ArticlePDF Available

Abstract

Among various pet animals, dogs have been men’s best companion and sharing the common dwellings. Recent analysis indicated that in India’s dog population has increased by 58% since 2007. Therefore, concern for diseases of dogs has also increased. The dogs often suffer from many diseases due to various managerial practices. One of such diseases is Bordetellosis often synonymous with kennel cough. Kennel cough is multi–etiological disease but Bordetella bronchiseptica, a gram negative bacterium, has been considered the main causative agent. It causes canine infectious bronchitis characterized by frequent dry and hacking coughing with high morbidity (~ 80%). This organism has also reported to cause zoonotic infections in human beings. Though a well studied disease of dogs, little is understood about its epidemiology in developing countries including India. The PCR and ELISA are the common diagnostic methods for Bordetella bronchiseptica infection. However, detection of the pathogen does not mean the disease and many of the cases of kennel cough may not be associated with bordetellosis. Further studies are necessary to understand its epidemiology in developing countries for proper management of kennel cough and other related problems.
Advances in Animal and Veterinary Sciences. 1 (3S): 1 4
Special Issue 3 (Epidemiology and Animal Disease Investigations)
http://www.nexusacademicpublishers.com/journal/4
Bhardwaj et al (2013).
Bordetella Bronchiseptica
Infection
1
ISSN: 23078316 (Online); ISSN: 23093331 (Print)
Mini Review
Monika Bhardwaj, Bhoj Raj Singh*, Prasanna Vadhana
Section of Epidemiology, Indian Veterinary Research Institute, Izatnagar243122, India
*Corresponding author: brs1762@gmail.com
ARTICLE HISTORY
ABSTRACT
Received:
Revised:
Accepted:
20131001
20131014
20131020
Among various pet animals, dogs have been men’s best companion and sharing the common
dwellings. Recent analysis indicated that in India’s dog population has increased by 58% since
2007. Therefore, concern for diseases of dogs has also increased. The dogs often suffer from many
diseases due to various managerial practices. One of such diseases is Bordetellosis often
synonymous with kennel cough. Kennel cough is multietiological disease but Bordetella
bronchiseptica, a gram negative bacterium, has been considered the main causative agent. It causes
canine infectious bronchitis characterized by frequent dry and hacking coughing with high
morbidity (~ 80%). This organism has also reported to cause zoonotic infections in human beings.
Though a well studied disease of dogs, little is understood about its epidemiology in developing
countries including India. The PCR and ELISA are the common diagnostic methods for Bordetella
bronchiseptica infection. However, detection of the pathogen does not mean the disease and many of
the cases of kennel cough may not be associated with bordetellosis. Further studies are necessary
to understand its epidemiology in developing countries for proper management of kennel cough
and other related problems.
All copyrights reserved to Nexus® academic publishers
Key Words: Kennelcough,
Bordetellosis, B. bronchiseptica,
Dog, India
ARTICLE CITATION: Bhardwaj M, Singh BR and Vadhana P (2013). Bordetella bronchiseptica infection and kennel cough in dogs. Adv.
Anim. Vet. Sci. 1 (3S): 1 4.
Dog, an affectionate and loyal pet learns rapidly to live with its
master with all his good and bad vices and is prone to acquire
even the human diseases. Dogs’ population in India was around
10.2 millions in 2012 (Bradley and Kingnov, 2012) and is
increasing rapidly with change in socioeconomic structure in
India. In India, pup population increased by 58% during 2007 to
2012 (Euromonitor International). Increase in population
means more diseases, more attention and more expense. There
are several diseases of pet dogs which make them suffer silently
but respiratory infections are nuisance to their owners too.
Moreover, with every cough, germs contaminate the
environment and cough sounds also disturb the owners’ peace.
The common respiratory infections of canines include canine
influenza, canine distemper, parasitic infestations (Dirofilaria
immitis, Trichuris vulpis), blastomycosis, histoplasmosis,
coccidioidiomycosis and canine infectious tracheobronchitis
(kennel cough). Among the cough causing infectious diseases
bordetellosis, often synonymous to kennel cough, is one of the
most prevalent respiratory infections of dogs. Kennel cough
characterized by frequent dry and hacking coughing high
morbidity but low mortality rate. Kennel cough is a multi
etiological disease but Bordetella bronchiseptica, the causal
organism of bordetellosis in dogs, is considered to be the main
etiologic agent.
Kennel Cough
Canine infectious tracheobronchitis or kennel cough affects
dogs of all ages. It is more common in dogs housed together in
rehoming centres, boarding or training kennels, pet shops,
shelters and veterinary clinics than in individually owned and
stray dogs. The primary etiologies are Bordetella bronchiseptica,
Canine Adenovirus (Bulut et al., 2013) and Canine Parainfluenza
virus (Erles et al. 2004). Some secondary agents including
Mammalian Reo virus, Canine respiratory Corona virus, CAV
type 1 (CAV1), Canine Herpes virus, Mycoplasma sp., Pseudomonas
sp., Pasteurella sp., Streptococcus sp., and coliforms invading after
some primary sickness may also induce the symptoms of kennel
cough. More specifically, Streptococcus equi subsp. zooepidemicus
and Mycoplasma cynos are often involved in causation of the
disease which last much longer and more serious than the one
caused by primary pathogens (Chalker et al., 2003 & 2004;
Rycroft et al., 2007).
Bordetella bronchiseptica, a Gramnegative bacterium,
colonizes the respiratory tract of wide range of mammalian
hosts including dogs, pigs, cats, rabbits, mice, rats, guinea pigs,
sheep, horses and bears (Lennox and Kelleher, 2009). The
interspecies transmission of B. bronchiseptica has been reported
among laboratory animals and between a rabbit and a human
patient. It may be transmitted between cats and dogs living in
close proximity and results in respiratory disease. It has already
showed by few researchers that isolates from dogs and cats
living in close proximity gave similar banding patterns in
pulsed field gel electrophoresis.
Besides B . bronchiseptica, Canine Adenovirus type 2 is one of
the other major etiologies of kennel cough (Bulut et al., 2013).
The virus replicates in nonciliated bronchiolar epithelial cells,
nasal mucosa, pharynx, tonsillar crypts, mucous cells in the
bronchi and trachea in peribronchial glands and type 2 alveolar
epithelial cells which results in interstitial pneumonia,
necrotizing bronchitis or bronchiolitis and bronchiolitis
obliterans. For diagnosis of CAV 2 infection either cultivation
Bordetella Bronchiseptica
Infection and Kennel Cough in Dogs
Advances in Animal and Veterinary Sciences. 1 (3S): 1 4
Special Issue 3 (Epidemiology and Animal Disease Investigations)
http://www.nexusacademicpublishers.com/journal/4
Bhardwaj et al (2013).
Bordetella Bronchiseptica
Infection
2
ISSN: 23078316 (Online); ISSN: 23093331 (Print)
of the virus in primary dog kidney cells or immunofluorescence
assay (Buonavoglia and Martella, 2007) or polymerase chain
reaction (Hu et al., 2001) or virus precipitation or
hemagglutination inhibition or complement fixation or agar gel
diffusion or virus neutralization tests have been used.
Another minor cause of kennel cough is Canine
parainfluenza virus (Erles et al., 2004). For the detection of
virus, hemadsorption or immunofluorescence, RTPCR (Erles
et al., 2004), hemagglutination inhibition and the virus
neutralization tests have been demonstrated.
Rarely Canine Herpes virus (Kawakami et al., 2010),
mammalian Reo virus, Canine distemper virus and canine
respiratory corona virus, S. equi subsp. zooepidemicus and
Mycoplasma cynos (Chalker et al., 2003) may also be cause of
kennel cough in dogs.
Clinical Features of Bordetellosis
Bordetellosis comprises of two clinical forms. The most
common uncomplicated form is associated with dry hacking
cough, gagging and retching behavior in dogs. The other form,
the complicated form characterized by wet cough, is common
in puppies or immunocompromised dogs. The disease is
associated with mucoid discharges and signs of systemic
infection including pyrexia, anorexia, chorioretinitis, vomiting
and diarrhoea leading to death of the pup. Incubation period
ranges between 1 to 8 days showing clinical signs for 12 weeks.
Infected dogs may shed the pathogen for 23 months after
clinical recovery (Edinboro et al., 2004).
The genus Bordetella, belonging to family Alcaligenaceae
(Gerlach et al., 2001), is comprised of nine species as B.
bronchiseptica, B. pertussis, B. parapertussis (human), B. parapertussis
(ovine), B. hinzii, B. avium, B. holmseii, B. trematum and B. petrii
(Mattoo and Cherry, 2005). Bordetella bronchiseptica, B. pertussis, B.
parapertussis and B. holmesii and have been associated with
zoonotic respiratory infections (Cotter and Miller, 2001).
Bordetella bronchiseptica had been known by many names earlier
viz., Bacillus bronchicanis, Alcaligenes bronchisepticus, Brucella
bronchiseptica, Alcaligenes bronchicanis, Haemophilus bronchisepticus
and finally MorenoLopez named it as B. bronchiseptica.
Besides kennel cough in dogs, B. bronchiseptica also causes
atrophic rhinitis in pigs (Shome et al., 2006), snuffles in rabbits,
suppurative bronchopneumonia in cats, suppurative
necrotizing bronchopneumonia in guinea pigs, atrophic rhinitis
in rats and respiratory infections in humans. Though B.
bronchiseptica is a recognized cause of kennel cough throughout
the world (Durgut et al., 2003), in India it is only a suspected
cause of kennel cough and has rarely been isolated from dogs
(Bonde et al., 1990; Reddy et al., 2003; Bhardwaj, 2013; Bhardwaj
et al., 2013).
Virulence Factors of Bordetella
Bordetella LPS is a highly immunogenic, major constituent of the
outer cell membrane and an important bacterial defense against
host immune responses including antibodies, complement,
antimicrobial peptides, and surfactants. The LPS of B.
bronchiseptica is highly charged due to the presence of uronic
acids in the ‘O’ specific side chains, thus it is capable of masking
negative charges present on the membranes to prevent an
efficient membrane attack by the cationic antibacterial peptides
(Preston and Maskell, 2001; Pilione et al., 2004; Schaeffer et al.,
2004; Goebel et al., 2008).
The genus Bordetella exhibits several virulence factors such
as adhesins, filamentous hemagglutinin, pertactin and fimbriae
as well as the cytotoxic factor adenylate cyclase toxin (ACT),
which differ among different species. The expression of these
virulence factors is controlled by the BvgAS twocomponent
system in response to certain environmental stimuli. The
regulatory system is characterized by antigenic modulation and
phase variation. The antigenic modulation decides the
activation and repression of synthesis of virulence factors which
are dependent on growth conditions whereas phase variation is
the result of mutations in vir gene which also modulates
virulence under appropriate cultural conditions.
Filamentous hemagglutinin, a 220 kDa rod shaped protein
encoded by fhaB gene, has been found to be associated with
virulence (Mattoo and Cherry, 2005). However, adhesion
proteins (Edwards et al., 2005) and pertactin (Sebaihia et al.,
2006) are considered as important virulence factors for
Bordetella species. Out of six major fimbrial subunits fim2 and
fim3 fimbrial subunit genes are responsible for bordetellae
adhesion to host cells (Mattoo and Cherry, 2005). The tracheal
cytotoxin TCT expressed by B. avium, a toxin lethal for tracheal
cells and degenerating bones is also present in B. bronchiseptica.
The adenylate cyclase toxin (ACT) also acts as an important
factor for virulence of Bordetella strains (Masin et al., 2006;
Vojtova et al., 2006; Buboltz et al., 2008). Besides all of these
toxins, dermonecrotic toxin (DNT), a heat labile intracellular
160 kDa protein of B. bronchiseptica may play a role in the
production of respiratory disease in dogs (Hoffmann and
Schmidt, 2004; Masin et al., 2006).
Diagnostic Techniques
The diagnosis of bordetellosis depends primarily on the
isolation of the B . bronchiseptica followed by the identification of
the organism by biochemical, serological and molecular
methods.
Bacterial Culture and Isolation
Bordetella species grow readily on blood agar, BordetGengou
agar, SmithBaskerville culture media and MacConkey agar at
optimum temperature of 37°C. The room temperature
incubation should be avoided because of overgrowth of other
bacteria suppressing B. bronchiseptica multiplication. In case of B.
pertussis it was showed that colony numbers decreased by 75%
on transportation of specimens at refrigerated temperature
(4oC).
Bordetella bronchiseptica strains have phase 1 (smooth, small,
convex and virulent) and phase 4 (rugged, large, and non
virulent) colonies. Biochemically, all strains are positive for
oxidase, catalase and citrate utilization (Denes et al., 2006) and
are negative for fermentation of any sugar, production of
gelatinase, DNase, indole and H2S.
Isolation of B . bronchiseptica from different sites of
respiratory tract of dogs (Gonazalez et al., 2006) and have
widely been reported. But, in India the pathogen is rarely
isolated from dogs (Bhardwaj, 2013; Bhardwaj et al., 2013).
However, in India it has been isolated several times from pigs
either associated with atrophic rhinitis or from healthy stocks
(Shome et al., 2006; Mazumder et al., 2012; Kumar, 2013). But
attempts have been made to isolate the organism from dogs
(Bonde et al., 1990; Reddy et al., 2003). Bhardwaj (2013)
reported isolation of B. bronchiseptica from an apparently healthy
dog but not from the dogs suffereing from kennel cough. They
used transport media (buffered peptone water with 0.8% agar
and horse serum) for transportation of nasal swabs and throat
swabs. The isolate of B. bronchiseptica was sensitive to
etrapenem, azithromycin, imipenam, ciprofloxacin, gentamicin,
piperacillin+tazobactum, tetracycline polymixinB and
nalidixic whereas resistant to vancomycin, lincomycin,
penicillin, cefotaxime, amoxicillin, ceftazidime, nitrofurantoin,
ceftriaxone and amoxicillin+ clavulanic acid (Bhardwaj et al.,
2013).
Advances in Animal and Veterinary Sciences. 1 (3S): 1 4
Special Issue 3 (Epidemiology and Animal Disease Investigations)
http://www.nexusacademicpublishers.com/journal/4
Bhardwaj et al (2013).
Bordetella Bronchiseptica
Infection
3
ISSN: 23078316 (Online); ISSN: 23093331 (Print)
Serological Methods
Due to difficulty in isolation, serological tests are often
considered good adjunct to facilitate diagnosis of kennel cough.
Several serological tests have been developed, standardized and
evaluated for detection of Bordetella antibodies for rapid
assessment of prevalence of the infection in laboratory animals
and other livestock. Commonly employed serological tests
include tube agglutination, indirect haemagglutination (Bonde
et al., 1990), microagglutination test (Denes, 2005; Kumar,
2013) and ELISA (Ellis et al., 2001; Kumar, 2013). In a study on
136 serum samples revealed that MAT titres positively correlate
with kennel cough symptoms and were high in sick dogs than
in apparently healthy dogs (Bhardwaj, 2013; Bhardwaj et al.,
2013). High Bordetella agglutinin titre (>128) in clinically
diseased dogs indicates that Bordetella infection might be an
important pathogen for kennel cough. Bhardwaj et al. (2013)
also used whole cell ELISA (wcELISA) and precipitated protein
ELISA (ppELISA) and found wcELISA much superior than
ppELISA as an aid for diagnosis of bordetellosis in dogs.
Molecular Diagnosis
Isolation and identification of B. bronchiseptica is a time
consuming process and serological techniques do not have good
specificity. As a result, polymerase chain reaction (PCR) has
been exploited to attain a fast and accurate detection of
Bordetella in clinical samples. For the identification of B.
bronchiseptica, genus specific and species specific PCRs (Hozbor
et al., 1999; Coutinho et al., 2009; Register and DeJong, 2006;
Koidl et al., 2007; Register and Nicholson, 2007; Xin et al., 2008;
Stępniewska and MarkowskaDaniel, 2010; Roorda et al., 2012;
Kumar, 2013; Bhardwaj et al., 2013) have been used. Ribotyping
and RAPD analysis are already combined by a few researchers
to evaluate genetic relatedness among canine B. bronchiseptica
isolates.
Bhardwaj et al. (2013) screened 147 dogs using genus and
species specific multiplex PCR but could not establish any
good association between clinical disease and detection of B.
bronchiseptica by PCR. The genus specific primers used are
A643BbalcF and A856BbalcR (Table 1). Species specific
primers used by different researchers (Table 2) have been
designed either from fim or fla gene sequences.
Name of primers
Sequence 5' 3'
Product
length (bp)
References
A643BbalcF
GCCGACCCACGCAGCGAATAT
213
Bhardwaj, 2013;
Kumar, 2013;
Bhardwaj et al., 2013
A856BbalcR
GGCCGGTGACGAGATAGCTGTG
B688BbalcF
ACCAACCGCATTTATTCCTACTA
324
B1012Bbalc
GGCCCTGGAGTTCGTATTTATG
Name of primers
Sequence 5' 3'
Product
length (bp)
References
425BBfim1 F
TGAACAATGGCGTGAAAGC
425
Xin et al., 2008
425BBfim2 R
TCGATAGTAGGACGGGAGGAT
237BBFla 4 F
TGGCGCCTGCCCTATC
237
Hozbor et al., 1999
237BBFla 2 R
AGGCTCCCAAGAGAGAAAGGCTT
There are only few reports on plasmid profiling of B.
bronchiseptica (Mazumder et al., 2012; Kumar, 2013). Bhardwaj et
al. (2013) could identify single plasmid (Molecular weight, 50
MDa) from a single isolate of B. bronchiseptica while several
isolates from pigs have been reported to harbor multiple
plasmids (Mazumder et al., 2012; Kumar, 2013).
Vaccines
Vaccination plays an important role in the prevention of
infectious canine tracheobronchitis (Datz, 2003a). Live
avirulent intranasal vaccines that combine B. bronchiseptica with
canine parainfluenza virus, and canine adenovirus 2, have been
reported to confer better protection than B. bronchiseptica
vaccines alone against kennel cough. Datz (2003b) reviewed
modified live vaccines available worldwide for kennel cough
intended for intranasal administration containing live, avirulent
B. bronchiseptica with or without canine parainfluenza virus and
canine adenovirus type 2. Intranasal as well as injectable
vaccines of B. bronchiseptica may afford substantial protection
against B. bronchiseptica (Ellis et al., 2001). In India, Reddy et al.
(2003) prepared inactivated aluminium hyrdroxide gel B.
bronchiseptica vaccine which protected vaccinated mice against
homologous B. bronchiseptica challenge.
Zoonotic Importance
Bordetella bronchiseptica infection in humans is rare but has been
documented in both healthy and immunosuppressed
individuals (Hewlett, 2000; Schneider and Gross, 2001; Lo et al.,
2001). Intranasal vaccination in dogs may be one of the major
risk factor for humans. Pneumonia, sepsis, and death have been
reported after infection in human beings (Shimoni et al., 2000).
CONCLUSIONS
Kennel cough is one of the severe respiratory tract infections of
dogs mostly in close confinements. Being a multietiological
disease, the identification of organism is a bit difficult. In
developing countries including India, this disease has not been
given much importance due to other important health problems
in dogs and thus majority of bordetellosis cases might remain
undiagnosed. This disease has major importance for dog
breeders and army stations where they keep dogs in close
association. This disease is of special concern due to its
contagiousness. Due to difficulty in diagnosis, some rapid,
reliable and economical tests need to be developed and
evaluated to reveal its epidemiology in developing countries.
Though PCR has been found to be the most rapid, sensitive (up
to 5 CFU) and specific method to detect B. bronchiseptica, its field
version needs evaluation. The MAT a wellevaluated test is
better diagnostic test than ELISA but lack the desired
sensitivity and specificity. Moreover, attempts for development
of risk free vaccines are also needed to combat bordetellosis in
dogs.
Table 1: List of genusspecific
primers for Bordetella spp.
Table 2: List of speciesspecific
primers for Bordetella
bronchiseptica
Advances in Animal and Veterinary Sciences. 1 (3S): 1 4
Special Issue 3 (Epidemiology and Animal Disease Investigations)
http://www.nexusacademicpublishers.com/journal/4
Bhardwaj et al (2013).
Bordetella Bronchiseptica
Infection
4
ISSN: 23078316 (Online); ISSN: 23093331 (Print)
REFERENCES
Bhardwaj M ( 2013). Evaluation of molecular and serologic al techniques f or
diagnosis of bordetellosis in dogs. M.V. Sc. thesis, Indian Veterinary
Research Institute, Izatnagar, India.
Bhardwaj M, Singh BR, Kumar S and Pawde AM (2013). Poor associ ation of
Bordetella bronchiseptica infection with kennel cough in dogs in northern
India. Universal J. Microbiol. Res. 1: 1014.
Bonde AV, Sherikar AA and Mulbagal AN (1990). Seroprevalence of Bordetella
bronchiseptica and canine p arainfluenza virus type 2 in dogs in Bombay.
J. Bombay Vet. Col. 2(2): 7982.
Bradley T and Kingnov R (2012). The dog economy is global but what is the
world's true canine capital? The Atlantic.
http://www.theatlantic.com/business/archive/2012/11/thedog
economyisglobalbutwhatistheworldstruecanine
capital/265155/
Buboltz AM, Nicho lson TL, Parette MR, Hester SE, Parkhill J and Harvill ET
(2008). Replacement of adenylate cyclase toxin in a lineage of Bordetella
bronchiseptica. J. Bacteriol. 190(15): 55025511.
Bulut O, Yapici O, Avci O, Simsek A, Atli K, Dik I, Yavru S, Hasircioglu
S, Kale M and Mamak N (2013). The Serological and Virological
Investigation of Canine Adenovirus Infection on th e Dogs. Scientific
World J. http://dx.doi.org/10.1155/2013/5 87024.
Buonavoglia C and Martella V (2007). Ca nine respiratory viruses. Vet Res.
38:35573.
Chalker VJ, Brooks HW and Brownlie J (2003). The association of
Streptococcus equi sub sp. zooepidemicus with canine infect ious respiratory
disease. Vet. Microbiol. 95: 149 156.
Chalker VJ, Owen WM, Paterson C, Barker E, Brooks H, Rycroft AN and
Brownlie J (2004). Mycoplasmas associated with canine infect ious
respiratory disease. Microbiol. 150: 349134 97.
Cotter PA and Miller JF (2001). Bordetella. In: Principles of bacterial
pathogenesis. E. A. Groisman (ed.), London, U K Academic Press. 619
674.
Coutinho T A , Bernardi M L , Cardoso MRI, Borowski S M, Moreno A M and
Barcellos DESN (2009). Performance of transport and selective media
for swine Bordetella bronchiseptica recovery and it com parison to
polymerase chain reaction detection. Braz. J. Microbiol. 40: 470 479.
Datz C (2003a). Bordetella inf ections in dogs and cats: Pathogenesis, clinical
signs, and diagnosis. Compend. Contin. Educ. Pract. Vet . 25: 896901.
Datz C (2003b). Bordetella infect ions in dogs and cats: Treatment and
prevention. Compend.Contin. Educ. Pract. Vet. 25: 902 914.
Denes AL (2005). Investigation regarding isolation, identification and
carriage of Bo rdetella bronchiseptica in pigs, horses and dogs. Bulletin
USAMV ClujNapoca, Seria Med. Vet. 62:109112.
Denes AL, Rapuntean Gh, Cosmina Cuc, F iN N, Nadas G and Calina D
(2006). Biochemic al tests used for identification of Bordetella
bronchiseptica. Buletinul USAMVCN. 63: 6770.
Durgut R, Borku MK, Ozkok S, Pekkaya S, Guzel M and Ozkanlar YE (2003).
Kennel cough syndrome of dogs observed in Ankara province. Indian
Vet. J. 80(8): 743745.
Edinboro CH, Ward MP and Glickm an LT (2004). A placebo controlled trial
of two intranasal vaccines to prevent tracheobronchitis (kennel cough)
in dogs entering a humane shelter. Prev. Vet. Med. 62: 8999.
Edwards JA, Groathouse NA and Boitano S (2005). Bordetella bronchiseptica
adherence to cilia is mediated by multiple adhesin f actors and blocked
by surfactant protein A. Infect Immun. 73(6):361826.
Ellis JA, Haines DM, West KH, Burr JH, Dayton A, Townsend HGG, Kanara
EW, Konoby C, Crichlo w A, Martin K and Headrick G (2001). Effect
of vaccination on experim ental infection with Bordetella bronchiseptica in
dogs. J. Am. Vet. Med. Assoc. 218:367375.
Erles K, Dubovi EJ, Brooks HW and Brownlie J (200 4). Longitudinal study of
viruses associated with canine infectious respiratory disease. J. Clin.
Microbiol. 42:45244529.
Gerlach G, von Wintzingerode F, Middendorf B and Gross R (20 01).
Evolutionary trendsin the genus Bordetella. Mic robes Infect. 3: 6172.
Goebel EM, Wolfe DN, E lder K, Stibitz S and Harvill ET (2008). ‘O’ antigen
protects Bordetella parapertussis from complement. Infect. Immun. 76:
17741780.
Gonzalez GM, Rosales ME, Morales, GB and Crespo JAM (2006). Isolation
and characterization of Bordetella bronchiseptica strains from canine
origin. Vet Mex. 37(3): 313332.
Hewlett EL (200 0). Bordetella sp ecies. In: Principles and p ractice of inf ectious
diseases.Mandell, G.L., Bennett, J.E., Dolin, R., eds. Philadelphia:
Churchill Livingston, 241422 p.
Hoffmann C and Schmidt G (2004). CNF and DN T. Rev. Physiol. Biochem.
Pharmacol. 152: 4963.
Hozbor D, Fouque F and Guiso N (1999). Detection of Bordetella bronchiseptica
by polymerase chain reaction. Res. Microbiol. 150: 33334 1.
Hu RL, Huang G, Qiu W, Zhong ZH, Xi a XZ and Yin Z (2001). Detection and
differentiation of CAV1 and CAV2 by polymerase chain reaction,
Vet. Res. Commun. 25:7784.
Kawakami K, Oga wa H, Maeda K, Im ai A, Ohashi E, Matsunaga S, Tohya Y,
Ohshima T andMochizuki M (2010). Nosocomial Outbreak of Serious
Canine Inf ectious Tracheobronchitis (Kennel Cough) Caused b y
Canine Herpesvirus Infection. J Clin Microbiol. 4 8(4): 11761181.
Koidl C, Bozic M, Burmeister A, Hess M, Marth E and Kessler HH (2007).
Detection and Differentiation of Bordetella spp. by Real Time PCR. J.
Clin. Microbiol. 45(2): 347350.
Kumar S (2013). Studies on occurrence of Bordetella infection in pigs. M.V.Sc.
thesis, Indian Veterinary Research Institute, Izatnagar, India.
Lennox AM and Kelleher S (2009). Bacterial and parasitic diseases of rabb its.
Veterinary Clinics of North America: Exotic Anim al Practice. 12(3):
519530.
Lo Re V, Brennan PJ, Wadlin J, Weaver R and Nach amkin I (2001). Infected
branchial cleft cyst due to Bordetella bronchiseptica in an
immunocompetent patient. J. Clin. Microbiol. 39: 4210 2412.
Masin J, Sebo P and Locht C (2006). Bordetella protein toxins. In: The
comprehensive sourcebook of bacterial protein toxins. Alouf, J. E. and
Popoff, M. R. (eds.). SaDiego, CA: Academic Press. 291 309 p.
Mattoo S and Cherry JD (2005). Molecular pathogenesis, epidemiology and
clinical manifestations of respiratory infections due to Bordetella pertussis
and other Bordetella subspecies. Clin. Microb iol. Rev. 18: 326382.
Mazumder Y, Das A, Kar D, Shome B R, Dutta BK and Rahman H ( 2012).
Isolation of Bordetella Bronchis eptica from pigs in North East India. J.
Anim. Sci .Adv. 2(4): 396406.
Pilione MR, Pishko EJ, Preston A, Maskell DJ and Harv ill ET ( 2004). pagP is
required for resistance to antibody m ediated complement lysis during
Bordetella bronchiseptica respiratory infection. Infect. Immun. 72: 2837
2842.
Preston A and Maskell D (2001). The m olecular genetics and role in infection
of lipopolysaccharide biosynthesis in the Bordetellae. J. Endotoxin.
Res. 7: 251 261.
Reddy GS, Sharma MSR and Srinivasan VA (2003). Efficacy of inactivated
Bordetella bronchiseptica vaccine in mice and dogs. Indian Vet. J. 80(1): 1
2.
Register KB and DeJong KD ( 2006). Analytical verification of mu ltiplex PCR
for identification of Pasteurella multocida and Bo rdetella bronchiseptica from
swine. Vet. Microbiol. 117: 201 210.
Register KB and Nicholson TL (2007). Misident ification of Bordetella
bronchiseptica as Bordetella pertussis using a newly described realtim e
PCR targeting the pertactin gene. J. Med. Microbiol. 56: 16 081610.
Roorda L, Buitenwerf J, Ossewaarde JM and van der Zee A (2011). A realtime
PCR assay with impr oved specif icity for detection and discrimination
of all clinically relevant Bordetella sp ecies by the presence and
distribution of three insertion sequence elements. BMC Res. N otes. 4:
11.
Rycroft AN, Tsounakou E and Chalker V (2007). Serologic al evidence of
Mycoplasma cynos infection in canine infectious respiratory disease. Vet.
Microbiol. 120: 358 362.
Schaeffer LM, McCormack FX, Wu H and Weiss AA (2004). Interactions of
pulmonary collectins with Bordetella b ronchiseptica and Bo rdetella pertussis
lipopolysaccharide elucid ate the structural basis of their antimicrobial
activities. Infect. Immun. 72: 71247130.
Schneider B. and Gross R (2001). Bordetella pertussis : Increasing problems with
a wellknown pathogen and its relatives. In: Em erging bacterial
pathogens. Muhldorf er, I., Schafer, K.P., eds. Basel, Switzerland: S.
Karger Publishing. 123136 p.
Sebaihia M, Preston A, Maskell DJ, Kuzmiak H, Connell TD, King ND et al.
(2006). Comparison of the genome sequence of th e poultry pathogen
Bordetella avium with those of B. bronchiseptica, B. pertussis and B.
parapertussis reveals extensive diversity in surface structures associated
with host interaction. J. Bacteriol. 188: 60026015.
Shimoni Z, Niven M, Mosenkis M and G reif J (2000). Fatal pneumonia due to
Bordetella bronchiseptica. Isr. Med. Assoc. J. 2: 402403.
Shome BR, Shome R, Rahman H, Mazumder Y, Das A, Rahman MM and
Bujarbaruah KM (2006). Characterization of Bordetella bronchiseptica
associated with atrophic rhinitis outbreak in pigs. Indian J. Anim. S ci.
76(6): 433436.
Stępniewska K and Markowska DI (2010). Evaluation of PCR test for
detection of dermonecrotoxin of Bordetella Bronchiseptica. Bull. Vet. Inst.
Pulawy. 54: 495 499.
Vojtova J, Kamanova J and Sebo P (2006). Bordetella adenylate cyclase toxin: A
swift saboteur of host defense. Curr. Opin. Microbiol. 9: 6975.
Xin W, ShiFeng Y and Fang W (200 8). Development and application of PCR
assay for detection of Bordetella bronchiseptica in rabbits . Pathol. Hyg. 9th
World Rabbit Congress: 8791179.
... Bordetella bronchiseptica is a zoonotic and one of the major respiratory pathogen which causes infectious tracheobronchitis, commonly known as kennel cough in dogs (Bhardwaj et al., 2013;Kalhoro et al., 2015). The disease mostly occurs when a large numbers of dogs are housed together in pet shops, in breeding or boarding kennels, in shelters, in research facilities and even in veterinary clinics (Bhardwaj et al., 2013). ...
... Bordetella bronchiseptica is a zoonotic and one of the major respiratory pathogen which causes infectious tracheobronchitis, commonly known as kennel cough in dogs (Bhardwaj et al., 2013;Kalhoro et al., 2015). The disease mostly occurs when a large numbers of dogs are housed together in pet shops, in breeding or boarding kennels, in shelters, in research facilities and even in veterinary clinics (Bhardwaj et al., 2013). Infection with B. bronchiseptica can increase the pathogenicity of different viral and bacterial pathogens by destroying the ciliated epithelial cells (Register, 2004). ...
... Uncontrolled and overpopulated packs of stray dogs can transmit many infections to humans and other animals including life-threatening diseases such as rabies as well as less threating diseases like B. bronchiseptica infections (Anonymous, 2015). The agent is a common inhabitant of the respiratory tract of several animal species, and one of the main microorganism of the kennel cough in dogs particularly in crowded shelters (Chalker et al., 2003;Bhardwaj et al., 2013). To date, there are few studies on the presence of B. bronchisepticaon in dogs and no data regarding characterization of strains in Turkey (Maden et al., 2000;Erdeger, 2002). ...
Article
Full-text available
Bordetella bronchiseptica (B. bronchiseptica) is the most important pathogen associated with kennel cough in dogs. The presence of B. bronchiseptica in pet dogs and shelter dogs with clinical respiratory disease was investigated in present study. The genetic relatedness among the strains was determined to evaluate the role of stray dogs in spread of B. bronchiseptica to pet dogs by detection of virulence genes such as filamentous hemagglutinin (fha), pertactin (prn) and dermonecrotic toxin (dnt). We also performed the random amplified polymorphic DNA (RAPD) assay. A total of 96 B. bronchiseptica were isolated from stray and pet dogs. The fha, prn and dnt virulence genes were detected in 86, 83.3 and 61.4% strains, respectively by polymerase chain reaction (PCR) techniques. The most common genotype from stray and pet dogs was fha+prn+dnt+ as detected in 37.5% and 11.4% of all the strains, respectively. The RAPD assay showed that 3 different patterns were obtained from 96 B. bronchiseptica strains. Sixty one (63.5%) of them were clustered in one main group and then further placed in another 2 sub-groups by RAPD assay. Genetic association was seen between the B. bronchiseptica strains from stray and pet dogs. In conclusion, this study revealed that B. bronchiseptica is present at a higher rate in stray dogs than pet dogs. Stray dogs might have a significant role in the transmission of B. bronchiseptica to pet dogs. (C)2016 PVJ. All rights reserved
... Bordetella bronchiseptica is an infectious bacterium that normally lives in upper respiratory tract. B. bronchiseptica may be transmitted among dogs living in close places which are considered one of the most prevalent respiratory infections of dogs. it is clinically characterized by frequent dry and hacking coughing with high morbidity and low mortality rate [39]. ...
Article
Full-text available
The objective of this article was to briefly review about the most common bacterial and fungal infections in pet animals especially dogs by describing information about the causative agent, clinical signs and symptoms, route of transmission and diagnosis of the infection. In last years, the pet population has increased and the interest in having pets where are became sharing in our daily life in many purposes such as protection, entertainment, hunting and helping their owner, etc... . Thus, the increase of the knowledge and awareness of dog owners regarding these diseases enable them to significantly reduce the occurrence of these infections. Bacterial infections such as Pasteurella, Salmonella, Brucella, Yersinia enterocolitica, Leptospira, Campylobacter, Bordetella bronchiseptica, and Coxiella burnetii, and fungal infections including Aspergillosis, Candidiasis and Dermatophytosis are the most common bacterial and fungal infections affecting dogs.
Article
Full-text available
Kennel cough is a multifactorial disease occurring all over the world; however, its epidemiology is still not fully understood. To the authors' knowledge, no studies monitoring the occurrence of infectious agents responsible for kennel cough have been carried out in Poland. Therefore, the objective of our study was to determine which of the four pathogens most frequently isolated in other countries are predominant in northeastern Poland. Swabs from the upper respiratory tract and tracheal lavage fluids from dogs (n = 40) exhibiting symptoms of this disease were analysed. Canine herpesvirus, canine parainfluenza virus, canine adenovirus type 2 and Bordetella bronchiseptica were identified by polymerase chain reaction. At least one of the above-listed infectious agents was found in all dogs. The predominant pathogen within the area under our study, both in mono-and co-infections, was canine herpesvirus (32/40), whereas canine adenovirus type 2 occurred least frequently (4/40). The effectiveness of detection of selected pathogens from both types of study material was also compared. Tracheal lavage fluid was more suitable for the isolation of canine herpes virus, canine parainfluenza virus, and Bordetella bronchiseptica. Swabs from the upper respiratory tract were more suitable for the isolation of canine adenovirus type 2. Canine, canine herpesvirus, canine parainfluenza virus, respiratory disease
Article
Full-text available
DNA extracted from serum samples collected from 114 apparently healthy and 71 clinically sick pet dogs of different age, sex, breed and place was used as templet for detection of Bordetella infection through genus specific PCR (gPCR) targeting alc gene and species specific PCR (sPCR) targeting fim gene. Bordetella DNA could be detected in serum of 7 apparently healthy and 7 sick dogs both with gPCR and sPCR. Clinical status (p= 0.35), age (p= 0.31) and sex (p= 0.72) had no significant association with detection of Bordetella DNA in serum samples. Of the 14 samples positive 12 (85.7%) were from Kerala and two (14.3%) from Manipur dogs. Sequencing of the gel purified gPCR product targeting alc gene revealed 95% homology with alc gene sequence of several species of Bordetella and sequencing of the gel purified sPCR product targeting fim gene revealed 100% identity with Bordetella bronchiseptica fim gene. The study suggested that B. bronchiseptica might be the most common bordetellae affecting pet dogs irrespective of clinical illness. The study concluded that PCR with serum extracted DNA template can be an option for rapid detection of Bordetella infection in pet dogs
Article
Full-text available
Bordetella bronchiseptica is isolated from naso-pharyngeal swab obtained from a dog suffering with hacking cough and identified by using standard methods. The isolate was used for production of vaccine, agglutination and challenge studies. The dogs vaccinated with inactivated aluminium hydroxde gel B. bronchiseptica vaccine showed agglutination titres of <4,170.66 and 640 on day 0, 14 and 28 respectively. The vaccine protected all vaccinated mice when challenged with virulent B. bronchiseptica.
Data
Full-text available
Respiratory tract infections (RTI) are quite common in dogs especially in dogs housed together in re-homing centres, boarding or training kennels, pet shops, shelters and veterinary clinics. The contagious RTIs are commonly diagnosed as canine infectious tracheobronchitis or kennel cough. Though kennel cough is a multi-etiological disease, Bordetella bronchiseptica is considered to be the important causal agents of kennel cough besides Canine Adenovirus Type 2, Canine Para-influenza virus, Pseudomonas spp., Pasteurella spp., Mycoplasma and Streptococcus spp. Thus to administer the right treatment correct etiological diagnosis is necessary. In the present study conventional bacteriological, serological and molecular method (PCR) were evaluated for their diagnostic potential for bordetellosis in dogs. Nasal and/or throat swabs of 147 apparently healthy (78) and clinically sick (with cough, 69) dogs of different breed, age and sex were collected from Ahemdabad, Amroha, Chennai, Delhi, Lucknow, Meerut, Mumbai, Palampur, and Bareilly and examined for presence of Bordetella. Isolation of B. bronchiseptica was made from only one dog while with PCR Bordetella genus specific and B. bronchiseptica species specific PCR, 7 (4.8%) and 3 (2.0%) samples, respectively were found positive. The standardized multiplex PCR using alc gene and fla gene/ fim gene sequences was specific and sensitive (could detect up to 5 CFU). Serum samples from 136 dogs were tested for Bordetella specific antibodies using micro-agglutination test (MAT), whole cell antigen ELISA (wcELISA) and precipitated protein antigen ELISA (ppELISA). Out of 136 serum samples, 38 (27.9%), 69 (50.7%), 132 (97.1%) were detected positive with MAT, wcELISA and ppELISA, respectively. Except MAT none of the three serological tests had specificity required for diagnosis. For detecting Bordetella, PCR was more sensitive than bacteriological isolation. Neither isolation nor detection of Bordetella by PCR nor detection of Bordetella antibodies with ELISA had significant correlation with clinical sickness (kennel cough). Although health status, age and breed had no association with detection of Bordetella antibodies, females appeared to be significantly (p, 0.033) more prone for carriage of Bordetella bronchiseptica infection.
Article
A placebo-controlled field trial was conducted to compare the effectiveness of intranasal (IN) vaccines containing Bordetella bronchiseptica and canine-parainfluenza virus, with (IN-BPA) or without (IN-BP) canine-adenovirus type 2, for prevention of kennel cough at a humane shelter. Dogs were examined on admission to the shelter and those without respiratory signs of disease were assigned daily, on a rotating basis, to receive one of three vaccines. We enrolled 972 healthy dogs. Dogs were monitored for up to 30 days post-vaccination for coughing and other clinical signs of respiratory disease. Thirty-three (10.7%; 95% confidence interval (CI): 7.2%, 14.2%) dogs in the IN-BP group, 36 (10.2%; CI: 7.0%, 13.4%) [corrected] dogs in the IN-BPA group, and 42 (13.5%; CI: 9.7%, 17.3%) [corrected] dogs in the IN-P group coughed spontaneously for > or = 1 day within 30 days of vaccination (P = 0.37). The IN-BP and IN-BPA vaccines were 20.7 and 24.4% effective, respectively, in reducing coughing compared with a placebo vaccine. The strongest prognostic factor for coughing (regardless of vaccine group) was the number of days spent at the shelter, with each additional day increasing the risk of coughing by 3% (95% CI: 1.01, 1.06) [corrected] The low incidence of coughing in the shelter during this study precluded observation of differences in vaccine effectiveness. No differences in vaccine-associated adverse events (coughing, sneezing, nasal or ocular discharge) were noted during the first 3 days post-administration or thereafter.
Article
In this study, 55 dogs from different kennels showing clinical signs of kennel cough syndrome in the province of Ankara were used. The most prominent and obvious clinical sign of the animals was a persistent dry hacking cough or an intermittent cough elicited by palpation. They revealed neutrophilia (16-18 × 106/ml) with a left shift and lymphopenia (0.2-04×106/ml). All of the pharyngeal swabs and transtracheal aspirates yielded positive results in bacterial culture. Pasteurella spp., coagulase positive Staphylococcus spp., Enterobacter spp., Escherichia coli, Klebsiella pneumonia and Streptococcus spp. were isolated.
Article
Bordetella bronchiseptica is a common cause of respiratory infection in dogs and cats. The disease has a high morbidity but low mortality and is diagnosed in individual pets as well as in group situations, such as boarding kennels and breeding facilities. Bordetella organisms have several pathogenic properties that result in clinical signs of respiratory tract disease. Diagnosis of bordetellosis is often based on the history and physical examination findings, but bacterial isolation and ancillary tests are also useful.
Article
The causes of mortality among pigs and piglets suffering from chronic respiratory disease with curvature of turbinate bone in an organized piggery in Meghalaya were investigated. Out of 50 pigs maintained at the farm, 24 (48.0%) were affected. Out of 9 postmortem samples and 12 nasal swabs from live pigs processed for bacterial isolation, 11(52.3%) yielded the isolation of B. brochiseptica. In vitro antibiotic sensitivity revealed more than 50% (6) isolates resistant to ampicillin, doxycycline, erythromycin, chloramphenicol, gentamycin and ciprofloxacin. In haemagglutination test, all the 11 B. brochiseptica isolates agglutinated rabbit RBC. The soluble proteins extracted from 6 isolates of B. bronchiseptica showed 23-27 major polypeptide bands within the molecular weight range of 114.0- 14.4kDa. Most of the immunogenic protein bands separated in western blot were in the range of 20-100kDa. Plasmid analysis revealed 3 plasmid profiles and the number of plasmids varied from 1-4 with molecular size ranging from 3.5-24.0kb. Dendogram analysis revealed similarity ranging from more than 78-97% among the isolates. The restriction digestion of wild plasmids from B bronchiseptica with EcoRI suggested 3 recognition sites for I isolate and 2 sites for the other isolates. The present study established the involvement of B. bronchiseptica as causative agent in atrophic rhinitis in the pigs based on the isolation of the organisms and their characterization.
Article
Dogs and cats with respiratory disease caused by Bordetella bronchiseptica are often managed with antibiotic therapy and supportive care, although mild infections may not require treatment. Appropriate antibiotics are based on susceptibility data and the ability to reach therapeutic concentrations in respiratory secretions. Other potentially useful medications include antitussives, bronchodilators, and antiinflammatories. Vaccines are available for both dogs and cats to help prevent bordetellosis, and research is ongoing to refine current products and develop new ones.
Article
The aim of the study was the evaluation and optimisation of PCR test for the detection of dermonecrotoxin gene (DNT) of Bordetella bronchiseptica. For the optimisation of the test, vaccine strain B16 was used. The optimisation procedure included: estimation of optimal Mg2+ concentration, annealing temperature, numbers of cycles, as well as sensitivity. The specificity of PCR test was checked with DNA of other pathogens existing in pigs' respiratory tract. The elaborated test was specific and sensitive to detect DNT gene of B. bronchiseptica, in both clinical samples, as well as in pure culture of the bacteria.
Data
Bordetellosis is one of the important respiratory tract infections causing infectious atrophic rhinitis (AR) in pig herds. The disease propagates in subclinical state for long affecting productivity of the piggery thus the diagnosis of the infection at an early stage and in carrier pigs may be economically important for successful control and eradication of the disease. In the present study occurrence of B. bronchiseptica infection in backyard and farmed pigs of different age, sex and breed was determined through conventional bacterioscopy, polymerase chain reaction (PCR) and serology (MAT and ELISA). In the study, from 392 pigs, 358 serum samples and 316 deep nasal swabs were collected and screened for B.bronchiseptica antibodies and antigen, respectively. From 316 nasal swabs collected from pigs of Uttar Pradesh (274) and Nagaland (42), B. bronchiseptica could be isolated from six (1.92%) nasal swabs (5 from UP pigs and one from Nagaland). The isolation rate varied from 0% to 3.6 % in nasal swabs collected from pigs at different places. Presence of the pathogen in nasal swabs had no association either with age, sex, breed, place or rearing system indicating ubiquitous prevalence of the infection in pigs. Though all the six B. bronchiseptica isolates had similar plasmid profile, all the strains varied significantly in their antimicrobial sensitivity patterns and belonged to different antibiogram types indicating the diversity in the isolates from different pig populations. With the multiplex PCR (mPCR) standardized in the study using alc gene (genus specific) and fla gene and fim2 gene (species specific) sequences, of the 316 samples 26 (8.2%) were positive for genus specific PCR and 14 (4.4%) for species specific PCR indicating that there might be infection of brodetellae other than B. bronchiseptica in pigs. Further mPCR had better sensitivity (5 CFU) and rapidity in detecting nasal excretion of Bordetella in pigs than conventional isolation method. Positivity with mPCR did not vary significantly among pigs of different breeds but age, sex, rearing system and locality appeared to be the important determinants affecting carriage of the pathogen. Of the 358 pig sera tested with MAT, wc-ELISA and pp-ELISA, 242 (67.6%), 309 (86.3 %) and 331 (92.5%), respectively were positive for B. bronchiseptica antibodies indicating high prevalence of infection in swine herds. However, at 100% sensitivity of the serological tests, specificity remained <15% and it could not be enhanced to >50% without hampering the sensitivity (<80%). Therefore, serological tests cannot be used for diagnosis the diseases but MAT may be used as swine herd screening test for bordetellosis.
Data
Economical piggery production demands scientifically raised healthy livestock. However, in India, pig rearing is still practiced in old fashioned poorly hygienic pig sties. Many kinds of diseases haunt the piggeries in India either causing outbreaks or isolated cases of morbidity and mortality leading to heavy economic losses to poor farmers. Besides hygiene and scientific breeding several other epidemiological factors including age, breed, sex, place and management are key factors that contribute for precipitation, spread and persistence of the diseases in herds of livestock. Bordetellosis or atrophic rhinitis (AR) caused by Bordetella bronchiseptica in pigs is an economically important disease because in addition to high morbidity and mortality in nursery/growing and finishing piggery units, persistence of infection leads to decreased rate of weight gain, inefficient feed conversion and increased time to market pigs. Bordetella bronchiseptica infection is primarily associated with atrophic rhinitis in growing pigs and major contributory pathogen for precipitation of progressive atrophic rhinitis. Clinical signs of atrophic rhinitis or B. bronchiseptica infection are sneezing, abnormal nasal discharge or epistaxis, and shortening/ deformity of snout. Bordetella bronchiseptica infections of swine respiratory tract are enzootic in many herds and are reported frequently from almost all countries. However, there are only few reports on occurrence of B. bronchiseptica infection in pigs in India. Therefore, this study was planned to determine occurrence of Bordetella infection in pigs in Uttar Pradesh and Nagaland, two major states for production and consumption of pork. The study was planned to estimate the burden of bordetellosis in pigs in relation to age, sex and breed of pigs reared under conventional backyard piggery and on organized pig farms. From 392 animals included in the study, serum samples and nasal swabs were collected from 358 and 316 animals, respectively. Of the sampled animals 45 piglet (0-2 month), 196 grower (2-8 month) and 151 adults (>8 months) belonged to non-descript indigenous (6), large black Yorkshire (42) and cross bred (344) groups. Of the sampled animals 212 were male and 180 female and were either under backyard rearing (215) or under organized piggery (177). The collected nasal swab and serum samples were analyzed for presence of the organism (isolation through conventional method, antigen detection with PCR) and Bordetella antibodies (with microagglutination test, wc-ELISA, pp-ELISA), respectively. On bacterioscopic analysis of 316 pig nasal swabs B. bronchiseptica could be isolated from six (1.92%) samples. The isolation rate in the present study varied from place to place (0% to 3.6%). Although no B. bronchiseptica could be isolated from indigenous pigs and piglets, no significant difference was observed in isolation rates of B. bronchiseptica in samples collected from pigs of different age, sex, breed and place reared under different rearing systems. A total of 14 samples were positive for species specific amplicon while 26 for genus specific amplicon in mPCR. Among the 14 positive samples for Bordetella bronchiseptica specific PCR, 8 (3.9%) were from pigs under backyard piggeries and six (3.8%) were from pigs on organized piggeries with no significant (P, 0.828) difference among pigs reared under the two systems of piggery. None of the samples from indigenous pig was positive while sample of one large black Yorkshire and thirteen cross bred pigs were positive for B. bronchiseptica specific amplicon in PCR. Among the positive samples 7 each were from grower and adult animals but none from piglets. Of the positives with PCR, 9 samples were from male and 5 from female pigs showing significant difference in carriage of the pathogen by the animals of the two sexes (P, <0.001). Detection of B. bronchiseptica by PCR in more number of pigs than isolation indicated that PCR method was more sensitive than the conventional method as reported earlier in several studies. Therefore, multiplex PCR may be recommended for rapid diagnosis of the B. bronchiseptica infection at an early stage and in carrier pigs. In the present study only 6.7% serum samples from Gurgaon (Haryana), 66.3% samples from Nagaland and 71.8% samples from Uttar Pradesh were positive for Bordetella bronchiseptica agglutinins in MAT. Besides geography of the place of pig rearing, farming system appeared to be another important determinant for MAT positivity. Significantly (P, <0.001) more samples from backyard (84.5%) pigs were positive than the pigs reared on organized farms (44.7%). Of the positive samples, 115 were from male animals (58.4%) and 127 were from females (78.9%). A total of 34.2% piglets, 55% growers and 90% adults were positive with MAT showing positive correlation of prevalence of B. bronchiseptica agglutinins with advancing age. Similarly, 5 (83.3%) indigenous, 3 (8.8%) large black Yorkshire and 234 (73.6%) cross bred pigs sampled were positive with MAT for Bordetella agglutinins. At cut-off titre (≥125), to have 100% sensitivity 309 (86.3%) sera samples were positive for anti B. bronchiseptica IgGs with wc-ELISA. State wise, 9 (60%) of Haryana, 70 (73.7%) of Nagaland and 230 (92.7%) of Uttar Pradesh pig serum samples were positive. Among the positives, 182 samples were from pigs reared under backyard farming (88.3%) and 127 were from pigs under organized (83.6%) farming system (P, 0.192). Of 309 pig serum samples positive with wc-ELISA, 170 were from male (86.3%) and 139 were from female (86.3%) pigs. Age appeared to be a significant determinant (P, <0.001) for positivity in wc-ELISA. Positivity in wc-ELISA was positively correlated with increasing age as only 63.2% piglets were positive in contrast to 88.2% and 92.1% positives among grower and adult pigs, respectively. Similar to age, breed was also a significant (P, <0.001) determinant for positivity in wc-ELISA as all the serum samples of indigenous pigs, 67.6% of large black Yorkshire and 88.9% of cross-bred pigs were positive with wc-ELISA. At cut-off value of 117 for 100% sensitivity of pp-ELISA, 241, 78, and 12 of pig sera samples from Uttar Pradesh (97.1%), Nagaland (82.1%) and Gurgaon (80%) (Haryana), respectively, were positive for B. bronchiseptica antibodies. Farming system had no significant effect on positivity in pp-ELISA as 92.2% pigs under backyard and 94.1% of pigs under organized piggeries were positive for Bordetella antibodies. Similarly no marked difference was evident in pp-ELISA positivity among male and female pig. However, age was positively correlated with pp-ELISA titres as with the wc-ELISA titres. Significantly (P, <0.001) less number of piglets (65.8%) were positive than grower (95.9%) and adult (96.7%) pigs. Similar to age, difference was significant in pp-ELISA results for the serum samples of different pig breeds as all the samples from indigenous animals while 76.5% samples of large black Yorkshire and 94.7% samples from cross-bred pigs were positive. In the present study, whole cell antigen ELISA (wc-ELISA) and cell lysate precipitated protein ELISA (pp-ELISA) though proved to be much more sensitive than any other test used in the study for diagnosis of bordetellosis. The pp-ELISA gives more positive results than wc-ELISA in pigs probably due to use of proteins as antigen which are often more antigenic then other bacterial components. Briefly, the conclusions of the study are as under: 1. Isolation of the organism, though difficult is the most authentic indication of infection and association with the disease. 2. PCR is more sensitive than conventional bacterioscopy. 3. ELISA (whole cell or precipitated protein) has limited value to be used as diagnostic test. 4. MAT can be used as diagnostic test for screening pig herd. 5. More work is needed to standardize and evaluate serological diagnostics by using other antigens specific for the disease. 6. Due to variation in antibiogram of isolates from different places no uniform antibiotic regimen may be recommended for therapeutic use.