Significant role of PB1 and UBA domains in multimerization of Joka2, a selective autophagy cargo receptor from tobacco

Abstract

Tobacco Joka2 protein is a hybrid homolog of two mammalian selective autophagy cargo receptors, p62 and NBR1. These proteins can directly interact with the members of ATG8 family and the polyubiquitinated cargoes designed for degradation. Function of the selective autophagy cargo receptors relies on their ability to form protein aggregates. It has been shown that the N-terminal PB1 domain of p62 is involved in formation of aggregates, while the UBA domains of p62 and NBR1 have been associated mainly with cargo binding. Here we focus on roles of PB1 and UBA domains in localization and aggregation of Joka2 in plant cells. We show that Joka2 can homodimerize not only through its N-terminal PB1-PB1 interactions but also via interaction between N-terminal PB1 and C-terminal UBA domains. We also demonstrate that Joka2 co-localizes with recombinant ubiquitin and sequestrates it into aggregates and that C-terminal part (containing UBA domains) is sufficient for this effect. Our results indicate that Joka2 accumulates in cytoplasmic aggregates and suggest that in addition to these multimeric forms it also exists in the nucleus and cytoplasm in a monomeric form.

Full text

ORIGINAL RESEARCH ARTICLE
published: 31 January 2014
doi: 10.3389/fpls.2014.00013
Significant role of PB1 and UBA domains in
multimerization of Joka2, a selective autophagy
cargo receptor from tobacco
Katarzyna Zientara-Rytter and Agnieszka Sirko*
Department of Plant Biochemistry, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland
Edited by:
Diane C. Bassham, Iowa State
University, USA
Reviewed by:
Gian P. Di Sansebastiano, Università
del Salento, Italy
Georgia Drakakaki, University of
California Davis, USA
*Correspondence:
Agnieszka Sirko, Department of
Plant Biochemistry, Institute of
Biochemistry and Biophysics,
Polish Academy of Sciences, ul.
Pawinskiego 5A, 02-106 Warsaw,
Poland
e-mail: asirko@ibb.waw.pl
Tobacco Joka2 protein is a hybrid homolog of two mammalian selective autophagy cargo
receptors, p62 and NBR1. These proteins can directly interact with the members of
ATG8 family and the polyubiquitinated cargoes designed for degradation. Function of the
selective autophagy cargo receptors relies on their ability to form protein aggregates. It has
been shown that the N-terminal PB1 domain of p62 is involved in formation of aggregates,
while the UBA domains of p62 and NBR1 have been associated mainly with cargo binding.
Here we focus on roles of PB1 and UBA domains in localization and aggregation of Joka2
in plant cells. We show that Joka2 can homodimerize not only through its N-terminal
PB1-PB1 interactions but also via interaction between N-terminal PB1 and C-terminal
UBA domains. We also demonstrate that Joka2 co-localizes with recombinant ubiquitin
and sequestrates it into aggregates and that C-terminal part (containing UBA domains)
is sufficient for this effect. Our results indicate that Joka2 accumulates in cytoplasmic
aggregates and suggest that in addition to these multimeric forms it also exists in the
nucleus and cytoplasm in a monomeric form.
Keywords: Joka2, PB1, UBA, autophagy, proteasome, ubiquitin, selective autophagy cargo receptor, NBR1
INTRODUCTION
Autophagy is a highly evolutionary conserved process among all
eukaryotic organisms. It is responsible for degradation of cellular
components in ubiquitin-proteasome system (UPS) independent
manner (Yoshimori, 2004). The cellular components could be
degraded by autophagy in unselective or selective manner. In
the latter case the specific proteins, so called selective autophagy
receptors, capable of the selective recognition of the cargos are
needed (Weidberg et al., 2011). Soluble proteins, protein aggre-
gates, or other cellular components assigned for degradation in
the selective manner are usually marked by a polyubiquitin tail
(Hershko and Ciechanover, 1998) which is recognized by the
selective autophagy cargo receptors as a signal for degradation
(Wilkinson et al., 2001). The selective autophagy cargo receptors
control selectivity of autophagy flux. Similarly to other proteins
involved in signaling and regulatory pathways they have mod-
ular domains responsible for specific interactions with variety
of proteins (Pawson and Nash, 2003). Such form of regulation
guarantees interconnections with the wide range of pathways and
provides exact control of the appropriate process.
Both the N-terminal PB1 (Phox and Bem1) domains and
the C-terminal UBA (ubiquitin associated) domains of p62 and
NBR1 as well as of their homologs from animals, fungi, and plants
are recognized as modules mediating protein-protein interaction
(Geetha and Wooten, 2002; Kirkin et al., 2009a,b). Interestingly,
p62 contains only one UBA domain, while NBR1 and plant
selective autophagy cargo receptors, such as tobacco Joka2 and
Arabidopsis AtNBR1 have two non-identical UBA domains. The
animal proteins contain JUBA and UBA, while the plant proteins
contain UBA1 and UBA2 domains. It has been shown that only
UBA2 of AtNBR1 (NBR1 from Arabidopsis) can bind ubiquitin
in vitro (Svenning et al., 2011). Both PB1 and UBA domains of
p62 appeared absolutely crucial for its ability to form character-
istic cytoplasmic bodies and for its function as a factor driving
polyubiquitinated cargos to the autophagic degradation machin-
ery. Therefore, specific degradation of polyubiquitinated cargos is
highly dependent on two features of p62, its polymerization via
the N-terminal PB1 domain and its ability to bind polyubiquitin
via the C-terminal UBA domain (Bjorkoy et al., 2005).
PB1 domain is a protein interaction module conserved in ani-
mals, fungi, amoebas, and plants (Sumimoto et al., 2007). It
was first found in phagocyte oxidase activator p67phox and the
yeast polarity protein Bem1p (Ito et al., 2001). According to the
recent data, in all eukaryotes there are nearly 200 proteins con-
taining the PB1 domain (Letunic et al., 2002). It is about 80
amino acids long and possesses an ubiquitin-like β-grasp fold
containing two alpha helices and mixed five-stranded β-sheets.
Additionally, it can harbor an OPCA (OPR/PC/AID) motif com-
posed of about 20-amino acid with highly conserved acidic and
hydrophobic residues and/or lysine residue conserved on the first
β-strand (Ponting, 1996; Nakamura et al., 1998; Moscat and Diaz-
Meco, 2000; Terasawa et al., 2001; Ponting et al., 2002). The PB1
domain present in mammalian p62 possesses both, the acidic
OPCA motif and the conserved lysine (a residue of basic charge).
It enables specific PB1-PB1 dimerization due to salt bridges for-
mation between the OPCA from one PB1 and the lysine from the
other PB1 (Gong et al., 1999; Sanz et al., 1999, 2000; Avila et al.,
2002; Cariou et al., 2002; Lamark et al., 2003). The PB1 domain
www.frontiersin.org January 2014 | Volume 5 | Article 13 |1

Zientara-Rytter and Sirko Selected interactions of Joka2 domains
of p62 is responsible not only for homo-dimerization but also for
interaction with other proteins. Conversely, the PB1 domain of
mammalian NBR1 harbors only the OPCA motif and lacks the
lysine residue what enables hetero-dimerization but is not suf-
ficient for NBR1-NBR1 homo-dimers formation via PB1. Thus,
additional CC motifs are involved in homo-dimerization of NBR1
proteins (Lamark et al., 2003). Interestingly, an ubiquitin fold of
the PB1 domain is structurally similar to the ubiquitin and to the
UbL (ubiquitin-like) domain and (Hirano et al., 2004). Although
much weaker than the conventional ubiquitin-UBA binding, an
apparent interaction between UbL and UBA domains of Dsk2
protein was indicated (Lowe et al., 2006). For those reasons it was
postulated that the PB1 domain of p62 could be recognized by its
UBA domain.
The UBA domain was initially identified by bioinformatic
analysis (Hofmann and Bucher, 1996). It is about 45 residues long
domain formed by three alpha helices and a hydrophobic patch
mediating protein–protein interaction (Dieckmann et al., 1998).
The UBA domain is found in many proteins involved in the degra-
dation pathways engaging ubiquitin-like proteins, for example in
Dsk2 or Rad23 involved in UPS or in p62 and NBR1 involved
in autophagy-lysosomal machinery. Most UBA domains, but not
all of them (Davies et al., 2004), are able to bind various ubiqui-
tin forms, such as monoubiquitin or the K48- or K63-chains of
polyubiquitin (Vadlamudi et al., 1996; Bertolaet et al., 2001a,b;
Wilkinson et al., 2001; Funakoshi et al., 2002; Rao and Sastry,
2002). For instance, the UBA domain of p62 shows a preference
for K63-polyubiquitinated substrates (Seibenhener et al., 2004;
Long et al., 2008).
Although the mammalian p62 and NBR1 proteins were exten-
sively studied, their plant homologs are far less characterized.
Previously, it has been shown by us that Joka2, a selective
autophagy cargo receptor from tobacco, is a functional and struc-
tural hybrid of mammalian selective autophagy cargo receptors by
sharing some features of p62 and some of NBR1 (Zientara-Rytter
et al., 2011). In this study we focused on two regions of Joka2,
the N-terminal PB1 domain and the C-terminal region contain-
ing UBA domains. Our results pointed out their significant role
in oligomerization and aggregation of Joka2 in plant cells.
MATERIALS AND METHODS
DNA CLONING AND PLASMID CONSTRUCTION
Plasmids used in this study are listed in Tab le 1 . Details of
theirconstructionareavailableuponrequest.Sequencesencod-
ing recombinant unstable ubiquitin (UbG76V)linkedtoYFPwere
designed based on previous results (Heessen et al., 2003). Gateway
entry vectors were created by cDNA cloning into pENTR™/
D-TOPO vector. Gateway LR recombination reactions were done
as described in the Gateway® Technology—manual (Invitrogen,
12535-019 and 12535-027, respectively). Oligonucleotides for
PCR and DNA sequencing are listed in Tab l e 2. All plasmids were
checked by DNA sequencing and/or by digestion by restriction
enzymes. Conventional techniques were used for Escherichia coli
or Agrobacterium tumefaciens transformation.
YEAST TWO HYBRID ASSAY
Yeast cells transformation was performed by the LiAc/ss car-
rier DNA/PEG method (Gietz and Woods, 2002) following the
“Quick and Easy TRAFO Protocol.” After the transformation cells
were placed on the appropriate synthetic dropout (SD) medium,
prepared according to Invitrogen Handbook (PT3024-1), for
transformants selection and, later, for testing of the possible
protein-protein interactions. Plates were incubated at 30◦Cforup
to 7 days.
PLANT MATERIAL AND GROWTH CONDITIONS
Nicotiana benthamiana plantsweregrowninsoilingrowth
chamber under the conditions of 60% relative humidity, with a
day/night regime of 16 h light 300 μmol photons m2−1s−1at
23◦C and 8 h dark at 19◦C.
TRANSIENT PROTEIN EXPRESSION
For transient co-expression of proteins in N. benthamiana leaves
fresh overnight cultures of A. tumefaciens containing appropri-
ate binary plasmids were spun down and washed twice. Next,
cells were re-suspended in sterile water and brought to a final cell
density 2 ×108cfu/ml (OD600 ∼0.2). For bimolecular fluores-
cent complementation (BiFC) experiments the cell suspensions
were adjusted to 4 ×108cfu/ml and mixed 1:1 before infiltra-
tion. Young N. benthamiana plants with fully expanded leaves
of about 5 cm in diameter were infiltrated by bacterial suspen-
sion using a needless syringe. Leaves were harvested and analyzed
under confocal microscope 3 days after agroinfiltration.
CONFOCAL MICROSCOPE ANALYSIS
For staining of nuclei, prior the microscope analysis, agroin-
filtrated leaves were incubated with a fluorescent dye DAPI
(1 μg/ml) for 15 min in the darkness at room temperature. After
the treatment, plant material was washed in water (3 times,
5 min each) and immediately observed in a confocal microscope.
For LMB treatment plant material was incubated with lepto-
mycin B (20 ng/ml) up to 24 h before obser vation. All images
were obtained in the Laboratory of Confocal and Fluorescence
Microscopy at IBB PAS using a Nicon confocal microscope,
Eclipse TE2000-E and processed using EZ-C1 3.60 FreeViewer
software. For GFP/YFP the 488-nm line from an Argon-Ion Laser
(40 mW) was used for excitation, and a 500–530 nm band pass
filter for detection of emission. For RFP the 543nm line of a
Green He-Ne Laser (1.0mW) was used for excitation and the
565–640 nm filter was used for detection. The same 543 nm line
of a Green He-Ne Laser (1.0 mW) but with a 650 nm long pass
filter was used for chlorophyll emission and detection, respec-
tively. The blue fluorescence of DAPI or CFP was imaged using
404 nm Violet-Diode Laser MOD (44.8 mW) for excitation and
430–465 nm or 435–485 nm bands pass filter for emission.
RESULTS
JOKA2 LOCALIZATION AND INTERACTIONS IN PLANT CELLS
Joka2 protein is a homolog of two human receptors of selec-
tive autophagy, p62 and NBR1. Similarly to these proteins,
Joka2 not only forms small cytosolic, punctuated bodies which
are imported to the central vacuole by autophagy machinery
but also creates larger cytoplasmic aggregates. Also alike p62,
Joka2 has been observed by us in a nucleus in stably trans-
formed Nicotiana tabacum plants (Zientara-Rytter et al., 2011).
To understand the phenomenon of this variable localization of
Frontiers in Plant Science | Plant Cell Biology January 2014 | Volume 5 | Article 13 |2

Zientara-Rytter and Sirko Selected interactions of Joka2 domains
Table 1 | Plasmids used in this study.
Plasmid Description References
GATEWAY ENTRY VECTOR
pENTR-D TOPO Entry vector for subcloning in gateway technology Invitrogen
GATEWAY DESTINATION VECTORS
pSITE-nEYFP-C1 Binary vector for BiFC Chakrabarty et al., 2007; Martin et al., 2009
pSITE-cEYFP-C1 Binary vector for BiFC Chakrabarty et al., 2007; Martin et al., 2009
pSITE-nEYFP-N1 Binary vector for BiFC Chakrabarty et al., 2007; Martin et al., 2009
pSITE-cEYFP-N1 Binary vector for BiFC Chakrabarty et al., 2007; Martin et al., 2009
pSITE-2CA Binary vector for gfp fusion at N-terminus of cDNA Chakrabarty et al., 2007
pSITE-4CA Binary vector for rfp fusion at N-terminus of cDNA Chakrabarty et al., 2007
pSITE-4NB Binary vector for rfp fusion at C-terminus of cDNA Chakrabarty et al., 2007
pH7CWG2 Binary vector for cfp fusion at C-terminus of cDNA Karimi et al., 2005
pK7WGY2 Binary vector for yfp fusion at N-terminus of cDNA Karimi et al., 2005
pH7YWG2 Binary vector for yfp fusion at C-terminus of cDNA Karimi et al., 2005
pK7CWG2 Binary vector for cfp fusion at C-terminus of cDNA Karimi et al., 2005
pH7WGC2 Binary vector for cfp fusion at N-terminus of cDNA Karimi et al., 2005
pDEST22 “Prey” vector for Y2H with AD domain of GAL4 protein fused to cDNA N-terminus Invitrogen
pDEST32 “Bait” vector for Y2H with BD domain of GAL4 protein fused to cDNA N-terminus Invitrogen
CONSTRUCTED GATEWAY ENTRY VECTORS FOR SUBCLONING
pEntrUBA UBA domains (1444–2526bp/482–842 aa) from NtJoka2 in pENTR-D TOPO This study
pEntrUb-VV NtUbG76V in pENTR-D TOPO This study
pEntrPB1 PB1 domain (1–1266bp/1–422 aa) from NtJoka2 in pENTR-D TOPO Zientara-Rytter et al., 2011
pEntrPB1ZZ PB1ZZ domain (1–2253bp/1–751 aa) from NtJoka2 in pENTR-D TOPO Zientara-Rytter et al., 2011
pEntrZZ ZZ domain (316–2253bp/106–751 aa) from NtJoka2 in pENTR-D TOPO Zientara-Rytter et al., 2011
pEntrZZUBA ZZUBA domain (316–2526bp/106–842 aa) from NtJoka2 in pENTR-D TOPO Zientara-Rytter et al., 2011
pEntrATG8f NtATG8f cDNA in pENTR-D TOPO Zientara-Rytter et al., 2011
pEntrJ Full-length NtJoka2 in pDONR221 Zientara-Rytter et al., 2011
U17036 ORF cDNA of AtNBR1 in vector pENTR/SD-TOPO for subcloning and direct
expression
www.arabidopsis.org
CONSTRUCTED PLANT EXPRESSION VECTORS
PB1-YFP PB1 domain (1–1266 bp/1–422 aa) of NtJoka2 from pEntrPB1 in pH7YWG2 This study
PB1-CFP PB1 domain (1–1266bp/1–422 aa) of NtJoka2 from pEntrPB1 in pH7CWG2 This study
PB1ZZ-YFP PB1-ZZ domains (1–2253 bp/1–751 aa) of NtJoka2 from pEntrPB1ZZ in pH7YWG2 This study
PB1ZZ-CFP PB1-ZZ domains (1–2253bp/1–751 aa) of NtJoka2 from pEntrPB1ZZ in pK7CWG2 This study
INT1-YFP First interdomain region (316–1266 bp/106–422 aa) of NtJoka2 from pEntrINT1 in
pH7YWG2
This study
INT2-YFP Second interdomain region (−2253 bp/–751 aa) of NtJoka2 from pEntrINT2 in
pH7YWG2
This study
ZZ-YFP ZZ domain (316–2253bp/106–751 aa) of NtJoka2 from pEntrZZ in pH7YWG2 This study
ZZUBA-YFP ZZ-UBA domains (316–2526 bp/106–842 aa) of NtJoka2 from pEntrZZUBA in
pH7YWG2
This study
ZZUBA-CFP ZZ-UBA domains (316–2526bp/106–842 aa) of NtJoka2 from pEntrZZUBA in
pH7CWG2
This study
CFP-ZZUBA ZZ-UBA domains (316–2526 bp/106–842 aa) of NtJoka2 from pEntrZZUBA in
pH7WGC2
This study
UBA-YFP UBA domains (1444–2526 bp/482–842 aa) of NtJoka2 from pEntrUBA in pH7YWG2 This study
UBA-CFP UBA domains (1444–2526bp/482–842 aa) of NtJoka2 from pEntrUBA in pH7CWG2 This study
Joka2-YFP Full-length NtJoka2 from pEntrJ in pH7YWG2 This study
YN-ATG8f Full-length NtATG8f from pEntrATG8f in pSITE-nEYFP-C1 This study
Joka2-YC Full-length NtJoka2 from pEntrJ in pSITE-cEYFP-N1 This study
Joka2-YN Full-length NtJoka2 from pEntrJ in pSITE-nEYFP-N1 This study
YC-Joka2 Full-length NtJoka2 from pEntrJ in pSITE-cEYFP-C1 This study
YN-Joka2 Full-length NtJoka2 from pEntrJ in pSITE-nEYFP-C1 This study
(Continued)
www.frontiersin.org January 2014 | Volume 5 | Article 13 |3

Zientara-Rytter and Sirko Selected interactions of Joka2 domains
Table 1 | Continued
Plasmid Description References
PB1ZZ-YN PB1-ZZ domains (1–2253 bp/1–751 aa) of NtJoka2 from pEntrPB1ZZ in
pSITE-nEYFP-N1
This study
PB1ZZ-YC PB1-ZZ domains (1–2253 bp/1–751 aa) of NtJoka2 from pEntrPB1ZZ in
pSITE-cEYFP-N1
This study
PB1-YC PB1 domain (1–1266 bp/1–422 aa) of NtJoka2 from pEntrPB1 in pSITE-cEYFP-N1 This study
PB1-YN PB1 domain (1–1266 bp/1–422 aa) of NtJoka2 from pEntrPB1 in pSITE-nEYFP-N1 This study
YC-PB1 PB1 domain (1–1266bp/1–422 aa) of NtJoka2 from pEntrPB1 in pSITE-cEYFP-C1 This study
YN-PB1 PB1 domain (1–1266 bp/1–422 aa) of NtJoka2 from pEntrPB1 in pSITE-nEYFP-C1 This study
UBA-YC UBA domains (–2526 bp/–842 aa) of NtJoka2 from pEntrUBA in pSITE-cEYFP-N1 This study
UBA-YN UBA domains (–2526 bp/–842 aa) of NtJoka2 from pEntrUBA in pSITE-nEYFP-N1 This study
YC-UBA UBA domains (–2526 bp/–842 aa) of NtJoka2 from pEntrUBA in pSITE-cEYFP-C1 This study
YN-UBA UBA domains (–2526 bp/–842 aa) of NtJoka2 from pEntrUBA in pSITE-nEYFP-C1 This study
YC-NBR1 Full-length NtJoka2 from pEntrJ in pSITE-cEYFP-C1 This study
YN-NBR1 Full-length NtJoka2 from pEntrJ in pSITE-nEYFP-C1 This study
Joka2-RFP Full-length NtJoka2 from pEntrJ in pSITE-4NB This study
GFP-NBR1 Full-length NtJoka2 from pEntrJ in pSITE-2CA This study
RFP-NBR1 Full-length NtJoka2 from pEntrJ in pSITE-4CA This study
Ub-VV-YFP NtUb from pEntrUb-VV in pH7YWG2 This study
CONSTRUCTED YEAST EXPRESSION VECTORS
AD-UBA UBA domains (1444–2526 bp/482–842 aa) of NtJoka2 from pEntrUBA in pDEST22 This study
BD-UBA UBA domains (1444–2526 bp/482–842 aa) of NtJoka2 from pEntrUBA in pDEST32 This study
AD-PB1 PB1 domain (1–1266bp/1–422 aa) of NtJoka2 from pEntrPB1 in pDEST22 Zientara-Rytter et al., 2011
BD-PB1 PB1 domain (1–1266bp/1–422 aa) of NtJoka2 from pEntrPB1 in pDEST32 Zientara-Rytter et al., 2011
AD-PB1ZZ PB1-ZZ domains (1–2253bp/1–751 aa) of NtJoka2 from pEntrPB1ZZ in pDEST22 Zientara-Rytter et al., 2011
BD-PB1ZZ PB1-ZZ domains (1–2253bp/1–751 aa) of NtJoka2 from pEntrPB1ZZ in pDEST32 Zientara-Rytter et al., 2011
AD-ZZUBA ZZ-UBA domains (316–2526bp/106–842 aa) of NtJoka2 from pEntrZZUBA in
pDEST22
Zientara-Rytter et al., 2011
BD-ZZUBA ZZ-UBA domains (316–2526bp/106–842 aa) of NtJoka2 from pEntrZZUBA in
pDEST32
Zientara-Rytter et al., 2011
YEAST EXPRESSION VECTORS USED AS A CONTROLS
pEXP32/Krev1 Yeast expression vector to use as a “bait” for interaction strength controls Invitrogen
pEXP22/RalGDS-wt Yeast expression “prey” vector for strong interaction control Invitrogen
pEXP22/RalGDS-m1 Yeast expression “prey” vector for weak interaction control Invitrogen
pEXP22/RalGDS-m2 Yeast expression “prey” vector for negative interaction control Invitrogen
PLANT EXPRESSION VECTORS USED AS A LOCALIZATION CONTROLS
vac-ck CD3-969 Tonoplast marker—binary plasmid with a CFP fuses to the C-terminus of γ-TIP, an
aquaporin of the vacuolar membrane
Nelson et al., 2007
Table 2 | Oligonucleotides used for PCR and DNA sequencing.
Name Sequence Description
Joka2-F3 caccatgaagggtttacatgatct For cloning UBA domains with second interdomain region of Joka2
Joka2-R3 ctctccagcaataagatccatg
Joka2-F2 caccatgtctactcccttacgatc For cloning first interdomain region of Joka2
Joka2-R1 aatagtcccagtcccatcactg
Joka2-F3 caccatgaagggtttacatgatct For cloning second interdomain region of Joka2
Joka2-R2 ctggggtggtgcctgcg
ubq-F caccatgcagatcttcgtgaa For cloning tobacco ubiquitin cDNA
ubq-R-VV cttaccaacaacaccacggagacggaggac
att-L2 gtacaagaaagctgggtcg For sequencing destination vectors from 3end
CaM35S-F gatatctccactgacgtaagggatg For sequencing binary vectors from 5end
Frontiers in Plant Science | Plant Cell Biology January 2014 | Volume 5 | Article 13 |4

Zientara-Rytter and Sirko Selected interactions of Joka2 domains
Joka2 several plasmids encoding truncated variants of the protein
were prepared (Figure S1). A series of co-localization experi-
ments in leaves of N. benthamiana plants transiently transformed
with the plasmids containing plant expression cassettes encod-
ing various combinations of the fusion proteins were performed
(Figures 1–3). Previously, localization of Joka2 in acidic speckles
and co-localization of Joka2 with NtATG8f was established in our
laboratory (Zientara-Rytter et al., 2011). The BiFC method, used
in this study, confirmed not only the autophagosomal localiza-
tion of Joka2 but also its direct in vivo interaction with NtATG8f
(Figure 1A). Moreover, the vacuolar localization of Joka2 fused
to RFP (Figures 1C,D) and the partial co-localization of the GFP-
AtNBR1 and RFP-AtNBR1 proteins used as a localization control
(Figure 1B) are in agreement with results reported previously for
EGFP-mCherry-AtNBR1 suggesting that AtNBR1 is transported
to the vacuole (Svenning et al., 2011). Additionally, the nuclear
localization of Joka2 in stably transformed Joka2-YFP seedlings
was confirmed by DAPI staining (Figure 2B) and the function-
ality of the nuclear export sequence (NES) located in the first
interdomain region (INT1), between PB1 and ZZ domains was
demonstrated (Figure 2A). The treatment with nuclear export
inhibitor (LMB) enclosed the truncated PB1-YFP protein in the
nucleus but did not change the cytoplasmic localization of the
INT1 protein nor the localization of the INT2 protein, each
fused to YFP (Figure 2A). The observed subcellular localization of
INT1 and PB1 truncated proteins in the absence of LMB strongly
suggests that the nuclear localization signal (NLS) is located in
PB1 domain and not in INT1 region. The subcellular location
of the truncated PB1-YFP protein is affected by LMB treat-
ment similarly as the subcellular location of the full length Joka2
(Zientara-Rytter et al., 2011 and Figure S2), however LMB does
not change intracellular distribution of the free green fluorescent
protein (GFP) in stably transformed plants (Figure S3).
Finally, co-localization of Joka2-CFP with unstable recombi-
nant ubiquitin linked to YFP (Ub-VV-YFP) indicated that Joka2
is present in ubiquitin-containing protein aggregates (Figure 3).
It could be assumed that at least one of UBA domains of Joka2
is involved in recognition of ubiquitin-containing proteins and
in sequestration of poly-ubiquitinated proteins into aggregates.
To verify this assumption, the cassettes: PB1-CFP, PB1ZZ-
CFP, ZZUBA-CFP, CFP-ZZUBA, UBA-CFP were transiently
co-expressed in N. benthamiana leaves with the cassette for Ub-
VV-YFP. This experiment showed that the C-terminal part of
Joka2 possessing UBA domains was necessary for co-localization
FIGURE 1 | Cytoplasmic and vacuolar localization of transiently
expressed Joka2 and AtNBR1 in leaf epidermal cells of
N. benthamiana. (A) BiFC assay of interaction between Joka2 and
NtATG8f using randomly chosen combination (YN-NtATG8f+Joka2-YC) of
the vectors. (B) Co-localization of co-expressed GFP-AtNBR1 and
RFP-AtNBR1 (AtNBR1 fused to two variants of fluorescent protein).
(C) Localization of Joka2-RFP in the vacuole. (D) Subcellular
localization of co-expressed RFP-Joka2 and γ-TIP-CFP—a tonoplast
marker based on an aquaporin of the vacuolar membrane fused to
CFP. The enlarged part of the picture visualizes tonoplast (the blue
fluorescence signal) of the central vacuole which surrounds the
nucleus (N) and red fluorescence of RFP-Joka2 fusion protein
observed mainly inside the vacuole close to the tonoplast as a smear
(arrowheads) or in spots (arrows). Scale bar, 10μm.
www.frontiersin.org January 2014 | Volume 5 | Article 13 |5

Zientara-Rytter and Sirko Selected interactions of Joka2 domains
FIGURE 2 | Nuclear localization of Joka2. (A) Subcellular localization of
transiently expressed truncated Joka2 proteins (INT1-YFP, INT2-YFP, and
PB1-YFP) in leaf epidermal cells of N. benthamiana treated (+LMB) and not
treated (−LMB) with the inhibitor of nuclear export. The localization of
INT1-YFP and the INT2-YFP was unaffected by the LMB treatment, while
PB1-YFP remained in the nucleus only after treatment with LMB. White lines
with arrows indicate the cross-section of the cells used in analysis shown to
the left. The nuclei are stained blue with DAPI. (B) An rhizodermis cell of
transgenic tobacco line J4-1 expressing Joka2-YFP (yellow) and DAPI staining
(blue) indicating the nuclear localization of Joka2-YFP. Scale bar, 10 μm.
of Joka2 with Ub-VV-YFP. Moreover, the sequestration of Ub-
VV-YFP into aggregates took place only in the presence of
C-terminal UBA domains of Joka2, whereas N-terminal PB1
domain of Joka2 had no effect on its localization. Moreover,
truncated Joka2 with ZZUBA or UBA domains were always
co-localized with Ub-VV-YFP.
Joka2 EXISTS IN PLANTA IN MONOMERIC AND IN OLIGOMERIC
FORMS
Due to a structural similarity between Phox/Bem1p (PB1)
domain and ubiquitin-like (UbL) domain, selective autophagy
cargo receptors (Joka2, p62, and NBR1) might be included into
a family of ubiquitin receptor proteins containing both UbL and
ubiquitin-associated (UBA) domains (Figures 4B,D). Moreover,
p62 possess many properties that are similar to the UbL–UBA
proteins, such as direct interaction with proteasome by PB1
domain (Babu et al., 2005; Geetha et al., 2008) and ability to
deliver polyubiquitinated proteins to UPS (Seibenhener et al.,
2004; Babu et al., 2005). It was shown by us previously in yeast
two hybrid (Y2H) experiments that Joka2 can form homod-
imers (Zientara-Rytter et al., 2011). Here, Joka2 dimerization
is confirmed in planta using the BiFC method in which fusion
proteins linking Joka2 with either N- or C-terminal part of YFP
(YN or YC, respectively; see Figure S4) were generated by tran-
sient co-expression in N. benthamiana leaves using all four pos-
sible combinations, namely YN-Joka2 with YC-Joka2, YN-Joka2
with Joka2-YC, Joka2-YN with Joka2-YC, and Joka2-YN with YC-
Joka2 (Figure 5 and Figure S5). Additionally, self-interaction of
AtNBR1, an Arabidopsis homolog of Joka2, was verified using one
randomly selected combination, namely YN-AtNBR1 and YC-
AtNBR1 (Figure 5). The BiFC assay confirmed that both cargo
receptors,Joka2andAtNBR1,wereabletomakemultimeric
forms in planta. Interestingly, for both proteins the fluorescence
of the restored YFP was observed only in aggregates what suggests
that Joka2 and AtNBR1 are present in oligomeric forms only in
aggregasomes, while outside of aggregasomes, in the cytoplasm
and the nucleus they rather exist in monomeric forms.
PB1-PB1 INTERACTIONS ARE SUFFICIENT FOR AGGREGATES
FORMATION
It is obvious that aggregation of selective autophagy cargo recep-
tors is possible due to their ability to polymerize. Molecular
Frontiers in Plant Science | Plant Cell Biology January 2014 | Volume 5 | Article 13 |6

Zientara-Rytter and Sirko Selected interactions of Joka2 domains
FIGURE 3 | Truncated Joka2 containing only UBA domains co-localizes
with ubiquitin linked to YFP (Ub-VV-YFP). Truncated Joka2 proteins lacking
PB1, PB1, and ZZ, ZZ, and UBA or UBA domains were transiently
co-expressed in N. benthamiana leaves with unstable ubiquitin linked to YFP
(Ub-VV-YFP). The overlapping fluorescent signals were observed only in the
case of co-expression of Ub-VV-YFP with the following versions of the
recombinant proteins: full-length Joka2-CFP, ZZUBA-CFP, CFP-ZZUBA,
UBA-CFP. Scale bar, 10 μm.
modeling of PB1 domain of Joka2 revealed that it has a
basic/acidic surface structure, which is similar to PB1 domain
of p62 which, in turn, has the ability to polymerize (Svenning
et al., 2011). In the PB1 domain, both proteins harbor the N-
terminal basic charge cluster and the C-terminal, acidic OPCA
motif (Figures 4A,C).
Previously, it has been shown by us in Y2H experiments that
the N-terminal PB1 domain of Joka2 is involved in dimers for-
mation (Zientara-Rytter et al., 2011). We decided to confirm this
result in planta by BiFC. The constructs encoding the PB1ZZ
and PB1 fragments of Joka2 were used in this experiment. The
fusion proteins were generated by linking PB1ZZ or PB1 with
either N- or C-terminal parts of YFP and fluorescence of YFP was
observed in several combinations of the fusions. For PB1ZZ only
one combination was tested (PB1ZZ-YC+PB1ZZ-YN), while for
PB1 all four combinations were used. The fluorescence was
observed in all analyzed combinations except PB1-YC+YN-PB1
(Figure 6) and the negative controls (not shown). These results
indicate that PB1 domain of Joka2 protein can form homo-dimers
in planta.
UBA DOMAINS ARE ALSO INVOLVED IN AGGREGASOMES FORMATION
During subsequent analysis, various Joka2 fragments linked to
YFP or CFP were tested for their subcellular localization and
www.frontiersin.org January 2014 | Volume 5 | Article 13 |7

Zientara-Rytter and Sirko Selected interactions of Joka2 domains
FIGURE 4 | PB1 sequence analysis. (A) Alignment of PB1 domain
sequences from tobacco Joka2, Arabidopsis NBR1, and Homo sapiens p62
and NBR1. Blue background color denotes basic residues and red background
color denotes acidic residues from OPCA-motif important for PB1 domain
interactions and self-interaction. (B) Alignment of PB1 domain sequences of
Joka2, AtNBR1, and ubiquitin sequence from Arabidopsis thaliana. Green
background color denotes similar residues between ubiquitin and PB1
domain of Joka2 and AtNBR1. Identical amino acids are indicated with
asterisks and by dots are marked amino acids with high similarity. (C) PB1
domain from Joka2 modeled using Swissmodel (PBD: 2KKC). By blue color
are marked basic residues and by red are colored acidic residues from
OPCA-motif. Two surfaces are shown. (D) PB1 domain from Joka2 modeled
using Swissmodel (PBD: 2KKC). Green color marks amino acids similar
between ubiquitin and PB1 domain of Joka2. Two surfaces are shown.
ability to form cytoplasmic aggregates. Cassettes encoding the
respective fusion proteins were transiently expressed in N. ben-
thamiana leaves and the recombinant proteins were analyzed
under confocal microscopy (Figure 7). Interestingly, somewhat
diffused distribution was observed in each of the tested dele-
tion constructs, namely PB1, PB1ZZ, INT1, ZZ, INT2, ZZUBA,
UBA. Such distribution was similar to K11A/D60A mutant with
disturbed acidic/basic surface described by the Johansen’s group
(Svenning et al., 2011). The truncated proteins containing PB1
domain (PB1, PB1ZZ) were able to create aggregates in planta,
but this tendency was weaker (e.g., smaller and less aggregates and
more apparent “diffused” distribution in the cytoplasm) than in
the case of full Joka2 containing all three domains, PB1, ZZ, and
double UBA (Figure 7A). In summary, this experiment indicated
(i) necessity of PB1 domain for protein multimerization in vivo
and (ii) contribution of UBA domains to the process of aggregates
formation (or stabilization).
This problem was investigated further by transient co-
production of the full length Joka2 (Joka2-YFP) with truncated
versions (PB1 or PB1ZZ, ZZUBA, UBA) linked to CFP, what
enabled monitoring of both types of the proteins in one cell
(Figure 7B). Interestingly, full-length Joka2 co-expressed with
some truncated forms (PB1 or PB1ZZ) was observed not only
in aggregates but also a weak fluorescence was present in the
nucleus and cytoplasm (Figure 7B). Such dual localization was
not observed when Joka2 was co-produced with ZZUBA or UBA
domains or with full-length Joka2 (Figure 7B). This result is in
agreement with the results shown in Figures 3,7A and indicates
that UBA domains are also involved in cytoplasmic bodies for-
mation. Moreover, this result strongly suggested a possibility of
PB1-UBA interaction.
PB1-UBA INTERACTIONS IN AGGREGASOMES
It is known that PB1 domains are also able to interact with
other domains. For example, PB1 domain from p62 can directly
interact with PB1 domain from NBR1 protein or with the
Rpt1 subunit of 26S proteasome (Seibenhener et al., 2004; Babu
et al., 2005; Geetha et al., 2008). The NMR studies of PB1
domain has shown that it creates an ubiquitin-like, β-grasp fold,
similar to the well-characterized UbL domain (Hirano et al.,
2004). Therefore, it was postulated that PB1 domain can also
directly interacts with UBA (Su and Lau, 2009; Isogai et al.,
Frontiers in Plant Science | Plant Cell Biology January 2014 | Volume 5 | Article 13 |8

Zientara-Rytter and Sirko Selected interactions of Joka2 domains
FIGURE 5 | BiFC assay of dimerization of transiently expressed Joka2
and AtNBR1 in leaf epidermal cells of N. benthamiana.Four combinations
of BiFC plasmids were used for analysis of Joka2 dimerization
(YC-Joka2+YN-Joka2, YC-Joka2+Joka2-YN, Joka2-YC+Joka2-YN, and
Joka2-YC+YN-Joka2). Joka2-Joka2 interaction (green signal) was observed in
all combinations. Dimerization of AtNBR1 was tested by BiFC method using
only one randomly chosen plasmids combination (YC-AtNBR1+YN-AtNBR1).
Scale bar, 10 μm. Negative controls are shown in Figure S5.
2011). A similar interaction was reported for the UbL and
UBA family of ubiquitin binding proteins involved in proteaso-
mal degradation of ubiquitinated substrates, like Dsk2 protein
(Lowe et al., 2006). Despite the fact that UBA domains were
not crucial for multimerization of the selective autophagy cargo
receptors, we decided to test if a direct interaction between
PB1 and UBA domains from Joka2 is possible. The screen-
ing performed in Y2H system indicated that the interaction
between these domains could take place in vivo (Figure 8A). The
strongest interaction was observed when the truncated PB1ZZ
protein was fused to AD domain of GAL4, while the truncated
ZZUBA protein was fused to BD domain of GAL4. Nevertheless,
it was still moderate interaction in comparison to the posi-
tive control and the other previously described by us inter-
actions using Y2H system, namely PB1-PB1. Nevertheless, the
PB1-UBA interaction was also confirmed by BiFC experiment
in planta. Interestingly, the fluorescent signal from YFP (obtained
as a consequence of a direct binding of UBA and PB1) was
observed only in aggregates (Figure 8B) despite the fact that both
fusion proteins share diffuse localization in N. benthamiana cells
(see Figures 3,7B).
DISCUSSION
The main focus of this study was on characterization of the role
of PB1 and UBA domains in multimerization and aggregation of
Joka2 in plant cells. The results are shown in a form of a model
summarizing and explaining detected interactions (Figure 8). It
has been shown by us that Joka2 has multiple cellular local-
izations. We have observed Joka2 in autophagosomes, where its
interaction with ATG8 proteins is possible; in vacuole where it
is presumably degraded; in cytosolic aggregates (aggregasomes)
and in the nucleus. The nuclear location was especially apparent
after treatment with LMB, an inhibitor of nuclear export. We were
able to localize the functional NES (nuclear export sequence),
www.frontiersin.org January 2014 | Volume 5 | Article 13 |9

Zientara-Rytter and Sirko Selected interactions of Joka2 domains
FIGURE 6 | BiFC assay of dimerization of PB1 in planta.The
combinations of plasmids (PB1-YC+YN-PB1, PB1-YC+PB1-YN,
YC-PB1+PB1-YN, YC-PB1+YN-PB1, and PB1ZZ-YC+PB1ZZ-YN) were
used for BiFC analysis in leaf epidermal cells of N. benthamiana.The
interaction (green signal) was mainly observed in cytosolic aggregates.
For the combination of PB1-YC+YN-PB1 no fluorescence signal was
observed in plant cells. For the combination of YC-PB1+YN-PB1 the
weak fluorescence in cytoplasm was also present. Two independent
representative pictures are shown for the combination of
YC-PB1ZZ+YN-PB1ZZ. Scale bar, 10 μm.
FIGURE 7 | Involvement of PB1 and UBA domains in formation of
Joka2-Joka2 aggregates in planta.(A)Localization of truncated forms
of Joka2 in N. benthamiana epidermal cells. (B) Joka2 subcellular
localization analysis after co-expression of Joka2-YFP with various
truncated forms of Joka2 linked to CFP in N. benthamiana leaves. Scale
bar, 10 μm.
however, localization of NLS (nuclear localization sequence) was
not yet done. Several positions might be considered since several
NLS consensuses were detected within Joka2. Nonetheless, the
results shown in Figure 2A suggest that NLS must be present
in the INT2 region. The function of Joka2 in nucleus is still
unknown. It is possible that Joka2, similarly to ATG8 proteins,
accumulates in the nucleus to prevent activation of autophagy by
the excess of Joka2 in the cytoplasm or, since UPS is the main
degradation pathway in the nucleus, Joka2 could be involved in
shuttling of the protein cargos to the nuclear proteasomes as it is
Frontiers in Plant Science | Plant Cell Biology January 2014 | Volume 5 | Article 13 |10

Zientara-Rytter and Sirko Selected interactions of Joka2 domains
FIGURE 8 | Interaction between PB1 and UBA domains. (A) Yeast
two-hybrid (Y2H) analysis demonstrating weak interaction between PB1
domain and the fragment containing UBA domains of Joka2. Truncated
proteins lacking either PB1 or UBA domains were fused to AD or BD
domain of GAL4 protein and co-expressed in yeast cells (AH109 strain).
Positive and negative controls for protein interaction analysis were
provided by Invitrogen. (B) BiFC assay for PB1-UBA interaction in planta.
Indicated combinations of plasmids (PB1-YN+UBA-YC, YN-PB1+UBA-YC,
YC-PB1+UBA-YN, PB1-YC+UBA-YN) were used for analysis. Scale bar,
10 μm.
FIGURE 9 | Model explaining possible PB1-UBA interactions detected in this work. Involvement of Joka2 in targeting of the ubiquitinated proteins into the
cytoplasmic or nuclear Ubiquitin-Proteasomal System (UPS) is only hypothetical.
postulated for p62 (Pankiv et al., 2010). Such role of Joka2 is plau-
sible due to the strong structure similarity of Phox/Bem1p (PB1)
domain to the ubiquitin-like (UbL) domain directly interacting
with proteasome compounds (Hirano et al., 2004).
Joka2 is a strongly aggregating protein. PB1 domain of Joka2
has similar basic/acidic surface to PB1 of p62 protein (Svenning
et al., 2011; Zientara-Rytter et al., 2011). It is known that the
N-terminal basic charge cluster is able to bind non-covalently to
www.frontiersin.org January 2014 | Volume 5 | Article 13 |11

Zientara-Rytter and Sirko Selected interactions of Joka2 domains
the C-terminal acidic OPCA motif. Our results indicate that PB1
domain is sufficient for Joka2 oligomerization in planta and that
the C-terminal region containing UBA1 and UBA2 domains addi-
tionally promotes Joka2 aggregation. Moreover, the aggregates
formed by the truncated proteins lacking the fragment with UBA
domains are mostly not co-localized with ubiquitin aggregates
(Figure 3), what is in agreement with previously proved involve-
ment of UBA domains in recognition of poly-ubiquitinated pro-
teins (Seibenhener et al., 2004). We noticed that small aggregates
formed by the truncated ZZUBA or UBA proteins co-localized
with the aggregates formed by recombinant ubiquitin linked to
YFP (Ub-VV-YFP). Such co-localization was not observed for
truncated Joka2 lacking UBA but possessing PB1 domain. Our
data proved that co-localization of Joka2 with ubiquitin linked to
YFP is dependent upon the presence of C-terminal UBA domains
but not the N-terminal PB1 domain. Therefore, we conclude that
at least one of UBA domains of Joka2 (presumably UBA2) is
necessary of binding of polyubiquitin aggregates.
We have demonstrated that the specific protein-protein inter-
action between PB1 and at least one of UBA domain of Joka2
is possible. Such interaction was only hypothesized for other
selective autophagy cargo receptors due to the high similarity
in domain architecture between, for example, p62 and Dsk2
or Rad23 (Su and Lau, 2009). Our data indicated that interac-
tion between PB1 and at least one of UBA domains takes place
in vivo andthatitismuchweakerthanPB1-PB1interaction.
Interestingly, such PB1-UBA interaction was only observed in
aggregates despite the fact that both truncated proteins were
spread in the whole cytoplasm. Also for PB1-PB1 interaction
the fluorescent signal was observed mostly in aggregates. This
conclusion is supported by the observation that detection of
the PB1-PB1 interaction in the cytoplasmic non-aggregated frac-
tions of PB1 proteins was possible only in one combination of
thevectors.Therefore,weconcludethatPB1-PB1andPB1-UBA
interactions take place mainly in aggregates. Aggregates forma-
tion is a consequence of self oligomerization of Joka2 and both
types of interactions are necessary for multimerization of Joka2
in poly-ubiquitin-containing aggregates (Figure 9).
Interestingly, since the aggregates of p62 have been reported
to contain proteasomal components (Seibenhener et al., 2004),
it is worth to speculate that Joka2 may interact with proteaso-
mal subunits. Such interaction was previously determined for
p62 (Babu et al., 2005; Geetha et al., 2008). The structural sim-
ilarity of the PB1 domain from Joka2 to the PB1 domain from
p62aswellastotheUbLdomain,letushypothesizethatJoka2
upon binding of poly-ubiquitinated substrates via one of its C-
terminally located UBA domains could bring them directly to
proteasome by the presumed direct contact of N-terminal PB1
domain with proteasomal subunits. Thus, it is tempting to specu-
late that Joka2, similarly to p62 (Seibenhener et al., 2004; Babu
et al., 2005; Geetha et al., 2008), could be involved in shut-
tling of substrates for degradation between UPS and autophagy
machinery (Figure 9).
ACKNOWLEDGMENTS
This work was supported by the Polish Ministry of Science and
Higher Education (grant No W16/7.PR/2011) and the National
Science Centre (grant No 2012/05/N/NZ1/00699).
SUPPLEMENTARY MATERIAL
The Supplementary Material for this article can be found online
at: http://www.frontiersin.org/journal/10.3389/fpls.2014.00013/
abstract
Figure S1 | Graphical illustration of Joka2 and its truncated forms used in
this study. The proteins and domains are drawn to scale. See text for
details and domains description.
Figure S2 | Cycling of Joka2-YFP and PB1-YFP between cytoplasm and
nucleus is inhibited by LMB treatment.
Figure S3 | Subcellular localization analysis of fluorescent signal in cells of
transgenic tobacco line AB5 expressing free GFP protein treated (+LMB)
and not treated (−LMB) with the inhibitor of nuclear export. No change in
fluorescent protein localization could be noticed regardless from LMB
treatment. Arrows indicate nuclei.
Figure S4 | Schematic illustration of binary vectors used for BiFC assay.
Figure S5 | The typical examples of negative controls for BiFC assay.
REFERENCES
Avila, A., Silverman, N., Diaz-Meco, M. T., and Moscat, J. (2002). The Drosophila
atypical protein kinase C-ref(2)p complex constitutes a conserved mod-
ule for signaling in the toll pathway. Mol. Cell. Biol. 22, 8787–8795. doi:
10.1128/MCB.22.24.8787-8795.2002
Babu, J. R., Geetha, T., and Wooten, M. W. (2005). Sequestosome 1/p62 shuttles
polyubiquitinated tau for proteasomal degradation. J. Neurochem. 94, 192–203.
doi: 10.1111/j.1471-4159.2005.03181.x
Bertolaet, B. L., Clarke, D. J., Wolff, M., Watson, M. H., Henze, M., Divita, G.,
et al. (2001a). UBA domains mediate protein-protein interactions between
two DNA damage-inducible proteins. J. Mol. Biol. 313, 955–963. doi:
10.1006/jmbi.2001.5105
Bertolaet, B. L., Clarke, D. J., Wolff, M., Watson, M. H., Henze, M., Divita, G.,
et al. (2001b). UBA domains of DNA damage-inducible proteins interact with
ubiquitin. Nat. Struct. Biol. 8, 417–422. doi: 10.1038/87575
Bjorkoy, G., Lamark, T., Brech, A., Outzen, H., Perander, M., Overvatn, A., et al.
(2005). p62/SQSTM1 forms protein aggregates degraded by autophagy and has
a protective effect on huntingtin-induced cell death. J. Cell Biol. 171, 603–614.
doi: 10.1083/jcb.200507002
Cariou, B., Perdereau, D., Cailliau, K., Browaeys-Poly, E., Bereziat, V., Vasseur-
Cognet, M., et al. (2002). The adapter protein ZIP binds Grb14 and regulates its
inhibitory action on insulin signaling by recruiting protein kinase Czeta. Mol.
Cell. Biol. 22, 6959–6970. doi: 10.1128/MCB.22.20.6959-6970.2002
Chakrabarty, R., Banerjee, R., Chung, S. M., Farman, M., Citovsky, V., Hogenhout,
S. A., et al. (2007). PSITE vectors for stable integration or transient expression of
autofluorescent protein fusions in plants: probing Nicotiana benthamiana-virus
interactions. Mol. Plant Microbe Interact. 20, 740–750. doi: 10.1094/MPMI-20-
7-0740
Davies, G. C., Ettenberg, S. A., Coats, A. O., Mussante, M., Ravichandran, S.,
Collins, J., et al. (2004). Cbl-b interacts with ubiquitinated proteins; differential
functions of the UBA domains of c-Cbl and Cbl-b. Oncogene 23, 7104–7115.
doi: 10.1038/sj.onc.1207952
Dieckmann, T., Withers-Ward, E. S., Jarosinski, M. A., Liu, C. F., Chen, I. S., and
Feigon, J. (1998). Structure of a human DNA repair protein UBA domain that
interacts with HIV-1 Vpr. Nat. Struct. Biol. 5, 1042–1047. doi: 10.1038/4220
Funakoshi, M., Sasaki, T., Nishimoto, T., and Kobayashi, H. (2002). Budding yeast
Dsk2p is a polyubiquitin-binding protein that can interact with the proteasome.
Proc. Natl. Acad. Sci. U.S.A. 99, 745–750. doi: 10.1073/pnas.012585199
Geetha, T., Seibenhener, M. L., Chen, L., Madura, K., and Wooten, M. W. (2008).
p62 serves as a shuttling factor for TrkA interaction with the proteasome.
Biochem. Biophys. Res. Commun. 374, 33–37. doi: 10.1016/j.bbrc.2008.06.082
Geetha, T., and Wooten, M. W. (2002). Structure and functional properties of
the ubiquitin binding protein p62. FEBS Lett. 512, 19–24. doi: 10.1016/S0014-
5793(02)02286-X
Gietz, R. D., and Woods, R. A. (2002). Transformation of yeast by lithium
acetate/single-stranded carrier DNA/polyethylene glycol method. Methods
Enzymol. 350, 87–96. doi: 10.1016/S0076-6879(02)50957-5
Frontiers in Plant Science | Plant Cell Biology January 2014 | Volume 5 | Article 13 |12

Zientara-Rytter and Sirko Selected interactions of Joka2 domains
Gong, J., Xu, J., Bezanilla, M., Van Huizen, R., Derin, R., and Li, M. (1999).
Differential stimulation of PKC phosphorylation of potassium channels by ZIP1
and ZIP2. Science 285, 1565–1569. doi: 10.1126/science.285.5433.1565
Heessen, S., Dantuma, N. P., Tessarz, P., Jellne, M., and Masucci, M. G. (2003).
Inhibition of ubiquitin/proteasome-dependent proteolysis in Saccharomyces
cerevisiae by a Gly-Ala repeat. FEBS Lett. 555, 397–404. doi: 10.1016/S0014-
5793(03)01296-1
Hershko, A., and Ciechanover, A. (1998). The ubiquitin system. Annu. Re v.
Biochem. 67, 425–479. doi: 10.1146/annurev.biochem.67.1.425
Hirano, Y., Yoshinaga, S., Ogura, K., Yokochi, M., Noda, Y., Sumimoto, H., et al.
(2004). Solution structure of atypical protein kinase C PB1 domain and its mode
of interaction with ZIP/p62 and MEK5. J. Biol. Chem. 279, 31883–31890. doi:
10.1074/jbc.M403092200
Hofmann, K., and Bucher, P. (1996). The UBA domain: a sequence motif present
in multiple enzyme classes of the ubiquitination pathway. Trends Biochem. Sci.
21, 172–173. doi: 10.1016/S0968-0004(96)30015-7
Isogai, S., Morimoto, D., Arita, K., Unzai, S., Tenno, T., Hasegawa, J., et al.
(2011). Crystal structure of the ubiquitin-associated (UBA) domain of p62
and its interaction with ubiquitin. J. Biol. Chem. 286, 31864–31874. doi:
10.1074/jbc.M111.259630
Ito, T., Matsui, Y., Ago, T., Ota, K., and Sumimoto, H. (2001). Novel modu-
lar domain PB1 recognizes PC motif to mediate functional protein-protein
interactions. EMBO J. 20, 3938–3946. doi: 10.1093/emboj/20.15.3938
Karimi, M., De Meyer, B., and Hilson, P. (2005). Modular cloning in plant cells.
Trends Plant Sci. 10, 103–105. doi: 10.1016/j.tplants.2005.01.008
Kirkin, V., Lamark, T.,Sou, Y. S., Bjorkoy, G., Nunn, J. L., Bruun, J. A., et al. (2009a).
A role for NBR1 in autophagosomal degradation of ubiquitinated substrates.
Mol. Cell 33, 505–516. doi: 10.1016/j.molcel.2009.01.020
Kirkin, V., McEwan, D. G., Novak, I., and Dikic, I. (2009b). A role for ubiquitin in
selective autophagy. Mol. Cell 34, 259–269. doi: 10.1016/j.molcel.2009.04.026
Lamark, T., Perander, M., Outzen, H., Kristiansen, K., Overvatn, A., Michaelsen,
E., et al. (2003). Interaction codes within the family of mammalian Phox and
Bem1p domain-containing proteins. J. Biol. Chem. 278, 34568–34581. doi:
10.1074/jbc.M303221200
Letunic, I., Goodstadt, L., Dickens, N. J., Doerks, T., Schultz, J., Mott, R., et al.
(2002). Recent improvements to the SMART domain-based sequence annota-
tion resource. Nucleic Acids Res. 30, 242–244. doi: 10.1093/nar/30.1.242
Long, J., Gallagher, T. R., Cavey, J. R., Sheppard, P. W., Ralston, S. H., Layfield,
R., et al. (2008). Ubiquitin recognition by the ubiquitin-associated domain of
p62 involves a novel conformational switch. J. Biol. Chem. 283, 5427–5440. doi:
10.1074/jbc.M704973200
Lowe, E. D., Hasan, N., Trempe, J. F., Fonso, L., Noble, M. E., Endicott, J. A., et al.
(2006). Structures of the Dsk2 UBL and UBA domains and their complex. Acta
Crystallogr. D Biol. Crystallogr. 62, 177–188. doi: 10.1107/S0907444905037777
Martin, K., Kopperud, K., Chakrabarty, R., Banerjee, R., Brooks, R., and Goodin,
M. M. (2009). Transient expression in Nicotiana benthamiana fluorescent
marker lines provides enhanced definition of protein localization, move-
ment and interactions in planta. Plant J. 59, 150–162. doi: 10.1111/j.1365-
313X.2009.03850.x
Moscat, J., and Diaz-Meco, M. T. (2000). The atypical protein kinase Cs. Functional
specificity mediated by specific protein adapters. EMBO Rep. 1, 399–403. doi:
10.1093/embo-reports/kvd098
Nakamura, R., Sumimoto, H., Mizuki, K., Hata, K., Ago, T., Kitajima, S., et al.
(1998). The PC motif: a novel and evolutionarily conserved sequence involved
in interaction between p40phox and p67phox, SH3 domain-containing cytoso-
lic factors of the phagocyte NADPH oxidase. Eur. J. Biochem. 251, 583–589. doi:
10.1046/j.1432-1327.1998.2510583.x
Nelson, B. K., Cai, X., and Nebenfuhr, A. (2007). A multicolored set of in vivo
organelle markers for co-localization studies in Arabidopsis and other plants.
Plant J. 51, 1126–1136. doi: 10.1111/j.1365-313X.2007.03212.x
Pankiv, S., Lamark, T., Bruun, J. A., Overvatn, A., Bjorkoy, G., and Johansen, T.
(2010). Nucleocytoplasmic shuttling of p62/SQSTM1 and its role in recruitment
of nuclear polyubiquitinated proteins to promyelocytic leukemia bodies. J. Biol.
Chem. 285, 5941–5953. doi: 10.1074/jbc.M109.039925
Pawson, T., and Nash, P. (2003). Assembly of cell regulatory systems through pro-
tein interaction domains. Science 300, 445–452. doi: 10.1126/science.1083653
Ponting, C. P. (1996). Novel domains in NADPH oxidase subunits, sorting nex-
ins, and PtdIns 3-kinases: binding partners of SH3 domains? Protein Sci. 5,
2353–2357. doi: 10.1002/pro.5560051122
Ponting, C. P., Ito, T., Moscat, J., Diaz-Meco, M. T., Inagaki, F., and Sumimoto, H.
(2002). OPR, PC and AID: all in the PB1 family. Trends Bioche m. Sci. 27, 10. doi:
10.1016/S0968-0004(01)02006-0
Rao, H., and Sastry, A. (2002). Recognition of specific ubiquitin conju-
gates is important for the proteolytic functions of the ubiquitin-associated
domain proteins Dsk2 and Rad23. J. Biol. Chem. 277, 11691–11695. doi:
10.1074/jbc.M200245200
Sanz, L., Diaz-Meco, M. T., Nakano, H., and Moscat, J. (2000). The atypical PKC-
interacting protein p62 channels NF-kappaB activation by the IL-1-TRAF6
pathway. EMBO J. 19, 1576–1586. doi: 10.1093/emboj/19.7.1576
Sanz, L., Sanchez, P., Lallena, M. J., Diaz-Meco, M. T., and Moscat, J. (1999). The
interaction of p62 with RIP links the atypical PKCs to NF-kappaB activation.
EMBO J. 18, 3044–3053. doi: 10.1093/emboj/18.11.3044
Seibenhener, M. L., Babu, J. R., Geetha, T., Wong, H. C., Krishna, N. R., and
Wooten, M. W. (2004). Sequestosome 1/p62 is a polyubiquitin chain bind-
ing protein involved in ubiquitin proteasome degradation. Mol. Cell. Biol. 24,
8055–8068. doi: 10.1128/MCB.24.18.8055-8068.2004
Su, V., and Lau, A. F. (2009). Ubiquitin-like and ubiquitin-associated domain pro-
teins: significance in proteasomal degradation. Cell.Mol.LifeSci.66, 2819–2833.
doi: 10.1007/s00018-009-0048-9
Sumimoto, H., Kamakura, S., and Ito, T. (2007). Structure and function of the PB1
domain, a protein interaction module conserved in animals, fungi, amoebas,
and plants. Sci. STKE 2007:re6. doi: 10.1126/stke.4012007re6
Svenning, S., Lamark, T., Krause, K., and Johansen, T. (2011). Plant NBR1 is
a selective autophagy substrate and a functional hybrid of the mammalian
autophagic adapters NBR1 and p62/SQSTM1. Autophagy 7, 993–1010. doi:
10.4161/auto.7.9.16389
Terasawa, H., Noda, Y., Ito, T., Hatanaka, H., Ichikawa, S., Ogura, K., et al.
(2001). Structure and ligand recognition of the PB1 domain: a novel
protein module binding to the PC motif. EMBO J. 20, 3947–3956. doi:
10.1093/emboj/20.15.3947
Vadlamudi, R. K., Joung, I., Strominger, J. L., and Shin, J. (1996). p62, a
phosphotyrosine-independent ligand of the SH2 domain of p56lck, belongs to
a new class of ubiquitin-binding proteins. J. Biol. Chem. 271, 20235–20237. doi:
10.1074/jbc.271.34.20235
Weidberg, H., Shvets, E., and Elazar, Z. (2011). Biogenesis and cargo selectivity
of autophagosomes. Annu. Rev. Biochem. 80, 125–156. doi: 10.1146/annurev-
biochem-052709-094552
Wilkinson, C. R., Seeger, M., Hartmann-Petersen, R., Stone, M., Wallace, M.,
Semple, C., et al. (2001). Proteins containing the UBA domain are able
to bind to multi-ubiquitin chains. Nat. Cell B iol. 3, 939–943. doi: 10.1038/
ncb1001-939
Yoshimori, T. (2004). Autophagy: a regulated bulk degradation process inside
cells. Biochem. Biophys. Res. Commun. 313, 453–458. doi: 10.1016/j.bbrc.
2003.07.023
Zientara-Rytter, K., Lukomska, J., Moniuszko, G., Gwozdecki, R., Surowiecki,
P., Lewandowska, M., et al. (2011). Identification and functional analysis of
Joka2, a tobacco member of the family of selective autophagy cargo receptors.
Autophagy 7, 1145–1158. doi: 10.4161/auto.7.10.16617
Conflict of Interest Statement: The authors declare that the research was con-
ducted in the absence of any commercial or financial relationships that could be
construed as a potential conflict of interest.
Received: 30 October 2013; accepted: 12 January 2014; published online: 31 January
2014.
Citation: Zientara-Rytter K and Sirko A (2014) Significant role of PB1 and UBA
domains in multimerization of Joka2, a selective autophagy cargo receptor from
tobacco. Front. Plant Sci. 5:13. doi: 10.3389/fpls.2014.00013
This article was submitted to Plant Cell Biology, a section of the journal Frontiers in
Plant Science.
Copyright © 2014 Zientara-Rytter and Sirko. This is an open-access article dis-
tributed under the terms of the Creative Commons Attribution License (CC BY). The
use, distribution or reproduction in other forums is permitted, provided the original
author(s) or licensor are credited and that the original publication in this jour-
nal is cited, in accordance with accepted academic practice. No use, distribution or
reproduction is permitted which does not comply with these terms.
www.frontiersin.org January 2014 | Volume 5 | Article 13 |13