ArticlePDF Available

Vitamin D receptor regulates intestinal proteins involved in cell proliferation, migration and stress response

Authors:

Abstract and Figures

Genome-wide association studies found low plasma levels of 25-hydroxyvitamin D and vitamin D receptor (VDR) polymorphisms associated with a higher prevalence of pathological changes in the intestine such as chronic inflammatory bowel diseases. In this study, a proteomic approach was applied to understand the overall physiological importance of vitamin D in the small intestine, beyond its function in calcium and phosphate absorption. In total, 569 protein spots could be detected by two-dimensional-difference in-gel electrophoresis (2D-DIGE), and 82 proteins were considered as differentially regulated in the intestinal mucosa of VDR-deficient mice compared to that of wildtype (WT) mice. Fourteen clearly detectable proteins were identified by MS/MS and further analyzed by western blot and/or real-time RT-PCR. The differentially expressed proteins are functionally involved in cell proliferation, cell adhesion and cell migration, stress response and lipid transport. Mice lacking VDR revealed higher levels of intestinal proteins associated with proliferation and migration such as the 37/67 kDa laminin receptor, collagen type VI (alpha 1 chain), keratin-19, tropomyosin-3, adseverin and higher levels of proteins involved in protein trafficking and stress response than WT mice. In contrast, proteins that are involved in transport of bile and fatty acids were down-regulated in small intestine of mice lacking VDR compared to WT mice. However, plasma and liver concentrations of cholesterol and triglycerides were not different between the two groups of mice. Collectively, these data imply VDR as an important factor for controlling cell proliferation, migration and stress response in the small intestine.
Content may be subject to copyright.
R E S E A R C H Open Access
Vitamin D receptor regulates intestinal proteins
involved in cell proliferation, migration and stress
response
Hagen Kühne
1
, Alexandra Schutkowski
1
, Susann Weinholz
2
, Christina Cordes
2
, Angelika Schierhorn
3
, Kristin Schulz
4
,
Bettina König
1
and Gabriele I Stangl
1*
Abstract
Background: Genome-wide association studies found low plasma levels of 25-hydroxyvitamin D and vitamin D
receptor (VDR) polymorphisms associated with a higher prevalence of pathological changes in the intestine such as
chronic inflammatory bowel diseases.
Methods: In this study, a proteomic approach was applied to understand the overall physiological importance of
vitamin D in the small intestine, beyond its function in calcium and phosphate absorption.
Results: In total, 569 protein spots could be detected by two-dimensional-difference in-gel electrophoresis (2D-DIGE),
and 82 proteins were considered as differentially regulated in the intestinal mucosa of VDR-deficient mice compared to
that of wildtype (WT) mice. Fourteen clearly detectable proteins were identified by MS/MS and further analyzed by
western blot and/or real-time RT-PCR. The differentially expressed proteins are functionally involved in cell proliferation,
cell adhesion and cell migration, stress response and lipid transport. Mice lacking VDR revealed higher levels of
intestinal proteins associated with proliferation and migration such as the 37/67 kDa laminin receptor, collagen type VI
(alpha 1 chain), keratin-19, tropomyosin-3, adseverin and higher levels of proteins involved in protein trafficking and stress
response than WT mice. In contrast, proteins that are involved in transport of bile and fatty acids were down-regulated in
small intestine of mice lacking VDR compared to WT mice. However, plasma and liver concentrations of cholesterol and
triglycerides were not different between the two groups of mice.
Conclusion: Collectively, these data imply VDR as an important factor for controlling cell proliferation, migration and
stress response in the small intestine.
Keywords: VDR-deficiency, Small intestine, Proteomics, Laminin receptor, Cell adhesion, Mice, Stress response
Background
Vitamin D is well known for its role in regulation of cal-
cium homeostasis and bone metabolism [1], but it also
exerts numerous other non-skeletal biological effects in
almost all tissues [2]. It is currently assumed that vitamin
D participates in the regulation of up to 5% of the human
genome [3]. One important target tissue of vitamin D is
the intestine where it regulates calcium and phosphate
absorption [4-6]. Non-skeletal vitamin D effects in the
intestine have been characterized mainly in the colon
and include the regulation of tight junction proteins in
the epithelial layer [7]. Vitamin D further modulates co-
lonic T-cell responses and inflammation processes [5,8-10],
and regulates the proliferation of intestinal cells in the
colon [11-13]. It should therefore be presumed that vita-
min D deficiency leads to mucosal dysregulation. The
observed associations of low vitamin D levels or VDR
deficiency with inflammatory bowel diseases in epidemi-
ologic studies [14-17], genome-wide association studies
[18] and experimental murine models [7,19-21], and the
linkage between vitamin D deficiency and colorectal cancer
[22,23] may reflect the proposed intestinal dysregulation
in response to vitamin D deficiency. Apart from the
* Correspondence: gabriele.stangl@landw.uni-halle.de
1
Institute of Agricultural and Nutritional Sciences, Martin Luther University
Halle-Wittenberg, Von-Danckelmann-Platz 2, D-06120 Halle (Saale), Germany
Full list of author information is available at the end of the article
© 2014 Kühne et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain
Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article,
unless otherwise stated.
Kühne et al. Lipids in Health and Disease 2014, 13:51
http://www.lipidworld.com/content/13/1/51
vitamin D function in mineral absorption, there is a gap
of knowledge on the role of vitamin D in the small in-
testine, although the cells from the small intestine reveal
a higher VDR expression than most of the other tissues
[24]. The VDR is a nuclear receptor that mediates the
cellular effects of vitamin D by binding to vitamin D re-
sponse elements of target genes [25]. Therefore, mice
lacking VDR are an appropriate model to elucidate the
overall functions of vitamin D in selected tissues [26].
To target the gap of knowledge on vitamin D function
in the small intestine, we performed quantitative com-
parative protein expression profiling of the small intes-
tinal mucosa of VDR knockout (KO) versus wildtype
(WT) mice by applying two-dimensional-difference in-
gel electrophoresis (2D-DIGE) in combination with ESI-
QTOF-MS/MS.
Results
Analysis and identification of differentially
expressed proteins
In order to determine the differential protein expression
pattern of the small intestinal mucosa of VDR-KO and
WT mice, protein extracts were analyzed by 2D-DIGE. In
total, 569 protein spots could be detected on the resulting
consensus 2D gel. Comparative analysis of the protein ex-
pression profiles revealed that 82 protein spots can
be classified differentially expressed (by a regulation
factor > 2.0 (up- or down-regulated)) between VDR-KO
and corresponding WT mice. 19 spots could be assigned
to 14 unique proteins by MS/MS identification (Table 1).
A representative 2D gel image is shown in Figure 1 and
direct spot comparisons are shown in Figure 2. Three
spots were identified as β-actin with various pIs and mo-
lecular weights. Also, 94 kDa glucose-regulated protein
(GRP94), heat shock cognate 71 kDa protein (Hsc70) and
keratin-19 (K19) were detected in multiple spots which
may represent post-translationally modified forms of these
proteins. Proteins that were up-regulated in small intestinal
mucosa of VDR-KO compared to WT mice included pro-
teins that are involved in cell adhesion (37/67 kDa laminin
receptor (37/67LR), collagen type VI (alpha 1 chain) (Col
6a1)), cytoskeleton proteins (tropomyosin-3 (Tpm3), adse-
verin, K19), stress response and protein trafficking proteins
(GRP94, valosin-containing protein (VCP/p97)) and the
proteasome activator subunit 2 (PA28β). Proteins that were
down-regulated in VDR-KO compared to WT mice are
two lipid transport proteins (ileal lipid-binding protein
(ILBP), intestinal fatty acid-binding protein (I-FABP)), the
cytoskeleton component β-actin, the 14-3-3 protein iso-
form ζ/δ, the heat shock cognate protein Hsc70 and
6-phosphogluconolactonase (6PGL). Note, PA28βand
6PGL failed to overcome the Mascot significance level of
56 and may therefore be indefinite despite adequate se-
quence coverage.
Verification of 2D-DIGE data by western blotting and RT-PCR
To verify the 2D-DIGE results, the 37/67LR protein ex-
pression was analyzed by western blot analysis. 37/67LR
was chosen because of its tenfold higher expression in
VDR-KO compared to WT mice. Western blot analysis
revealed that protein expression of 37/67LR was about
fivefold higher in the small intestinal mucosa of VDR-
KO than in the mucosa of WT mice (Figure 3), thus in-
deed supporting the initial proteomic profiling results.
To analyze whether the observed differences in protein
expression between the VDR-KO and the WT mice were
linked to changes in the mRNA levels, we determined the
relative mRNA concentrations of the corresponding genes.
Here we show that the relative mRNA abundances of
β-actin, Col6a1 and 14-3-3 protein ζ/δwere in line with
proteinexpressiondata(Table1).TheintestinalmRNA
abundances of GRP94 and PA28βwhich were slightly lower
in the VDR-KO mice than in the WT mice completely dif-
fered from the protein data, and the mRNA abundances of
seven other genes were not different between VDR-KO and
WT mice, assuming post-transcriptional effects which are
responsible for the discrepancy between mRNA and pro-
tein data (Table 1). As indicated in Figure 4, no difference
in relative mRNA concentration of 37/67LR was found
in small intestinal mucosa of VDR-KO and WT mice.
Increased expression of the membrane form of 37/67LR
is associated with increased mRNA expression and activity
of matrix metalloproteinase (MMP)-2 [27]. Therefore, we
also analyzed the mRNA abundance of MMP-2. Data re-
veal that mRNA-concentration of MMP-2 was higher in
the small intestine of VDR-KO mice than in small intes-
tine of WT mice (1.7-fold; p < 0.01; Figure 4).
Lipid concentrations in plasma and liver
Triglyceride and cholesterol concentrations of plasma and
liver did not differ between VDR-KO and WT mice (tri-
glycerides in plasma: VDR-KO, 1.85 ± 0.31 mmol/l, WT,
1.71 ± 0.48 mmol/l; liver triglycerides: VDR-KO, 60.3 ±
8.4 μmol/g, WT, 57.9 ± 8.8 μmol/g; cholesterol in plasma:
VDR-KO, 3.34 ± 0.28 mmol/l, WT, 3.39 ± 0.54 mmol/l;
liver cholesterol: VDR-KO, 10.9 ± 1.4 μmol/g, WT, 12.4 ±
2.4 μmol/g).
Discussion
This study aimed to investigate the role of the vitamin D
on small intestinal mucosa proteins by use of VDR-KO
mice and 2D-DIGE analysis. Here we could identify 14
proteins that were differently expressed in VDR-KO and
WT mice indicating a direct or indirect involvement of
VDR in regulation of these proteins. The identified pro-
teins are involved in cell proliferation, cell migration and
stress response.
Intestinal integrity is governed by a variety of signaling
pathways that balance cell proliferation and differentiation.
Kühne et al. Lipids in Health and Disease 2014, 13:51 Page 2 of 9
http://www.lipidworld.com/content/13/1/51
Table 1 Differentially expressed proteins and mRNA abundances of genes in the small intestinal mucosa of VDR-KO relative to WT mice
UniProtAcc. Protein Spot no. Fold change
a
No. of peptides Coverage (%) pI (theor.) Mascot score mRNA fold change
a
Function
P14206 37/67 kDa laminin
receptor (37/67LR)
16 +10.8 9 39 4.80 422 n.s. Membrane receptor for laminin
P08113 94 kDa glucose-regulated
protein (GRP94)
18, 19 +5.0, +5.5 22 28 4.74 307 1.4* Chaperone, stress response
P21107 Tropomyosin 3 (Tpm3) 13 +4.3 11 28 4.68 225 n.d. Cytoskeleton
Q04857 Collagen type VI
(alpha 1 chain) (Col6a1)
1 +4.2 9 10 5.20 88 +1.8* Extracellular matrix protein
Q01853 Valosin-containing
protein(VCP/p97)
17 +3.8 18 28 5.14 204 n.s. Chaperon, stress response,
protein degradation
P97372 Proteasome activator
complex subunit 2 (PA28β)
8 +3.1 8 40 5.54 35
c
1.6* Proteasome activation
P19001 Keratin, type I
cytoskeletal 19 (K19)
14, 15 +2.1, +2.9 14 39 5.28 127 n.s. Cytoskeleton
Q60604 Adseverin 2 +2.8 18 30 5.46 88 n.s. Cytoskeleton
P60710 β-actin 5, 6, 7 6.5, 4.2-4.1 5 15-21 5.29
b
54-70 2.0* Cytoskeleton
Q9CQ60 6-phosphogluconolactonase
(6PGL)
92.7 3 15 5.55 39
c
n.s. Carbohydrate metabolism
P63017 Heat shock cognate
71 kDa protein (Hsc70)
3, 4 2.5, 2.6 31 52 5.37 586 n.s. Chaperone, stress response
P51162 Ileal lipid-binding
protein (ILBP)
10 2.5 8 68 5.91 210 n.d. Lipid metabolism
P55050 Fatty acid-binding
protein 2 (I-FABP)
11 2.4 4 31 6.62 102 n.s. Lipid metabolism
P63101 14-3-3 protein ζ/δ12 2.3 18 63 4.73 353 1.6* Signal transduction
a)
+indicates up- and “–“ down-regulationinVDR-KOvs.WTmice;
b)
full length protein;
c)
below Mascot significance threshold of 56; *
)
Significantly different from WT mice (p < 0.05, Studentst-test); n.s. non-significant; n.d.
not determined.
Kühne et al. Lipids in Health and Disease 2014, 13:51 Page 3 of 9
http://www.lipidworld.com/content/13/1/51
Figure 1 2D spot pattern of analytical gels. A) Gels are composed of small intestinal mucosa of vitamin D receptor knockout (VDR-KO) and
corresponding wildtype (WT) mice. In total, 15 μg of fluorescence labeled proteins were subjected to 2D-DIGE. B) Enlarged sections showing
selected spots of the analytical gel in A). For spot description, see Table 1.
Figure 2 Representative spot comparison of differentially expressed proteins of vitamin D receptor knockout and wildtype mice.
Regulated and identified proteins from small intestinal mucosa of vitamin D receptor knockout (VDR-KO, left) mice are pictured in comparison to
their respective wildtype (WT) mice (right) counterpart. Spot number is given in brackets.
Kühne et al. Lipids in Health and Disease 2014, 13:51 Page 4 of 9
http://www.lipidworld.com/content/13/1/51
Under physiological conditions, cell replenishment is char-
acterized by continuous proliferation of crypt epithelial
cells, migration of the cells along the crypt-villus axis and
extrusion at the villus tip. Cell migration requires cycles of
polarized attachment of cells to the underlying matrix, and
the establishment of the polarized state. Regulated re-
arrangements of the cytoskeleton and coordinated intra-
cellular trafficking of organelles and membrane proteins
are important steps in these processes. Here, we found
that VDR deficiency is associated with the up-regulation
of proteins that are involved in processes of proliferation
and migration of epithelial cells in the small intestine.
These include 37/67LR, Col6a1, Tpm3, adseverin, K19 and
GRP94. Among those proteins, the strongest change was
observed for 37/67LR, which functions in its membrane
bound form as a non-integrin receptor for the basement
membrane glycoprotein laminin [28,29]. 37/67LR is over-
expressed in a variety of common cancers and its expres-
sion level correlates with aggressiveness and metastatic
potential [29]. Recent data demonstrate that 37/67LR pre-
dominantly appears in the undifferentiated/proliferative re-
gion of the human intestinal crypt and regulates adhesion
and proliferation of epithelial cells [30]. We assume that
the strong expression of 37/67LR in the VDR-KO mice
might reflect a disturbed balance between cell proliferation
and differentiation in favor of proliferation. This confirms
the anti-proliferative function of vitamin D and VDR
which has been described for the colon and colon car-
cinoma cells [31,32]. The finding that the mRNA ex-
pression of MMP-2 was also enhanced corroborates the
high abundance of 37/67LR in the small intestine of
mice lacking VDR [27]. However, increased protein ex-
pression of 37/67LR was not associated with increased
mRNA levels indicating posttranscriptional regulation.
A second protein that was up-regulated in the VDR-KO
mice was Col6a1. Collagen VI functions as a bona fide basal
lamina component in the intestine, and is involved in epi-
thelial cell behavior and cell-fibronectin interactions [33].
Besides cellular adhesion components, also cytoskeletal
components were up-regulated in the intestine of VDR-
KO mice. K19, that belongs to one of those up-regulated
cytoskeletal proteins, functions as an intermediate fila-
ment mainly in proliferating crypt cells [34] and is associ-
ated with a less differentiated phenotype of Caco-2-cells
[35]. Tpm3 and the gelsolin-family member adseverin are
two other differentially expressed proteins which are in-
volved in actin-filament assembly and turnover [36,37]. In
the context of an altered expression of β-actin in the small
Figure 3 Western blot analysis of 37/67 kDa laminin receptor. A) Protein expression of 37/67 kDa laminin receptor (37/67LR) of small
intestinal mucosa samples of vitamin D receptor knockout (VDR-KO) and wildtype (WT) mice are represented as means ± s.d. (n = 6). *Significantly
different from WT mice (p < 0.05, Students t-test). B) Representative immunoblot of 37/67LR and GAPDH from small intestinal mucosa samples of
VDR-KO and WT mice.
Figure 4 Relative mRNA levels of 37/67 kDa laminin receptor
(37/67LR) and matrix-metalloproteinase-(MMP)-2. Relative mRNA
levels in small intestinal mucosa of vitamin D receptor knockout
(VDR-KO) and wildtype (WT) mice were determined by real-time
detection RT-PCR analysis. Expression values were normalized to HPRT
and Ppia. Bars represent means ± s.d. (n= 6). *Significantly different
from WT mice (p < 0.05, Students t-test).
Kühne et al. Lipids in Health and Disease 2014, 13:51 Page 5 of 9
http://www.lipidworld.com/content/13/1/51
intestine of VDR-KO mice, the findings assume changes
in the regulation of actin-filament dynamics in these ani-
mals, and confirm other studies that found vitamin D in-
volved in modulation of cytoskeletal protein expression in
e.g. muscle cells [38] and cell lines [39,40].
Vitamin D is supposed to be involved in reducing oxida-
tive cell and endoplasmic reticulum (ER) stress [41-43], and
colon cells of VDR-KO mice show higher levels of bio-
markers for oxidative stress than those of WT mice [32].
Thecurrentstudyfoundacoupleofdifferentiallyexpressed
stress response proteins in the small intestine of VDR-KO
mice compared to WT mice that may underline the vita-
min D function in stress response. In particular, we ob-
served alterations in the intestinal expression of GRP94, a
member of the HSP90 family, the ATP-driven VCP/p97,
Hsc70, a molecular chaperone of the HSP70 family, and
the proteasome activator subunit PA28βin mice lacking
VDR compared to WT mice. These proteins are involved
in adaptive mechanisms to stress response, especially in
processing misfolded proteins (ubiquitination, refolding)
[44-47]. Since the small intestine is normally exposed to
a multitude of stressors like harmful nutritional compo-
nents, microorganisms, toxins and luminal antigens, it can
be speculated that vitamin D may modify the response to
cells to those stressors.
The multifunctional protein 14-3-3ζ/δwas less expressed
in small intestine of VDR-KO than of WT mice. Proteins of
the 14-3-3 family are highly conserved eukaryotic proteins
that regulate many cellular processes by altering the con-
formation, activity or subcellular localization of target pro-
teins, e.g. cytoskeletal components [48-50]. Interestingly,
14-3-3ζ/δis also involved in regulation of Wnt/β-catenin
signaling in intestinal stem cells, a pathway that is impli-
cated in intestinal development and regeneration [51], and
that has been associated with the differentiation-promoting
effect of vitamin D/VDR in colon carcinoma cells [23,52].
Besides alterations in proteins involved in cell prolifer-
ation, cell migration, cytoskeletal organization and stress
response, the small intestine of VDR-KO mice showed
reduced expression of ILBP and I-FABP, proteins that
are involved in lipid metabolism and transport. Recent
findings show an enlarged size of total bile acid pool, a
stimulated bile acid synthesis and a reduced gene ex-
pression of bile acid transporters in the liver but not in
intestine of VDR-KO compared to WT mice [53]. In that
study, analyzed mRNA expression levels of ILBP show no
differences between VDR-KO and WT mice which is
confirmed by our results. Nevertheless, our study shows
reduced protein expression of ILBP in VDR-KO mice
indicating the involvement of post transcriptional mecha-
nisms in regulation of ILBP. Expression of ILBP is stimu-
lated by bile acid concentration [54], thus local differences
in bile acid concentration may account for reduced ILBP
protein expression in intestine of VDR-KO mice. FABP is
usually involved in the transport of long chain fatty acids
into enterocytes [55]. Despite the observed reduction in
protein levels of FABP in the VDR-KO mice compared to
the WT mice, we found no differences in plasma and liver
lipids between these two groups of mice. These data con-
firm recently published data that show comparable fatty
acid absorption rates between VDR-KO and WT mice
[56]. We therefore assume that the diminished expression
of both transporters may not induce obvious disturbances
in lipid metabolism.
Conclusions
Collectively, these data imply that the small intestine of
mice lacking VDR expresses higher levels of proteins that
are principally involved in cell proliferation, cell migration
and stress response than corresponding WT mice. Thus,
we can conclude that vitamin D may play a direct or an
indirect role in balancing cell proliferation, cell migration
and stress response in the small intestine.
Methods
Animals and study design
Six 12 to 15-week-old male vitamin D receptor knockout
mice (VDR-KO; B6.129S4-VDR
tm1Mbd
>/J; Jackson La-
boratory, Bar Habor, USA) and six age-matched male
wildtype (WT) mice (C57BL/6 J, Charles River, Sulzfeld,
Germany) were fed a rescue diet containing 2% calcium
and 1.25% phosphorus. Other basal components of the
diet were (in g/kg) casein (200), sucrose (200), lactose (200),
starch (49.5), coconut fat (200), soybean oil (10), cholesterol
(1.5), cellulose (50), DL-methionine (2), vitamin and min-
eral mixture (87), containing 1,000 IU vitamin D
3
.Allmice
were kept individually in a room controlled for temperature
(22 ± 2°C), relative humidity (5060%) and a 12-h light,
12-h dark cycle. All mice were allowed free access to
food and water. The experimental procedures described
followed established guidelines for the care and hand-
ling of laboratory animals and were approved by the
council of Saxony-Anhalt (approval number: 42502-5-
34 MLU).
Sample collection
Prior to killing by decapitation under light anesthesia with
diethyl ether all mice were food deprived for 10 hours.
Blood was collected into EDTA tubes. Plasma was ob-
tained by centrifugation at 1,500 gfor 20 min and stored
at 20°C. The small intestine (from pylorus to ileocecal
valve) was completely excised and washed several times
with cold NaCl solution (0.9%). Intestinal mucosa was
harvested by scraping the surface of the small intestine.
Obtained mucosa samples were snap-frozen in liquid
nitrogen and stored at 80°C. The liver was excised and
samples for lipid extraction were snap-frozen and stored
at 80°C as well.
Kühne et al. Lipids in Health and Disease 2014, 13:51 Page 6 of 9
http://www.lipidworld.com/content/13/1/51
Protein extraction
For isoelectric focusing (IEF), protein extracts of small
intestinal mucosa of each mouse were prepared. Therefore,
20 mg of frozen small intestinal mucosa were mechanically
disrupted (MPI FastPrep®24-System, MP Biomedicals LLC,
Illkirch Cedex, France) in 200 μl of 50 mM TrisHCl
buffer (pH 7.5) containing protease inhibitor cocktail
(1:100, Roche, Mannheim Germany). Crude homogenates
were centrifuged for 15 min (16,000g, 4°C), the superna-
tants were collected and protein concentrations were
determined according to Bradford [57]. For subsequent
fluorescence labeling and IEF, the samples were pooled
group-wise at equal protein amounts and the resulting
protein solutions were cleaned using the ReadyPrep2D
Cleanup Kit (Bio-Rad, Munich, Germany) according to the
manufacturers protocol. The resulting protein precipitate
was resuspended in a 2D compatible buffer (7 M Urea,
2 M thiourea, 4% CHAPS, 30 mM TrisHCl, pH 8.5). Pro-
tein concentrations of the resuspended solutions were
measured in dilution to discriminate urea interferences.
2D-DIGE analysis
Protein pools were labeled with fluorescence dyes using
the Refraction-2D Kit (NH DyeAGNOSTICS GmbH,
Halle (Saale), Germany) according to the manufacturers
instructions. The internal standard consisted of homoe-
quivalent amounts of protein from VDR-KO and WT
mice. For analytical gels, 5 μg of labeled protein per
animal group along with 5 μg of the internal standard
were pooled and mixed with DeStreak rehydration buffer
(GE Healthcare, Munich, Germany) containing 0.5%
carrier ampholytes (pH 47, SERVA Electrophoresis,
Heidelberg, Germany) and added to immobilized pH gra-
dient strips (pH 47, 7 cm, linear, Bio-Rad, Munich,
Germany) for passive sample loading overnight at room
temperature. Preparative gels were loaded with 300 μgof
total protein that was spiked with labeled protein for
the subsequent matching process with analytical gels.
First dimension IEF was run on a Protean IEF Cell (Bio-
Rad, Munich, Germany) followed by a two step equilibra-
tion process using equilibration buffer (50 mM TrisHCl
(pH 8.8), 6 M Urea, 2% SDS, 30% glycerol, bromophenol
blue) supplemented with 2% DTT (step 1) or 2.5% iodoa-
cetamide (step 2), and incubating the stripes for 15 min,
respectively. Thereafter, proteins were separated using lin-
ear SDS-PAGE (12.5%) and fixed (50% ethanol, 10% acetic
acid) for 1 h. The samples were processed in six replicates.
For preparative gels, the fixation step was omitted and the
fluorescence signal was recorded directly before staining
with colloidal Coomassie blue [58]. Fluorescence signal ac-
quisition was achieved using a Typhoon Trio laser scanner
(GE Healthcare, Munich, Germany). Gel analysis was per-
formed with the Delta2D software (Decodon, Greifswald,
Germany). Protein spots that showed a regulation factor of
at least 2 between the two groups were considered for fur-
ther analysis.
Protein identification by ESI-QTOF-MS/MS-analysis
Protein spots were excised from Coomassie-stained gels,
washed, and digested with trypsin (Promega, Mannheim,
Germany) in 10 μl of 10 mM ammonium bicarbonate
(pH 8.0) overnight at 37°C. Peptides were extracted from
gel pieces and injected into a nanoACQUITY UPLC sys-
tem (Waters Co., Eschborn, Germany). 2 μl were injected
via microliter pickupmode and desalted on-line through
a symmetry C18 180 μm × 20 mm precolumn. The pep-
tides were separated on a 100 μm × 100 mm analytical RP
column (1.7 μmBEH130C18,WatersCo.,Eschborn,
Germany) using a typical UPLC gradient from 3.0 to
33.0% over 15 min and a flow rate of 600 nl/min. The mo-
bile phases used were 0.1% formic acid in water and 0.1%
formic acid in acetonitrile. The column was connected to
a SYNAPT® G2 HDMS-mass spectrometer (Waters Co,
Eschborn, Germany). The data were acquired in LC/MS
E
mode switching between low and elevated energy on al-
ternate scans. Subsequent correlation of precursor and
product ions can then be achieved using both retention
and drift time alignment. Using ProteinLynx Global SER-
VER 2.5.2 data were processed and searched against the
SwissProt database specified for Mus musculus using
Mascot search engine of Matrix Science [59].
Western blot analysis
Standard western blot procedure was performed as de-
scribed earlier [60]. Small intestinal mucosa samples were
prepared as described above and 30 μg of protein of each
individual mouse were resolved by electrophoresis in
12% SDS-PAGE gels. Membranes were incubated with
anti-67 kDa laminin receptor antibody (1:1000; Abcam,
Cambridge, UK; ab133645) and anti-GAPDH antibody
(1:1000; Cell Signaling, Boston MA, USA; #5174S) re-
spectively and subsequently detected with secondary
HRP-conjugated antibody (1:1000; anti-rabbit IgG, Cell
Signaling) using ECL Prime western blotting detection
reagent (GE Healthcare, Munich, Germany).
Real-time detection RT-PCR analysis
Total RNA was isolated from aliquots of mice small intes-
tinalmucosabypeqGoldTrifastreagent (Peqlab, Erlangen,
Germany) according to the manufacturers protocol. cDNA
synthesis and determination of mRNA abundance by real-
time detection PCR (Rotor-Gene 6000, Corbett Research,
Mortlake, Australia) were performed as described previ-
ously [61]. Calculation of the relative mRNA concentrations
was performed according to [62]. PCR data were normal-
ized to the reference genes hypoxanthine guanine phos-
phoribosyl transferase (HPRT) and peptidylprolyl isomerase
A (Ppia). The following target-specific primers were used
Kühne et al. Lipids in Health and Disease 2014, 13:51 Page 7 of 9
http://www.lipidworld.com/content/13/1/51
for real-time PCR analysis: peptidylprolyl isomerase A
(NM_008907, Ppia), for, 5-GTGGTCTTTGGGAAGG
TGAA-3,rev,5-TTACAGGACATTGCGAGCAG-3;
37/67 kDa laminin receptor (NM_011029, Rpsa), for, 5-
CTTGACGTCCTGCAGATGAA-3,rev,5-GGATTCTC-
GATGGCAACAAT-3and matrix metalloproteinase
(MMP)-2 (NM_008610.2, Mmp2), for, 5-GAGATCT
TCTTCTTCAAGGAC-3,rev,5-AATAGACCCAG-
TAC TCATTCC-3 ,β-actin (NM_007393, Actb), for,
5- ACGGCCAGGTCATCACTATTG 3,rev,5-
CACAGGATTCCATACCCAAGAAG 3.Allother
primer pairs were purchased from Sigma-Aldrich
(www.kicqstart-primers-sigmaaldrich.com).
Lipid analysis
Liver lipids were extracted using a mixture of n-hexane
and isopropanol (3:2, v:v) [63]. Aliquots of lipid extracts
were dried and dissolved in a small volume of Triton
X-100 [64]. Concentrations of total cholesterol and tri-
glycerides were determined as described previously [65].
Statistical analysis
Data are presented as means ± standard deviation (s.d.).
Means of VDR-KO and WT mice were compared by
Studentst-test using the Minitab Statistical software,
version 13 (Minitab, State College, USA). Means were
considered significantly different at p < 0.05.
Abbreviations
2D-DIGE: Two-dimensional-difference in-gel electrophoresis; 6PGL:
6-Phosphogluconolactonase; Col6a1: Collagen type VI (alpha 1 chain);
ESI-QTOF: Electrospray ionization-time of flight; GAPDH: Glyceraldehyde
3-phosphate dehydrogenase; GRP94: 94 kDa glucose-regulated protein;
HPRT: Hypoxanthine guanine phosphoribosyl transferase; HRP: Horseradish
peroxidase; Hsc70: Heat shock cognate 71 kDa protein; HSP: Heat shock
protein; IEF: Isoelectric focusing; I-FABP: Intestinal fatty acid-binding protein;
ILBP: Ileal lipid-binding protein; K19: Keratin-19; KO: Knockout; LR: Laminin
receptor; MMP-2: Matrixmetalloproteinase-2; PA28β: Proteasome activator
subunit 2; pI: Isoelectric point; Ppia: Peptidylprolyl isomerase A;
Tpm3: Tropomyosin-3; UPLC: Ultra-performance liquid Chromatography, VCP/
p97, Valosin-containing protein; VDR: Vitamin D receptor; WT: Wildtype.
Competing interests
The authors declare that they have no competing interests.
Authorscontributions
HK, AlS and GS designed the experiment. HK, SW, CC, and KS carried out 2D
experiments and expression analyses. AnS. delivered MS/MS data. HK, BK, AlS
and GS carried out data analysis and interpretation. HK, AlS, BK, and GS
wrote the manuscript. All authors read and approved the final manuscript.
Acknowledgements
This work was supported by a grant from The Federal Ministry of Education
and Research of Germany (01EA1323A).
Author details
1
Institute of Agricultural and Nutritional Sciences, Martin Luther University
Halle-Wittenberg, Von-Danckelmann-Platz 2, D-06120 Halle (Saale), Germany.
2
Department of Applied Biosciences and Process Engineering, Anhalt
University of Applied Sciences, D-06366 Köthen, Germany.
3
Institute for
Biochemistry and Biotechnology, Martin Luther University Halle-Wittenberg,
D-06120 Halle (Saale), Germany.
4
Institute of Medical Immunology, Martin
Luther University Halle-Wittenberg, D-06112 Halle (Saale), Germany.
Received: 10 January 2014 Accepted: 11 March 2014
Published: 19 March 2014
References
1. Wacker M, Holick MF: Vitamin D - effects on skeletal and extraskeletal
health and the need for supplementation. Nutrients 2013, 5:111148.
2. Holick MF: The vitamin D deficiency pandemic and consequences for
nonskeletal health: mechanisms of action. Mol Aspects Med 2008,
29:361368.
3. Hossein-nezhad A, Spira A, Holick MF: Influence of vitamin D status and
vitamin D3 supplementation on genome wide expression of white
blood cells: a randomized double-blind clinical trial. PLoS One 2013,
8:e58725.
4. Bouillon R, Carmeliet G, Verlinden L, van Etten E, Verstuyf A, Luderer HF,
Lieben L, Mathieu C, Demay M: Vitamin D and human health: lessons
from vitamin D receptor null mice. Endocr Rev 2008, 29:726776.
5. Sun J: Vitamin D and mucosal immune function. Curr Opin Gastroenterol
2010, 26:591595.
6. Christakos S: Mechanism of action of 1,25-dihydroxyvitamin D3 on
intestinal calcium absorption. Rev Endocr Metab Disord 2012, 13:3944.
7. Kong J, Zhang Z, Musch MW, Ning G, Sun J, Hart J, Bissonnette M, Li YC:
Novel role of the vitamin D receptor in maintaining the integrity of the
intestinal mucosal barrier. Am J Physiol Gastrointest Liver Physiol 2008,
294:G208G216.
8. Froicu M, Cantorna MT: Vitamin D and the vitamin D receptor are critical
for control of the innate immune response to colonic injury. BMC Immunol
2007, 8:5.
9. Froicu M, Zhu Y, Cantorna MT: Vitamin D receptor is required to control
gastrointestinal immunity in IL-10 knockout mice. Immunology 2006,
117:310318.
10. Ooi JH, Chen J, Cantorna MT: Vitamin D regulation of immune function in
the gut: why do T cells have vitamin D receptors? Mol Aspects Med 2012,
33:7782.
11. Sadava D, Remer T, Petersen K: Hyperplasia, hyperproliferation and
decreased migration rate of colonic epithelial cells in mice fed a diet
deficient in vitamin D. Biol Cell 1996, 87:113115.
12. Kállay E, Bareis P, Bajna E, Kriwanek S, Bonner E, Toyokuni S, Cross HS:
Vitamin D receptor activity and prevention of colonic hyperproliferation
and oxidative stress. Food Chem Toxicol 2002, 40:11911196.
13. Holt PR, Arber N, Halmos B, Forde K, Kissileff H, Mcglynn KA, Moss SF, Fan K,
Yang K: Colonic epithelial cell proliferation decreases with increasing
levels of serum 25-hydroxy vitamin D. Cancer Epidemiol Biomarkers Prev
2002, 11:113119.
14. Jørgensen SP, Hvas CL, Agnholt J, Christensen LA, Heickendorff L, Dahlerup JF:
Active Crohns disease is associated with low vitamin D levels. JCrohns
Colitis 2013, 7:e407e413.
15. Gilman J, Shanahan F, Cashman KD: Determinants of vitamin D status in
adult Crohns disease patients, with particular emphasis on
supplemental vitamin D use. Eur J Clin Nutr 2006, 60:889896.
16. McCarthy D, Duggan P, OBrien M, Kiely M, McCarthy J, Shanahan F,
Cashman KD: Seasonality of vitamin D status and bone turnover in
patients with Crohns disease. Aliment Pharmacol Ther 2005, 21:10731083.
17. Garg M, Lubel JS, Sparrow MP, Holt SG, Gibson PR: Review article: vitamin
D and inflammatory bowel diseaseestablished concepts and future
directions. Aliment Pharmacol Ther 2012, 36:324344.
18. Ramagopalan SV, Heger A, Berlanga AJ, Maugeri NJ, Lincoln MR, Burrell A,
Handunnetthi L, Handel AE, Disanto G, Orton S-M, Watson CT, Morahan JM,
Giovannoni G, Ponting CP, Ebers GC, Knight JC: A ChIP-seq defined
genome-wide map of vitamin D receptor binding: associations with
disease and evolution. Genome Res 2010, 20:13521360.
19. Liu W, Chen Y, Golan MA, Annunziata ML, Du J, Dougherty U, Kong J,
Musch M, Huang Y, Pekow J, Zheng C, Bissonnette M, Hanauer SB, Li YC:
Intestinal epithelial vitamin D receptor signaling inhibits experimental
colitis. J Clin Invest 2013, 123:39833996.
20. Zhao H, Zhang H, Wu H, Li H, Liu L, Guo J, Li C, Shih DQ, Zhang X:
Protective role of 1,25(OH)2 vitamin D3 in the mucosal injury and
epithelial barrier disruption in DSS-induced acute colitis in mice.
BMC Gastroenterol 2012, 12:57.
21. Kim J-H, Yamaori S, Tanabe T, Johnson CH, Krausz KW, Kato S, Gonzalez FJ:
Implication of intestinal VDR deficiency in inflammatory bowel disease.
Biochim Biophys Acta 1830, 2013:21182128.
Kühne et al. Lipids in Health and Disease 2014, 13:51 Page 8 of 9
http://www.lipidworld.com/content/13/1/51
22. DErrico I, Moschetta A: Nuclear receptors, intestinal architecture and
colon cancer: an intriguing link. Cell Mol Life Sci 2008, 65:15231543.
23. Pereira F, Larriba MJ, Muñoz A: Vitamin D and colon cancer. Endocr Relat
Cancer 2012, 19:R51R71.
24. Wang Y, Zhu J, DeLuca HF: Where is the vitamin D receptor? Arch Biochem
Biophys 2012, 523:123133.
25. Haussler MR, Whitfield GK, Kaneko I, Haussler CA, Hsieh D, Hsieh J-C, Jurutka PW:
Molecular mechanisms of vitamin D action. Calcif Tissue Int 2013, 92:7798.
26. Nagpal S, Na S, Rathnachalam R: Noncalcemic actions of vitamin D
receptor ligands. Endocr Rev 2005, 26:662687.
27. Givant-Horwitz V, Davidson B, Reich R: Laminin-induced signaling in tumor
cells: the role of the Mr 67,000 laminin receptor. CANCER Res 2004,
64:35723579.
28. Vana K, Zuber C, Pflanz H, Kolodziejczak D, Zemora G, Weiss S: LRP/LR as an
alternative promising target in therapy of prion diseases, alzheimers
disease and cancer. Infect Disord Drug Targets 2009, 9:6980.
29. Omar A, Reusch U, Knackmuss S, Little M, Weiss SFT: Anti-LRP/LR-specific
antibody IgG1-iS18 significantly reduces adhesion and invasion of
metastatic lung, cervix, colon and prostate cancer cells. J Mol Biol 2012,
419:102109.
30. Khalfaoui T, Groulx J-F, Sabra G, Guezguez A, Basora N, Vermette P, Beaulieu J-F:
Laminin receptor 37/67LR regulates adhesion and proliferation of normal
human intestinal epithelial cells. PLoS One 2013, 8:e74337.
31. Krishnan AV, Feldman D: Mechanisms of the anti-cancer and anti-
inflammatory actions of vitamin D. Annu Rev Pharmacol Toxicol 2011,
51:311336.
32. Kallay E, Pietschmann P, Toyokuni S, Bajna E, Hahn P, Mazzucco K,
Bieglmayer C, Kato S, Cross HS: Characterization of a vitamin D receptor
knockout mouse as a model of colorectal hyperproliferation and DNA
damage. Carcinogenesis 2001, 22:14291435.
33. Groulx J-F, Gagné D, Benoit YD, Martel D, Basora N, Beaulieu J-F: Collagen
VI is a basement membrane component that regulates epithelial
cell-fibronectin interactions. Matrix Biol 2011, 30:195206.
34. Quaronis A, Calnek D, Quaroni E, Chandler JS: Keratin expression in rat
intestinal crypt and villus cells. J Biol Chem 1991, 266:1192311931.
35. Hein Z, Schmidt S, Zimmer K-P, Naim HY: The dual role of annexin II in
targeting of brush border proteins and in intestinal cell polarity.
Differentiation 2011, 81:243252.
36. Ishikawa R, Yamashiro S, Matsumura M: Differential modulation of
actin-severing activity of gelsolin by multiple isoforms of cultured rat cell
tropomyosin. J Biol Chem 1989, 264:74907497.
37. Lees JG, Bach CTT, Neill GMO: Interior decoration tropomyosin in actin
dynamics and cell migration. Cell Adh Migr 2011, 5:181186.
38. Max D, Brandsch C, Schumann S, Kühne H, Frommhagen M, Schutkowski A,
Hirche F, Staege MS, Stangl GI: Maternal vitamin D deficiency causes
smaller muscle fibers and altered transcript levels of genes involved in
protein degradation, myogenesis, and cytoskeleton organization in the
newborn rat. Mol Nutr Food Res 2013, 25:110.
39. Pendás-Franco N, González-Sancho JM, Suárez Y, Aguilera O, Steinmeyer A,
Gamallo C, Berciano MT, Lafarga M, Muñoz A: Vitamin D regulates the
phenotype of human breast cancer cells. Differentiation 2007, 75:193207.
40. Brackman D, Trydal T, Lillehaug AD JR: Reorganization of the cytoskeleton
and morphological changes induced by 1,25-dihydroxyvitamin D3 in
C3H/10T1/2 mouse embryo fibroblasts: relation to inhibition of
proliferation. Exp Cell Res 1992, 201:485493.
41. Riek AE, Oh J, Sprague JE, Timpson A, de las Fuentes L, Bernal-Mizrachi L,
Schechtman KB, Bernal-Mizrachi C: Vitamin D suppression of endoplasmic
reticulum stress promotes an antiatherogenic monocyte/macrophage
phenotype in type 2 diabetic patients. J Biol Chem 2012, 287:3848238494.
42. Noyan T, Balaharoğlu R, Kömüroğlu U: The oxidant and antioxidant effects
of 25-hydroxyvitamin D3 in liver, kidney and heart tissues of diabetic
rats. Clin Exp Med 2005, 5:3136.
43. Hamden K, Carreau S, Jamoussi K, Miladi S, Lajmi S, Aloulou D, Ayadi F,
Elfeki A: 1Alpha,25 dihydroxyvitamin D3: therapeutic and preventive
effects against oxidative stress, hepatic, pancreatic and renal injury in
alloxan-induced diabetes in rats. J Nutr Sci Vitaminol (Tokyo) 2009,
55:215222.
44. Meyer H, Bug M, Bremer S: Emerging functions of the VCP/p97
AAA-ATPase in the ubiquitin system. Nat Cell Biol 2012, 14:117123.
45. Marzec M, Eletto D, Argon Y: GRP94: An HSP90-like protein specialized for
protein folding and quality control in the endoplasmic reticulum.
Biochim Biophys Acta 1823, 2012:774787.
46. Liu T, Daniels CK, Cao S: Comprehensive review on the HSC70 functions,
interactions with related molecules and involvement in clinical diseases
and therapeutic potential. Pharmacol Ther 2012, 136:354374.
47. Pickering AM, Davies KJA: Differential roles of proteasome and
immunoproteasome regulators Pa28αβ, Pa28γand Pa200 in the
degradation of oxidized proteins. Arch Biochem Biophys 2012, 523:181190.
48. Gardino AK, Yaffe MB: 14-3-3 proteins as signaling integration points for
cell cycle control and apoptosis. Semin Cell Dev Biol 2011, 22:688695.
49. Kleppe R, Martinez A, Døskeland SO, Haavik J: The 14-3-3 proteins in
regulation of cellular metabolism. Semin Cell Dev Biol 2011, 22:713719.
50. Angrand P-O, Segura I, Völkel P, Ghidelli S, Terry R, Brajenovic M, Vintersten K,
Klein R, Superti-Furga G, Drewes G, Kuster B, Bouwmeester T, Acker-Palmer A:
Transgenic mouse proteomics identifies new 14-3-3-associated proteins
involved in cytoskeletal rearrangements and cell signaling. Mol Cell Proteomics
2006, 5:22112227.
51. Tian Q, Feetham MC, Tao WA, He XC, Li L, Aebersold R, Hood L: Proteomic
analysis identifies that 14-3-3 interacts with b-catenin and facilitates its
activation by Akt. Proc Natl Acad Sci U S A 2004, 101:1537015375.
52. Palmer HG: Vitamin D3 promotes the differentiation of colon carcinoma
cells by the induction of E-cadherin and the inhibition of beta-catenin
signaling. J Cell Biol 2001, 154:369388.
53. Schmidt DR, Holmstrom SR, Fon Tacer K, Bookout AL, Kliewer SA,
Mangelsdorf DJ: Regulation of bile acid synthesis by fat-soluble vitamins
A and D. J Biol Chem 2010, 285:1448614494.
54. Kramer W, Corsiero D, Friedrich M, Girbig F, Stengelin S, Weyland C:
Intestinal absorption of bile acids: paradoxical behaviour of the 14 kDa
ileal lipid-binding protein in differential photoaffinity labelling. Biochem J
1998, 333:335341.
55. Agellon L, Toth M, Thomson A: Intracellular lipid binding proteins of the
small intestine. Mol Cell Biochem 2002, 239:7982.
56. Wong KE, Szeto FL, Zhang W, Ye H, Kong J, Zhang Z, Sun XJ, Li YC:
Involvement of the vitamin D receptor in energy metabolism: regulation
of uncoupling proteins. Am J Physiol Endocrinol Metab 2009, 296:E820828.
57. Bradford MM: A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-dye
binding. Anal Biochem 1976, 72:248254.
58. Neuhoff V, Arold N, Taube D, Ehrhardt W: Improved staining of proteins in
polyacrylamide gels including isoelectric focusing gels with clear background
at nanogram sensitivity using Coomassie Brilliant Blue G-250 and R-250.
Electrophoresis 1988, 6:255262.
59. Mascot search engine. [www.matrixscience.com]
60. Bettzieche A, Brandsch C, Eder K, Stangl GI: Lupin protein acts
hypocholesterolemic and increases milk fat content in lactating rats by
influencing the expression of genes involved in cholesterol homeostasis
and triglyceride synthesis. Mol Nutr Food Res 2009, 53:11341142.
61. Bettzieche A, Brandsch C, Schmidt M, Weisse K, Eder K, Stangl GI: Differing
effect of protein isolates from different cultivars of blue lupin on plasma
lipoproteins of hypercholesterolemic rats. Biosci Biotechnol Biochem 2008,
72:31143121.
62. Pfaffl MW: A new mathematical model for relative quantification in
real-time RT-PCR. Nucleic Acids Res 2001, 29:e45.
63. Hara A, Radin N: Lipid extraction of tissues with a low-toxicity solvent.
Anal Biochem 1978, 90:420426.
64. De Hoff JL, Davidson LM, Kritchevsky D: An exzymatic assay for determining
free and total cholesterol in tissue. Clin Chem 1978, 435:433435.
65. König B, Koch A, Spielmann J, Hilgenfeld C, Stangl GI, Eder K: Activation of
PPARalpha lowers synthesis and concentration of cholesterol by
reduction of nuclear SREBP-2. Biochem Pharmacol 2007, 73:574585.
doi:10.1186/1476-511X-13-51
Cite this article as: Kühne et al.:Vitamin D receptor regulates intestinal
proteins involved in cell proliferation, migration and stress response.
Lipids in Health and Disease 2014 13:51.
Kühne et al. Lipids in Health and Disease 2014, 13:51 Page 9 of 9
http://www.lipidworld.com/content/13/1/51
... 10 Traditionally recognized as a central regulator to maintain mineral and bone homeostasis, vitamin D has recently been revealed to be involved in a number of aspects of intestinal inflammation and maintaining intestinal epithelial homeostasis. [11][12][13] Vitamin D deficiency can attenuate innate immune pathway of antimicrobial and antiinflammatory response in the gut. 14 Vitamin D receptor signaling also suppresses NF-κB pathway of gut mucosal inflammation, 15 indicating that vitamin D status may affect allergic response in the gut. ...
... Vitamin D can modulate eosinophils migration in a concentration-dependent manner and reduce the release of cytotoxic granules by eosinophils. 50,51 Vitamin D and its receptor mediated signaling has been involved in the proliferation of intestinal mucosal epithelial cells and maintaining intact intestinal barrier function, 13,52 which can affect the production of gutderived chemokines and cytokines for recruiting eosinophils. Thus, vitamin D may directly or indirectly affect the resolution of blood eosinophilia and symptoms of CMA. ...
Article
Background and objectives: Cow milk allergy is the most common food allergic disease in young infants and vitamin D has a critical role in regulating intestinal inflammation. Methods and study design: To determine roles of vitamin D in cow milk allergy, fifty-six young infants with cow milk allergy were enrolled. The serum 25-hydroxyvitamin D (25OHD), total and specific IgE, circulating regulatory T lymphocytes, and blood eosino-phil counts were determined. Results: The serum 25OHD in cow milk allergy and age-matched infants were sim-ilar (68.3±38.9 nmol/L versus 72.9±33.1 nmol/L, p>0.05), 71% Cow milk allergy infants (40/56) had serum 25OHD lower than 75 nmol/L compared to 66% (37/56) in the controls. The cow milk allergy infants with 25OHD lower than 75 nmol/L had persistent blood eosinophilia and delayed resolution of symptoms after cow milk elimination compared to those with 25OHD above 75 nmol/L (odd ratio 3.7, 95% CI 1.1-12.6, p<0.05). The serum 25OHD inversely correlated with blood eosinophil counts after cow milk elimination (r=-0.37, p<0.01). Cow milk allergy infants with 25OHD lower than 50 nmol/L (vitamin D deficiency, n = 22) were in general at younger age (1.6±0.6 months) compared to infants with insufficient (50-75 nmol/L) or normal (>=75 nmol/L) group (4.3±1.2 and 4.6±0.9 months, respectively, p<0.001). Conclusions: Low serum vitamin D associates with persistent blood eosinophilia and symptoms in young cow milk allergy infants.
... 7 The binding of 1,25(OH) 2 D to the VDR can influence a wide range of biological effects including cellular differentiation, proliferation, and phenotypic changes. 8,9 While the Abbreviations: 25 traditional roles of vitamin D have focused on its role in the maintenance of skeletal health, the non-skeletal roles of vitamin D have been intensively investigated over the last 30 years since the discovery that VDR was expressed by a wide range of cell types. For example, many studies have found an association between low serum concentrations of 25 hydroxyvitamin D (25(OH)D) and the development and progression of various diseases in humans. ...
... The median CIBDAI of CE dogs was 9 (range 3-16) and the duration of clinical signs before presentation was a median of 7 weeks (range 4 weeks to 3 years). Inflammatory changes were present in all dogs with CE and the median WSAVA score was 5 (range [1][2][3][4][5][6][7][8][9][10][11][12][13][14]. The WSAVA score was significantly higher in dogs with CE compared to controls (P 5 0.0001). ...
Article
Full-text available
Background: There is growing evidence linking low blood vitamin D concentration to numerous diseases in people and in dogs. Vitamin D influences cellular function by signaling through the vitamin D receptor (VDR). Little is known about which non-skeletal tissues express the VDR or how inflammation influences its expression in the dog. Objectives: To define which non-skeletal canine tissues express the VDR and to investigate expression in inflamed small intestine. Animals: Thirteen non-skeletal tissues were collected prospectively from 6 control dogs. Thirty-five dogs diagnosed with a chronic enteropathy (CE) and 24 control dogs were prospectively enrolled and duodenal biopsies were evaluated for VDR expression. Methods: Prospective; blinded assessment of canine intestinal VDR. Dogs with CE were included once other identifiable causes of intestinal disease were excluded. Age matched controls were included with no intestinal clinical signs. VDR expression was assessed immunohistochemically in all samples, using a Rat IgG VDR monoclonal antibody. Quantitative real-time polymerase chain reaction (qPCR) was also used for duodenal biopsies. Results: VDR expression as assessed by immunohistochemistry (IHC) was highest in the kidney, duodenum, skin, ileum and spleen, and weak in the colon, heart, lymph node, liver, lung, and ovary. Gastric and testicular tissue did not express the VDR. There was no statistical difference in duodenal VDR expression between the 24 healthy dogs and 34 dogs with CE when quantified by either qPCR (P = 0.87) or IHC (P = 0.099). Conclusions and clinical importance: The lack of down regulation of VDR expression in inflamed intestine contrasts with previous studies in humans. Our findings support future studies to investigate whether vitamin D and its analogues can be used to modulate intestinal inflammation in the dog.
... 8 In addition, by comparing the level of protein expression in the intestine of Vdr À/À and WT mice, it was demonstrated that vitamin D, directly and/or indirectly, regulates proteins involved in intestinal epithelial cell proliferation, migration and stress response. 106 It is also well accepted that exposure to 1,25(OH) 2 D has a profound influence on intestinal stem cell function, thought to be the cell of origin of intestinal tumors. 107 Wnt/b-catenin signaling may also be a crucial pathway for intestinal stem cell development. ...
Article
Vitamin D activity is associated with the modulation of a wide variety of biological systems, in addition to its roles in calcium homeostatic mechanisms. While vitamin D is well known to promote gastrointestinal calcium absorption, vitamin D also plays a role in attenuating and/or preventing the progression of several gastrointestinal diseases including Crohn’s disease, ulcerative colitis, and colorectal cancer, and may also play a role in chemotherapy-induced intestinal mucositis. The pro-differentiation, immunomodulatory, and anti-inflammatory effects of vitamin D, which has been reported in numerous circumstances, are key potential mechanisms of action in the prevention of gastrointestinal disorders. While the debate of the effectiveness of vitamin D to treat bone pathologies continues, the clinical importance of vitamin D therapy to prevent gastrointestinal disorders should be investigated given current evidence, using both nutritional and pharmaceutical intervention approaches. Impact statement The non-skeletal functions of vitamin D play an important role in health and disease. The anti-inflammatory properties and maintenance of intestinal function fulfilled by vitamin D impact other systems in the body though downstream processing. This review provides insight into the mechanisms underpinning the potential benefits of vitamin D in both maintaining intestinal homeostasis and associated diseased states.
... The secosteroid hormone 1,25-dihydroxy-vitamin D 3 (1,25-D 3 ) binds to the vitamin D receptor (VDR), which translocates into the nucleus, binds to VDR-responsive elements (VDREs), and associates with coregulatory complexes to either activate or repress gene transcription. 1,25-D 3 is metabolized by the VDR target gene CYP24A1 [2] and activates a number of downstream metabolic pathways including calcium absorption through induction of S100g [3] and maintenance of bone health [4][5][6] and cellular pathways regulating cell differentiation and proliferation [7][8][9][10]. 1,25-D 3 -bound VDR can cause cell cycle arrest by targeting G0S2, CDKN1A [11,12], IGFBP3 [13], and E2F target genes [14]. ...
Article
Full-text available
Background Lysine-specific demethylase 1A (LSD1) is a key regulator of the androgen (AR) and estrogen receptors (ER), and LSD1 levels correlate with tumor aggressiveness. Here, we demonstrate that LSD1 regulates vitamin D receptor (VDR) activity and is a mediator of 1,25(OH)2-D3 (vitamin D) action in prostate cancer (PCa). Methods Athymic nude mice were xenografted with CWR22 cells and monitored weekly after testosterone pellet removal. Expression of LSD1 and VDR (IHC) were correlated with tumor growth using log-rank test. TRAMP tumors and prostates from wild-type (WT) mice were used to evaluate VDR and LSD1 expression via IHC and western blotting. The presence of VDR and LSD1 in the same transcriptional complex was evaluated via immunoprecipitation (IP) using nuclear cell lysate. The effect of LSD1 and 1,25(OH)2-D3 on cell viability was evaluated in C4-2 and BC1A cells via trypan blue exclusion. The role of LSD1 in VDR-mediated gene transcription was evaluated for Cdkn1a, E2f1, Cyp24a1, and S100g via qRT-PCR-TaqMan and via chromatin immunoprecipitation assay. Methylation of Cdkn1a TSS was measured via bisulfite sequencing, and methylation of a panel of cancer-related genes was quantified using methyl arrays. The Cancer Genome Atlas data were retrieved to identify genes whose status correlates with LSD1 and DNA methyltransferase 1 (DNMT1). Results were correlated with patients’ survival data from two separate cohorts of primary and metastatic PCa. Results LSD1 and VDR protein levels are elevated in PCa tumors and correlate with faster tumor growth in xenograft mouse models. Knockdown of LSD1 reduces PCa cell viability, and gene expression data suggest a dual coregulatory role of LSD1 for VDR, acting as a coactivator and corepressor in a locus-specific manner. LSD1 modulates VDR-dependent transcription by mediating the recruitment of VDR and DNMT1 at the TSS of VDR-targeted genes and modulates the epigenetic status of transcribed genes by altering H3K4me2 and H3K9Ac and DNA methylation. Lastly, LSD1 and DNMT1 belong to a genome-wide signature whose expression correlates with shorter progression-free survival and overall survival in primary and metastatic patients’ samples, respectively. Conclusions Results demonstrate that LSD1 has a dual coregulatory role as corepressor and coactivator for VDR and defines a genomic signature whose targeting might have clinical relevance for PCa patients. Electronic supplementary material The online version of this article (doi:10.1186/s13148-017-0382-y) contains supplementary material, which is available to authorized users.
... Vitamin D is involved in multiple biological processes, from bone metabolism (absorption of calcium and bone mineralization), up to complex mechanisms of immune response and modulation (proliferation and cellular differentiation) There has been reported that low serum levels of 25-hydroxyVitamin D, in the organism, and diverse variations of the VDR gene, are related with autoimmune diseases such as systemic lupus, psoriasis, multiple sclerosis, autoimmune disease of thyroid and inflammatory disease of intestine (Zilahi et al., 2015;Smyk et al., 2013;Kühne et al., 2014;Kalman and Toldy, 2014). ...
Article
Full-text available
Background: Multiple sclerosis (MS) is the most prevalent autoimmune inflammatory demyelinating disease of the central nervous system (CNS) in young adults. More than 50 genomic regions have been associated with MS susceptibility. Due the important immune-modulating properties of Vitamin D, Vitamin D receptor (VDR) gene polymorphisms - which interfere with the actions of Vitamin D- could be related to increased risk of MS. Methods: We studied 120 patients fulfilling the McDonald criteria for MS (81 females and 39 males) and 180 healthy unrelated controls, nested in a case-Control study, and were recruited from the National Institute of Neurology and Neurosurgery, Manuel Velasco Suárez in Mexico City. Genotyping of VDR gene polymorphisms BsmI (rs1544410) and TaqI (rs731236) was performed using TaqMan SNP Genotyping Assay which consists of a predesigned mix of unlabeled polymerase chain reaction (PCR) primers and the TaqMan minor groove binding group (MGB) probe (FAM dye-labeled). Results: There was a statistically significant, positive association between MS and the T/T genotype of BsmI polymorphism (OR=4.15; 95%CI 1.83-9.39), showing also a significant positive trend across genotypes (p<0.01). This association was also present evaluating the recessive inheritance model of the polymorphism (OR=3.91; 95%CI 1.77-8.64). When evaluating the association by alleles, the statistically significant positive association seen by genotypes was confirmed in the T allele carriers, showing an OR of 1.83 (95%CI 1.27-2.65) for MS. Conclusions: We found a positive association of the genetic VDR polymorphisms TaqI (rs731236) and BsmI (rs1544410), with the risk of MS in a sample of Mexican adults.
... For damaged cells, for example, in rotenone-induced neurotoxicity, calcitriol enhances cell autophagy by increasing autophagic markers such as beclin-1 and microtubule-associated protein 1A/1B-light chain 3 (involved in autophagy) [54]. At least in the small intestine, VDR has been described as an important factor for controlling cell replication, migration, and stress response [55]. The role of the axis calcitriol/VDR, when calcitriol is considered as a cytokine-like molecule, appears to promote immune function in order to maintain tissue homeostasis by assessing cell stress response and the regulatory machinery of cell cycle and differentiation. ...
Article
Background: The change of podocyte morphology is a pathologic feature of chronic kidney disease. Several studies have suggested that vitamin D plays a role in the protection of podocytes, but the underlying mechanism remains unclear. Methods: The effects of paricalcitol on podocyte injury were tested in a puromycin aminonucleoside (PAN)-induced rat model and cultured mouse podocytes. Proteinuria, podocyte foot process (FP) effacement, and the expression of nestin and vitamin D receptor (VDR) were evaluated. VDR-siRNA or plasmids containing VDR-shRNA were transfected into podocytes to silence VDR expression. Chromatin immunoprecipitation (ChIP) and luciferase reporter assays were performed to verify the connection between VDR and nestin gene expression. Results: Paricalcitol significantly alleviated proteinuria and podocyte FP effacement in PAN-induced nephrosis, which was accompanied by increased VDR expression in the glomeruli. Paricalcitol also inhibited PAN-induced nestin overexpression in the glomeruli. In an in vivo study, PAN significantly inhibited VDR protein expression, stimulated nestin protein expression, and resulted in nestin filament derangement in mouse podocytes, while paricalcitol treatment abolished these effects. In contrast, downregulation of VDR resulted in derangement and overexpression of nestin. ChIP assays demonstrated the presence of a vitamin D response element (VDRE) in the nestin promoter, and paricalcitol enhanced the binding of VDR to VDRE. Furthermore, luciferase reporter assays of the nestin promoter fragment showed that paricalcitol effectively repressed nestin reporter gene expression after PAN treatment, and mutation of VDRE abolished this effect. Conclusions: Paricalcitol directly regulates nestin transcription through the interaction of VDR/VDRE, thereby preventing morphological changes of podocytes in PAN nephropathy.
Article
Understanding of vitamin D physiology is important because about half of the population is being diagnosed with deficiency and treated with supplements. Clinical guidelines were developed based on observational studies showing an association between low serum levels and increased cardiovascular risk. However, new randomized controlled trials have failed to confirm any cardiovascular benefit from supplementation in the general population. A major concern is that excess vitamin D is known to cause calcific vasculopathy and valvulopathy in animal models. For decades, administration of vitamin D has been used in rodents as a reliable experimental model of vascular calcification. Technically, vitamin D is a misnomer. It is not a true vitamin because it can be synthesized endogenously through ultraviolet exposure of the skin. It is a steroid hormone that comes in 3 forms that are sequential metabolites produced by hydroxylases. As a fat-soluble hormone, the vitamin D-hormone metabolites must have special mechanisms for delivery in the aqueous bloodstream. Importantly, endogenously synthesized forms are carried by a binding protein, whereas dietary forms are carried within lipoprotein particles. This may result in distinct biodistributions for sunlight-derived versus supplement-derived vitamin D hormones. Because the cardiovascular effects of vitamin D hormones are not straightforward, both toxic and beneficial effects may result from current recommendations.
Article
Inflammatory Bowel Diseases (IBD) are increasing sharply, and the common medications are not effective for most patients. Vitamin D (VD) has been considerate to reduce inflammatory processes and may be helpful in IBD. The aim of this review was to perform an update on the potential role of VD in the IBD. We performed a search for articles associating VD and IBD published in MEDLINE-PubMed and EMBASE. The focused question used for the search was “What is the association between Inflammatory Bowel Disease and Vitamin D?” The exclusion criteria for this search were studies not in English, editorials, case reports, or poster presentations. VD prevents the inflammatory process such as negatively interfering with the release of Interleukin (IL)-1, IL-6, and Tumour Necrosis Factor-α; enhancing the function of the intestinal epithelial barrier; decreasing the occurrence of apoptosis; stimulating Toll-Like Receptor-4; inducing the production of an antimicrobial peptide in Paneth cells. Furthermore, deficiency of VD is related to the severity of the symptoms and increased the risk of cancer and surgery. In conclusion, VD shows a potential role in the management of IBD, the supplementation is inexpensive, safe, and leads to improvement of the quality of life.
Article
Background: Low vitamin D status is linked to increased incidence of food allergy and intestinal inflammation. Whether vitamin D status is associated with immunological changes in children with gastrointestinal food allergy (GFA) remains unclear. Methods: Forty-nine GFA children (aged 2-11 years old) were enrolled in this study. Serum 25-hydroxyvitamin D (25OHD) level, total immunoglobulin E (IgE), specific IgE against allergens, circulating regulatory T lymphocytes (Tregs), and blood eosinophil numbers were measured. Results: Levels of serum 25OHD in the GFA children ranged 35.5-156.4nmol/L, with a mean value similar to that of the healthy controls. Compared to those with normal 25OHD (≥75nmol/L), GFA children with low 25OHD (<75nmol/L) had increased total IgE (84% vs. 54%, P<0.05), persistent blood eosinophilia (56% vs. 25%, P<0.05), and delayed resolution of symptoms after food allergen elimination (odds ratio 3.51, 95% CI 1.00-12.36, P<0.05). Among the GFA children with elevated total IgE, those with low 25OHD had lower circulatory Tregs (8.79±2.4% vs. 10.21±1.37%, P<0.05), higher total IgE (1197.5±1209.8 vs. 418.5±304.6kU/L, P<0.05), and persistent eosinophilia (0.61±0.52 vs. 0.31±0.15×10(9)cells/L, P<0.05) compared to those with normal 25OHD. In addition, serum 25OHD concentrations inversely correlated with total IgE (R=-0.434, P<0.05), and positively with Treg population (R=0.356, P<0.05). Conclusion: Low serum vitamin D status correlates with stronger allergic immune response in GFA children.
Article
Full-text available
Multiple isoforms of tropomyosin (TM) of rat cultured cells show differential effects on actin-severing activity of gelsolin. Flow birefringence measurements have revealed that tropomyosin isoforms with high Mrvalues (high MrTMs) partially protect actin filaments from fragmentation by gelsolin, while tropomyosins with low Mrvalues (low MrTMs) have no significant protection even when the actin filaments have been fully saturated with low MrTMs. We have also examined effect of nonmuscle caldesmon on the severing activity of gelsolin because 83-kDa nonmuscle caldesmon stimulates actin binding of rat cell TMs (Yamashiro-Matsumura, S., and Matsumura, F. (1988) J. Cell Biol. 106, 1973–1983). While nonmuscle caldesmon alone or low MrTMs alone show no significant protection against fragmentation by gelsolin, the low MrTMs coupled with 83-kDa protein are able to protect actin filaments. Further, high MrTMs together with 83-kDa protein appear to block the severing activity completely. Electron microscopic analyses of length distribution of actin filaments have confirmed the results. The average length of control actin filaments is measured as 1.46 ± 1.0 µM, and gelsolin shortens the average length to 0.084 ± 0.039 µM. Similar short average lengths are obtained when gelsolin severs actin complexed with low MrTMs (0.080 ± 0.045 µM) or with nonmuscle caldesmon (0.11 ± 0.072 µM) while longer average length (0.22 ± 0.18 µM) is measured in the presence of high MrTMs. The simultaneous addition of nonmuscle caldesmon makes the average length considerably longer, i.e. 0.61 ± 0.37 µM in the presence of low MrTMs and 1.57 ± 0.97 µM in the presence of high MrTMs. Furthermore, the actin binding of gelsolin is strongly inhibited by co-addition of high MrTMs and nonmuscle caldesmon. These results suggest that TM and gelsolin share the same binding site on actin molecules and that the differences in the actin affinities between TMs are related to their abilities of protection against gelsolin.
Article
Full-text available
Interactions between the cell basal membrane domain and the basement membrane are involved in several cell functions including proliferation, migration and differentiation. Intestinal epithelial cells can interact with laminin, a major intestinal basement membrane glycoprotein, via several cell-surface laminin-binding proteins including integrin and non-integrin receptors. The 37/67kDa laminin receptor (37/67LR) is one of these but its role in normal epithelial cells is still unknown. The aim of this study was to characterise the expression pattern and determine the main function of 37/67LR in the normal human small intestinal epithelium. Immunolocalization studies revealed that 37/67LR was predominantly present in the undifferentiated/proliferative region of the human intestinal crypt in both the immature and adult intestine. Using a human intestinal epithelial crypt (HIEC) cell line as experimental model, we determined that 37/67LR was expressed in proliferative cells in both the cytoplasmic and membrane compartments. Small-interfering RNA-mediated reduction of 37/67LR expression led to HIEC cell-cycle reduction and loss of the ability to adhere to laminin-related peptides under conditions not altering ribosomal function. Taken together, these findings indicate that 37/67LR regulates proliferation and adhesion in normal intestinal epithelial cells independently of its known association with ribosomal function.
Article
Full-text available
The inhibitory effects of vitamin D on colitis have been previously documented. Global vitamin D receptor (VDR) deletion exaggerates colitis, but the relative anticolitic contribution of epithelial and nonepithelial VDR signaling is unknown. Here, we showed that colonic epithelial VDR expression was substantially reduced in patients with Crohn's disease or ulcerative colitis. Moreover, targeted expression of human VDR (hVDR) in intestinal epithelial cells (IECs) protected mice from developing colitis. In experimental colitis models induced by 2,4,6-trinitrobenzenesulfonic acid, dextran sulfate sodium, or CD4+CD45RBhi T cell transfer, transgenic mice expressing hVDR in IECs were highly resistant to colitis, as manifested by marked reductions in clinical colitis scores, colonic histological damage, and colonic inflammation compared with WT mice. Reconstitution of Vdr-deficient IECs with the hVDR transgene completely rescued Vdr-null mice from severe colitis and death, even though the mice still maintained a hyperresponsive Vdr-deficient immune system. Mechanistically, VDR signaling attenuated PUMA induction in IECs by blocking NF-κB activation, leading to a reduction in IEC apoptosis. Together, these results demonstrate that gut epithelial VDR signaling inhibits colitis by protecting the mucosal epithelial barrier, and this anticolitic activity is independent of nonepithelial immune VDR actions.
Article
Full-text available
β-Catenin is a central effector of Wnt signaling in embryonic and stem cell development and in tumorigenesis. Here, through a mass spectrometric analysis of a β-catenin protein complex, we identified 12 proteins as putative β-catenin interactors. We show that one of them, 14-3-3ζ, enhances β-catenin-dependent transcription by maintaining a high level of β-catenin protein in the cytoplasm. More importantly, 14-3-3ζ facilitates activation of β-catenin by the survival kinase Akt and colocalizes with activated Akt in intestinal stem cells. We propose that Akt phosphorylates β-catenin, which results in 14-3-3ζ binding and stabilization of β-catenin, and these interactions may be involved in stem cell development. • stem cells
Article
Use of the real-time polymerase chain reaction (PCR) to amplify cDNA products reverse transcribed from mRNA is on the way to becoming a routine tool in molecular biology to study low abundance gene expression. Real-time PCR is easy to perform, provides the necessary accuracy and produces reliable as well as rapid quantification results. But accurate quantification of nucleic acids requires a reproducible methodology and an adequate mathematical model for data analysis. This study enters into the particular topics of the relative quantification in real-time RT-PCR of a target gene transcript in comparison to a reference gene transcript. Therefore, a new mathematical model is presented. The relative expression ratio is calculated only from the real-time PCR efficiencies and the crossing point deviation of an unknown sample versus a control. This model needs no calibration curve. Control levels were included in the model to standardise each reaction run with respect to RNA integrity, sample loading and inter-PCR variations. High accuracy and reproducibility (<2.5% variation) were reached in LightCycler PCR using the established mathematical model.
Article
A protein determination method which involves the binding of Coomassie Brilliant Blue G-250 to protein is described. The binding of the dye to protein causes a shift in the absorption maximum of the dye from 465 to 595 nm, and it is the increase in absorption at 595 nm which is monitored. This assay is very reproducible and rapid with the dye binding process virtually complete in approximately 2 min with good color stability for 1 hr. There is little or no interference from cations such as sodium or potassium nor from carbohydrates such as sucrose. A small amount of color is developed in the presence of strongly alkaline buffering agents, but the assay may be run accurately by the use of proper buffer controls. The only components found to give excessive interfering color in the assay are relatively large amounts of detergents such as sodium dodecyl sulfate, Triton X-100, and commercial glassware detergents. Interference by small amounts of detergent may be eliminated by the use of proper controls.
Article
The β-catenin signaling pathway is deregulated in nearly all colon cancers. Nonhypercalcemic vitamin D3 (1α,25-dehydroxyvitamin D3) analogues are candidate drugs to treat this neoplasia. We show that these compounds promote the differentiation of human colon carcinoma SW480 cells expressing vitamin D receptors (VDRs) (SW480-ADH) but not that of a malignant subline (SW480-R) or metastasic derivative (SW620) cells lacking VDR. 1α,25(OH)2D3 induced the expression of E-cadherin and other adhesion proteins (occludin, Zonula occludens [ZO]-1, ZO-2, vinculin) and promoted the translocation of β-catenin, plakoglobin, and ZO-1 from the nucleus to the plasma membrane. Ligand-activated VDR competed with T cell transcription factor (TCF)-4 for β-catenin binding. Accordingly, 1α,25(OH)2D3 repressed β-catenin–TCF-4 transcriptional activity. Moreover, VDR activity was enhanced by ectopic β-catenin and reduced by TCF-4. Also, 1α,25(OH)2D3 inhibited expression of β-catenin–TCF-4-responsive genes, c-myc, peroxisome proliferator-activated receptor δ, Tcf-1, and CD44, whereas it induced expression of ZO-1. Our results show that 1α,25(OH)2D3 induces E-cadherin and modulates β-catenin–TCF-4 target genes in a manner opposite to that of β-catenin, promoting the differentiation of colon carcinoma cells.
Article
Epidemiologic data reveal associations between low serum concentrations of 25-hydroxyvitamin D (25(OH)D) and higher risk of falls and muscle weakness. Fetal stage is critical for the development of skeletal muscle, but little information is available on the impact of maternal vitamin D deficiency on muscles of offspring. To investigate the morphology and transcriptome of gastrocnemius muscle in newborns in response to maternal vitamin D deficiency, 14 female rats were fed either a vitamin D3 deficient (0 IU/kg) or a vitamin D3 adequate diet (1000 IU/kg) 8 weeks prior to conception, during pregnancy, and lactation. Analysis of cholecalciferol, 25(OH)D3 and 1,25-dihydroxyvitamin D3 show that dams fed the vitamin D deficient diet and their newborns suffered from a relevant vitamin D deficiency. Muscle cells of vitamin D deficient newborns were smaller than those of vitamin D adequate newborns (p < 0.05). Muscle transcriptome of the newborns revealed 426 probe sets as differentially expressed (259 upregulated, 167 downregulated) in response to vitamin D deficiency (fold change ≥1.5, p < 0.05). The effected genes are involved in protein catabolism, cell differentiation and proliferation, muscle cell development, and cytoskeleton organization. Maternal vitamin D deficiency has a major impact on morphology and gene expression profile of skeletal muscle in newborns.