Elucidation of bacteria found in car interiors and strategies to reduce the presence of potential pathogens

Abstract

The human microbiome is influenced by a number of factors, including environmental exposure to microbes. Because many humans spend a large amount of time in built environments, it can be expected that the microbial ecology of these environments will influence the human microbiome. In an attempt to further understand the microbial ecology of built environments, the microbiota of car interiors was analyzed using culture dependent and culture independent methods. While it was found that the number and type of bacteria varied widely among the cars and sites tested, Staphylococcus and Propionibacterium were nearly always the dominant genera found at the locations sampled. Because Staphylococcus is of particular concern to human health, the characteristics of this genus found in car interiors were investigated. Staphylococcus epidermidis, S. aureus, and S. warnerii were the most prevalent staphylococcal species found, and 22.6% of S. aureus strains isolated from shared community vehicles were resistant to methicillin. The reduction in the prevalence of pathogenic bacteria in cars by using silver-based antimicrobial surface coatings was also evaluated. Coatings containing 5% silver ion additives were applied to steering wheels, placed in cars for five months and were found to eliminate the presence of culturable pathogenic bacteria recovered from these sites relative to controls. Together, these results provide new insight into the microbiota found in an important built environment, the automobile, and potential strategies for controlling the presence of human pathogens.

Full text

Elucidation of bacteria found in car interiors and strategies to reduce the presence of potential
pathogens
Rachel E. Stephenson
a,1
, Daniel Gutierrez
a,1
, Cindy Peters
b
, Mark Nichols
b
and Blaise R. Boles
a
*
a
Department of Molecular, Cellular, and Developmental Biology, University of Michigan, Ann Arbor, MI 48109, USA;
b
Materials
Research Department, Ford Motor Company Dearborn, MI 48121, USA
(Received 23 August 2013; accepted 3 December 2013)
The human microbiome is influenced by a number of factors, including environmental exposure to microbes. Because
many humans spend a large amount of time in built environments, it can be expected that the microbial ecology of these
environments will influence the human microbiome. In an attempt to further understand the microbial ecology of built
environments, the microbiota of car interiors was analyzed using culture dependent and culture independent methods.
While it was found that the number and type of bacteria varied widely among the cars and sites tested, Staphylococcus
and Propionibacterium were nearly always the dominant genera found at the locations sampled. Because Staphylococcus
is of particular concern to human health, the characteristics of this genus found in car interiors were investigated.
Staphylococcus epidermidis,S. aureus, and S. warnerii were the most prevalent staphylococcal species found, and
22.6% of S. aureus strains isolated from shared community vehicles were resistant to methicillin. The reduction in the
prevalence of pathogenic bacteria in cars by using silver-based antimicrobial surface coatings was also evaluated. Coat-
ings containing 5% silver ion additives were applied to steering wheels, placed in cars for five months and were found
to eliminate the presence of culturable pathogenic bacteria recovered from these sites relative to controls. Together, these
results provide new insight into the microbiota found in an important built environment, the automobile, and potential
strategies for controlling the presence of human pathogens.
Keywords: Staphylococcus; microbial ecology of built environments; fomite; antimicrobial coatings
Introduction
The environments that humans encounter daily are
sources of exposure to microbial communities and some
are of potential concern to human health. Humans spend a
significant amount of time indoors and thus the microbial
ecology of indoor environments likely impacts the human
microbiome (Klepeis et al. 2001; Kembel et al. 2012). In
the past few years studies have emerged that examine the
microbial communities of built environments. Current
evidence suggests that indoor microbiomes originate
mainly from outside air or the human skin (Pakarinen
et al. 2008; Rintala et al. 2008; Grice & Segre 2011).
The microbial species present in a built environment
are predominantly determined by exposure to microbes
and selection of certain microbial types by the environ-
ment (Martiny et al. 2006). Previously, most studies
examining the microbiome of built environments have
concentrated on buildings, with a particular focus on
health care settings (Rintala et al. 2008; Tringe et al.
2008; Amend et al. 2010; Kembel et al. 2012). In this
study, both culture-dependent and culture-independent
approaches were utilized to study the microbial ecology
of the automobile built environment. Automobiles are
potentially important fomites for exposure to microbes as
many individuals spend a significant amount of time in
this setting.
The Staphylococcus genus is of particular impor-
tance concerning fomite colonization and transmission
to humans. Staphylococci frequently colonize human
skin and mucosal surfaces, and thus are likely to be
transmitted to inanimate surfaces that humans come into
contact with (Safdar & Bradley 2008; Foster 2009;
Pynnonen et al. 2011; Payne et al. 2013). Of particular
concern is Staphylococcus aureus, which has the
capacity to cause a variety of devastating infectious
diseases (Lowy 1998; Klevens et al. 2007; Otto 2012).
S. aureus infections and outbreaks have previously been
associated with exposures to a multitude of contami-
nated fomites including whirlpools, razors, towels,
handrails and toys (Miller & Diep 2008; Kassem 2011).
Because staphylococci can colonize commonly touched
inanimate objects, it is feasible that interior surfaces of
automobiles could serve as reservoirs for pathogenic
staphylococci and may play an important role in human
colonization and infection.
This study addresses three general questions. First,
what is the relative abundance of microbes at different
frequently touched automobile surface interiors? Second,
*Corresponding author. Email: brboles@umich.edu
1
These authors contributed equally to the work.
© 2014 The Author(s). Published by Taylor & Francis.
This is an Open Access article. Non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly attributed, cited, and is not altered,
transformed, or built upon in any way, is permitted. The moral rights of the named author(s) have been asserted.
Biofouling, 2014
Vol. 30, No. 3, 337–346, http://dx.doi.org/10.1080/08927014.2013.873418

what is the composition of the microbial communities
found in automobile interiors? Third, can automobile
interior surfaces be designed to resist colonization by
potential pathogens?
Materials and methods
Sample collection and bacterial culturing
Samples were collected from indicated automobile inte-
rior sites using Whatman neutralizing buffer swabs (GE
Healthcare Life Sciences, Piscataway, NJ, USA). These
swabs were wetted in the provided storage/transport buf-
fer and ~ 6.5 cm
2
of the indicated surface was sampled.
The swabs were suspended in 2 ml of sterile phosphate
buffer saline (PBS) and vortexed for 30 s to re-suspend
the bacteria. For culturing, suspended samples were seri-
ally diluted in sterile PBS to extinction. Dilutions were
plated on nutrient agar (Becton Dickinson, Franklin
Lakes, NJ, USA) and TSA blood agar (Becton Dickin-
son, Franklin Lakes, NJ, USA) and incubated for 3 days
at 30°C.
Bacterial isolate identification via partial 16S rRNA
PCR amplification and sequencing
For 16S rRNA sequencing, single colonies were
suspended in 100 μl of sterile water and heated to 100°C
for 15 min. The suspension was centrifuged for 10 s at
6,400 rpm and 5 μl of each suspension were used as the
template for PCR amplification of the 16S rRNA gene.
PCR was performed using a mix of 25μl of GoTaq®
Green Master Mix (Promega, Madison, WI, USA), 18 μl
of PCR certified water (Promega), and 1 μleachof
forward primer (8FPL, AGTTTGATCCTGGCTCAG) and
reverse primer (806R, GGACTACCAGGGTATCTAAT) as
previously described (Vornhagen et al. 2013). PCR prod-
ucts were cleaned using the QIAquick PCR Purification
System (Qiagen, Valencia, CA, USA) according to the
manufacturer’s protocol. The purified DNA was checked
for quantity and purity using a NanoQuant Tecan M200
(Tecan, Durham, NC, USA). Sequencing was performed
by the DNA Sequencing Core at the University of
Michigan (Ann Arbor, MI, USA) using Applied Biosys-
tems 3730xl DNA Analyzers (Applied Biosystems, Carls-
bad, CA, USA), BigDyev3.1 chemistry (MCLAB, San
Francisco, CA, USA), and the protocols recommended by
the manufacturer. Resulting partial 16s rRNA gene
sequences were analyzed using CHROMAS (Brisbane,
Australia) and compared to known sequences in the
National Center for Biotechnology (NCBI) database using
the Basic Local Alignment Search Tool (BLAST).
Culture-independent analysis
For culture-independent analysis, car interiors were
sampled as described above and swab tips were removed
and placed in sterile 2.0 ml vials. Samples were stored at
–80°C prior to analysis by pyrosequencing. DNA was
extracted using a modified Qiagen DNA preparation kit,
which included incubating the swab in lysis buffer for 1
h, bead-beating utilizing a Qiagen Tissue Lyser, and
column capture, purification and elution of DNA. PCR
was conducted to generate barcoded amplicons with
linkers. To prepare for FLX sequencing, the size and
concentration of DNA fragments were determined by
using DNA chips within a Bio-Rad Experion Automated
Electrophoresis Station (Bio-Rad Laboratories, Hercules,
CA, USA) and a TBS-380 Fluorometer (Promega Corpo-
ration, Madison, WI, USA). A sample containing 9.6 ×
10
6
molecules μl
−1
of double-stranded DNA with an
average size of 625 bp was mixed with 9.6 million DNA
capture beads and subsequently amplified by emulsion
PCR. After bead recovery and enrichment, the
bead-attached DNAs were denatured with NaOH, and
sequencing primers were annealed. A two-region 454
sequencing run was performed on a 70 × 75 GS
PicoTiterPlate using a Genome Sequencer FLX System
(Roche, Nutley, NJ, USA). Following sequencing, all
failed sequence reads, low quality sequence ends (Avg
Q25), short reads < 150 bp (final mean length 412 bp)
and tags and primers were removed. Sequence collec-
tions were then depleted of any non-bacterial sequences,
sequences with ambiguous base calls, sequences with
homopolymers > 5 bp in length, and chimeras as previ-
ously described (Bailey et al. 2010; Callaway et al.
2010; Capone et al. 2011; Handl et al. 2011). To deter-
mine the predicted identity of microorganisms in the
remaining sequences, they were de-noised, de-replicated,
and OTU clustering was performed using uClust
(www.drive5.com). Sequences were then queried using
BLASTn against a highly curated custom database of
high quality 16s bacterial sequences derived and manu-
ally curated from NCBI. Using a NET analysis pipeline,
the resulting BLASTn outputs were compiled and data
reduction analysis was performed as described previously
(Bailey et al. 2010; Callaway et al. 2010; Handl et al.
2011; Capone et al. 2011). Bacteria were classified at the
closest well-characterized genus. Rarefaction analysis
was conducted using QIIME (Caporaso et al. 2010).
Sequences were de-noised and chimeras removed using
UCHIME (Edgar et al. 2011). Sequences < 250 bp were
removed and sequences > 250 bp were trimmed to 250
bp. Sequences were then normalized to 1,200 bp and 10
iterations of rarefaction were performed to evaluate the
number of species present.
Measurements of antibacterial activity on surfaces
To determine the ability of S. aureus (strain ATCC6538P)
to colonize different engineered car surfaces, the
procedure outlined in the Japanese International Standard
338 R.E. Stephenson et al.

for Measurement of antibacterial activity on plastic sur-
faces, JIS Z 2801, was utilized. Briefly, two surfaces were
examined: a polycarbonate/ABS (Sabic Cycoloy
MC8002, Ford Motor Company, Dearborn, MI, USA)
hard plastic surface with the same formulation used to
mold many interior car parts and a soft polyurethane foam
surface used to cover steering wheels. The PC/ABS sub-
strata were coated with a black, two-component, solvent
borne urethane coating (Product 318LE/303LE, Red Spot
Paint, Evansville, IN, USA) designed for interior automo-
tive trim. The polyurethane foam substrates were coated
with a 1-component waterborne coating (Red Spot Paint,
product 458 W) using an in-mold process typically used
for automotive steering wheels. In addition to a control
formulation of each of the above coatings, which con-
tained no antimicrobial additives, four formulations of
each coating were prepared with the addition of antimicro-
bial additives to the liquid coatings described above (458
W and 318LE/303LE). These coatings contained: 3%
Agion silver ion (Sciessent, Wakefield, MA, USA), 5%
Agion silver ion, 1% micronized polyolefin wax coated
with nanosilver (Deurex MXAg 9,520, Deurex AG, Ger-
many), and 4% silane quaternary ammonium salt (Biosafe
HM4100, Biosafe, Pittsburgh, PA, USA). Each formula-
tion was sprayed on the respective substratum at a thick-
ness of ~25 μm. After coating, the panels were cut into
50 × 50 mm squares and sterilized by submerging in 70%
EtOH. S. aureus test inoculum of 6 × 10
5
was generated
by suspending bacteria in dilute nutrient broth (1:500) and
400 μl of the suspension were placed on the plastic sur-
faces that were placed in the Petri dish. The surfaces were
covered with a sterile piece of stomacher bag (40 × 40
mm) that spread the inoculum evenly over the surface.
Samples were incubated at 35°C at a relative humidity >
90% for 24 h. Bacteria were recovered from the plastic
surfaces by adding 10 ml of SCDLP broth (17 g l
−1
casein
peptone, 3 g l
−1
soybean peptone, 5 g l
−1
NaCl, 2.5 g l
−1
Na
2
HPO
4
, 2.5 g l
−1
glucose, 1 g l
−1
lecithin, 7 g l
−1
poly-
oxyethylene sorbitan monooleate) to the plastic surface
and vigorously pipetting up and down to remove attached
bacteria. The number of viable colony-forming units
(CFUs) remaining on the surfaces was determined by plat-
ing serial dilutions in nutrient agar, incubating for 48 h at
35°C and counting colonies.
To assess the long-term efficacy of the coatings
formulated to resist microbial colonization, some coated
materials were aged via an artificial accelerated weather-
ing protocol, SAE J2412. During the test, surface
specimen exposures were monitored based on measured
light at 1.06 W m
–2
(@ 420 nm) using a lamp and filter
combination that closely mimics the wavelength distribu-
tion of light transmitted through automotive glass. Speci-
mens were cycled between a 1 h dark cycle at 38°C and
95% humidity and a 3 h light cycle at 70°C and 50%
humidity. Surface specimens were removed after expo-
sures of 2,500 kJ m
–2
and 5,000 kJ m
–2
for evaluation.
Antimicrobial susceptibility testing
All S. aureus isolates were tested for susceptibility to the
antimicrobials listed in Table 3using the Clinical and
Lab Standards Institute broth microdilution method
(Bou 2007). Mueller–Hinton broth was purchased from
BDD and MIC plates were incubated at 35°C for 24 h.
S. aureus strains ATCC 25,923 and ATCC 29,213 were
utilized as control strains for each antimicrobial suscepti-
bility assay.
Statistical analyses
Statistical analyses were performed using a 1-way analysis
of variance (ANOVA). Results are expressed as mean ±
standard error (SE) of the mean, unless otherwise indicated.
Results
Relative abundance of colony-forming units at interior
car locations
To gain insight into relative abundance of bacterial colo-
nization in different areas of car interiors which might
serve as fomites, locations that were reasoned to come
into frequent contact with the driver were swabbed (indi-
cated in Figure 1A). A total of 18 cars from the Ford
Motor Company employee fleet were swabbed. Analysis
of colony-forming units (CFUs) from each site revealed
that each swabbed location had culturable bacteria pres-
ent and that there was significant variation in total CFUs
in each location from car to car (Figure 1B). However,
by this analysis, the most highly colonized locations with
over 100 culturable CFUs per 6.5 cm
2
surface area were
areas of frequent touching by the occupants, including
locations on the steering wheel (A, K), the gear shifter
(C), door handles and window switches (E, G), and the
center console near the beverage holder (D).
Culture independent analysis of bacteria in car
interiors
To gain insight into the types of bacteria present on
highly colonized areas culture independent analysis was
conducted. Steering wheels (A), gear shifters (C), and
the center console (D) were swabbed in five cars (car
numbers: 19, 21, 22, 23, 24) and extracted DNA was
subjected to bTEFAP FLX massively parallel pyrose-
quencing. Each sampled site possessed a unique bacterial
community at the genus level (Table 1). The most domi-
nant bacterial genera that were present at all sampled
sites were Staphylococcus and Propionibacterium.
Biofouling 339

Genus-level differences extended to the level of bac-
terial class and upon averaging across samples from the
five cars, 38.3% of the sequences derived from bTEFAP
were members of the class Bacilli (car 19: 52.1%, car
21: 56.0%, car 22: 55.9%, car 23: 7.4%, car 24: 20.3%);
21.4% were members of the class Actinobacteria (car 19:
28.5%, car 21: 10%, car 22: 15.9%, car 23: 25.1%, car
24: 27.2%), 10.9% were Gammaproteobacteria (car 19:
A
B
Figure 1. Analysis of CFUs present at different car interior locations. (A) Image of a typical car interior with swab sampling sites
labels. Swabs of 6.5 × 6.5 cm area were collected from (A) steering wheel, (B) radio volume knob, (C) gear shifter, (D) center
console, (E) door latch, (F) door lock, (G) door lock control, (H) door handle, (I) window control, (J) cruise control button, and (K)
interior steering wheel. (B) Number of CFUs isolated from swab locations A–K from 18 different cars. ns = not sampled.
340 R.E. Stephenson et al.

3.2%, car 21: 4.1%, car 22: 8.5%, car 23: 38.7%, car 24:
7.5%); 9.47% were Betaproteobacteria (car 19: 3.3%, car
21: 12.7%, car 22: 5.6%, car 23: 8.2%, car 24: 17.8%);
6.8% were Alphaproteobacteria (car 19: 4.1%, car 21:
2.5%, car 22: 7.2%, car 23: 12.1%, car 24: 8.2%), and
5.6% were Clostridia (car 19: 1.9%, car 21: 8.9%, car
22: 3.1%, car 23: 5.3%, car 24: 9.1%). The remaining
7.5% comprised 10 other bacterial classes.
Staphylococcus species present in car interiors
Because the genus Staphylococcus was determined to be
a dominant member of the car interior microbiome and
many staphylococcal species have the potential to be
dangerous opportunistic pathogens, the identity of the
staphylococcal species present was determined. Isolates
that grew on nutrient agar and blood agar plates for the
culture-dependent CFU analysis (Figure 1B) were
patched onto mannitol salt agar, which is a selective
medium for members of the Staphylococcus genus. DNA
was isolated from 87 patched colonies that grew on man-
nitol salt agar, 16s rRNA DNA was amplified and
sequenced, and the resulting sequences were analyzed to
determine Staphylococcus species (Table 2). Staphylococ-
cus epidermidis,S. aureus, and S. warneii were found to
be the most frequently isolated staphylococci, making up
87% of the staphylococcal isolates (representing 43, 31,
and 13% respectively).
Antimicrobial susceptibility patterns of S. aureus
isolates
The ability to withstand antibiotic treatment is one of the
reasons S. aureus is a prominent and dangerous
Table 1. Estimated relative abundance of bacterial genera (%) from swabs of the indicated car locations as determined by bTEFAP.
Genus 19A 19C 19D 21C 21D 22C 22D 23A 23C 23D 24A 24C 24D
Staphylococcus 77.1 74.1 10.2 19.1 3.32 14.0 63.7 12.5 10.5 1.05 19.7 29.2 28.2
Propionibacterium 9.72 17.5 3.5 7.44 0.50 6.04 2.75 22.6 8.53 .06 21.3 17.4 0.08
Pantoea 1.21 0 0 0 0.07 0 0 5.01 0 98.2 0 0 0
Exiguobacterium 0 0 0 0 91.8 0 0 0 .03 0 0 0 0
Acidovorax 1.23 0.17 6.55 3.41 0 9.22 0.02 7.55 3.75 0 11.5 2.96 23.5
Streptococcus 1.02 0.07 4.17 7.30 0 12.5 5.49 5.80 0 0.06 9.93 13.2 5.15
Clostridium 0.15 1.16 0 14.3 0 3.00 0.11 0.23 13.1 0.03 1.79 5.67 1.93
Mycobacterium 0.22 0.01 0.39 0 0 0.09 0.12 0 38.0 .05 0 0 0.13
Massilia 0 0 0 14.3 0.04 1.83 0 0 0 0.04 0.45 0 8.45
Acinetobacter 0.64 1.32 0.57 1.00 0 2.61 0 1.66 0.21 0.01 9.06 1.48 3.22
Micromonospora 0.05 0 19.0 0 0.03 0 0.24 0.07 0 0 0 0 0
Sphingomonas 0 0 5.89 0 0.05 4.99 0 0 1.72 0.02 3.02 0 2.92
Corynebacterium 0.61 0 0 2.49 0 0.19 0 4.03 0 0 7.06 6.89 1.42
Dehalococcoides 0.07 0 10.4 0 0 0 0 5.71 0 0 0 0 0
Brevundimonas 0 0 0 0 0 0 0 12.5 0 0 0 0 0
Gemella 0.01 0 0 0 0 7.10 0.24 0 0 0.01 0 5.21 0
Trichococcus 0 0 0 0 0 12.1 0 0 0 0 0 0 0
Pseudomonas 0 1.02 0.03 3.20 0.08 2.18 0.68 1.79 0.02 0 0.05 0 5.66
Knoellia 0.01 0 11.3 0 0.01 0 0 0 0 0 0 0 0
Maricaulis 0 0 0 0 0 0 0 10.7 0 0 0 0 0
Geitlerinema 1.78 0.11 0 5.76 0.02 0.31 0 0 0 0.03 0.02 2.34 0.34
Microbacterium 0 0 0 0 1.10 0 7.54 0 0 0.04 0 0 1.80
Micrococcus 0.03 0 0 17.3 0.13 0.31 7.87 0.03 0 0 0.77 0.82 0
Ewingella 0 0 0 0 0 0 0 2.03 9.29 0 0 0 0
Bacillus 0 0 0 2.32 0.07 5.23 3.07 0.06 0 0 7.13 7.35 0
Roseomonas 0.43 0 0 0 0.44 0 0 0 0 0 0 0 7.93
Xylanimicrobium 0.58 0.02 7.47 0 0 0 0 0 0 0 0 0 0
Kineococcus 1.65 0.02 7.18 0 0.07 0 0 0 0 0 0 0 0
Thermomonas 0 0 7.58 0 0 0 0 0 0 0 0 0 0
Veillonella 0.01 0 0 0 0 0 0 0 0 0 0.15 1.22 5.75
Ralstonia 0 0 0.86 0 0 0 0 1.26 5.53 0 0 0 0.60
Solimonas 0 0 0 0 0 6.90 0 0 0 0 0 0 0
Comamonas 0.03 0.04 0.07 0.03 0 1.37 0.02 2.03 0.29 0 0.98 0.15 1.72
Streptomyces 0 0 0 0.20 0.13 0 0.93 1.11 0.31 0.03 4.99 0 0
Stenotrophomons 0 0 0 0 0 4.25 0 0 1.88 0.01 0.01 0.22 0.15
Janibacter 0 1.03 0 0 0.09 2.77 3.42 0 0 0 0 0 0
Other genera 3.51 3.43 4.84 1.85 2.05 3.01 3.92 3.33 6.84 0.36 2.09 5.86 1.05
Note: 19, 21, 22, 23, 24 are car identifiers and locations are A –steering wheel, C –gear shift knob, D –area near cup holder (see Figure 1A).The rel-
ative percentage of sequences assigned to a given taxonomic classification (genera) for each individual sample is arranged from highest to lowest
across samples. The 36 most abundant genera are shown and the remaining that were at low levels are grouped as together as ‘other genera’.
Biofouling 341

pathogen. Of particular concern is methicillin-resistant
S. aureus (MRSA), which has become a major
nosocomial and community pathogen. S. aureus strains
that are methicillin resistant have a mecA gene that
encodes for a unique penicillin-binding protein that has
decreased affinity for β-lactam antibiotics (Lambert
2005). To determine the prevalence of MRSA isolates
from car interiors, the steering wheels of 30 community-
shared cars (Zipcars) were swabbed and streaked onto
mannitol salt agar. Colonies that grew and were able to
ferment mannitol were confirmed to be S. aureus by 16s
rRNA amplification and sequencing. On average, at least
five S. aureus isolates (155 total) from each of the 30
cars was tested for methicillin resistance by plating cul-
ture dilutions onto tryptic soy agar containing 10 μgml
−1
methicillin. Of the 155 isolates tested, 35 (22.6%) were
found to be methicillin resistant and these isolates were
confirmed as mecA positive by PCR. Isolates (35 MRSA
and 120 MSSA) were also tested for susceptibility to
other clinically relevant antibiotics (Table 3). All MSSA
isolates were sensitive to oxacillin, gentamicin, levoflox-
acin, rifampin, and vancomycin. In addition most were
sensitive to tetracycline (98%) and erythromycin (78%),
but only 9% were sensitive to penicillin. The 35 MRSA isolates were all sensitive to gentamicin, rifampin, and
vancomycin, and 94% were sensitive to tetracycline.
Table 2. Staphylococcal species present at different swab locations. Ratio indicates number of positive samples per Staphylococcus
organism isolated at the site.
Swab
location
S.
aureus
S.
epidermidis
S.
caprae
S.
sciuri
S.
capitis
S.
cohnii
S.
saprophyticus
S.
xylosus
S.
warneii
S.
hominis
S.
haemolyticus
A 8/18 9/18 0/18 0/18 0/18 0/18 0/18 0/18 1/18 0/18 0/18
B 2/9 5/9 1/9 0/9 0/9 0/9 0/9 0/9 1/9 0/9 0/9
C 6/15 6/15 0/15 0/15 0/15 0/15 0/15 0/15 1/15 1/15 1/15
D 5/18 10/18 0/18 0/18 0/18 0/18 0/18 0/18 3/18 0/18 0/18
E 2/9 4/9 1/9 0/9 0/9 0/9 0/9 0/9 1/9 0/9 1/9
J 2/10 3/10 0/10 0/10 1/10 0/10 0/10 0/10 4/10 0/10 0/10
K 2/8 1/8 0/8 1/8 1/8 1/8 1/8 1/8 0/8 0/8 0/8
A–K 27/87 38/87 2/87 1/87 2/87 1/87 1/87 1/87 11/87 1/87 2/87
Table 3. Antimicrobial susceptibility profiles for methicillin
sensitive (MSSA) and methicillin resistant (MRSA) S. aureus
isolates collected from shared cars.
Number of susceptible isolates
(%) among
Antimicrobial
MSSA
(n= 120)
MRSA
(n= 35)
Penicillin 11 (9.1) 0 (0)
Oxacillin 120 (100) 0 (0)
Erythromycin 94 (78.3) 8 (22.8)
Gentamicin 120 (100) 35 (100)
Levofloxacin 120 (100) 12 (34.3)
Rifampin 120 (100) 35 (100)
Tetracycline 118 (98.3) 33 (94.3)
Vancomycin 120 (100) 35 (100)
B
A
Figure 2. Analysis of car interior plastics treated with antimi-
crobial formulations for the ability to resist S. aureus surface
colonization. Hard plastic surfaces (A) or soft plastic surfaces
(B) that were either untreated (control) or sprayed with the indi-
cated antimicrobial formulations were exposed to 6 × 10
5
CFUs
of S. aureus and the number of CFUs present after 24 h was
determined. Error bars show the SE of the mean; *p< 0.005 vs
24 h control.
342 R.E. Stephenson et al.

Susceptibility to levofloxacin and erythromycin was 34%
and 22% respectively, and as expected all were resistant
to the β-lactams penicillin and oxacillin.
Analysis of antimicrobial surfaces for S. aureus
colonization
Considering that antibiotic resistant S. aureus was
frequently found in car interiors and this environment
might serve as a fomite that could lead to increased colo-
nization of occupants, strategies to reduce or eliminate
S. aureus colonization were investigated. Since most
interior touch surfaces are painted to enhance the compo-
nent’s appearance or feel, antimicrobial additives were
added to the typical coating formulations to assess the
efficacy in inhibiting microbial colonization (Figure 2).
Both steering wheel grip (soft) and center trim (hard)
coating formulations were assessed for the ability to
resist S. aureus colonization. Four automotive paint
formulations containing commercially available
antimicrobial additives (3% silver ion, 5% silver ion, 1%
nanosilver coated micronized wax, and 4% silane quater-
nary ammonium salt) were used to coat both hard and
soft surfaces and all of these significantly reduced the
ability of S. aureus to colonize the surface over a 24 h
time period (Figure 2A and 2B). To test the durability of
these antimicrobial coated surfaces, they were exposed to
an artificial weathering process that mimics exposures
A
B
Figure 3. Analysis of artificially weathered car interior plastics
treated with antimicrobial formulations for the ability to resist S.
aureus surface colonization. Hard plastic surfaces (A) or soft
plastic surfaces (B) that were either untreated (control) or
sprayed with indicated antimicrobial formulations were artifi-
cially weathered then incubated with upto 6 × 10
5
CFUs S. aur-
eus. The number of CFUs present after 24 h was determined.
Black bars are unweathered surfaces, gray bars were exposed to
2,500 kJ m
–2
, and white bars were exposed to 5,000 kJ m
–2
. Error
bars the SE of the mean; *p< 0.005 vs the comparable 24 h
control.
B
A
Figure 4. Analysis of CFUs present on production steering
wheels vs silver treated steering wheels. (A) Locations of swab-
bing at hard trim piece locations (T1–3) or soft exterior loca-
tions (S1–5). (B) Number of CFUs isolated from swab
locations from trim (T) or exterior steering wheel locations (S)
from production (Pro) vs silver coated (Ag) steering wheels.
*p< 0.005 vs the comparable production piece; **p< 0.05 vs
the comparable production piece.
Biofouling 343

likely to occur inside an automobile (UV light, heat, and
humidity conditions common to car interiors). The 1%
nanosilver (Deurex) and 4% silane quaternary ammo-
nium salt (Biosafe) treated surfaces lost anti-S. aureus
colonization properties after artificial weathering,
whereas the silver ion treated surfaces retained the ability
to resist colonization (Figure 3).
Analysis of antimicrobial surfaces in cars
Next 5% Agion silver ion treated surfaces were exam-
ined to determine whether they would reduce pathogen
colonization when placed in automobiles. The steering
wheels of five cars from the Ford Motor Company
motor fleet which are driven daily were swabbed at
hard trim piece locations (T
1–3
) or soft exterior loca-
tions (S
1–5
) on standard production steering wheels
(Figure 4A). Swabs of the non-silver treated produc-
tion steering wheel locations were plated on nutrient
agar and TSA blood agar to determine total CFUs per
location (Figure 4B,T
Pro
&S
Pro
). Swabs were also
plated onto mannitol agar and S. aureus and S. epide-
rmidis were confirmed to be found on every produc-
tion steering wheel by 16s rRNA analysis. After
swabbing, the production steering wheel was removed
and replaced with a 5% silver ion treated steering
wheel. Five months later the steering wheel was
swabbed at the same locations and CFUs were deter-
mined (Figure 4B,T
Ag
&S
Ag
). All swabs from the
silver treated steering wheels had significantly fewer
CFUs. 16s rRNA analysis of the colonies that came
from swabbed silver treated steering wheels revealed
all of the isolates were members of the Bacillus genus
(B. subtillis,B. sphaericus,B. firmus,B. megaterium,
B. simplex).
Discussion
Despite the fact that humans spend a significant amount
of time inside automobiles, very little is known about
the microbial ecology of car interiors and how this might
impact the occupant’s microbiome. In this study,
bacterial communities of frequently touched car interior
surfaces were enumerated and analyzed. These results
indicate that the most highly colonized locations were
areas that would be suspected to have frequent touching
by the occupants, including locations on the steering
wheel, the gear shifter, door handles and window
switches, and the center console near the beverage holder
(Figure 1). The bacterial communities of steering wheels,
gear shifters, and the center console were analyzed by
culture independent pyrosequencing and though this
revealed novel populations at each site, two genera, viz.
–Staphylococcus and Propionibacterium were the
dominant members at most sites. Members of these
genera commonly colonize human skin, which suggests
the prevalent genera which are able to persist on car
interior surfaces are deposited there by skin to surface
contact.
Because several members of the staphylococcal
genus are important human pathogens, the species
present were determined and it was found that the most
prevalent were S. epidermidis (43%), S. aureus (31%),
and S. warneii (13%) (Table 2). A relatively high
percentage (22.6%) of methicillin resistant S. aureus was
also isolated from shared community driven cars
(Table 3).
This analysis suggests that car interiors may be
important environmental reservoirs that are capable of
harboring antibiotic resistant S. aureus. This is of
potential interest because colonization by S. aureus
significantly increases the likelihood of a person devel-
oping several types of infections (Stenehjem & Rimland
2013). S. aureus can readily be transferred from fomites
to people. Colonized individuals can shed the organism
into the environment, contaminating surfaces, which
would allow for transfer to other individuals. S. aureus
infection is notable for its ability to repeatedly infect
patients, especially at sites involving the skin (Kaplan
2005; Crum et al. 2006) and there are indications that
transmission among household members is common (Be-
gier et al. 2004; Miller & Diep 2008). Therefore, limit-
ing skin exposures via fomites may be one useful
strategy to reduce infection and spread in these scenar-
ios.
In order to explore strategies that limit colonization
by pathogenic microbes, plastics used in the production
of car interiors were coated with antimicrobial silver
formulations and tested for their ability to resist coloni-
zation by S. aureus. All silver treated surfaces displayed
the ability to resist S. aureus colonization. However
exposure to artificial weathering revealed that some trea-
ted surfaces (Agion) retained anti-colonization properties,
while others lost the ability to resist colonization (Deurex
MXAg9510 and Biosafe). It is unclear why weathering
caused these differences.
Finally the ability of 5% Agion silver ion treated
surfaces in the form of steering wheels and trim within
steering wheels was examined for the ability to resist
pathogen colonization when placed inside cars. Initial
swabbing of non-antimicrobial production steering
wheels revealed relatively high levels of bacteria coloni-
zation by CFU analysis and the presence of S. aureus
and S. epidermidis on each steering wheel. These pro-
duction steering wheels were replaced with steering
wheels that had been treated with 5% Agion, and five
months later swabbing revealed significantly fewer CFUs
and the absence of all staphylococcal species. The only
culturable microbes present on these surfaces were mem-
bers of the spore-forming Bacillus genus.
344 R.E. Stephenson et al.

Overall these results suggest bacteria present on
frequently touched car interior surfaces likely originate
from human skin. The deposit of some of these microbes
on car interiors could have undesired consequences. For
example, many skin microbes have the capacity to
produce unpleasant odors (Dumas et al. 2009; Ara et al.
2013). Others, such as S. aureus, have the capacity to
render more serious consequences and could potentially
be a threat to human health. In addition, the presence of
drug resistant S. aureus in cars used by multiple people
could lead to the dissemination of this pathogen.
Environmental sources of S. aureus are clearly not iso-
lated to cars. In hospitals, MRSA is frequently isolated
from nurse workstations, bed spaces, pagers, and stetho-
scopes (Smith 1996; Singh et al. 2002; Hardy et al. 2006).
Measures to control MRSA in these environments have
likely contributed to limiting MRSA infections (Vriens
et al. 2002; Meek 2004) and this success lends credence to
the notion that environmental sources are an important
component of MRSA pathogenesis. It is possible that strat-
egies to reduce S. aureus car interior colonization, like
those examined here, could reduce transmission, coloniza-
tion and infection by this dangerous pathogen. It is pro-
posed that individuals experiencing frequent S. aureus
skin infections or those concerned about S. aureus carrier
status consider the surfaces of car interiors as potential
reservoirs for S. aureus.
Acknowledgments
This work was supported by a grant to BRB from Ford Motor
Company. The authors would like to thank Jeff Scheu (Red
Spot Paint) and Janice Gould (Red Spot Paint) for coordinating
the development and formulation of antimicrobial coatings
including preparation of all painted test plaques.
References
Amend AS, Seifert KA, Samson R, Bruns TD. 2010. Indoor
fungal composition is geographically patterned and more
diverse in temperate zones than in the tropics. Proc Nat
Acad Sci. 107:13748–13753.
Ara K, Hama M, Akiba S, Koike K, Okisaka K, Hagura T,
Kamiya T, Tomita F. 2013. Foot odor due to microbial
metabolism and its control. Can J Microbiol.
52:357–364.
Bailey MT, Dowd SE, Parry NMA, Galley JD, Schauer DB,
Lyte M. 2010. Stressor exposure disrupts commensal
microbial populations in the intestines and leads to
increased colonization by Citrobacter rodentium. Infect
Immun. 78:1509–1519.
Begier EM, Frenette K, Barrett NL, Mshar P, Petit S, Boxrud
DJ, Watkins-Colwell K, Wheeler S, Cebelinski EA, Glen-
nen A, et al. 2004. A high-morbidity outbreak of methicil-
lin-resistant Staphylococcus aureus among players on a
college football team, facilitated by cosmetic body shaving
and turf burns. Clin Infect Dis. 39:1446–1453.
Bou G. 2007. Minimum Inhibitory Concentration (MIC) analy-
sis and susceptibility testing of MRSA. linkspringercom.
vol 391. Totowa, NJ: Humana Press; p. 29–49.
Callaway TR, Dowd SE, Edrington TS, Anderson RC, Krueger
N, Bauer N, Kononoff PJ, Nisbet DJ. 2010. Evaluation of
bacterial diversity in the rumen and feces of cattle fed
different levels of dried distillers grains plus solubles using
bacterial tag-encoded FLX amplicon pyrosequencing. J
Anim Sci. 88:3977–3983.
Capone KA, Dowd SE, Stamatas GN, Nikolovski J. 2011.
Diversity of the human skin microbiome early in life. J
Invest Dermatol. 131:2026–2032.
Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman
FD, Costello EK, Fierer N, Peña AG, Goodrich JK,
Gordon JI, et al. 2010. QIIME allows analysis of
high-throughput community sequencing data. Nat Meth.
7:335–336.
Crum NF, Lee RU, Thornton SA, Stine OC, Wallace MR,
Barrozo C, Keefer-Norris A, Judd S, Russell KL. 2006.
Fifteen-year study of the changing epidemiology of
methicillin-resistant Staphylococcus aureus. Am J Med.
119:943–951.
Dumas ER, Michaud AE, Bergeron C, Lafrance JL, Mortillo S,
Gafner S. 2009. Deodorant effects of a supercritical hops
extract: antibacterial activity against Corynebacterium
xerosis and Staphylococcus epidermidis and efficacy testing
of a hops/zinc ricinoleate stick in humans through the
sensory evaluation of axillary deodorancy. J Cosmet
Dermatol. 8:197–204.
Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R. 2011.
UCHIME improves sensitivity and speed of chimera
detection. Bioinformatics. 27:2194–2200.
Foster TJ. 2009. Colonization and infection of the human host
by staphylococci: adhesion, survival and immune evasion.
Vet Dermatol. 20:456–470.
Grice EA, Segre JA. 2011. The skin microbiome. Nat Rev
Microbiol. 9:244–253.
Handl S, Dowd SE, Garcia-Mazcorro JF, Steiner JM,
Suchodolski JS. 2011. Massive parallel 16S rRNA gene
pyrosequencing reveals highly diverse fecal bacterial and
fungal communities in healthy dogs and cats. FEMS Micro-
biol Ecol. 76:301–310.
Hardy KJ, Oppenheim BA, Gossain S, Gao F, Hawkey PM.
2006. Relationship between environmental contamination
with methicillin‐resistant Staphylococcus aureus (MRSA)
and patients’acquisition of MRSA. Infect Control Hosp
Epidemiol. 27:127–132.
Kaplan SL. 2005. Treatment of community-associated
methicillin-resistant Staphylococcus aureus infections.
Pediatr Infect Dis J. 24:457.
Kassem II. 2011. Chinks in the armor: the role of the nonclini-
cal environment in the transmission of Staphylococcus bac-
teria. Am J Infect Control. 39:539–541.
Kembel SW, Jones E, Kline J, Northcutt D, Stenson J,
Womack AM, Bohannan BJ, Brown GZ, Green JL. 2012.
Architectural design influences the diversity and structure
of the built environment microbiome. ISME J.
6:1469–1479.
Klepeis NE, Nelson KE, Ott WR, Robinson J, Tsang AM,
Switzer P, Behar JV, Hern SC, Engelmann S. 2001. The
National Human Activity Pattern Survey (NHAPS): a
resource for assessing exposure to environmental pollutants.
J Expo Anal Environ Epidemiol. 11:231–252.
Klevens RM, Morrison MA, Nadle J, Petit S, Gershman K,
Ray S, Harrison LH, Lynfield R, Dumyati G, Townes JM,
et al. 2007. Invasive methicillin-resistant Staphylococcus
aureus infections in the United States. JAMA.
298:1763–1771.
Biofouling 345

Lambert P. 2005. Bacterial resistance to antibiotics: modified tar-
get sites. Advanced Drug Delivery Reviews. 57:1471–1485.
Lowy FD. 1998. Staphylococcus aureus infections. N Engl J
Med. 339:520–532.
Martiny JBH, Bohannan BJM, Brown JH, Colwell RK,
Fuhrman JA, Green JL, Horner-Devine MC, Kane M,
Krumins JA, Kuske CR, et al. 2006. Microbial biogeogra-
phy: putting microorganisms on the map. Nature Rev
Microbiol. 4:102–112.
Meek C. 2004. Isolate patients, screen staff to fight MRSA.
Can Med Assoc J. 171:1158–1158.
Miller LG, Diep BA. 2008. Colonization, fomites, and viru-
lence: rethinking the pathogenesis of community-associated
methicillin-resistant Staphylococcus aureus infection. Clin
Infect Dis. 46:752–760.
Otto M. 2012. MRSA virulence and spread. Cell Microbiol.
14:1513–1521.
Pakarinen J, Hyvärinen A, Salkinoja-Salonen M, Laitinen S,
Nevalainen A, Mäkelä MJ, Haahtela T, von Hertzen L.
2008. Predominance of Gram-positive bacteria in house
dust in the low-allergy risk Russian Karelia. Environ
Microbiol. 10:3317–3325.
Payne DE, Martin NR, Parzych KR, Rickard AH, Underwood
A, Boles BR. 2013. Tannic acid inhibits Staphylococcus
aureus surface colonization in an IsaA-dependent manner.
Infect Immun. 81:496–504.
Pynnonen M, Stephenson RE, Schwartz K, Hernandez M,
Boles BR. 2011. Hemoglobin promotes Staphylococcus
aureus nasal colonization. PLoS Pathog. 7:e1002104.
Rintala H, Pitkaranta M, Toivola M, Paulin L, Nevalainen
A. 2008. Diversity and seasonal dynamics of bacterial
community in indoor environment. BMC Microbiol.
8:56.
Safdar N, Bradley EA. 2008. The risk of infection after nasal
colonization with Staphylococcus aureus. Am J Med.
121:310–315.
Singh D, Kaur H, Gardner WG, Treen LB. 2002. Bacterial con-
tamination of hospital pagers. Infect Control Hosp
Epidemiol. 23:274–276.
Smith MA. 1996. Contaminated stethoscopes revisited. Arch
Intern Med. 156:82.
Stenehjem E, Rimland D. 2013. MRSA nasal colonization
burden and risk of MRSA infection. Am J Infect Control.
41:405–410.
Tringe SG, Zhang T, Liu X, Yu Y, Lee WH, Yap J, Yao F,
Suan ST, Ing SK, Haynes M, et al. 2008. The airborne
metagenome in an indoor urban environment. PLoS ONE.
3:e1862.
Vornhagen J, Stevens M, McCormick DW, Dowd SE,
Eisenberg JNS, Boles BR, Rickard AH. 2013.
Coaggregation occurs amongst bacteria within and
between biofilms in domestic showerheads. Biofouling.
29:53–68.
Vriens M, Blok H, Fluit A, Troelstra A, Werken CVD, Verhoef
J. 2002. Costs associated with a strict policy to eradicate
methicillin-resistant Staphylococcus aureus in a Dutch Uni-
versity Medical Center: a 10-year survey. Eur J Clin Micro-
biol. 21:782–786.
346 R.E. Stephenson et al.