blond JL, Lavillette D, Cheynet V, Bouton O, Oriol G, Chapel-
Fernandes S. An envelope glycoprotein of the human endogenous
retrovirus HERV-W is expressed in the human placenta and fuses
cells expressing the type D mammalian retrovirus receptor. J Virol.
2000;74:3321–9.
15. Mi S, Lee X, Li X, Veldman GM, Finnerty H, Racie L, et al. Syncytin
is a captive retroviral envelope protein involved in human placental
morphogenesis. Nature. 2000;403:785–9.
16. Dupressoir A, Vernochet C, Bawa O, Harper F, Pierron G, Opolon P,
et al. Syncytin-A knockout mice demonstrate the critical role in
placentation of a fusogenic, endogenous retrovirus-derived, envelope
gene. Proc Natl Acad Sci U S A. 2009;106:12127–32.
17. Bjerregaard B, Talts JF, Larsson LI. The endogenous envelope
protein syncytin is involved in myoblast fusion. In: Larsson LI,
editor. Cell fusions, regulation and control. New York: Springer;
2011. p. 267–75.
18. Søe K, Andersen TL, Hobolt-Pedersen AS, Bjerregaard B, Larsson LI,
Delaissé JM. Involvement of human endogenous retroviral syncytin-1
in human osteoclast fusion. Bone. 2011;48:837–46.
19. Bjerregaard B, Holck S, Christensen IJ, Larsson LI. Syncytin is
involved in breast cancer-endothelial cell fusions. Cell Mol Life
Sci. 2006;63:1906–11.
20. Strick R, Ackermann S, Langbein M, Swiatek J, Schubert SW,
Hashemolhosseini S, et al. Proliferation and cell-cell fusion of endo-
metrial carcinoma are induced by the human endogenous retroviral
syncytin-1 and regulated by TGF-beta. J Mol Med. 2007;85:23–38.
21. Lavillette D, Marin M, Ruggieri A, Mallet F, Cosset FL, Kabat D.
The envelope glycoprotein of human endogenous retrovirus type W
uses a divergent family of amino acid transporters/cell surface recep-
tors. J Virol. 2000;76:6442–52.
22. Mortensen K, Lichtenberg J, Thomasen PD, Larsen LI. Spontaneous
fusion between cancer cells and endothelial cells. Cell Mol Life Sci.
2004;61:2125–31.
23. Yu C, Shen K, Lin M, Chen P, Lin C, Chang GD, et al. GCMa
regulates the syncytin-mediated trophoblastic fusion. J Biol Chem.
2002;277:50062–8.
24. Ikawa M, Inoue N, Benham AM, Okabe M. Fertilization: a sperm’s
journey to and interaction with the oocyte. J Clin Invest. 2010;120:
984–94.
25. Mallet PJ, Stock CE, Fraser LR. Acrosome loss in human sperm
incubated in vitro under capacitating conditions. Int J Androl. 1985;8:
357–64.
26. Green S, Fishel S, Rowe P. The incidence of spontaneous acrosome
reaction in homogeneous populations of hyperactivated human sper-
matozoa. Hum Reprod. 1999;14:1819–22.
27. Bedford JM, Cooper GW. Membrane fusion events in the fertilization of
vertebrate eggs. In: Poste G, Nicholson GL, editors. Cell surface reviews.
Amsterdam: Elsevier/North-Holland Biomedical press; 1978. p. 65–125.
28. Ponferrada VG, Mauck BS, Wooley DP. The envelope glycoprotein
of human endogenous retrovirus HERV-W induces cellular resistance
to spleen necrosis virus. Arch Virol. 2003;148:659–75.
29. Potgens AJG, Drewlo S, Kokozidou M, Kaufmann P. Syncytin: the
major regulator of trophoblast fusion? Recent developments and
hypotheses on its action. Hum Reprod Update. 2004;10:487–96.
30. Rubinstein E, Ziyyat A, Wolf JP, Le Naour F, Boucheix C. The
molecular players of sperm-egg fusion in mammals. Semin Cell
Dev Biol. 2006;17:254–63.
31. Gordon-Alonso M, Yañez-Mó M, Barreiro O, Álvarez S, Muñoz-
Fernández MÁ, Valenzuela-Fernández A, et al. Tetraspanins CD9
and CD81 modulate HIV-1-induced membrane fusion. J Immunol.
2006;177:5129–37.
JAssistReprodGenet