The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae

Article (PDF Available)inBMC Microbiology 14(1):79 · March 2014with 470 Reads
DOI: 10.1186/1471-2180-14-79 · Source: PubMed
Abstract
Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscBUpNA) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscBUpA) or the upstream region of lscA with lscB (lscAUpB) were generated. Transformants harboring the lscBUpNA or the lscBUpA fusion, respectively, showed levan formation while the transformant carrying lscAUpB did not. qRT-PCR and Western blot analyses showed that lscBUpNA had an expression similar to lscB while lscBUpA had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae.
Figures - available via license: CC BY 2.0
R E S E A R C H A R T I C L E Open Access
The conserved upstream region of lscB/C
determines expression of different levansucrase
genes in plant pathogen Pseudomonas syringae
Shaunak Khandekar
1*
, Abhishek Srivastava
1,2
, Daniel Pletzer
1
, Antje Stahl
1
and Matthias S Ullrich
1
Abstract
Background: Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial
blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has
three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously,
nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated
promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA.
Results: Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially,
the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB
UpN
A) was
generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding
part of the upstream region of lscB with lscA (lscB
Up
A) or the upstream region of lscA with lscB (lscA
Up
B) were generated.
Transformants harboring the lscB
UpN
Aor the lscB
Up
Afusion, respectively, showed levan formation while the transformant
carrying lscA
Up
Bdid not. qRT-PCR and Western blot analyses showed that lscB
UpN
Ahad an expression similar to lscB
while lscB
Up
Ahad a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting.
Conclusions: Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while
the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to
expression of lscB.WeproposethatlscA might be an ancestral levansucrase variant upstream of which the PAPE got
inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae.
Keywords: Pseudomonas syringae, Levansucrase, Expression, Exopolysaccharides, Levan, Evolution
Background
Pseudomonas syringae comprises a large and well-studied
group of plant-pathogenic bacteria [1]. They infect a broad
range of host plants and are subdivided into more than
50 different pathogenic variants called pathovars [2]. P.
syringae possesses a number of well-studied virulence
and pathogenicity factors such as the Type III effector
trafficking system, various phytotoxins, different mech-
anisms suppressing the plant defense, or synthesis of
exopolysaccharides [3-5]. Exopolysaccharides play a variety
of roles in virulence and pathogenicity not only in
Pseudomonas but also in other biofilm-producing organ-
isms [6,7]. The two major exopolysaccharides produced
by P. syringae pv. glycinea are alginate and levan [7].
Levan is a β-(2,6) polyfructan with extensive branching
through β-(2,1) linkages, while alginate is a copolymer
of O-acetylated β-(1,4)-linked D-mannuronic acid and
its C-5 epimer, L-guluronic acid [7-10].
P. syringae pv. glycinea PG4180 causes bacterial blight
of soybean plants. Like some other Pseudomonas species,
this organism utilizes sucrose as a carbon source with the
help of the enzyme levansucrase (EC 2.4.1.10, Lsc), in the
process releasing glucose and forming the exopolysacchar-
ide levan. PG4180 produces no alginate due to a native
frameshift mutation in the algT gene and hence, the exo-
polysaccharide matrix of this strain is mainly composed of
levan [11]. Additionally to several draft genome sequences
[12-18], the complete genome sequences of three P. syrin-
gae pathovars are available, namely pv. tomato DC3000
[19], pv. phaseolicola 1448A [20] and pv. syringae B728a
* Correspondence: skhandekar@jacobs-alumni.de
1
Molecular Life Sciences Research Center, Jacobs University Bremen, Campus
Ring 1, Bremen 28759, Germany
Full list of author information is available at the end of the article
© 2014 Khandekar et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use,
distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public
Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this
article, unless otherwise stated.
Khandekar et al. BMC Microbiology 2014, 14:79
http://www.biomedcentral.com/1471-2180/14/79
[21]. These strains serve as excellent model organisms
to study plant-microbe interactions. Like in some other
P. syringae pathovars, the PG4180 genome contains
three copies of the lsc gene, of which two lscA and
lscC are chromosomally encoded while lscB is plasmid-
encoded. Of the three copies, only lscB and lscC have been
shown to be expressed while no expression was observed
for lscA under the tested growth conditions since a mu-
tant, PG4180.M6, lacking lscB and lscC but containing
lscA was levan-negative [10].Interestingly, the ORF coding
for LscA is fully functional since this gene from pv.
glycinea, and its homologues from pv. phaseolicola and
pv. tomato, could be expressed from recombinant pro-
moters in Escherichia coli [9,22]. Even though LscB is
predominantly extra-cellular and LscC is predominantly
retained in the periplasm, the two enzymes are 98%
identical at the amino acid level [23]. There are only
five amino acid residues different, four of which are
conserved changes. Since the enzymes are highly similar
in their structure as well as function, all experiments in
this study were done using lscB only.
As reported by Srivastava et al. [24], nucleotide sequence
comparison of the lscA variants with those of lscB/C
variants of P. syringae pathovars showed that the first
48-bp of the N-terminus of the ORF lscB/C were absent in
lscA. In silico removal of this N-terminal region increased
the identity from 87.5% to 93% at the amino acid residue
sequence level between LscA and B/C variants. The com-
parison also showed that a ~450-bp upstream region,
which is highly conserved in all lscB/Cvariant loci, is miss-
ing upstream of lscA. This region spanning from 450-bp
to +48-bp with respect to the translational start site of
lscB/C was predicted to be a pro-phage borne DNA
based on sequence similarities and hence was termed
phage-associated promoter element (PAPE) [24].
P. syringae is the only Lsc-synthesizing organism having
multiple gene copies coding for this enzyme. The rationale
for the occurrence of multiple lsc gene copies, some of
which carry upstream PAPEs, remained obscure and
prompted the current study, during which the transcrip-
tional start site of lscB/C was determined to be -339 bp
upstream to the translational start codon. Subsequently,
the PAPE with or without the N-terminal coding sequence
was fused to lscA. Additionally, the upstream region of
lscA was fused with the coding sequence of lscB while lscB
and lscA with their native upstream sequences served
as controls. All fusion constructs were expressed in the
levan-negative mutant PG4180.M6 [10], and tested for
their levan formation ability by zymographic detection
followed by matrix-assisted laser desorption/ionization
time of flight (MALDI-TOF) analysis as well as by
Western blotting. Furthermore, the expression of the
fusions at the mRNA level was checked by qRT-PCR
analysis. In addition, a PCR approach with cDNA was
undertaken to show that the expression of lscA is also
cryptic in other P. syringae pathovars.
Results
Determination of the transcriptional start site of lscB
The coding regions and upstream sequences of lscB/C
are highly identical to each other (98.1% DNA identity
for the coding sequences and 97.5% DNA identity for
the 500-bp upstream sequences). As shown by Srivastava
et al., a deletion construct ending at position 332-bp
with respect to the lscB translational start codon does
not lead to levan formation in levan negative mutant
PG4180.M6 while the construct ending 440-bp leads to
levan formation in the same mutant [24]. Consequently,
primer extension experiments using total RNA from
PG4180 cells and a set of reverse oligonucleotide primers
were used to determine the transcriptional start site (TSS)
of the lscB gene. Resolving the extension products on a
polyacrylamide gel resulted in a clear signal at nucleotide
position 339-bp upstream of the translational start codon
of lscB (Figure 1). The experiments were repeated for lscC
giving identical results (Data not shown).
Qualitative analysis of lsc fusion proteins
The fusion constructs were introduced to the levan-
negative mutant PG4180.M6 and were first analyzed
Figure 1 Determination of the transcriptional start site (TSS) of
lscB in P. syringae pv. glycinea PG4180. The TSS was determined
by electrophoresis of nucleotide sequencing reaction and primer
extension product using primer pe.BC.PG ~ 150 bp on 6%
polyacrylamide gel. Nucleotide of the TSS (*) is shown at the right.
Khandekar et al. BMC Microbiology 2014, 14:79 Page 2 of 11
http://www.biomedcentral.com/1471-2180/14/79
for their levan forming ability on sucrose supplemented
mannitol-glutamate agar plates. Both, the PG4180.M6
mutant complemented with lscB
UpN
Aand lscB
Up
A,showed
levan formation indistinguishable from that of the PG4180.
M6 mutant complemented with lscB (Figure 2). In contrast,
PG4180.M6 complemented with lscA
Up
Bwas levan
negative, same as PG4180.M6 transformed with lscA, thus,
suggesting that the upstream region of lscB mediates
expression of downstream located genes while that of
lscA does not.
Characterization of lsc fusion proteins
To verify the molecular sizes of Lsc encoded by the indi-
vidual fusion constructs, a Western blot analysis using
Lsc-specific antibodies was performed (Figure 3a). Under
denaturing conditions, it was interesting to observe that
LscB
UpN
A migrated at an intermediate rate i.e. faster
than LscB but slower than LscB
Up
A. The signal for
LscB
Up
A was weaker than those representing LscB or
LscB
UpN
A suggesting that the N-terminus of LscB might
contribute to the expression level or stability of Lsc. In
contrast, protein samples of PG4180.M6 transformed
with LscA or LscA
Up
B did not show any signal specific
for Lsc at all thus confirming that lack of levan formation
was due to lack of the corresponding protein.
To check for the enzymatic function of Lscs encoded by
the individual fusion constructs, zymographic detection
was done with non-denatured total protein samples of
transformed mutants (Figure 3b). The above reported levan
forming ability of transformants M6(lscB), M6(lscB
UpN
A)
and M6(lscB
Up
A) could be attributed to the enzymatic
functioning of proteins or fusion proteins. As expected,
native protein samples derived from M6(lscA) or M6
(lscA
Up
B) did not exhibit any in-gel levan production
(Figure 3b). An interesting observation was the altered
electrophoretic mobility of the enzymatically active pro-
teins. The LscB
UpN
A migrated slower as compared to LscB
even though the predicted molecular masses of both pro-
teins were almost identical (~47.6 kDa) suggesting possible
differences in the respective protein charges. In accordance
with the Western blot results, LscB
Up
A seemed to be less
expressed than LscB or LscB
UpN
Asuggestinganimportant
role of the N-terminus for transcriptional or translational
processes.
MALDI-TOF analysis
The altered electrophoretic migration rate of LscB
UpN
Aas
compared to LscB during the native gel protein separation
suggested that the two proteins were indeed different al-
though their predicted protein sizes were almost identical.
To demonstrate that LscB
UpN
A produced a unique and
novel enzyme and to show that the other two transfor-
mants indeed also produced the intended Lsc proteins, we
subjected the levan-forming fusion proteins to MALDI-
TOF analysis. The peptides recovered in the MALDI-TOF
analysis are shown in Figure 4. The recovered peptides
gave rise to an overall good coverage in the protein se-
quences (Table 1). Some of the peptides recovered were
unique to each protein (Figure 4, underlined). E.g., peptides
SFVQEVYDYGYIPAM from LscB
UpN
A and SFVQEEYDY-
GYIPAM from LscB were located at the same position,
namely 413427, in the respective amino acid sequences
Figure 2 Illustration of the different lsc genes and fusion
constructs. (a) Levan formation ability of the proteins encoded by
the fusion constructs in levan negative mutant PG4180.M6. The cells
were grown on mannitol-glutamate agar medium containing 5%
sucrose at 18°C to check for levan formation (indicated by the
dome-shaped glossy slime) around the colony. LscB, LscB
UpN
A and
LscB
Up
A showed levan formation. (b) Schematic representation of the
DNA fusion products. The dashed line and dashed arrow represents
lscB while the solid line and solid arrow represents lscA.
Figure 3 Detection of levansucrase. (a) Western blot analysis:
10 μg of total proteins were separated by 10% SDS-PAGE, transferred
onto PVDF membrane, hybridized with anti-Lsc antiserum and detected
using BCIP/NBT. The dark bands (arrow) correspond to Lsc and the
corresponding fusion proteins. (b) Zymogram: 100 μg of total proteins
were separated by 10% native-PAGE and incubated in 5% sucrose
solution overnight. The white bands indicate formation of levan after
utilization of sucrose by Lsc and the fusion proteins.
Khandekar et al. BMC Microbiology 2014, 14:79 Page 3 of 11
http://www.biomedcentral.com/1471-2180/14/79
of these proteins but had different masses, 1,782 Da as
compared to 1,812 Da, indicating they were from different
proteins. Similar differences were observed for the other
peptide sequences shown in the Figure 4 indicating that
the fusion constructs indeed led to the synthesis of novel
fusion proteins or of the proteins intended despite the
presence of similar upstream regions.
Analysis of lscA fusion protein expression by qRT-PCR
The difference in the amount of levan produced by LscB
Up
A
as compared to LscB
UpN
A and LscB in the zymogram
prompted us to check if this correlated at the RNA level.
Samples were grown in HSC medium at 18°C and harvested
at OD
600
of 0.5 since lsc transcription is maximum at this
optical density [23]. The total RNA was extracted from the
cells and the expression of lscB and lscA
Up
Bwas checked
by lscB-specific primers while that of lscA,lscB
UpN
Aand
lscB
Up
Awas checked by lscA-specific primers. The results
showed that, considering the standard deviation obtained
for the samples, the lscB
UpN
Ahad expression levels similar
to lscB (Figure 5) further supporting the results of the
Western blot and zymogram. On the other hand lscB
Up
A
had only 60% expression as compared to lscB.Aswas
the trend seen in the Western blot and zymogram, lscA
and lscA
Up
Bhad no expression. This indicated that even
though the upstream region of lscB is sufficient to promote
the expression of lsc, the expression level is enhanced by
thepresence48-bpN-terminusoflscB.
Analysis of native gene expression of lscA in P. syringae
pathovars
Lack of expression of lscA had been shown before in
P. syringae pv. glycinea PG4180 [10]. However, this has
not been experimentally proven for other P. syringae
pathovars. Consequently, possible expression patterns of
lscA variants were also analyzed in the three P. syringae
pathovars pv. phaseolicola 1448A, pv. syringae B728a and
pv. tomato DC3000 using cDNA synthesis and PCR. No
amplicon was detected in any of the four strains as shown
in Figure 6 indicating that none of the lscA variants are
expressed. The specificity of the primers was demonstrated
by amplifying the lscA genes from corresponding genomic
Figure 4 Amino acid sequence alignment of LscB
UpN
A, LscB and LscB
Up
A. Fragments in bold indicate peptides recovered from MALDI-TOF
analysis. The underlined fragments indicate recovered peptides which are unique to that protein.
Table 1 Proteins identified by MALDI-TOF analysis
NCBI accession
number/gi
Protein description Predicted molecular
mass (Da)
Significant hit MASCOT score Peptides matched Sequence coverage (%)
13936820 LscB 47,603 LscB 101 10 31
3914944 LscB
UpN
A 47,621 LscA 110 12 33
416026576 LscB
Up
A 45,844 LscA 110 8 19
Khandekar et al. BMC Microbiology 2014, 14:79 Page 4 of 11
http://www.biomedcentral.com/1471-2180/14/79
DNA, all of which gave amplicons of the expected sizes.
The accuracy of reverse transcription was checked by
amplifying a cDNA of a PG4180.M6 transformant carrying
a recombinant lscA gene under the control of P
lac
,where
lscA is known to be expressed [10]. Successful cDNA
synthesis of total mRNA was also demonstrated by PCR
amplifying the cDNA derived from the mRNA of the hexR
gene, a hexose metabolism regulator [25]. Gene hexR gave
an amplicon of expected size (Figure 6) indicating correct
cDNA synthesis.
Discussion
Genomic co-existence of three highly conserved genes
coding for levansucrase is a feature unique to the plant
pathogen P. syringae despite the fact that numerous other
bacterial species harbor just a single copy of this gene
in their genomes. Artificial expression of lscA from P.
syringae under the control of the P
lac
had been shown
previously [10]. The same study also showed that lscA
could not be expressed under its own promoter. Major
differences between lscA and the natively expressed genes
lscB and lscC are not found in the coding sequences but in
their upstream DNA regions. The upstream regions of
lscB and lscC represent a possible PAPE [24]. We previ-
ously hypothesized that this PAPE might harbor regulatory
sites required for expression of levansucrase and general
sugar metabolism in P. syringae. Herein, the PAPE of lscB
was fused to the coding sequence of lscA and thus proven
for its transcriptional activity in P. syringae.
The nucleotide sequence of the predicted PAPE consists
of two parts, the upstream region of lscB and the first
48-bp coding for the N-terminus of LscB. The importance
of these 48-bp of the ORF for the expression was tested
by generating fusion constructs of the upstream region
and lscA with or without these coding nucleotides. Trans-
formants carrying either of the two fusion constructs
produced levan similar to the PG4180.M6 mutant comple-
mented with lscB. Western blotting, zymographic detection,
and qRT-PCR analyses confirmed these results but also
allowed a more detailed view; native lscB and the lscB
UpN
A
fusion had similar mRNA expression levels while that of
the fusion lscB
Up
A, which lacked the 48-bp of N-terminal
LscB-coding region, had less. Consequently, one might
speculate that although the -450 bp upstream DNA region
of lscB, which includes the TSS as determined in this study,
is sufficient for expression of lscA, the first 48-bp of the lscB
ORF increase the level of its expression. Since our respect-
ive results of Western blotting and zymographic detection
of Lsc activity were indistinguishable from each other, it
could be concluded that the N-terminus of LscB might not
be involved in altering of enzymatic activities.
A peculiar observation was the electrophoretic migration
of the individual proteins or fusion proteins in polyacryl-
amide gels. The observed faster migration of LscB
UpN
A
Figure 5 Quantitative expression of different lsc genes and
constructs in dependence of lscB.lscB
UpN
Ashows similar levels of
expression as lscB while lscB
Up
A, which does not contain the first 48 bp
of lscB ORF, has lower expression. lscA and lscA
Up
Bwere not seen to be
expressed. lscA,lscB
UpN
Aand lscB
Up
Awere detected using lscA primers (
1
)
while the rest using lscB primers (
2
). The data represent the mean relative
expression of 3 replicates ± standard deviations. Data were normalized to
the highest expression value of lscB, which was set to 100%.
Figure 6 Expression of lscA in different P. syringae pathovars.
The bacterial cells were harvested at OD
600
of 0.5 and 2.0. Total RNA
was extracted as described in the Materials and Methods followed by
generation of cDNA. PCR amplification of lscA fragment on the total
cDNA using strain-specific primers showed no amplicon (lscA panel)
indicating no expression of lscA. Quality of the primers was checked by
performing PCR amplification using genomic DNA (gDNA) as template.
Amplification using an unrelated gene hexR (hexR)andartificially
expressed lscA by P
lac
[M6(pRA3.1)] signified correct reverse transcription.
Khandekar et al. BMC Microbiology 2014, 14:79 Page 5 of 11
http://www.biomedcentral.com/1471-2180/14/79
as compared to LscB under denaturing conditions could
potentially be attributed to the apparent mass shift for
two proteins with nearly identical molecular masses as
described earlier [26]. Interestingly, the migration of
LscB
UpN
A was significantly slower than that of LscB
under native conditions. This finding might demonstrate
that modest changes in the proteins surface charge might
result in significant alterations of electrophoretic mobility
[22,27,28].
Although the different migration rates of the proteins
or fusion proteins under native or denaturing conditions
suggested that the synthesized proteins were indeed
different from each other, a MALDI-TOF analysis of each
of the proteins was conducted using protein samples from
zymograms. The produced levan surrounding the proteins
did not seem to impact mass spectrometric analysis. The
MASCOT score for each of the identified proteins was
above the significance threshold of 100. The sample from
the PG4180.M6(lscB) sample gave LscB from P. syringae
pv. phaseolicola 1448A as the first significant match which
was in line with the high homology of the respective genes
in the close relatives pv. glycinea and pv. phaseolicola
[24]. The sample from PG4180.M6(lscB
Up
A) which
should synthesize only LscA gave the first significant
match as LscA from P. syringae pv. glycinea race 4 strain.
This proved that the lscB
Up
Afusion actually synthesized
an active LscA and confirmed earlier findings that artificial
expression of LscA of PG4180 leads to levan formation
[10]. Although the majority of obtained peptides for
the sample representing LscB
UpN
AwereLscA-borne
as expected, the unique N-terminal 2,122-Da peptide
NSPLASMSNINYAPTIWSR could be detected. This
peptide is a consequence of the presence of the NheI
restriction site coding for the amino acid residues alanine
and serine. Oxidation of methionine, which was chosen as
a variable modification parameter, added another 16 Da to
the peptide mass which subsequently increased the mass
of the NSPLASMSNINYAPTIWSR fragment to 2,138 Da.
This mass was exactly the same as the mass of a recovered
peptide which did not find a match during the NCBI
search since the respective fusion peptide is not present in
the database. Thus, the synthesis of the LscB
UpN
Afusion
protein could also be proven.
ThemajorityofpreviousLscA-relatedstudieshave
been performed with P. syringae pv. glycinea PG4180
[9,10,23,24]. However, thus far, there was no evidence
for a lack of lscA expression in other pathovars of P.
syringae.SincethegenomesofP. syringae pv. phaseolicola
1448A, pv. syringae B728a and pv. tomato DC3000 are
fully sequenced [19-21], template-specific oligonucleo-
tide primers for cDNA-based mRNA detection could
be designed. Although mRNA samples were extracted
during different growth stages, namely, early-logarithmic
and late-logarithmic phase, no amplicons could be detected
in any of the strains suggesting that lscA variants were not
expressed. PCR amplification, using respective genomic
DNA as template, proved that the primers were binding
correctly. An independent gene, hexR, coding for a con-
served hexose metabolism regulator protein HexR, was
chosen to see if the total mRNA had been reverse tran-
scribed correctly [25]. This PCR amplification gave correct
sized amplicon of 880-bp for all the four strains demon-
strating the accuracy of the used method. PCR amplification
was also performed on the cDNA obtained from mRNA
samples of PG4180.M6 containing lscA under the control of
P
lac
. This experiment gave the same-sized amplicon as for
genomic DNA again proving the accuracy of the method.
In summary, we propose that lscA could be an ancestral
Lsc variant in P. syringae as suggested by Srivastava et al.
[24]. During evolution, the inactive promoter perhaps did
not allow expression of lscA after this gene had potentially
been introduced to an ancestral P. syringae. An evolution-
ary gene duplication of lscA followed by an insertion of
a prophage-borne PAPE might have led to a new lsc
variant, i.e. lscB which in turn got duplicated yielding
lscC or vice-versa. As a result of this evolutionary process,
two functional and expressed lsc genes emerged in the
plant pathogen, for which utilization of sucrose, and per-
haps levan formation, might be particularly important.
The advantage of an additional in planta fitness-increasing
and possibly virulence-promoting factor [29] could have
helped this organism to selectively establish itself as a
potent plant pathogen. As a consequence of this hypothesis,
one could speculate on a loss of the supposedly non-
expressed lscA during further evolutionary steps, a pheno-
menon also previously hypothesized by Smits et al. [30].
Conclusions
The differential expression of levansucrases in P. syringae
was long known, but not tested. In this study, we have po-
tentially solved the previously unexplainable phenomenon
that P. syringae is the only organism possessing multiple
levansucrase-encoding genes. We demonstrated the impor-
tance of the upstream region as well as the N-terminus of
lscB/C required for the expression of Lsc in P. syringae.The
upstream region of lscA does not seem to promote lsc ex-
pression. With careful controls, herein we also demonstrated
that lscA is not expressed in other P. syringae pathovars.
Methods
Bacterial strains, plasmids and growth conditions
Bacterial strains, plasmids and oligonucleotides used in
this study are listed in Tables 2 and 3. E. coli DH5αwas
used as the cloning host [31] and grown in Lysogeny
Broth (LB) medium at 37°C. P. syringae cultures were
grown in HSC medium (0.8 mM MgSO
4
.7H
2
O, 30 mM
KH
2
PO
4
,16mMK
2
HPO
4
, 2 mM KNO
3
,20μM FeCl
3
,
19 mM NH
4
Cl, 100 mM glucose) [32] at 18°C. Bacterial
Khandekar et al. BMC Microbiology 2014, 14:79 Page 6 of 11
http://www.biomedcentral.com/1471-2180/14/79
growth in liquid media was monitored by measuring the
optical density at 600 nm (OD
600
) and harvested for (i)
protein sampling at an OD
600
of 2.0 or (ii) RNA extrac-
tion and cDNA synthesis at an OD
600
of 0.5 and 2.0.
Antibiotics were added to the media at the following
concentrations (μgml
-1
): ampicillin 50; tetracycline 25,
and chloramphenicol 25.
Molecular genetic techniques
Plasmid isolation, restriction enzyme digests, agarose and
polyacrylamide gel electrophoreses, electroporation, PCR,
and other routine molecular methods were performed
using standard protocols [31]. Nested deletion analysis of
the upstream region of lscB in plasmid pRB7.2 [10] was
conducted using the Erase-a-Base kit (Promega, Madison,
USA). For analysis of the lsc upstream regions, PCR was
used to generate products covering the respective regions
(Table 3). PCR products of the lsc upstream regions were
cloned in vectors pBBR1MCS or pBBR1MCS-3 [36].
Determination of transcriptional start site
Bacteria were incubated in HSC medium at 18°C to an
OD
600
of 0.5 and harvested by mixing 15 ml of the culture
with an equal volume of chilled killing buffer (20 mM
TrisHCl [pH7.5], 20 mM NaN
3
). This mixture was
centrifuged at 4°C for 15 min at 3,220 × g. Total RNA
was isolated from the cell pellets by acid phenol/
chloroform extraction as described previously [37]. For
primer extension analysis, 4 pmol of
32
P-labeled primer
pe.BC.PG ~ 150 bp (Table 3) were annealed with 10 μg
of total RNA and reverse transcription was performed
with M-MLV Reverse Transcriptase (Invitrogen, Karlsruhe,
Germany). Nucleotide sequencing using 5 μg of plasmid
pLB7.2 (Table 2) and primer pe.BC.PG ~ 150 bp was done
with the Sequenase Version 2.0 DNA Sequencing Kit
(USB, Cleveland, USA) according to the manufacturers
recommendation. The extension product and sequencing
reaction were resolved on a 6% polyacrylamide sequencing
gel. Signal detection was performed using a FLA-3000
phosphorimager (Raytest, Straubenhardt, Germany) ac-
cording to the manufacturers recommendations.
Generation of fusion constructs
All genes or DNA fragments were obtained by PCR amplifi-
cation unless otherwise stated. All restriction enzymes used
were obtained from Thermo Fisher Scientific Biosciences
(St. Leon Rot, Germany). The nucleotide sequencing was
done by Eurofins MWG Operon (Ebersberg, Germany).
Table 2 Bacterial strains and plasmids used in this study
Strain Description Reference or source
Pseudomonas syringae
pv. glycinea PG4180 Wild type, levan+ R. Mitchell
pv. phaseolicola 1448A Wild type, levan+ [33]
pv. syringae B728a Wild type, levan+ [34]
pv. tomato DC3000 Wild type, levan+ D. Cuppels
Pseudomonas syringae pv. glycinea PG4180
PG4180.M6 Sp
r
,Gm
r
,lscB lscC mutant of PG4180, levan- [10]
PG4180.M6(pRA3.1) Sp
r
,Gm
r
,Tc
r
,lscB lscC mutant of PG4180, containing lscA under control of
P
lac
on 3.1-kb PstI fragment in pRK415
[10]
Escherichia coli
DH5αsupE44 DlacU169 (F80 lacZDM15) hsdR17 recA1endA1gyrA96 thi-1 relA1[31]
Plasmids
pRK2013 Km
r
, helper plasmid [35]
pLB7.2 Ap
r
, contains lscB on 7.2-kb EcoRV insert [10]
pBBR1MCS Cm
r
, broad-host-range cloning vector [36]
pBBR1MCS-3 Tc
r
, broad-host-range cloning vector [36]
pBBR3-500-lscB Tc
r
,lscB gene with 500-bp upstream sequence in pBBR1MCS-3 [24]
pBBR3(lscA) Tc
r
,lscA gene containing insert from pRA3.1 in PBBR1MCS-3 not under control of P
lac
This study
pBBR3(lscB
UpN
A) Tc
r
, fusion of 518-bp upstream region of lscB (including first 48-bp of coding region)
and lscA (including start codon and downstream region) in pBBR1MCS-3
This study
pBBR3(lscB
Up
A) Tc
r
, fusion construct of 470-bp upstream region of lscB (without N-terminus) and lscA
(including start codon and downstream in pBBR1MCS-3
This study
pBBR3(lscA
Up
B) Tc
r
, fusion of 550-bp upstream region of lscA and lscB (including start codon and
downstream region) in pBBR1MCS-3
This study
Ap, Ampicillin; Cm, Chloramphenicol; Gm, Gentamycin; Km, Kanamycin; Sp, Spectinomycin; Tc, Tetracycline;
r
, resistant.
Khandekar et al. BMC Microbiology 2014, 14:79 Page 7 of 11
http://www.biomedcentral.com/1471-2180/14/79
Generation of lscB
UpN
Aand lscB
Up
A: The sequences of
the 518-bp PAPE and the 470-bp lscB upstream region
without the 48-bp coding sequence, respectively, were
ligated to the N-terminus of the 1,748-bp lscA fragment
using T4 DNA Ligase (Thermo Fisher Scientific Biosci-
ences) after treating the DNA with restriction enzyme NheI.
The ligation products were then treated with HindIII,
analysed by agarose gel electrophoresis, and the bands
corresponding to the fusion products (2,284 and 2,224 bp,
respectively) were purified from the gel using GeneJET
Gel Extraction kit (Thermo Fisher Scientific Biosciences).
The purified fusion products were ligated into pBluescript-
KS(II) using HindIII in such a way that the fusion products
were under control of the vector-borne lac promoter (P
lac
).
Formation of levan on LB agar containing 5% sucrose
indicated a functional lscA gene driven by the P
lac
.The
PAPE and lscB upstream regions were sequenced to
exclude any possibility of mutations. The fusion products
were then cloned into the broad host-range vector
pBBR1MCS using HindII in order to ligate them in
opposite orientation to the P
lac
andthenclonedinto
pBBR1MCS-3 using restriction enzymes PstIandXhoI
to keep the same opposite orientation with respect to
P
lac
as in case of pBBR1MCS. The constructs were intro-
duced into mutant PG4180.M6 via electroporation.
Generation of lscA
Up
B: A similar cloning strategy was
used to generate the lscA
Up
Bconstruct. The C-terminus
of the 550-bp PCR-amplified lscA upstream region and
the N-terminus of the 1,704-bp PCR-amplified ORF lscB
were ligated using a combination of restriction enzymes
XbaIandNheI which generate compatible DNA ends. This
ligation product was treated with endonucleases BamHI
and HindIII and subsequently ligated into pBluescript-SK
().TheconstructswereclonedintopBBR1MCSusing
restriction enzymes BamHI and HindII in order to ligate
them in opposite orientation to the P
lac
and then into
pBBR1MCS-3 using restriction enzymes using XbaIand
ApaI to keep the same opposite orientation with respect
to P
lac
as in case of pBBR1MCS.
Immunological and enzymatic detection of Lsc
Total proteins from PG4180.M6 and PG4180.M6 transfor-
mants harboring the lsc fusion constructs were obtained
as described previously [23]. For immunological detection
of the Lsc enzyme, total proteins were separated by 10%
SDS-PAGE and Western blot experiments were performed
with total protein fractions using polyclonal antibodies
raised against purified Lsc as reported earlier [10]. Zymo-
graphic detection of Lsc was done as described previously
by separating the total proteins by 10% native-PAGE and
incubating the gels in 5% sucrose solution [10]. Bacterial
cells grown on mannitol-glutamate agar plates with 1.5%
agar and 5% sucrose were used for the qualitative visual-
ization of Lsc activity, which led to levan formation in
form of a mucoid, dome-shaped colony morphology.
Lsc activity was quantified by measuring the amount of
glucose liberated during incubation with sucrose using
the Gluco-quant Glucose/HK assay kit (Roche Diagnos-
tics, Mannheim, Germany) at an absorbance of 340 nm.
One unit of Lsc activity corresponded to the amount
of enzyme which liberates 1 μmol glucose per minute
from sucrose. The experiments were repeated three-
fold and mean values were expressed as the quantity
of glucose release.
MALDI-TOF mass spectrometric analysis
Total proteins were separated using 10% native-PAGE
and incubated in 5% sucrose solution overnight [10]. As
soon as in-gel levan formation became apparent, the
corresponding bands were cut out from the gel and sub-
jected to an in-gel proteolytic cleavage using modified
porcine trypsin (Promega, Madison, WI) as adapted from
Table 3 Oligonucleotide primers used in this study
Oligonucleotides Nucleotide sequence (5-3)
pe.BC.PG ~ 150 bp GTCACCCATGCGGGCCAGCAG
lscB_UpN_f CCCAAGCTTCGATTGCAAGCTGATACACGTACC
lscB_UpN_r TAGGCTAGCTAGAGGACTATTTTTGAG
lscA_ORF_f CTAGCTAGCATGAGTAACATCAATTAC
lscA_ORF_r CCCAAGCTTCGGACGTCATCCTGATCGACAC
lscB_Up_r TAGGCTAGCAATTGATACCTTTAAATAGCTTTGGGAG
lscA_Up_f CGGGATCCAGCAAAGCGCTGTAAAACAGG
lscA_Up_r CTACTAGCTAGCGATGATGTCCTTTATTGGCGC
lscB_ORF_f GCTCTAGATGTCCACTAGCAGCTCTGCTGTAA
lscB_ORF_r CCCAAGCTTTCAGTATTACGGATACGATGAGC
lscA_gly_f TAAGCCCGGATTTTCCGGTC
lscA_gly_r TACTGTATGCGTGCCGCGTT
lscA_pha_f TCACGCTGACGGCTGACCGC
lscA_pha_r GCCTACTGTATGCGTGCCGCG
lscA_syr_f TCACGCTGACAGCTGATCGC
lscA_syr_r ACCAACGGTATGCGTACCGC
lscA_tom_f ATCACCCTGACAGCCGACCG
lscA_tom_r ACCGACAGTATGTGAACCCCGCT
lscA_f_RT ATGAGTAACATCAATTACGCACCC
lscA_r_RT TACTTTGGCAATTGCCGCAC
lscB_f_RT CTCTGCTGTAAGCCAGCTCAA
lscB_r_RT CGGGTGTGACGCAGGTGTAA
gyrA_fw CGAAGAGCTGGAAGTGATCC
gryA_rv GACGCTGAGCCTGATAGACC
hexR_fw ATGGACCGCGTAAGAAAC
hexR_rv TCAGCCTTGATCCTCGATCGG
Restriction sites in the primers are in italics: GAGCTC SacI, AAGCTT - HindIII,
GCTAGC - NheI, GGATCC - BamHI, TCTAGA XbaI.
Khandekar et al. BMC Microbiology 2014, 14:79 Page 8 of 11
http://www.biomedcentral.com/1471-2180/14/79
previous reports [38-40]. Trypsin digestion was carried
out for 1216 h at 37°C, and peptide samples were directly
used for MALDI-TOF MS exposure using an Autoflex II
TOF/TOF mass spectrometer (Bruker Daltonics, Bremen,
Germany) equipped with a 337 nm nitrogen laser and
operated with FlexControl 3.0 software. The matrix
used was 1 mg ml
1
of a-cyano-4-hydroxycinnamic acid
(HCCA; Bruker Daltonics) disolved in acetone and mixed
with two volumes of ethanol. Peptide samples were acid-
ified with 0.5% TFA in a ratio of 1:1 (v/v) and mixed with
the HCCA solution in a ratio of 1:1 (v/v). Samples of
0.5 μL were spotted and air-dried on MTB AnchorChip
targets with an anchor diameter of 600 μm(Bruker
Daltonics). Spots were twice rinsed with 2 μLof10mM
monobasic ammonium phosphate solution for ~5 s, dried,
and exposed to MALDI-TOF MS in positive-ion reflection
mode with the laser offset set to 67% +/15% and an
acquisition range of 8004,000 Da. A signal-to-noise ratio
of 6 was applied for peak identification using the Mascot
search engine [41] from Biotools software 3.1. Mass lists
were compared with NCBI databases and the Mascot
score probability set for p <0.05. Peptide sequence ana-
lyses was done using the ExPASy bioinformatics resource
portal [42].
Analysis of lsc gene expression by quantitative Reverse
Transcriptase polymerase chain reaction (qRT-PCR)
Total RNA was isolated by acid phenol/chloroform extrac-
tion as described previously [11]. The yield and the purity
of RNA were determined by measuring absorption at
260 nm. Total mRNA samples were treated with TURBO
DNA-free (Applied Biosystems, Darmstadt, Germany) to
remove remaining traces of genomic DNA as described by
the manufacturers recommendation. SYBR-green based
qRT-PCR was performed with 5 ng RNA template and
100 μM primer with QuantiTect SYBR Green one-step
RT-PCR Kit (Qiagen, Hilden, Germany) according to the
manufacturers instructions. The thermocycler program
comprised an initial step of 95°C for 15 min followed by
40 cycles of 95°C for 30 s, 58°C for 30 s, 72°C for 30 s. Re-
actions were performed with biological triplicates in a
Mastercycler ep realplex2 real-time PCR system (Eppendorf,
Hamburg, Germany) as described by the manufacturer
using their universal program. Reactions with no addition
of reverse transcriptase served as negative control and
proved the absence of DNA contamination. Specificity
of amplification was assessed by analyzing the melting
curve of the amplification product. Primers to amplify
lscB were used for constructs lscB and lscA
Up
Bwhile
primers to amplify lscA were used for constructs lscA,
lscB
UpN
Aand lscB
Up
A. All the results were normalized
to amplification of the cDNA of gyrA (PSPPH3667) as
described previously [43].
Analysis of lscA gene expression by Reverse-Transcriptase
polymerase chain reaction (RT-PCR)
Template-specific primers were designed for the respect-
ive lscA variants of P. syringae pv. glycinea PG4180, pv.
phaseolicola 1448A, pv. syringae B728a, and pv. tomato
DC3000. Bacterial cells were grown in HSC medium and
harvested at an OD
600
of 0.5 as well as 2.0. RNA was
extracted by acid phenol/chloroform extraction method
[11]. An RT-PCR was performed on total mRNA using
RevertAid First Strand cDNA Synthesis Kit (Fermentas)
as recommended by the manufacturer. The strain-specific
lscA primers were used to check for presence of an lscA
mRNA by PCR using cDNA as template. Regular PCR
with the same primer-pairs and genomic DNA as template
were used as controls. The thermocycler program was as
follows: 1 cycle of 95°C for 90 s; 25 cycles of 95°C for 15 s,
66°C for 15 s, 72°C for 30 s; 1 cycle of 72°C for 5 min. The
results were analyzed by 1% agarose gel electrophoresis.
Bioinformatics analyses
Vector NTI Advance 10.1.1 (Life Technologies, California,
USA) was used for the nucleotide, amino acid sequence
alignments, as well as for generating genetic maps. BLAST-
N and BLAST-P programs were used for online sequence
analyses [44]. The website www.pseudomonas.com was
consulted for the determination of P. syringae gene ortho-
logs and paralogs [45].
Abbreviations
Lsc: Levansucrase; MALDI-TOF: Matrix-assisted laser desorption/ionization-time
of flight; PAPE: Phage-associated promoter element; PG4180: Pseudomonas
syringae pv. glycinea PG4180.
Competing interests
All authors of the study (SK, ASr, DP, ASt and MU) declare that there are no
competing interests (whether political, personal, religious, ideological, academic,
intellectual or commercial) or any other activities influencing the work.
Authorscontributions
SK generated the fusion constructs, performed the levan formation, Western
blot, zymogram, RT-PCR and qRT-PCR assays; ASr determined the transcriptional
start site; DP generated and analysed a fusion construct; ASt conducted the
MALDI-TOF data acquisition and analysis; MU coordinated the study; SK and
MU prepared and revised the manuscript draft. All authors contributed to the
preparation and approval of the final manuscript.
Authorsinformation
SK Department of Molecular Microbiology, Molecular Life Sciences
Research Center, Jacobs University Bremen, Germany; ASr - Current Address:
Department of Experimental Limnology, Leibniz-Institute of Freshwater
Ecology and Inland Fisheries, Stechlin, Germany; DP Department of
Biochemical Engineering, Molecular Life Sciences Research Center, Jacobs
University Bremen, Germany; ASt Department of Molecular Microbiology,
Molecular Life Sciences Research Center, Jacobs University Bremen, Germany;
MU Department of Molecular Microbiology, Molecular Life Sciences Research
Center, Jacobs University Bremen, Germany.
Acknowledgements
We thank Helge Weingart for his helpful comments and Ramesh Mavathur
for his help with Sanger sequencing. This study was supported by the
Deutsche Forschungsgemeinschaft (UL-169/5-1).
Khandekar et al. BMC Microbiology 2014, 14:79 Page 9 of 11
http://www.biomedcentral.com/1471-2180/14/79
Author details
1
Molecular Life Sciences Research Center, Jacobs University Bremen, Campus
Ring 1, Bremen 28759, Germany.
2
Current Address: Department of
Experimental Limnology, Leibniz-Institute of Freshwater Ecology and Inland
Fisheries, Alte Fischerhuette 2, Stechlin 16775, Germany.
Received: 22 January 2014 Accepted: 19 March 2014
Published: 27 March 2014
References
1. Mansfield J, Genin S, Magori S, Citovsky V, Sriariyanum M, Ronald P, Dow M,
Verdier V, Beer SV, Machado MA, Toth I, Salmond G, Foster GD: Top 10
plant pathogenic bacteria in molecular plant pathology. Mol Plant Pathol
2012, 13:614629.
2. Young J, Saddler G, Takikawa Y: Names of plant pathogenic bacteria,
18641995. Rev Plant Pathol 1996, 75:721736.
3. Kvitko BH, Park DH, Velásquez AC, Wei C-F, Russell AB, Martin GB, Schneider DJ,
Collmer A: Deletions in the repertoire of Pseudomonas syringae pv. tomato
DC3000 type III Secretion effector genes reveal functional overlap among
effectors. PLoS Pathog 2009, 5:e100388.
4. Zhang J, Li W, Xiang T, Liu Z, Laluk K, Ding X, Zou Y, Gao M, Zhang X, Chen S,
Mengiste T, Zhang Y, Zhou J-M: Receptor-like cytoplasmic kinases integrate
signaling from multiple plant immune receptors and are targeted by a
Pseudomonas syringae effector. Cell Host Microbe 2010, 7:290301.
5. Huynh T, Dahlbeck D, Staskawicz B: Bacterial blight of soybean: regulation
of a pathogen gene determining host cultivar specificity. Science 1989,
245:13741377.
6. Denny TP: Involvement of bacterial polysaccharides in plant
pathogenesis. Annu Rev Phytopathol 1995, 33:173197.
7. Osman SF, Fett WF, Fishman ML: Exopolysaccharides of the phytopathogen
Pseudomonas syringae pv. glycinea. JBacteriol1986, 166:6671.
8. Gross M, Rudolph K: Studies on the extracellular polysaccharides (EPS)
produced in vitro by Pseudomonas phaseolicola I. Indications for a
polysaccharide resembling alginic acid in seven P. syringae pathovars.
J Phytopathol 1987, 118:276287.
9. Hettwer U, Jaeckel FR, Boch J, Meyer M, Rudolph K, Ullrich MS: Cloning,
nucleotide sequence, and expression in Escherichia coli of levansucrase
genes from the plant pathogens Pseudomonas syringae pv. glycinea and
P. syringae pv. phaseolicola. Appl Env Microbiol 1998, 64:31803187.
10. Li H, Ullrich MS: Characterization and mutational analysis of three allelic
lsc genes encoding levansucrase in Pseudomonas syringae. J Bacteriol
2001, 183:32823292.
11. Schenk A, Berger M, Keith LM, Bender CL, Muskhelishvili G, Ullrich MS: The
algT gene of Pseudomonas syringae pv. glycinea and new insights into
the transcriptional organization of the algT-muc gene cluster. J Bacteriol
2006, 188:80138021.
12. Sohn KH, Jones JDG, Studholme DJ: Draft genome sequence of
Pseudomonas syringae pathovar syringae strain FF5, causal agent of stem
tip dieback disease on ornamental pear. JBacteriol2012, 194:37333734.
13. Liu H, Qiu H, Zhao W, Cui Z, Ibrahim M, Jin G, Li B, Zhu B, Xie GL: Genome
sequence of the plant pathogen Pseudomonas syringae pv. panici LMG
2367. J Bacteriol 2012, 194:56935694.
14. Almeida NF, Yan S, Lindeberg M, Studholme DJ, Schneider DJ, Condon B,
Liu H, Viana CJ, Warren A, Evans C, Kemen E, Maclean D, Angot A, Martin
GB, Jones JD, Collmer A, Setubal JC, Vinatzer BA: A draft genome sequence
of Pseudomonas syringae pv. tomato T1 reveals a type III effector
repertoire significantly divergent from that of Pseudomonas syringae pv.
tomato DC3000. Mol Plant Microbe Interact 2009, 22:5262.
15. Studholme DJ, Ibanez SG, MacLean D, Dangl JL, Chang JH, Rathjen JP:
A draft genome sequence and functional screen reveals the repertoire
of type III secreted proteins of Pseudomonas syringae pathovar tabaci
11528. BMC Genomics 2009, 10:395.
16. Green S, Studholme DJ, Laue BE, Dorati F, Lovell H, Arnold D, Cottrell JE,
Bridgett S, Blaxter M, Huitema E, Thwaites R, Sharp PM, Jackson RW,
Kamoun S: Comparative genome analysis provides insights into the
evolution and adaptation of Pseudomonas syringae pv. aesculi on
Aesculus hippocastanum. PloS One 2010, 5:e10224.
17. Qi M, Wang D, Bradley CA, Zhao Y: Genome sequence analyses of
Pseudomonas savastanoi pv. glycinea and subtractive hybridization-based
comparative genomics with nine pseudomonads. PloS One 2011, 6:e16451.
18. Marcelletti S, Ferrante P, Petriccione M, Firrao G, Scortichini M:
Pseudomonas syringae pv. actinidiae draft genomes comparison reveal
strain-specific features involved in adaptation and virulence to Actinidia
species. PloS One 2011, 6:e27297.
19. Buell CR, Joardar V, Lindeberg M, Selengut J, Paulsen IT, Gwinn ML, Dodson RJ,
Deboy RT, Durkin AS, Kolonay JF, Madupu R, Daugherty S, Brinkac L, Beanan
MJ, Haft DH, Nelson WC, Davidsen T, Zafar N, Zhou L, Liu J, Yuan Q, Khouri H,
Fedorova N, Tran B, Russell D, Berry K, Utterback T, Aken SEV, Feldblyum TV,
DAscenzo M, et al. The complete genome sequence of the Arabidopsis and
tomato pathogen Pseudomonas syringae pv. tomato DC3000. Proc Natl Acad
Sci USA 2003, 100:1018110186.
20. Joardar V, Lindeberg M, Jackson RW, Selengut J, Dodson R, Brinkac LM,
Daugherty SC, DeBoy R, Durkin AS, Giglio MG, Madupu R, Nelson WC,
Rosovitz MJ, Sullivan S, Crabtree J, Creasy T, Davidsen T, Haft DH, Zafar N,
Zhou L, Halpin R, Holley T, Khouri H, Feldblyum T, White O, Fraser CM,
Chatterjee AK, Cartinhour S, Schneider DJ, Mansfield J, et al. Whole-genome
sequence analysis of Pseudomonas syringae pv. phaseolicola 1448A
reveals divergence among pathovars in genes involved in virulence and
transposition. J Bacteriol 2005, 187:64886498.
21. Feil H, Feil WS, Chain P, Larimer F, DiBartolo G, Copeland A, Lykidis A, Trong S,
Nolan M, Goltsman E, Thiel J, Malfatti S, Loper JE, Lapidus A, Detter JC, Land M,
Richardson PM, Kyrpides NC, Ivanova N, Lindow SE: Comparison of the
complete genome sequences of Pseudomonas syringae pv. syringae B728a
and pv. tomato DC3000. Proc Natl Acad Sci USA 2005, 102:1106411069.
22. Visnapuu T, Mäe A, Alamäe T: Hansenula polymorpha maltase gene
promoter with sigma 70-like elements is feasible for Escherichia
coli-based biotechnological applications: Expression of three genomic
levansucrase genes of Pseudomonas syringae pv. tomato. Process Biochem
2008, 43:414422.
23. Li H, Schenk A, Srivastava A, Zhurina D, Ullrich MS: Thermo-responsive
expression and differential secretion of the extracellular enzyme
levansucrase in the plant pathogenic bacterium Pseudomonas syringae
pv. glycinea. FEMS Microbiol Lett 2006, 265:178185.
24. Srivastava A, Al-Karablieh N, Khandekar S, Sharmin A, Weingart H, Ullrich MS:
Genomic distribution and divergence of levansucrase-coding genes in
Pseudomonas syringae. Genes 2012, 3:115137.
25. Del Castillo T, Ramos JL, Rodríguez-Herva JJ, Fuhrer T, Sauer U, Duque E:
Convergent peripheral pathways catalyze initial glucose catabolism in
Pseudomonas putida: genomic and flux analysis. J Bacteriol 2007,
189:51425152.
26. Rickwood D, Hames BD: Gel Electrophoresis of Nucleic Acids: A Practical
Approach. Oxford: IRL press; 1990.
27. Schagger H, Cramer WA, Vonjagow G: Analysis of molecular masses and
oligomeric states of protein complexes by blue native electrophoresis
and isolation of membrane protein complexes by two-dimensional na-
tive electrophoresis. Anal Biochem 1994, 217:220230.
28. Wittig I, Beckhaus T, Wumaier Z, Karas M, Schägger H: Mass estimation of
native proteins by blue native electrophoresis. Mol Cell Proteomics MCP
2010, 9:21492161.
29. Geier G, Geider K: Characterization and influence on virulence of the
levansucrase gene from the fireblight pathogen Erwinia amylovora.
Physiol Mol Plant Pathol 1993, 42:387404.
30. Smits THM, Rezzonico F, Duffy B: Evolutionary insights from Erwinia
amylovora genomics. J Biotechnol 2011, 155:3439.
31. Sambrook J: Molecular Cloning: A Laboratory Manual, Third Edition. 3rd edition.
Cold Spring Harbour, New York: Cold Spring Harbor Laboratory Press; 2001.
32. Bender CL, Liyanage H, Palmer D, Ullrich M, Young S, Mitchell R:
Characterization of the genes controlling the biosynthesis of the
polyketide phytotoxin coronatine including conjugation between
coronafacic and coronamic acid. Gene 1993, 133:3138.
33. Teverson DM: Genetics of Pathogenicity and Resistance in the Halo-Blight
Disease of Beans in Africa, Ph.D. thesis. United Kingdom: University of
Birmingham, Birmingham; 1997.
34. Loper J, Lindow S: Lack of evidence for in situ fluorescent pigment
production by Pseudomonas syringae pv. syringae on bean leaf
surfaces. Phytopathology 1987, 77:14491454.
35. Figurski DH, Helinski DR: Replication of an origin-containing derivative
of plasmid RK2 dependent on a plasmid function provided in trans.
Proc Natl Acad Sci USA 1979, 76:16481652.
36. Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM 2nd,
Peterson KM: Four new derivatives of the broad-host-range cloning
Khandekar et al. BMC Microbiology 2014, 14:79 Page 10 of 11
http://www.biomedcentral.com/1471-2180/14/79
vector pBBR1MCS, carrying different antibiotic-resistance cassettes.
Gene 1995, 166:175176.
37. Schenk A, Weingart H, Ullrich MS: Extraction of high-quality bacterial RNA
from infected leaf tissue for bacterial in planta gene expression analysis
by multiplexed fluorescent Northern hybridization. Mol Plant Pathol 2008,
9:227235.
38. Shevchenko A, Tomas H, Havlis J, Olsen JV, Mann M: In-gel digestion
for mass spectrometric characterization of proteins and proteomes.
Nat Protoc 2006, 1:28562860.
39. Speicher KD, Kolbas O, Harper S, Speicher DW: Systematic analysis of
peptide recoveries from in-gel digestions for protein identifications in
proteome studies. J Biomol Tech JBT 2000, 11:7486.
40. Granvogl B, Plöscher M, Eichacker LA: Sample preparation by in-gel digestion
for mass spectrometry-based proteomics. Anal Bioanal Chem 2007,
389:9911002.
41. Perkins DN, Pappin DJ, Creasy DM, Cottrell JS: Probability-based protein
identification by searching sequence databases using mass
spectrometry data. Electrophoresis 1999, 20:35513567.
42. Artimo P, Jonnalagedda M, Arnold K, Baratin D, Csardi G, de Castro E,
Duvaud S, Flegel V, Fortier A, Gasteiger E, Grosdidier A, Hernandez C,
Ioannidis V, Kuznetsov D, Liechti R, Moretti S, Mostaguir K, Redaschi N,
Rossier G, Xenarios I, Stockinger H: ExPASy: SIB bioinformatics resource
portal. Nucleic Acids Res 2012, 40:W597W603.
43. Vencato M, Tian F, Alfano JR, Buell CR, Cartinhour S, DeClerck GA, Guttman DS,
Stavrinides J, Joardar V, Lindeberg M: Bioinformatics-enabled identification of
the HrpL regulon and type III secretion system effector proteins of
Pseudomonas syringae pv. phaseolicola 1448A. Mol Plant Microbe Interact
2006, 19:11931206.
44. Mount DW: Using the Basic Local Alignment Search Tool (BLAST). In
Bioinformatics: Sequence and Genome Analysis.2
nd
edition. Cold Spring
Har Protoc 2007, 7:pdb.top17.
45. Winsor GL, Lam DKW, Fleming L, Lo R, Whiteside MD, Yu NY, Hancock REW,
Brinkman FSL: Pseudomonas Genome Database: improved comparative
analysis and population genomics capability for Pseudomonas genomes.
Nucleic Acids Res 2011, 39:D596D600.
doi:10.1186/1471-2180-14-79
Cite this article as: Khandekar et al.:The conserved upstream region of
lscB/C determines expression of different levansucrase genes in plant
pathogen Pseudomonas syringae.BMC Microbiology 2014 14:79.
Submit your next manuscript to BioMed Central
and take full advantage of:
Convenient online submission
Thorough peer review
No space constraints or color figure charges
Immediate publication on acceptance
Inclusion in PubMed, CAS, Scopus and Google Scholar
Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Khandekar et al. BMC Microbiology 2014, 14:79 Page 11 of 11
http://www.biomedcentral.com/1471-2180/14/79

Supplementary resources

  • ... The earlier levan production from bacteria has been carried out by using of different bacterial species such as P. fluorescencs (13). P. syringae (14), Leuconostoc kimchi (15). (16) Reported that there are several bacterial species producing extracellular levan, like Zymomonas mobilis, Bacillus subtilis, Bacillus polymyxa and Acetobacter xylinum. ...
    Research
    Full-text available
    The present investigation, was designed in order to isolate bacteria from rhizosphere soil of Cowpea farm in Iraq which is capable of levan production. The selected levan producing bacterium was identified as Pseudomonas brassicacearum based on the phenotypic identification by Bergey's Manual of Systematic Bacteriology and confirmed with the 16S rRNA gene sequencing. Acid hydrolyzed levan sample was subjected to TLC technique which revealed that, levan is composed of only one sugar which is fructose. R f values of levan produced by P. brassicacearum was 0.42 which is identical or close to R f values of fructose of 0.42. The effect of some factors on levan production by P. brassicacearum was investigated. The results showed that the best carbon source for levan production was sucrose 7.77 g/l, and casein was the best nitrogen source for levan production which gave 8.56 g/l, followed by ammonium sulfate and corn steep liquor which they gave 8.52, 8.09 g/l respectively. The highest levan yield was at the sucrose concentration of 300 g/l which gave 7.95 g/l. At initial pH of 7.8, P. brassicacearum gave their highest levan production that was 7.77 g/l. Levan production by P. brassicacearum continued increasing until it reached its maximum production at 40ºC which was 8.24 g/l. The optimal incubation period for levan production, was estimated at 8.70 g/l after 72 h of incubation.
  • ... The earlier levan production from bacteria has been carried out by using of different bacterial species such as P. fluorescencs (13). P. syringae (14), Leuconostoc kimchi (15). (16) Reported that there are several bacterial species producing extracellular levan, like Zymomonas mobilis, Bacillus subtilis, Bacillus polymyxa and Acetobacter xylinum. ...
    Article
    Full-text available
    The present investigation, was designed in order to isolate bacteria from rhizosphere soil of Cowpea farm in Iraq which is capable of levan production. The selected levan producing bacterium was identified as Pseudomonas brassicacearum based on the phenotypic identification by Bergey's Manual of Systematic Bacteriology and confirmed with the 16S rRNA gene sequencing. Acid hydrolyzed levan sample was subjected to TLC technique which revealed that, levan is composed of only one sugar which is fructose. R f values of levan produced by P. brassicacearum was 0.42 which is identical or close to R f values of fructose of 0.42. The effect of some factors on levan production by P. brassicacearum was investigated. The results showed that the best carbon source for levan production was sucrose 7.77 g/l, and casein was the best nitrogen source for levan production which gave 8.56 g/l, followed by ammonium sulfate and corn steep liquor which they gave 8.52, 8.09 g/l respectively. The highest levan yield was at the sucrose concentration of 300 g/l which gave 7.95 g/l. At initial pH of 7.8, P. brassicacearum gave their highest levan production that was 7.77 g/l. Levan production by P. brassicacearum continued increasing until it reached its maximum production at 40ºC which was 8.24 g/l. The optimal incubation period for levan production, was estimated at 8.70 g/l after 72 h of incubation.
  • ... However, it is not involved in the pathogenicity and/ or shifting of the host range [73]. All nine strains displayed homologues to levansucrase, LscA and LscB/C [75], an enzyme that utilizes sucrose to produce glucose and levan, the latter of which is an exopolysaccharide involved in the pathogenicity of many plant pathogenic bacteria [76]. All strains contained homologues of the bacterial flagellin cluster, including FliS which codes for a specific chaperone of the flagellum [77]. ...
    Article
    The European hazelnut (Corylus avellana) is threatened in Europe by several pseudomonads which cause symptoms ranging from twig dieback to tree death. A comparison of the draft genomes of nine Pseudomonas strains isolated from symptomatic C. avellana trees was performed to identify common and distinctive genomic traits. The thorough assessment of genetic relationships among the strains revealed two clearly distinct clusters: P. avellanae and P. syringae. The latter including the pathovars avellanae, coryli and syringae. Between these two clusters, no recombination event was found. A genomic island of approximately 20 kb, containing the hrp/hrc type III secretion system gene cluster, was found to be present without any genomic difference in all nine pseudomonads. The type III secretion system effector repertoires were remarkably different in the two groups, with P. avellanae showing a higher number of effectors. Homologue genes of the antimetabolite mangotoxin and ice nucleation activity clusters were found solely in all P. syringae pathovar strains, whereas the siderophore yersiniabactin was only present in P. avellanae. All nine strains have genes coding for pectic enzymes and sucrose metabolism. By contrast, they do not have genes coding for indolacetic acid and anti-insect toxin. Collectively, this study reveals that genomically different Pseudomonas can converge on the same host plant by suppressing the host defence mechanisms with the use of different virulence weapons. The integration into their genomes of a horizontally acquired genomic island could play a fundamental role in their evolution, perhaps giving them the ability to exploit new ecological niches.
  • ... Inulin type polyfructan is obtained from inulinosucrase and shows the opposite α-(2-1) chain with α-(2-6) branches (Figure 2I ). Levansucrases are widely distributed among Grampositive bacteria and several plant pathogens carry more than one enzyme (Khandekar et al., 2014); inulinosucrases are only present in lactic acid bacteria (Srikanth et al., 2015). Mechanism of reaction is similar to glucansucrases. ...
    Article
    Full-text available
    Bacteria produce a wide range of exopolysaccharides which are synthesized via different biosynthesis pathways. The genes responsible for synthesis are often clustered within the genome of the respective production organism. A better understanding of the fundamental processes involved in exopolysaccharide biosynthesis and the regulation of these processes is critical toward genetic, metabolic and protein-engineering approaches to produce tailor-made polymers. These designer polymers will exhibit superior material properties targeting medical and industrial applications. Exploiting the natural design space for production of a variety of biopolymer will open up a range of new applications. Here, we summarize the key aspects of microbial exopolysaccharide biosynthesis and highlight the latest engineering approaches toward the production of tailor-made variants with the potential to be used as valuable renewable and high-performance products for medical and industrial applications.
  • ... Furthermore quantitative expression analysis of lsc genes by quantitative Reverse Transcriptase (qRT)-PCR showed that lscB and lscC are actively expressed. However lscA is not being expressed due to an altered upstream region of lscA which does not seem to promote lsc expression [3]. Both enzymes are synthesized maximally at 18°C in vitro and in planta and their expression is optimal at the early logarithmic growth stage [4,5]. ...
    Article
    Background: Pseudomonas syringae pv. glycinea PG4180 causes bacterial blight on soybean plants and enters the leaf tissue through stomata or open wounds, where it encounters a sucrose-rich milieu. Sucrose is utilized by invading bacteria via the secreted enzyme, levansucrase (Lsc), liberating glucose and forming the polyfructan levan. P. syringae PG4180 possesses two functional lsc alleles transcribed at virulence-promoting low temperatures. Results: We hypothesized that transcription of lsc is controlled by the hexose metabolism repressor, HexR, since potential HexR binding sites were identified upstream of both lsc genes. A hexR mutant of PG4180 was significantly growth-impaired when incubated with sucrose or glucose as sole carbon source, but exhibited wild type growth when arabinose was provided. Analyses of lsc expression resulted in higher transcript and protein levels in the hexR mutant as compared to the wild type. The hexR mutant’s ability to multiply in planta was reduced. HexR did not seem to impact hrp gene expression as evidenced by the hexR mutant’s unaltered hypersensitive response in tobacco and its unmodified protein secretion pattern as compared to the wild type under hrp-inducing conditions. Conclusions: Our data suggested a co-regulation of genes involved in extra-cellular sugar acquisition with those involved in intra-cellular energy-providing metabolic pathways in P. syringae. Keywords: Plant pathogen, Bacterial blight, Soybean, Pseudomonas syringae, Levansucrase, Hexose metabolism, HexR
  • ... Furthermore quantitative expression analysis of lsc genes by quantitative Reverse Transcriptase (qRT)-PCR showed that lscB and lscC are actively expressed. However lscA is not being expressed due to an altered upstream region of lscA which does not seem to promote lsc expression [3] . Both enzymes are synthesized maximally at 18°C in vitro and in planta and their expression is optimal at the early logarithmic growth stage [4,5]. ...
    Book
    Full-text available
    This volume mainly reports on new and recent advancements on different aspects of Pseudomonas syringae, a plant pathogenic bacterial species that include a high number of pathogens of important crops, which is an interesting model organism in plant pathology. In addition some related fluorescent Pseudomonas spp., responsible of new and emerging diseases, as well as some pathogens previously included in the above genus and now classified in the genera Ralstonia, Acidovorax are also considered. The tremendous recent advancements on: the ecology and epidemiology and, in particular, the adaptation of P. syringae to stresses and adverse environmental conditions; the function and regulation of genes involved in the production of phytotoxins and on their mechanism of action in the interaction with the host cells; the structure, function and regulation of type three secretion system (TTSS) and the transport of the effectors proteins in the host cells; the possibility to control diseases through the induction of the systemic acquired resistance (SAR); the development of molecular techniques for the highly specific and sensible identification and detection of pathogens; the determination of the causal agents of new and emerging diseases as well the classification of the different pathovars of P. syringae; are reported in 76 chapters cured by leading scientist in the respective fields.
  • Article
    Synthesis of the exopolysaccharide levan occurs in the bacterial blight pathogen of soybean, Pseudomonas syringae pv. glycinea PG4180, when this bacterium encounters moderate to high concentrations of sucrose inside its host plant. The process is mediated by the temperature-dependent expression and secretion of two levansucrases, LscB and LscC. Previous studies showed the importance of a prophage-associated promoter element in driving the expression of levansucrase genes. Herein, heterologous screening for transcriptional activators revealed that the prophage-borne transcriptional regulator, LscR, from P. syringae mediates expression of levansucrase. A lscR-deficient mutant was generated and exhibited a levan-negative phenotype when grown on a sucrose-rich medium. This phenotype was confirmed by zymographic analysis and Western blots which demonstrated absence of levansucrase in the supernatant and total cell lysates. Transcriptional analysis showed a down-regulation of expression levels of levansucrase and glycosyl hydrolase genes in the lscR-deficient mutant. Ultimately, a direct binding of LscR to the promoter region of levansucrase was demonstrated using electrophoretic mobility shift assays allowing to conclude that a bacteriophage-derived regulator dictates expression of bacterial genes involved in in planta fitness. This article is protected by copyright. All rights reserved.
  • Chapter
    Polysaccharides produced by a variety of bacteria have properties as viscosifiers, thickening and gelling agents, which contribute to the rheology and texture of fermented food. In addition, some can act as prebiotic agents by enhancing the development of a microbiota that is beneficial to the human and animal gastrointestinal tract, as well as possibly possessing an immunomodulating effect. These aspects constitute an important field of research that could lead to the production of fermented functional foods which benefit human and animal health. Therefore, in this chapter, in addition to describing the nature and structure of bacterial exopolysaccharides (EPS), we review the current knowledge concerning the functional properties of EPS as well as describing their actual usages and future potential applications.
  • Article
    Gut microbiota influences more physiological and developmental processes of humans and animals than earlier expected. Therefore, the possibility to shape the composition and activity of this bacterial population by prebiotics becomes especially important. Inulin, a β-2,1 linked fructan polymer, from plants and fructooligosaccharides (FOS) derived from it are recognized and already widely used as prebiotics while β-2,6 linked fructans have received much less attention from scientific community. In this mini-review, we will address β-2,6 linked fructans: levan and levan-type FOS as novel potential prebiotics and summarize the literature data on levansucrases of Pseudomonas bacteria which are producing these fructans. The major attention is drawn to stable and highly efficient levansucrases of P. syringae pv. tomato, among which the Lsc3 protein has been most thoroughly studied using biochemical methods as well as extensive mutagenesis of the protein. Copyright © 2015. Published by Elsevier B.V.