Content uploaded by Geoffrey B Hill
Author content
All content in this area was uploaded by Geoffrey B Hill on Feb 27, 2014
Content may be subject to copyright.
Journal of Sustainable Development; Vol. 6, No. 4; 2013
ISSN 1913-9063 E-ISSN 1913-9071
Published by Canadian Center of Science and Education
1
The Effectiveness and Safety of Vermi-Versus Conventional
Composting of Human Feces with Ascaris Suum Ova as Model
Helminthic Parasites
Geoff B Hill1, Susan A Baldwin2 & Cecilia Lalander2
1 Department of Geography, University of British Columbia, British Columbia, Canada
2 Chemical and Biological Engineering, University of British Columbia, British Columbia, Canada
Correspondence: Geoff B Hill, Department of Geography, University of British Columbia, British Columbia,
Canada. E-mail: geoff.hill@geog.ubc.ca
Received: January 22, 2013 Accepted: February 25, 2013 Online Published: April 1, 2013
doi: URL:
Abstract
Composting toilets have been promoted for management of human waste at remote sites in parks and alpine
areas of recreation, but they may not be effective for producing a stable and safe end-product. Vermicomposting
has been shown to result in a more degraded final product but its effectiveness for pathogen destruction was
unclear due to conflicting information in the literature. This study sought to resolve the debate on whether or not
vermicomposting could produce a hygenic end-product that would be safe for disposal locally. Vermicomposting
was tested for destruction of the model pathogens, helminthic parasites, in an experiment with highly
concentrated and viable Ascaris suum (2626±1306 ova/g, 61.6±8.7% viable) inoculated into fecal matter and coir
(30:70 ratio) with and without Eisenia fetida worms. After 90 days at 19±3ºC six, eight, and 12 worms were
found alive with no significant difference between treatments or through time found in TS% (12-15%), ova
concentration and ova viability. A 100 times reduction in the concentration of Escherichia coli resulted from the
worm treatment versus the control. Significantly higher nitrate (22 735±4 741 mg/kg NO3
-) and lower pH (pH
4.60±0.01) were found in the treatment as compared to the control (5 078±2 167 mg/kg NO3
-) (pH 6.56±0.30).
Despite these improvements in fecal matter processing, vermicomposting was found ineffective at reducing
Ascaris suum ova concentration and viability. Decentralized vermicomposting can efficiently stabilize and
mature fecal matter; however prior to unrestricted end-product use, an additional sanitation step is necessary.
Keywords: vermicomposting, human waste, Ascaris suum, helminthic parasites, E. coli, nitrate
1. Introduction
Management of human waste using waterless technology is often the only option in remote locations.
Additionally, composting toilets are being adopted in some urban areas, since they are perceived as safe and
effective, although there is little on going monitoring to prove this. The ideal onsite human waste treatment
system would be a continuous flow, one step process to produce stabilized, sanitized and mature end-products
that can be handled without health risks and disposed onsite without environmental impacts, bringing about, at
very low cost and risk, production of a soil amendment that could be used for rehabilitation projects. The
waterless and waste reuse aspects of composting toilets make them an attractive sustainable technology.
Despite popular perception, Hill & Baldwin (2012) indicate that composting toilets fail to deliver these
objectives. Urine diverting dehydrating toilets (UDDTs) divert urine, evaporate moisture, and require ash
amendment in order to reduce pathogens through desiccation and alkalization and are considered to be an
improved design over latrine composting toilets. Despite the focus on pathogen destruction over stabilization, 31%
of samples from Bolivian UDDTs that met World Health Organization (WHO) guidelines for UDDTs (high pH,
low moisture, and long storage times), still contained viable Ascaris lumbricoides ova indicating that UDDT
systems are not reliable sanitization systems (McKinley, Parzen, & Guzmán, 2012).
Although vermicomposting has not been approved by Canadian or US federal agencies as a pathogen reduction
and stabilization pathway, it has been shown that vemicomposting (Eastman et al., 2001) and urine diverting
vermicomposting toilets (Hill & Baldwin, 2012) may have the capability to deliver on all of these objectives
(stabilization, maturation, and sanitization). By diverting urine, fecal matter and toilet paper become a suitable
www.ccsenet.org/jsd Journal of Sustainable Development Vol. 6, No. 4; 2013
2
feedstock for decentralized vermicomposting, a process that was shown, by Hill & Baldwin (2012), to produce
sanitized (low E. coli), mature (Solvita® 4±0) and stable (VS 60±10%) solid end-product from human
excrement, as has been shown similarly in numerous other studies including Bajsa, Nair, Mathew, Ho (2003)
(sewage sludge), Yadav, Hait, Tare (2007) (source separated fecal matter), Benitez, Nogales, Elvira,
Masciandaro, Ceccaniti (1999) (sewage sludge), and others for numerous animal manures and industrial wastes
as reviewed by Sinha, Herat, Bharambe (2009) and Edwards, Arancon, Sherman (2011). Vermicomposting toilet
systems have, moreover, been shown to be safer, easier and less expensive to manage than traditional
composting toilets (Hill & Baldwin, 2012). Diverted urine can be discharged directly to shallow septic fields for
rapid assimilation and pathogen attenuation by active soil microbes and plant roots or collected, stored, and
utilized as fertilizer in crop production (Del Porto & Steinfeld, 2000). One objective of this study was to directly
compare the efficacy of vermicomposting with that of composting without worms on the same feces starting
material under identical conditions. End-products were compared by measuring common composting quality
indices.
Postulated mechanisms for pathogen destruction by earthworms include: selective predation/ consumption
(Edward & Bohlen, 1996; Kumar & Shweta, 2011); mechanical destruction through action of gizzard (Edwards
& Subler, 2011); microbial inhibition through humic and coelomic acids or other enzymes secreted within the
digestive tract and extracellular and within gut (Edwards & Subler, 2011); stimulation of microbial antagonists
including the ones of the Streptosporangium and Pseudomonas genera (Kumar & Shweta, 2011); and indirectly
through stimulation of endemic or other microbial species which outcompete, antagonize, or otherwise destroy
pathogens (Edwards & Subler, 2011).
In addition to examining reduction of pathogens such as E. coli we chose to study also the fate of helminthic
parasites. Ascaris lumbricoides ova are one of the most resistant human parasites commonly found in fecal
matter (Eastman et al., 2001; Bowman et al., 2006; Jimenez-Cisneros & Maya-Rendon, 2007). The ova shells are
highly resistant to salts, chemicals, desiccation, acids, bases, oxidants and reductive agents (Jimenez-Cisneros &
Maya-Rendon, 2007). Bean, Hansen, & Margolin (2007) found that pH adjustment up to 12 for two to 72 hours
had no effect on ova viability compared to controls in neutral pH. Ammonia has been shown to have greater
destructive potential than pH adjustment alone (Mendez-Contreras, Jimenez, & Maya, 2004) presumably due to
the permeability of the ova shell to gases (Jimenez-Cisneros & Maya-Rendon, 2007). Temperatures greater than
40oC (with residence times determined by temperature and type of process) are also utilized to destroy ova
(Jimenez-Cisneros & Maya-Rendon, 2007). Thermophilic aerobic digestion at 48oC for 30 days achieved 78%
efficiency in helminthic ova reduction from 4.5 to <1 ova/10g TS (Gantzer, Gaspard, & Galvez, 2001). Despite
Ascaris ova defenses, Eastman et al. (2001) reported that vermicomposting could reduce ova to below acceptable
EPA limits. Based on Ascaris ova superior chemical defenses and resistance to aerobic processes, it seems
unlikely that a single passage (12-20 hours residence time (Wood, 1995)) through the gut of the earthworm
would be adequate to digest the three layers of protective ova shell and accomplish a reduction in viability or ova
concentration. It is possible that chitinase excreted within the earthworm gut (Wood, 1995) could begin the
degrading the ova’s middle chitin based protein layer (Jimenez-Cisneros & Maya-Rendon, 2007), which confers
mechanical resistance and prevents passage of material into the cell, but it seems likely that multiple passes or
considerable subsequent degradation outside the gut of the worm would be necessary to accomplish significant
decrease in ova viability or complete destruction and decrease in concentration. Bowman et al. (2006) found
holes in Eastman et al.’s (2001) methodology, which cast doubt on the validity of these earlier results.
Nevertheless, if vermicomposting were demonstrated to eradicate Ascaris ova from human excrement, the
process could be relied upon as the sole sanitization step in a decentralized treatment system of human waste in
which the residual organic matter could be reused for land application. To resolve this controversy, the
laboratory experiments were designed to also evaluate the effect of vermicomposting on helminthes by spiking
the model helminthic parasite Ascaris suum ova into the fecal matter. Although Ascaris suum are parasites that
more commonly infect pigs, they are the closest relative to A. lumbricoides, and the ova of both species are
similarly resistant to destruction. Composting quality variables were recorded along with Ascaris suum
concentration and viability to test the effectiveness and safety of vermicomposting in comparison with
composting without worms.
2. Method
Fecal matter from two male volunteers was collected over the course of two weeks and stored at 4oC for 2 weeks
prior to initiating the experiments. Four kilograms of fecal matter was saturated with distilled water, drained over
a 24 hour period, inoculated with three million Ascaris suum ova purchased from Excelsior Sentinel Inc.
(Trumansburg, NY) and mixed into four kilograms of damp coconut coir, making a 50:50 fecal:coir wet weight
www.ccsenet.org/jsd Journal of Sustainable Development Vol. 6, No. 4; 2013
3
feedstock. Coir was chosen as it is commonly used in vermiculture in Europe (Anbuselvi, 2009). It has little
nutritional value but considerable water holding capacity which makes it a great bulking agent for fecal matter,
as was discovered in pre-experiment trials (Anbuselvi, 2009). In addition to testing for Ascaris suum
concentration and viability, the feedstock (before being added to the coir) was sampled for a variety of
physicochemical variables to measure decomposition and maturity in end-products (Table 1). Feedstock and
end-products were vacuum sieved with a 250 µm sieve and volatile solids (%) were calculated on both fractions.
All analyses, unless otherwise stated, were conducted by Benchmarks Labs (Calgary, AB).
The feedstock was initially used in an experiment that was abandoned after 48 hours after the majority of the
worms died. Dead earthworms were removed; the material was recombined, thoroughly mixed, and placed at
4oC for 3 days while modifications to experimental design were made.
To increase worm survival, the original feedstock was placed into six 500 mL glass jars upon a bedding of 150 g
of damp coir, diluting it from its 50:50 fecal:coir ratio to 30:70. Fifteen mature Eisenia sp. worms, were added to
three treatment jars creating a worm density of ~0.013 grams earthworm per gram material. The remaining three
jars were left as controls. Permeable geotextile was placed on the top of the jars and sealed with threaded rims.
The jars were placed in a stratified pattern in a rectangular plastic container. A Hobo® air temperature and
relative humidity logger were added to the plastic container and the container was placed into a covered,
insulated, temperature regulated (18-22oC) and humidified (80-90%) chamber. After 90 days, counting the
number of worms and the cocoon density determined the health of the worms. Cocoons are formed as a result of
reproduction and their number informs on reproductive health of the worms. Then, the experiment jars were sent
by overnight courier to Benchmark Labs for testing. Material was thoroughly mixed before sub-sampling. Upon
completion of testing, Benchmark Labs shipped samples back to the authors for storage at 4oC. After 15 days,
samples were sent back to Benchmark Labs for total nitrogen and phosphorus testing. Coir was also sampled at
this time for the full suite of tests. Remaining sample was kept in the fridge at 4oC.
Table 1. Parameters tested and test names/ description or formulae, used to evaluate vermicomposting effects on
Ascaris suum. Parameters tested by Benchmark Labs (Calgary, AB) denoted with *
Parameter Test Name / Description or Formula Units
Percent total solids
(TS%)* APHA Method 3540B %
Percent volatile solids
(VS%)* APHA Method 2540 %
Percent volatile
solids >250um APHA Method 2540 with sieve fraction >250um %
Percent volatile solids
<250um APHA Method 2540 with sieve fraction <250um %
Ammonium-N
(NH4
+-N)* Mod. ASTM D6919 (ion chromatography) mg/kg (ds)
Free ammonia-N
(NH3-N)*
[NH3] = [NH4] (at 20oC)
109.3-pH mg/kg (ds)
pH* Cold water shake 1:2 sample:water, followed by measurement with
VWR symphony pH probe at 25oC -
E.coli*
Cold water shake extraction followed by USEPA Approved Method
1604, with only E. coli reported by membrane filtration using a
simultaneous detection technique
CFU/g (ds)
Nitrate (NO3
-)* APHA Method 4110A mg/kg (ds)
A
scaris sp. ova
concentration* As per Kato et al. 2003 with minor modifications #/g
Ascaris sp. ova
viability* As per Kato et al. 2003 with minor modifications % viable
Zinc (Zn)* Mod. EPA 3050A (Digestions), Mod. EPA 6020 (ICPMS) mg/kg (ds)
Phosphorus (P)* Mod. EPA 3050A (Digestions), Mod. EPA 200.7 (ICPOES) mg/kg (ds)
Total Kjeldahl Nitrogen
(TKN)* Watson, M. et al. (2003) mg/kg (ds)
To further investigate if the conversion of ammonia to nitrate was due to microbial activity in the composting
material, marker genes for total bacteria and bacterial ammonia oxidation were quantified. Genomic DNA was
www.ccsenet.org/jsd Journal of Sustainable Development Vol. 6, No. 4; 2013
4
extracted from duplicate 10g wet weight samples using the MoBio® PowerSoil DNA extraction kit (MoBio
Labs, Solana Beach, CA) according to the manufacturer’s instructions three weeks after final sampling. Total
nucleic acid concentration and DNA purity were measured using a NanoDrop® ND-2000 UV-Vis
Spectrophotometer (NanoDrop Technologies, Wilmington, DE). Appropriate dilutions with sterile
nucleotide-free water were carried out so that all DNA samples were the same concentration. Total bacteria 16S
rRNA and the bacterial ammonia monooxygenase structural gene, amoA, were quantified using primers Bac27F
5’ AGAGTTTGATCCTGGCTCAG 3’(Lane et al., 1985); Bac519R 5’ GNTTTACCGCGGCKGCTG 3’; and
amoA-1F; 5’-GGGGTTTCTACTGGTGGT; amoA-2R; 5’-CCCCTCKGSAAAGCCTTCTTC (Rotthauwe, J. H.,
Witzel, K. P., Liesack, W. 1997), respectively. Quantitative polymerase chain reaction with SsoAdvanced™
SYBR® Green Supermix (Bio-Rad Labs Inc., Hercules, CA) and primers concentrations of 200nM was
performed on a CFX Connect™ Real-Time PCR Detection System (Bio-Rad) with reaction conditions: 98oC
2min; up to 40 cycles of 98oC 5sec; annealing temperature of 55oC (total bacteria) or 60oC (amoA) 30sec; with a
final melting curve at 65-95oC at 0.5oC increments of 2sec. Reactions were performed in triplicate and all
amplicons produced only one melting curve peak. The average number of cycles required for each sample to
reach a threshold relative fluorescence unit was recorded (Cq value).
ANOVA tests were used to evaluate between treatments and controls after checking univariate assumptions,
which were met in all cases.
3. Results and Discussion
An average temperature of 19r3oC was measured through the duration of the 90 day experiment. The
temperature tolerance for Eisenia sp. is between 0-35oC with an optimum between 20-25oC (Neuhauser, Loehr,
& Malecki, 1988). The relative humidity in the covered chamber averaged 95r6%, which assisted in the
maintenance of soil moisture favored by earthworms without requiring frequent manual watering to replace
water lost through cellular respiration and evaporation.
The measured starting worm density was 0.013 g-worm/g-material (15 worms, average 0.3 g/worm, in 350 g of
wet material) and is within the range of worm densities 0.005-0.05 g-worm/g-material found to successfully
sanitize sewage sludge and fecal matter producing stable and mature end product in 8-9 weeks during
experimental trials (Benitez, 1999; Yadav et al., 2007). Worm count by the end of the 90 day experiment had
dropped to 8.7r3.0 from 15; nonetheless, the treatment effect of vermicomposting was considered sufficient as
the sample with the lowest final worm density (0.007g/ g) was still higher than that found sufficient in other
studies (Benitez et al., 1999; Yadav et al., 2007).
The cocoon density (0.069r0.087 cocoons/gram total feedstock (Table 2) is in the middle of a considerable
range of cocoon densities found in other experiments including Yadev et al. (2007) where 0.0026-0.0032
cocoons/g feedstock were found from 30 worms placed into 40 kg feedstock for 4 months, and Sangwan,
Kaushik, Garg (2008) who found 0.42-1.36 cocoons/g feedstock (from 5 worms placed into 150 g feedstock in 1
L containers for 13 weeks). Adequate nutrition is required to support growth and reproduction in earthworms
(Sangwan et al., 2008) and the cocoon density found here can be interpreted as an indicator of adequate nutrition
and affirmation of the vermicomposting process in the treatment jars (Dominguez & Edwards, 2011).
Nevertheless, being a closed experiment, the process was far from optimized; Eisenia sp. can produce 0.35
cocoons/worm/day (Dominguez & Edwards, 2011), which would equate to a cocoon density of 1.4 cocoons/g
material if the rate were maintained throughout the 90 day experiment.
The TS content of the feedstock, coir, treatment and control were all between 12-15%, which is within the
optimum range (75-90% moisture content) for vermicomposting (Neuhauser et al., 1988) (Table 2). Domínguez
and Edwards (Domínguez & Edwards, 1997) suggested the optimum moisture be between 80-90%. End-product
from non-bulked commercial vermicomposting toilets - which sustained adequate worm density (0.03r0.04
g-worm/g-material), reduced E.coli to 200 CFU/g, and produced mature, stable, high density (850 kg/m
3)
vermicompost - was considerably drier, a factor which is important in order to prevent anaerobic conditions
(27r10% TS) (Hill & Baldwin, 2012). However, the high lignin content (30%) and low density (70-80 kg/m3) of
the coconut coir bulking agent likely maintained oxygen transport preventing anaerobic conditions from
developing (Anbuselvi, 2009). As desired, there was no significant difference in TS between treatment and
control eliminating any effect or interaction moisture content may have had on decomposition or pathogen
destruction.
www.ccsenet.org/jsd Journal of Sustainable Development Vol. 6, No. 4; 2013
5
Table 2. Feedstock, coir, starting material, treatment, and control means and standard deviations for parameters
tested in determination of effect of vermicomposting on Ascaris suum
Parameter
(units)
Feedstock
(meanrSD)
Coir
(meanrSD)
Starting Avg+
(meanrSD)
Treatment
(meanrSD)
Control
(meanrSD)
p value
(T vs. C only)
TS (%) 14.53r0.17 14.70r0.46 14.65
r
0.49 12.38
r
1.34 13.23r0.59 0.49
VS (%) 93.224r2.183 95.323r1.551 94.802
r
2.701 91.687
r
0.346 92.214r0.503 0.209
VS >250um
(%) 95.647r0.579 96.270r1.175 96.092r1.310 93.677r1.142 92.336r0.476 0.0674
VS <250um
(%) 89.665r4.749 88.907r8.733 90.217r7.824 86.132r2.086 91.889r3.293 0.0314*
NH4
+-N
(mg/kg) 402.0r58.5 N.A. N.A. 66.8r25.1 <2.5 0.011
NH3-N
(mg/kg) 24.3r8.2 N.A. N.A. <2.5 <2.5 N.A.
pH 8.04r0.17 5.88r0.12 6.53
r
0.21 4.60
r
0.01 6.56r0.30 0.0074*
NO3
- (mg/kg) <2.5 0.23r0.40 <2.5 22 735
r
4741 5 078r2167 0.0042*
TKN (mg/kg) 34 000r15400 9 600r2200 16 900
r
15600 16 700
r
4100 19 000r1500 0.51
E.coli
(CFU/g) 61 422r9042 0++ 18 426r9042 442r290 310r360 0.65
A
scaris ova
(#/g) 2 626r1306 0++ 787.8r1306 6 269r3226 4 638r3095 0.56
Ascaris
(% viable) 61.6r8.7 N.A. 61.6r8.7 52.7r8.4 57.4 r7.2 0.50
Zn (mg/kg) 112.5r12.6 0++ 33.75
r
12.6 45.6
r
11.2 26.8r15.2 0.17
P (mg/kg) 5 833r1072 285.7r321.9 1 949
r
1119 2 554
r
889 3 299r1527 0.51
Cocoons (#/g) 0 0 0 0.069
r
0.087 0 N.A.
Worms (#) 0 15 15 8.7
r
3.1 0 N.A.
+: Weighted average by wet weight of coir and feedstock added to each container
++: Assumed, not measured.
N.A.: Not measured
Table 3. Comparison of studies on the effects of vermicomposting on pH, nitrate, total available nitrogen (TAN),
and volatile solids (VS) or total organic carbon (TOC)
pH Nitrate
(mg/kg ds)
Total Nitrogen
(units)
Decreased VS
or TOC
Source Feedstock Time Initial Final Initial Final Initial Final
Bajsa et al.
(2005)
Sludge N.A. 9.5 4.5 500 3750 N.A. N.A. N.A.
Bajsa et al.
(2005)
Sludge and sawdust N.A. 8 4.5 2500 1750 N.A. N.A. N.A.
Hill &
Baldwin
(2012)
Source separated
fecal matter 3r1 years N.A. 7.4r0.3 N.A. 1961
r700 N.A. N.A. Yes, 20-30%
Yadav et al.
(2010)
Source separated
fecal matter 4 mo 5.3r0.2 8.0r0.3 N.A. N.A. 41
(g/kg)
28
(g/kg) Yes, 48%VS
Kumar &
Shweta
(2011)
Cow dung with other
amendments 60 days N.A. N.A. N.A. N.A. 0.73-0.86% 1.0-1.4% Yes, 2-4%
Sangwan et
al. (2008)
Mixtures of cow
dung, biogas plant
slurry and press mud
91 days 7.4-8 6.1-7.4 N.A. N.A. 15-19
(g/kg)
21-27
(g/kg) Yes, 7-12%.
This study Source separated
fecal matter and coir 90 days 6.5r0.2 4.6r0.0 <2.5 23000
r
4
741
17
r
16
(g/kg)
17r4
(g/kg) N.A.
Vermicomposted material had a pH of 4.60r0.01 which was significantly less than the control (6.56r0.30)
(p=0.0074) and lower than the feedstock (8.04r0.17), coir (5.88r0.12) and weighted average of the two
www.ccsenet.org/jsd Journal of Sustainable Development Vol. 6, No. 4; 2013
6
(6.53r0.21) (Table 2). A wide range of vermicompost end-product pH values have been reported and generally
related to feedstock characteristics, as noted in Table 3. Eisenia sp. are suggested to have a pH preference as low
as 5.0 (Dominguez & Edwards, 2011) and as high as 7.0 (Sinha et al., 2009). The decrease in pH was expected
for both the control and even more so for the treatment: decomposition produces organic acids and CO2, while
nitrification (known to be amplified during vermicomposting) consumes hydroxide ions (Haug, 1993; Parkin &
Berry, 1999). A pH of 4.6 is too low for reuse of the end product as fertilizer and this would need to be raised by
adding a neutralizing agent, such as lime.
When the feedstock and coir were mixed together, the total (weighted) average volatile solids (VS) percent was
94.8r2.7%, which after 90 days was reduced to 91.7r0.35% in the vermicompost treatment and 92.2r0.5% in
the control (Table 2). The treatment and control were not significantly different. However, when sieved through
a 250Pm screen, the fine fraction of starting material, treatment, and control VS values were all lower than the
total VS values and as predicted, the vermicomposting VS was significantly lower than for the control (Table 2,
p=0.0314) indicating accelerated decomposition in the fine fraction. Conversely, in the fraction >250Pm the VS
of the starting material, treatment and control were all higher than the total VS values, and the control almost had
significantly less VS than the treatment (92.3r0.5 and 93.7r1.4), respectively p=0.0674) (Table 2). Large
filamentous fungal growths were observed in the control jars of similar previous experiments (results not shown).
Fungi are one of the main agents in decomposing large complex lignin particles and may have degraded this
fraction faster in the controls where there was less predation by worms (Dominguez & Edwards, 2011).
It is common in vermicomposting human fecal matter to see VS values decrease to 60-80% from starting values
of 90% (Table 3), however, the significant results found here are likely to still have important functional
meaning. The relatively small magnitude of VS reduction was likely due to a small fraction of biodegradable
carbon, and a large fraction containing lignin, the majority of which was not biodegradable, yet incinerated at
500oC and dominated the VS result. Chandler et al. (1980) proposed Equation 1, which can be used to calculate
the biodegradable fraction. Coconut coir has very high lignin content (30%); and resulting decomposition can
take many years (Anbuselvi, 2009). Applying the Chandler et al. (1980) equation to coir, the result is -1%; very
little of coir’s VS is thus biodegradable.
B=0.830-(0.028)X (1)
Where B is the biodegradable fraction of the VS and X is the percent lignin content as % fraction of the VS.
Coir was chosen as a bulking agent into which the Ascaris sp. inoculated fecal matter was placed in order to have
worms preferentially consume fecal matter over bulking agent maximizing the ingestion of Ascaris sp. ova. The
percent reduction in volatile solids as a result of vermicomposting can be estimated by dividing the recorded
percent reduction in fine volatile solids between treatment and averaged starting material (4.1r7.8%) by the wet
weight ratio of fecal matter to coir (0.3 (30:70)) to remove the influence of coir and by the fraction of material
<250Pm >250Pm (0.40r0.14) to include only the fine fraction of material. The result is 34r8% reduction in
volatile solids, bringing the reduction into a similar range found in other vermicomposting studies (Table 3).
The original VS reduction through vermicomposting may be even larger. A considerable fraction of the VS may
have been turned into CO2 subsequently fixed into microbial mass by lithoautotrophic nitrifying bacteria. The
nitrate content of the treatment material was very high (22 735r4741 mg/kg NO3
-); 10-500 times greater than
previously reported for vermicomposts from human waste (1 750-3 750 mg/kg NO3
-) (Table 3) or by commercial
compost quality standards (>50 mg/kg NO3
—N) (Wichuk & McCartney, 2010).
The high level of nitrate found in the vermicomposted material (5 078r2 167 mg/kg NO3
-) was significantly
greater than that of the control (p=0.0042) both of which were greater than the starting material, which was
below the detection limit (Table 2). Nitrate is produced by aerobic lithotrophic bacteria and archaea through the
oxidation of ammonium (Haug, 1993). This is the rate-limiting step in the nitrogen cycle due to the high oxygen
demand (amongst other limiting factors) of these microbes (~4g O2/g-NH3-N), which can prevent complete
conversion of all available nitrogen to nitrate. Comparing the total nitrogen (16 700r4100 mg/kg) to nitrate (22
735r4 741 mg/kg NO3
-) in the treatment, it appears that complete nitrification took place. Whereas only one
quarter of the TKN (19 000r1 500 mg/kg) was converted to nitrate (5 078r2 167 mg/kg) in the control. There is
ample supporting evidence for significantly increased mineralization rates, high nitrate content, and nitrifying
microbial mass associated with earthworm activity in burrows (Parkin & Berry, 1999) and in vermicomposting
operations ( Subler, S., Edwards, C., Metzger, J. (1998); Dominguez & Edwards, 2011). There is also research
indicating that coir is an excellent medium for nitrifying bacteria (Reghuvaran & Das Ravindranath, 2010).
Indeed, based on relative log2{-Delta(Cq)} values from the qPCR analysis, the ratio of bacterial ammonium
oxidizing genes (AmoA) to total bacteria DNA (16S rDNA) was ~40 times larger in the vermicomposting
www.ccsenet.org/jsd Journal of Sustainable Development Vol. 6, No. 4; 2013
7
treatment as compared to the control (p <0.01) (Figure 1). Vermicomposting human waste with coir may be a
highly effective process for the production of nitrate fertilizer.
The small amounts of ammonium-N found in the treatment (66.8r25.1mg/kg) may have resulted from recent
worm death and decay, which was not present in the controls. It is not known if there was any ammonium-N in
the coir since it was not measured. The coir was well aerated before being used in the experiment and likely did
not contain enough ammonium-N to have an impact on Ascaris inactivation. There was no significant difference
in zinc or potassium between treatment and control and no trend compared to starting material (Table 2).
Our results indicate no difference in Ascaris sp. concentration (p=0.56) or viability (p=0.50) between treatment
and control and no reduction in viability after 90 days compared to initial feedstock (Table 2). It appears as
though concentrations of ova are greater in the treatment and control than in the feedstock, and while this may be
due to loss of organic matter from decomposition, it was not a significant effect and the variability was likely
caused by incomplete mixing during inoculation.
Figure 1. Numbers of bacterial ammonia oxidation genes (amoA) relative to the total bacterial 16S rDNA in the
control and vermicomposting end-product samples as determined by qPCR of the respective genes. Top and
bottom whiskers represent the maximum and minimum values, respectively; the box, the first and third quartiles;
the thick horizontal line, the median; and the open circle, the mean
E.coli was reduced from a starting concentration of 6.1x104 CFU/g to <1000 CFU/g in both treatment and
control but no differences were found between treatment and control and no conclusions can be drawn in regards
to the efficacy of vermicomposting on bacterial pathogens. A considerable number of studies have been
conducted on bacterial pathogen destruction resulting from vermicomposting, the vast majority of which indicate
more rapid and complete bacterial pathogen destruction than a control lacking earthworms (Mitchell, 1978;
Brown & Mitchell, 1981; Eastman et al., 2001). More importantly, E. coli concentration had no correlation to
Ascaris sp. viability indicating that E. coli elimination alone cannot be proof of sanitation through
vermicomposting.
Due to the high lignin content of the coir, it is not possible to assume all matter and ova in the jars was ingested.
However, it is also unrealistic to rely on worms to consume the material completely enough to be assured 4 log10
reduction in Ascaris ova and meet WHO guidelines ((WHO), 2006) for unrestricted use (104 ova/g reduced to 1
www.ccsenet.org/jsd Journal of Sustainable Development Vol. 6, No. 4; 2013
8
ova/g). Moreover, ingestion of ova by Lumbricus terrestris appears to have little effect on Ascaris sp. ova
(Rysavy, 1969). The lack of ova reduction despite a full range of biochemical effects brought about by
vermicomposting casts doubt on the efficacy of pathogen destruction processes.
The data presented here should help to clarify some debate on the topic of Ascaris sp. ova destruction through
vermicomposting. Eastman et al. (2001) report significant helminth ova reduction from 8.26x105 ova/4g (dw) to
9.33r1.45x103 in 6 days through windrow vermicomposting with Eisenia sp. as compared to 2.16r0.18 x105
windrow composting without earthworms. However, as Bowman et al. (2006) point out, some aspects of
Eastman et al.’s (2001) experimental design and analyses appeared to be flawed. Eastman et al. (2001) report
inoculating 1x106 ova into the windrow, estimated to be 531 kg of raw material (which should result in an
average concentration of 2 ova/gram), yet contradictorily report sampling 2x105 ova/gram at the start of the test.
Eastman et al. (2001) also report adding 1:1.5 earthworm mass:biosolids mass. It seems unlikely that hundreds of
kilograms of earthworms could be sourced, let alone transported and applied. Bowman et al. (2006) also found
flaws with Cardosa & Ramirez (2002) who reported successful helminth ova destruction by vermicomposting to
acceptable limits (<1 ova/ 4 g end product) yet fail to mention that starting concentrations of ova were also
below this limit.
Bowman et al. (2006) conducted similar experiments using Ascaris sp. ova spiked potting soil, treatments with
worms, and controls without worms and found similar results: No reduction in Ascaris sp. concentration was
found after 183 days vermicomposting and no reduction in ova viability between vermicomposting and a control
after 7 days and less than a 1 log reduction after 6 months.
It is concluded that additional treatment is necessary to ensure the destruction of Ascaris ova, as the
vermicomposting process does not appear to have the capacity to do this. Post-treatment with urea and ash to
elevate ammonia concentrations, as per McKinley, Parzen, & Guzmán (2012b), should accomplish the desired
sanitization step. While vermicomposting was shown here failing to accomplish complete sanitization, it can be
relied upon as a low cost method to stabilize and mature fecal matter; processes which are both valuable in the
practical aspects of waste management and essential in the development of compost suitable and beneficial when
reused. Vermicomposing is also very useful for stabilization and increasing the nitrate content of the end product
increasing its value as a fertilizer, if desired.
4. Conclusions
Vermicomposting was sustained for 90 days. In comparison to controls without earthworms, vermicomposting
significantly increased nitrate, lowered pH and reduced volatile solids. Despite reduction in E.coli from 60000 to
<1000 CFU/g (ds) in both treatment and control, no reduction in Ascaris suum egg concentration or viability was
found. These results indicate that the previously postulated pathogen destruction by selective grazing and
extracellular biochemical process associated with vermicomposting have no effect on Ascaris suum ova
concentration or viability.
Acknowledgements
Support for this research project was provided by BEES (Alpine Club of Canada), the American Alpine Club,
Metro Vancouver, Natural Sciences and Engineering Research Council (Post Graduate Scholarship to GBH;
Discovery Grant to SAB), Mountain Equipment COOP, British Columbia Community Legacy Program, and the
UBC Alma Mater Society.
References
Anbuselvi, S. (2009). Study on biodegradation of coir waste by cyanobacteria and comparing its efficiency with
different organic manures on blackgram varieties. PhD. Bharath University
Bajsa, O., Nair, J., Mathew, K., & Ho, G. (2003). Vermiculture as a tool for domestic wastewater management.
Wa te r Sc ie nc e an d Te ch no lo g y, 48 (11-12), 125-132. PMid:14753527
Bean, C., Hansen, J., & Margolin, A. (2007). Class B alkaline stabilization to schieve pathogen inactivation.
International Journal of Environmental Research and Public Health, 4(1), 53-60.
http://dx.doi.org/10.3390/ijerph2007010009 PMid:17431316
Benitez, E., Nogales, R., Elvira, C., Masciandaro, G., & Ceccaniti, B. (1999) Enzyme activities as indicators of
the stabilization of sewage sludges composting with Eisenia foetida. Bioresource Technology, 67, 297-303.
http://dx.doi.org/10.1016/S0960-8524(98)00117-5
Bowman, D. D., Liotta, J. L., McIntosh, M., & Lucio-Forster, A. (2006). Ascaris suum Egg Inactivation and
Destruction by the Vermicomposting Worm, Eisenia foetida. Residuals and Biosolids Management.
www.ccsenet.org/jsd Journal of Sustainable Development Vol. 6, No. 4; 2013
9
Bridging to the Future, Water Environment Federation.
Brown, B. A., & Mitchell, M. J. (1981). Role of the earthworm, Eisenia foetida, in affecting survival of
Salmonella enteritidis ser. typhimurium. Pedobiologia, 22, 434-438.
Cardosa, V. L., & Ramirez, C. E. (2002). Vermicomposting of sewage sludge: A new technology for Mexico.
Wa te r, Sc ie n ce a nd Te c hn ol og y, 4 6, 153-158.
Chandler, J. A., Jewell, W. J., Gossett, J. M., Soest, P. J. V., & Robertson., J. B. (1980). Predicting methane
fermentation biodegradability. New York: John Wiley & Sons, Inc.
Del Porto, D., & Steinfeld, C. (2000). Composting Toilet System Book: A Practical Guide Pollution to Choosing,
Planning, and Maintaining Composting Toilet Systems. Concord, MA: Center of Ecological Pollution
Prevention.
Dominguez, J., & Edwards, C. A. (2011). Biology and ecology of earthworm species used for vermicomposting.
In C. A. Edwards, N. Q. Arancon, & R. Sherman (Eds.), Ve r m ic u l tu r e Te ch n o lo g y (pp. 249-261). Florida:
CRC Press Taylor and Francis Group.
Domínguez, J., & Edwards, C. A. (1997). Effects of stocking rate and moisture content on the growth and
maturation of Eisenia andrei (Oligochaeta) in pig manure. Soil Biology and Biochemistry, 29, 743-746.
http://dx.doi.org/10.1016/S0038-0717(96)00276-3
Eastman, B. R., Kane, P. N., Edwards, C. A., Trytek, L., Gunadi, B., Stermer, A. L., & Mobley, J. R. (2001). The
effectiveness of vermiculture in human pathogen reduction for USEPA biosolids stabilization. Compost
Science and Utilization, 9(1), 38-49.
Edwards, C. A., Arancon, N. Q., & Sherman, R. (2011). Ve r mi c u lt u re Te ch n o lo g y . Florida: CRC Press Taylor and
Francis Group.
Edwards, C. A., & Bohlen, P. J. (1996). Biology and Ecology of Earthworms. London, UK: Chapman and Hall.
Edwards, C. A., & Subler, S. (2011). Human pathogen reduction during vermicomposting. In C. A. Edwards,
N.Q. Arancon, & R. Sherman (Eds.), Ve r m ic u l tu r e Te c hn o l og y, (pp. 249-261). Florida: CRC Press Taylor
and Francis Group: .
Gantzer, C., Gaspard, P., & Galvez, L. (2001). Monitoring of bacterial and parasitological contamination during
various treatment of sludge. Wa te r Re se arc h, 3 5(16), 3763-3770.
http://dx.doi.org/10.1016/S0043-1354(01)00105-1
Haug, R. T. (1993). The Practical Handbook of Compost Engineering. Florida: Lewis Publishers.
Hill, G. B., & Baldwin, S. A. (2012). Vermicomposting toilets, an alternative to latrine style microbial
composting toilets, prove far superior in mass reduction, pathogen destruction, compost quality, and
operational cost. Wa st e M a na ge me n t, 3 2(10), 1811-20. http://dx.doi.org/10.1016/j.wasman.2012.04.023
PMid:22658870
Jimenez-Cisneros, B. E., & Maya-Rendon, C. (2007). Helminths and sanitation. In Méndez-Vilas, A. (Ed.),
Communicating Current Research and Educational Topics and Trends in Applied Microbiology, 1 (pp.
60-71). http://www.formatex.org/microbio/
Kato, S., Fogarty, E., & Bowman, D. D. (2003). Effect of aerobic and anaerobic digestion on the viability of
Cryptosporidium parvum oocysts and Ascaris suum eggs. International Journal of Environmental Health
Research, 13(2), 169-179. http://dx.doi.org/10.1080/0960312031000098071 PMid:12745337
Kumar, R., & Shweta (2011). Removal of pathogens during vermi-stabilization. Journal of Environmental
Science and Technology, 4(6), 621-629. http://dx.doi.org/10.3923/jest.2011.621.629
Lane, D. J., Pace, B., Olsen, G., Stahl, D., Sogin, M., & Pace, N. (1985). Rapid determination of 16S ribosomal
RNA sequences for phylogenetic analyses. PNAS, 82(20), 6955-6959.
http://dx.doi.org/10.1073/pnas.82.20.695
McKinley, J. W., Parzen, R. E., & Guzmán, A. M. (2012). Impact of climate and bulking materials on
characteristics of compost from ecological toilets. Journal of Water, Sanitation and Hygiene for
Development, 2(2), 79-86. http://dx.doi.org/10.2166/washdev.2012.059
McKinley, W., Parzen, R. E., & Guzmán, M. A. (2012b). Ammonia Inactivation of Ascaris Ova in Ecological
Compost Using Urine and Ash. Applied and Environmental Microbiology, published ahead of print 11 My
2012.
www.ccsenet.org/jsd Journal of Sustainable Development Vol. 6, No. 4; 2013
10
Mendez-Contreras, J., Jimenez, B., & Maya, C. (2004). Disinfection kinetics of pathogens in physiochemical
sludge treated with ammonia. Wat er S ci en ce a nd Te ch n ol og y, 5 0(9), 67-74.
Mitchell, M. J. (1978). Role of invertebrates and microorganisms in sludge decomposition. In R. Hartenstein, &
V. A . S p r i n g e l d ( E d s . ) , Utilization of Soil Organisms in Sludge Management, PB286932 (pp. 35-50).
Springfield, VT: The National Technology Information Service.
Neuhauser, E. F., Loehr, R. C., & Malecki, M. R. (1988). The potential of earthworms for managing sewage
sludge. In C. A. Edwards, & E. F. Neuhauser (Eds.), Earthworms in Waste and Environmental Management
(pp. 9-20). Den Hague, The Netherlands: SPB Academic Publishing
Parkin, T. B., & Berry, E. C. (1999). Microbial nitrogen transformations in earthworm burrows. Soil Biology and
Biochemistry, 31, 1765±1771.
Reghuvaran, A., & Das Ravindranath, A. (2010). Efficacy of biodegraded coir pith for cultivation of medicinal
plants. Journal of Scientific and Industrial Research, 69(7), 554-559.
Rotthauwe, J. H., Witzel, K. P., & Liesack, W. (1997). The ammonia monooxygenase structural gene amoA as a
functional marker: Molecular fine-scale analysis of natural ammonia-oxidizing populations. Applied and
Environmental Microbiology, 63(12), 4704-4712. PMid:9406389 PMCid:168793
Rysavy, B. (1969). Lumbricidae - an important parasitological factor in helminthoses of domestic and wild
animals. Pedobiologia, 9, 171-174.
Sangwan, P., Kaushik, C. P., & Garg, V. K. (2008). Vermiconversion of industrial sludge for recycling the
nutrients. Bioresource Technology, 99, 8699-8704. http://dx.doi.org/10.1016/j.biortech.2008.04.022
PMid:18490154
Sinha, R. K., Herat, S., & Bharambe, G., A., B. (2009). Vermistabilization of sewage sludge (biosolids) by
earthworms: converting a potential biohazard destined for landfill disposal into a pathogen-free, nutritive
and safe biofertilizer for farms. Wa s te M an ag em e nt & R es ea rc h, 2 8, 872-881
http://dx.doi.org/10.1177/0734242X09342147 PMid:19710116
Subler, S., Edwards, C., & Metzger, J. (1998). Comparing vermicomposts and composts. Biocycle, 39(7), 63-66.
Watson, M., Wolf, A., & Wolf, N. (2003). Total Nitrogen. In J. Peters (Ed.), Recommended Methods of Manure
Analysis. A3769 (pp. 18-24). University of Wisconsin-extension
(WHO), W. H. O. (2006). WHO GUIDELINES FOR THE SAFE USE OF WASTEWATER, EXCRETA AND
GREYWATER. Geneva, Switzerland, World Health Organization (WHO).
Wichuk, K. M., & McCartney, D. (2010). Compost stability and maturity evaluation—a literature review.
Canadian Journal of Civil Engineering, 37, 1505-1523. http://dx.doi.org/10.1139/L10-101
Woo d, M. ( 1995). Environmental Soil Biology. Bishopbriggs, Glasgow: Blackie Academic & Professional.
http://dx.doi.org/10.1007/978-94-011-0625-2
Ya da v, K . D . , H a it , S ., & Ta r e , V. ( 20 0 7) . S ou r ce s ep a ra t io n t ec h ni qu e s f or r ec o ve r y o f n ut r ie n ts f ro m h um an
excreta. Wo rl d To il e t S um mi t . New Delhi, India.
