Bordetella Bronchiseptica Infection and Kennel Cough in Dogs.

Abstract

Among various pet animals, dogs have been men’s best companion and sharing the common dwellings. Recent analysis indicated that in India’s dog population has increased by 58% since 2007. Therefore, concern for diseases of dogs has also increased. The dogs often suffer from many diseases due to various managerial practices. One of such diseases is Bordetellosis often synonymous with kennel cough. Kennel cough is multi–etiological disease but Bordetella bronchiseptica, a gram negative bacterium, has been considered the main causative agent. It causes canine infectious bronchitis characterized by frequent dry and hacking coughing with high morbidity (~ 80%). This organism has also reported to cause zoonotic infections in human beings. Though a well studied disease of dogs, little is understood about its epidemiology in developing countries including India. The PCR and ELISA are the common diagnostic methods for Bordetella bronchiseptica infection. However, detection of the pathogen does not mean the disease and many of the cases of kennel cough may not be associated with bordetellosis. Further studies are necessary to understand its epidemiology in developing countries for proper management of kennel cough and other related problems.

Full text

Advances in Animal and Veterinary Sciences. 1 (3S): 1 – 4
Special Issue – 3 (Epidemiology and Animal Disease Investigations)
http://www.nexusacademicpublishers.com/journal/4
Bhardwaj et al (2013).
Bordetella Bronchiseptica
Infection
1
ISSN: 2307–8316 (Online); ISSN: 2309–3331 (Print)
Mini Review
Monika Bhardwaj, Bhoj Raj Singh*, Prasanna Vadhana
Section of Epidemiology, Indian Veterinary Research Institute, Izatnagar–243122, India
*Corresponding author: brs1762@gmail.com
ARTICLE HISTORY
ABSTRACT
Received:
Revised:
Accepted:
2013–10–01
2013–10–14
2013–10–20
Among various pet animals, dogs have been men’s best companion and sharing the common
dwellings. Recent analysis indicated that in India’s dog population has increased by 58% since
2007. Therefore, concern for diseases of dogs has also increased. The dogs often suffer from many
diseases due to various managerial practices. One of such diseases is Bordetellosis often
synonymous with kennel cough. Kennel cough is multi–etiological disease but Bordetella
bronchiseptica, a gram negative bacterium, has been considered the main causative agent. It causes
canine infectious bronchitis characterized by frequent dry and hacking coughing with high
morbidity (~ 80%). This organism has also reported to cause zoonotic infections in human beings.
Though a well studied disease of dogs, little is understood about its epidemiology in developing
countries including India. The PCR and ELISA are the common diagnostic methods for Bordetella
bronchiseptica infection. However, detection of the pathogen does not mean the disease and many of
the cases of kennel cough may not be associated with bordetellosis. Further studies are necessary
to understand its epidemiology in developing countries for proper management of kennel cough
and other related problems.
All copyrights reserved to Nexus® academic publishers
Key Words: Kennel–cough,
Bordetellosis, B. bronchiseptica,
Dog, India
ARTICLE CITATION: Bhardwaj M, Singh BR and Vadhana P (2013). Bordetella bronchiseptica infection and kennel cough in dogs. Adv.
Anim. Vet. Sci. 1 (3S): 1 – 4.
Dog, an affectionate and loyal pet learns rapidly to live with its
master with all his good and bad vices and is prone to acquire
even the human diseases. Dogs’ population in India was around
10.2 millions in 2012 (Bradley and Kingnov, 2012) and is
increasing rapidly with change in socio–economic structure in
India. In India, pup population increased by 58% during 2007 to
2012 (Euromonitor International). Increase in population
means more diseases, more attention and more expense. There
are several diseases of pet dogs which make them suffer silently
but respiratory infections are nuisance to their owners too.
Moreover, with every cough, germs contaminate the
environment and cough sounds also disturb the owners’ peace.
The common respiratory infections of canines include canine
influenza, canine distemper, parasitic infestations (Dirofilaria
immitis, Trichuris vulpis), blastomycosis, histoplasmosis,
coccidioidiomycosis and canine infectious tracheobronchitis
(kennel cough). Among the cough causing infectious diseases
bordetellosis, often synonymous to kennel cough, is one of the
most prevalent respiratory infections of dogs. Kennel cough
characterized by frequent dry and hacking coughing high
morbidity but low mortality rate. Kennel cough is a multi–
etiological disease but Bordetella bronchiseptica, the causal
organism of bordetellosis in dogs, is considered to be the main
etiologic agent.
Kennel Cough
Canine infectious tracheobronchitis or kennel cough affects
dogs of all ages. It is more common in dogs housed together in
re–homing centres, boarding or training kennels, pet shops,
shelters and veterinary clinics than in individually owned and
stray dogs. The primary etiologies are Bordetella bronchiseptica,
Canine Adenovirus (Bulut et al., 2013) and Canine Parainfluenza
virus (Erles et al. 2004). Some secondary agents including
Mammalian Reo virus, Canine respiratory Corona virus, CAV
type 1 (CAV–1), Canine Herpes virus, Mycoplasma sp., Pseudomonas
sp., Pasteurella sp., Streptococcus sp., and coliforms invading after
some primary sickness may also induce the symptoms of kennel
cough. More specifically, Streptococcus equi subsp. zooepidemicus
and Mycoplasma cynos are often involved in causation of the
disease which last much longer and more serious than the one
caused by primary pathogens (Chalker et al., 2003 & 2004;
Rycroft et al., 2007).
Bordetella bronchiseptica, a Gram–negative bacterium,
colonizes the respiratory tract of wide range of mammalian
hosts including dogs, pigs, cats, rabbits, mice, rats, guinea pigs,
sheep, horses and bears (Lennox and Kelleher, 2009). The
interspecies transmission of B. bronchiseptica has been reported
among laboratory animals and between a rabbit and a human
patient. It may be transmitted between cats and dogs living in
close proximity and results in respiratory disease. It has already
showed by few researchers that isolates from dogs and cats
living in close proximity gave similar banding patterns in
pulsed field gel electrophoresis.
Besides B . bronchiseptica, Canine Adenovirus type 2 is one of
the other major etiologies of kennel cough (Bulut et al., 2013).
The virus replicates in non–ciliated bronchiolar epithelial cells,
nasal mucosa, pharynx, tonsillar crypts, mucous cells in the
bronchi and trachea in peribronchial glands and type 2 alveolar
epithelial cells which results in interstitial pneumonia,
necrotizing bronchitis or bronchiolitis and bronchiolitis
obliterans. For diagnosis of CAV 2 infection either cultivation
Bordetella Bronchiseptica
Infection and Kennel Cough in Dogs

Advances in Animal and Veterinary Sciences. 1 (3S): 1 – 4
Special Issue – 3 (Epidemiology and Animal Disease Investigations)
http://www.nexusacademicpublishers.com/journal/4
Bhardwaj et al (2013).
Bordetella Bronchiseptica
Infection
2
ISSN: 2307–8316 (Online); ISSN: 2309–3331 (Print)
of the virus in primary dog kidney cells or immunofluorescence
assay (Buonavoglia and Martella, 2007) or polymerase chain
reaction (Hu et al., 2001) or virus precipitation or
hemagglutination inhibition or complement fixation or agar gel
diffusion or virus neutralization tests have been used.
Another minor cause of kennel cough is Canine
parainfluenza virus (Erles et al., 2004). For the detection of
virus, hemadsorption or immunofluorescence, RT–PCR (Erles
et al., 2004), hemagglutination inhibition and the virus
neutralization tests have been demonstrated.
Rarely Canine Herpes virus (Kawakami et al., 2010),
mammalian Reo virus, Canine distemper virus and canine
respiratory corona virus, S. equi subsp. zooepidemicus and
Mycoplasma cynos (Chalker et al., 2003) may also be cause of
kennel cough in dogs.
Clinical Features of Bordetellosis
Bordetellosis comprises of two clinical forms. The most
common uncomplicated form is associated with dry hacking
cough, gagging and retching behavior in dogs. The other form,
the complicated form characterized by wet cough, is common
in puppies or immuno–compromised dogs. The disease is
associated with mucoid discharges and signs of systemic
infection including pyrexia, anorexia, chorioretinitis, vomiting
and diarrhoea leading to death of the pup. Incubation period
ranges between 1 to 8 days showing clinical signs for 1–2 weeks.
Infected dogs may shed the pathogen for 2–3 months after
clinical recovery (Edinboro et al., 2004).
The genus Bordetella, belonging to family Alcaligenaceae
(Gerlach et al., 2001), is comprised of nine species as B.
bronchiseptica, B. pertussis, B. parapertussis (human), B. parapertussis
(ovine), B. hinzii, B. avium, B. holmseii, B. trematum and B. petrii
(Mattoo and Cherry, 2005). Bordetella bronchiseptica, B. pertussis, B.
parapertussis and B. holmesii and have been associated with
zoonotic respiratory infections (Cotter and Miller, 2001).
Bordetella bronchiseptica had been known by many names earlier
viz., Bacillus bronchicanis, Alcaligenes bronchisepticus, Brucella
bronchiseptica, Alcaligenes bronchicanis, Haemophilus bronchisepticus
and finally Moreno–Lopez named it as B. bronchiseptica.
Besides kennel cough in dogs, B. bronchiseptica also causes
atrophic rhinitis in pigs (Shome et al., 2006), snuffles in rabbits,
suppurative bronchopneumonia in cats, suppurative
necrotizing bronchopneumonia in guinea pigs, atrophic rhinitis
in rats and respiratory infections in humans. Though B.
bronchiseptica is a recognized cause of kennel cough throughout
the world (Durgut et al., 2003), in India it is only a suspected
cause of kennel cough and has rarely been isolated from dogs
(Bonde et al., 1990; Reddy et al., 2003; Bhardwaj, 2013; Bhardwaj
et al., 2013).
Virulence Factors of Bordetella
Bordetella LPS is a highly immunogenic, major constituent of the
outer cell membrane and an important bacterial defense against
host immune responses including antibodies, complement,
antimicrobial peptides, and surfactants. The LPS of B.
bronchiseptica is highly charged due to the presence of uronic
acids in the ‘O’ specific side chains, thus it is capable of masking
negative charges present on the membranes to prevent an
efficient membrane attack by the cationic antibacterial peptides
(Preston and Maskell, 2001; Pilione et al., 2004; Schaeffer et al.,
2004; Goebel et al., 2008).
The genus Bordetella exhibits several virulence factors such
as adhesins, filamentous hemagglutinin, pertactin and fimbriae
as well as the cytotoxic factor adenylate cyclase toxin (ACT),
which differ among different species. The expression of these
virulence factors is controlled by the BvgAS two–component
system in response to certain environmental stimuli. The
regulatory system is characterized by antigenic modulation and
phase variation. The antigenic modulation decides the
activation and repression of synthesis of virulence factors which
are dependent on growth conditions whereas phase variation is
the result of mutations in vir gene which also modulates
virulence under appropriate cultural conditions.
Filamentous hemagglutinin, a 220 kDa rod shaped protein
encoded by fhaB gene, has been found to be associated with
virulence (Mattoo and Cherry, 2005). However, adhesion
proteins (Edwards et al., 2005) and pertactin (Sebaihia et al.,
2006) are considered as important virulence factors for
Bordetella species. Out of six major fimbrial subunits fim2 and
fim3 fimbrial subunit genes are responsible for bordetellae
adhesion to host cells (Mattoo and Cherry, 2005). The tracheal
cytotoxin TCT expressed by B. avium, a toxin lethal for tracheal
cells and degenerating bones is also present in B. bronchiseptica.
The adenylate cyclase toxin (ACT) also acts as an important
factor for virulence of Bordetella strains (Masin et al., 2006;
Vojtova et al., 2006; Buboltz et al., 2008). Besides all of these
toxins, dermonecrotic toxin (DNT), a heat labile intracellular
160 kDa protein of B. bronchiseptica may play a role in the
production of respiratory disease in dogs (Hoffmann and
Schmidt, 2004; Masin et al., 2006).
Diagnostic Techniques
The diagnosis of bordetellosis depends primarily on the
isolation of the B . bronchiseptica followed by the identification of
the organism by biochemical, serological and molecular
methods.
Bacterial Culture and Isolation
Bordetella species grow readily on blood agar, Bordet–Gengou
agar, Smith–Baskerville culture media and MacConkey agar at
optimum temperature of 37°C. The room temperature
incubation should be avoided because of overgrowth of other
bacteria suppressing B. bronchiseptica multiplication. In case of B.
pertussis it was showed that colony numbers decreased by 75%
on transportation of specimens at refrigerated temperature
(4oC).
Bordetella bronchiseptica strains have phase 1 (smooth, small,
convex and virulent) and phase 4 (rugged, large, and non–
virulent) colonies. Biochemically, all strains are positive for
oxidase, catalase and citrate utilization (Denes et al., 2006) and
are negative for fermentation of any sugar, production of
gelatinase, DNase, indole and H2S.
Isolation of B . bronchiseptica from different sites of
respiratory tract of dogs (Gonazalez et al., 2006) and have
widely been reported. But, in India the pathogen is rarely
isolated from dogs (Bhardwaj, 2013; Bhardwaj et al., 2013).
However, in India it has been isolated several times from pigs
either associated with atrophic rhinitis or from healthy stocks
(Shome et al., 2006; Mazumder et al., 2012; Kumar, 2013). But
attempts have been made to isolate the organism from dogs
(Bonde et al., 1990; Reddy et al., 2003). Bhardwaj (2013)
reported isolation of B. bronchiseptica from an apparently healthy
dog but not from the dogs suffereing from kennel cough. They
used transport media (buffered peptone water with 0.8% agar
and horse serum) for transportation of nasal swabs and throat
swabs. The isolate of B. bronchiseptica was sensitive to
etrapenem, azithromycin, imipenam, ciprofloxacin, gentamicin,
piperacillin+tazobactum, tetracycline polymixin–B and
nalidixic whereas resistant to vancomycin, lincomycin,
penicillin, cefotaxime, amoxicillin, ceftazidime, nitrofurantoin,
ceftriaxone and amoxicillin+ clavulanic acid (Bhardwaj et al.,
2013).

Advances in Animal and Veterinary Sciences. 1 (3S): 1 – 4
Special Issue – 3 (Epidemiology and Animal Disease Investigations)
http://www.nexusacademicpublishers.com/journal/4
Bhardwaj et al (2013).
Bordetella Bronchiseptica
Infection
3
ISSN: 2307–8316 (Online); ISSN: 2309–3331 (Print)
Serological Methods
Due to difficulty in isolation, serological tests are often
considered good adjunct to facilitate diagnosis of kennel cough.
Several serological tests have been developed, standardized and
evaluated for detection of Bordetella antibodies for rapid
assessment of prevalence of the infection in laboratory animals
and other livestock. Commonly employed serological tests
include tube agglutination, indirect haemagglutination (Bonde
et al., 1990), micro–agglutination test (Denes, 2005; Kumar,
2013) and ELISA (Ellis et al., 2001; Kumar, 2013). In a study on
136 serum samples revealed that MAT titres positively correlate
with kennel cough symptoms and were high in sick dogs than
in apparently healthy dogs (Bhardwaj, 2013; Bhardwaj et al.,
2013). High Bordetella agglutinin titre (>128) in clinically
diseased dogs indicates that Bordetella infection might be an
important pathogen for kennel cough. Bhardwaj et al. (2013)
also used whole cell ELISA (wcELISA) and precipitated protein
ELISA (ppELISA) and found wcELISA much superior than
ppELISA as an aid for diagnosis of bordetellosis in dogs.
Molecular Diagnosis
Isolation and identification of B. bronchiseptica is a time
consuming process and serological techniques do not have good
specificity. As a result, polymerase chain reaction (PCR) has
been exploited to attain a fast and accurate detection of
Bordetella in clinical samples. For the identification of B.
bronchiseptica, genus specific and species specific PCRs (Hozbor
et al., 1999; Coutinho et al., 2009; Register and DeJong, 2006;
Koidl et al., 2007; Register and Nicholson, 2007; Xin et al., 2008;
Stępniewska and Markowska–Daniel, 2010; Roorda et al., 2012;
Kumar, 2013; Bhardwaj et al., 2013) have been used. Ribotyping
and RAPD analysis are already combined by a few researchers
to evaluate genetic relatedness among canine B. bronchiseptica
isolates.
Bhardwaj et al. (2013) screened 147 dogs using genus and
species specific multiplex PCR but could not establish any
good association between clinical disease and detection of B.
bronchiseptica by PCR. The genus specific primers used are
A643Bbalc–F and A856Bbalc–R (Table 1). Species specific
primers used by different researchers (Table 2) have been
designed either from fim or fla gene sequences.
Name of primers
Sequence 5' – 3'
Product
length (bp)
References
A643Bbalc–F
GCCGACCCACGCAGCGAATAT
213
Bhardwaj, 2013;
Kumar, 2013;
Bhardwaj et al., 2013
A856Bbalc–R
GGCCGGTGACGAGATAGCTGTG
B688Bbalc–F
ACCAACCGCATTTATTCCTACTA
324
B1012Bbalc
GGCCCTGGAGTTCGTATTTATG
Name of primers
Sequence 5' – 3'
Product
length (bp)
References
425BBfim–1 F
TGAACAATGGCGTGAAAGC
425
Xin et al., 2008
425BBfim–2 R
TCGATAGTAGGACGGGAGGAT
237BBFla 4 F
TGGCGCCTGCCCTATC
237
Hozbor et al., 1999
237BBFla 2 R
AGGCTCCCAAGAGAGAAAGGCTT
There are only few reports on plasmid profiling of B.
bronchiseptica (Mazumder et al., 2012; Kumar, 2013). Bhardwaj et
al. (2013) could identify single plasmid (Molecular weight, 50
MDa) from a single isolate of B. bronchiseptica while several
isolates from pigs have been reported to harbor multiple
plasmids (Mazumder et al., 2012; Kumar, 2013).
Vaccines
Vaccination plays an important role in the prevention of
infectious canine tracheobronchitis (Datz, 2003a). Live
avirulent intranasal vaccines that combine B. bronchiseptica with
canine parainfluenza virus, and canine adenovirus– 2, have been
reported to confer better protection than B. bronchiseptica
vaccines alone against kennel cough. Datz (2003b) reviewed
modified live vaccines available worldwide for kennel cough
intended for intranasal administration containing live, avirulent
B. bronchiseptica with or without canine parainfluenza virus and
canine adenovirus type 2. Intranasal as well as injectable
vaccines of B. bronchiseptica may afford substantial protection
against B. bronchiseptica (Ellis et al., 2001). In India, Reddy et al.
(2003) prepared inactivated aluminium hyrdroxide gel B.
bronchiseptica vaccine which protected vaccinated mice against
homologous B. bronchiseptica challenge.
Zoonotic Importance
Bordetella bronchiseptica infection in humans is rare but has been
documented in both healthy and immuno–suppressed
individuals (Hewlett, 2000; Schneider and Gross, 2001; Lo et al.,
2001). Intranasal vaccination in dogs may be one of the major
risk factor for humans. Pneumonia, sepsis, and death have been
reported after infection in human beings (Shimoni et al., 2000).
CONCLUSIONS
Kennel cough is one of the severe respiratory tract infections of
dogs mostly in close confinements. Being a multi–etiological
disease, the identification of organism is a bit difficult. In
developing countries including India, this disease has not been
given much importance due to other important health problems
in dogs and thus majority of bordetellosis cases might remain
undiagnosed. This disease has major importance for dog
breeders and army stations where they keep dogs in close
association. This disease is of special concern due to its
contagiousness. Due to difficulty in diagnosis, some rapid,
reliable and economical tests need to be developed and
evaluated to reveal its epidemiology in developing countries.
Though PCR has been found to be the most rapid, sensitive (up
to 5 CFU) and specific method to detect B. bronchiseptica, its field
version needs evaluation. The MAT a well–evaluated test is
better diagnostic test than ELISA but lack the desired
sensitivity and specificity. Moreover, attempts for development
of risk free vaccines are also needed to combat bordetellosis in
dogs.
Table 1: List of genus–specific
primers for Bordetella spp.
Table 2: List of species–specific
primers for Bordetella
bronchiseptica

Advances in Animal and Veterinary Sciences. 1 (3S): 1 – 4
Special Issue – 3 (Epidemiology and Animal Disease Investigations)
http://www.nexusacademicpublishers.com/journal/4
Bhardwaj et al (2013).
Bordetella Bronchiseptica
Infection
4
ISSN: 2307–8316 (Online); ISSN: 2309–3331 (Print)
REFERENCES
Bhardwaj M ( 2013). Evaluation of molecular and serologic al techniques f or
diagnosis of bordetellosis in dogs. M.V. Sc. thesis, Indian Veterinary
Research Institute, Izatnagar, India.
Bhardwaj M, Singh BR, Kumar S and Pawde AM (2013). Poor associ ation of
Bordetella bronchiseptica infection with kennel cough in dogs in northern
India. Universal J. Microbiol. Res. 1: 10–14.
Bonde AV, Sherikar AA and Mulbagal AN (1990). Seroprevalence of Bordetella
bronchiseptica and canine p arainfluenza virus type 2 in dogs in Bombay.
J. Bombay Vet. Col. 2(2): 79–82.
Bradley T and Kingnov R (2012). The dog economy is global but what is the
world's true canine capital? The Atlantic.
http://www.theatlantic.com/business/archive/2012/11/the–dog–
economy–is–global–but–what–is–the–worlds–true–canine–
capital/265155/
Buboltz AM, Nicho lson TL, Parette MR, Hester SE, Parkhill J and Harvill ET
(2008). Replacement of adenylate cyclase toxin in a lineage of Bordetella
bronchiseptica. J. Bacteriol. 190(15): 5502–5511.
Bulut O, Yapici O, Avci O, Simsek A, Atli K, Dik I, Yavru S, Hasircioglu
S, Kale M and Mamak N (2013). The Serological and Virological
Investigation of Canine Adenovirus Infection on th e Dogs. Scientific
World J. http://dx.doi.org/10.1155/2013/5 87024.
Buonavoglia C and Martella V (2007). Ca nine respiratory viruses. Vet Res.
38:355–73.
Chalker VJ, Brooks HW and Brownlie J (2003). The association of
Streptococcus equi sub sp. zooepidemicus with canine infect ious respiratory
disease. Vet. Microbiol. 95: 149– 156.
Chalker VJ, Owen WM, Paterson C, Barker E, Brooks H, Rycroft AN and
Brownlie J (2004). Mycoplasmas associated with canine infect ious
respiratory disease. Microbiol. 150: 3491–34 97.
Cotter PA and Miller JF (2001). Bordetella. In: Principles of bacterial
pathogenesis. E. A. Groisman (ed.), London, U K Academic Press. 619–
674.
Coutinho T A , Bernardi M L , Cardoso MRI, Borowski S M, Moreno A M and
Barcellos DESN (2009). Performance of transport and selective media
for swine Bordetella bronchiseptica recovery and it com parison to
polymerase chain reaction detection. Braz. J. Microbiol. 40: 470 –479.
Datz C (2003a). Bordetella inf ections in dogs and cats: Pathogenesis, clinical
signs, and diagnosis. Compend. Contin. Educ. Pract. Vet . 25: 896–901.
Datz C (2003b). Bordetella infect ions in dogs and cats: Treatment and
prevention. Compend.Contin. Educ. Pract. Vet. 25: 902 –914.
Denes AL (2005). Investigation regarding isolation, identification and
carriage of Bo rdetella bronchiseptica in pigs, horses and dogs. Bulletin
USAMV Cluj–Napoca, Seria Med. Vet. 62:109–112.
Denes AL, Rapuntean Gh, Cosmina Cuc, F iN N, Nadas G and Calina D
(2006). Biochemic al tests used for identification of Bordetella
bronchiseptica. Buletinul USAMV–CN. 63: 67–70.
Durgut R, Borku MK, Ozkok S, Pekkaya S, Guzel M and Ozkanlar YE (2003).
Kennel cough syndrome of dogs observed in Ankara province. Indian
Vet. J. 80(8): 743–745.
Edinboro CH, Ward MP and Glickm an LT (2004). A placebo –controlled trial
of two intranasal vaccines to prevent tracheobronchitis (kennel cough)
in dogs entering a humane shelter. Prev. Vet. Med. 62: 89–99.
Edwards JA, Groathouse NA and Boitano S (2005). Bordetella bronchiseptica
adherence to cilia is mediated by multiple adhesin f actors and blocked
by surfactant protein A. Infect Immun. 73(6):3618–26.
Ellis JA, Haines DM, West KH, Burr JH, Dayton A, Townsend HGG, Kanara
EW, Konoby C, Crichlo w A, Martin K and Headrick G (2001). Effect
of vaccination on experim ental infection with Bordetella bronchiseptica in
dogs. J. Am. Vet. Med. Assoc. 218:367–375.
Erles K, Dubovi EJ, Brooks HW and Brownlie J (200 4). Longitudinal study of
viruses associated with canine infectious respiratory disease. J. Clin.
Microbiol. 42:4524–4529.
Gerlach G, von Wintzingerode F, Middendorf B and Gross R (20 01).
Evolutionary trendsin the genus Bordetella. Mic robes Infect. 3: 61–72.
Goebel EM, Wolfe DN, E lder K, Stibitz S and Harvill ET (2008). ‘O’ antigen
protects Bordetella parapertussis from complement. Infect. Immun. 76:
1774–1780.
Gonzalez GM, Rosales ME, Morales, GB and Crespo JAM (2006). Isolation
and characterization of Bordetella bronchiseptica strains from canine
origin. Vet Mex. 37(3): 313–332.
Hewlett EL (200 0). Bordetella sp ecies. In: Principles and p ractice of inf ectious
diseases.Mandell, G.L., Bennett, J.E., Dolin, R., eds. Philadelphia:
Churchill Livingston, 2414–22 p.
Hoffmann C and Schmidt G (2004). CNF and DN T. Rev. Physiol. Biochem.
Pharmacol. 152: 49–63.
Hozbor D, Fouque F and Guiso N (1999). Detection of Bordetella bronchiseptica
by polymerase chain reaction. Res. Microbiol. 150: 333–34 1.
Hu RL, Huang G, Qiu W, Zhong ZH, Xi a XZ and Yin Z (2001). Detection and
differentiation of CAV–1 and CAV–2 by polymerase chain reaction,
Vet. Res. Commun. 25:77–84.
Kawakami K, Oga wa H, Maeda K, Im ai A, Ohashi E, Matsunaga S, Tohya Y,
Ohshima T andMochizuki M (2010). Nosocomial Outbreak of Serious
Canine Inf ectious Tracheobronchitis (Kennel Cough) Caused b y
Canine Herpesvirus Infection. J Clin Microbiol. 4 8(4): 1176–1181.
Koidl C, Bozic M, Burmeister A, Hess M, Marth E and Kessler HH (2007).
Detection and Differentiation of Bordetella spp. by Real Time PCR. J.
Clin. Microbiol. 45(2): 347–350.
Kumar S (2013). Studies on occurrence of Bordetella infection in pigs. M.V.Sc.
thesis, Indian Veterinary Research Institute, Izatnagar, India.
Lennox AM and Kelleher S (2009). Bacterial and parasitic diseases of rabb its.
Veterinary Clinics of North America: Exotic Anim al Practice. 12(3):
519–530.
Lo Re V, Brennan PJ, Wadlin J, Weaver R and Nach amkin I (2001). Infected
branchial cleft cyst due to Bordetella bronchiseptica in an
immunocompetent patient. J. Clin. Microbiol. 39: 4210 –2412.
Masin J, Sebo P and Locht C (2006). Bordetella protein toxins. In: The
comprehensive sourcebook of bacterial protein toxins. Alouf, J. E. and
Popoff, M. R. (eds.). SaDiego, CA: Academic Press. 291 –309 p.
Mattoo S and Cherry JD (2005). Molecular pathogenesis, epidemiology and
clinical manifestations of respiratory infections due to Bordetella pertussis
and other Bordetella subspecies. Clin. Microb iol. Rev. 18: 326–382.
Mazumder Y, Das A, Kar D, Shome B R, Dutta BK and Rahman H ( 2012).
Isolation of Bordetella Bronchis eptica from pigs in North East India. J.
Anim. Sci .Adv. 2(4): 396–406.
Pilione MR, Pishko EJ, Preston A, Maskell DJ and Harv ill ET ( 2004). pagP is
required for resistance to antibody – m ediated complement lysis during
Bordetella bronchiseptica respiratory infection. Infect. Immun. 72: 2837–
2842.
Preston A and Maskell D (2001). The m olecular genetics and role in infection
of lipopolysaccharide biosynthesis in the Bordetellae. J. Endotoxin.
Res. 7: 251– 261.
Reddy GS, Sharma MSR and Srinivasan VA (2003). Efficacy of inactivated
Bordetella bronchiseptica vaccine in mice and dogs. Indian Vet. J. 80(1): 1–
2.
Register KB and DeJong KD ( 2006). Analytical verification of mu ltiplex PCR
for identification of Pasteurella multocida and Bo rdetella bronchiseptica from
swine. Vet. Microbiol. 117: 201– 210.
Register KB and Nicholson TL (2007). Misident ification of Bordetella
bronchiseptica as Bordetella pertussis using a newly described real–tim e
PCR targeting the pertactin gene. J. Med. Microbiol. 56: 16 08–1610.
Roorda L, Buitenwerf J, Ossewaarde JM and van der Zee A (2011). A real–time
PCR assay with impr oved specif icity for detection and discrimination
of all clinically relevant Bordetella sp ecies by the presence and
distribution of three insertion sequence elements. BMC Res. N otes. 4:
11.
Rycroft AN, Tsounakou E and Chalker V (2007). Serologic al evidence of
Mycoplasma cynos infection in canine infectious respiratory disease. Vet.
Microbiol. 120: 358– 362.
Schaeffer LM, McCormack FX, Wu H and Weiss AA (2004). Interactions of
pulmonary collectins with Bordetella b ronchiseptica and Bo rdetella pertussis
lipopolysaccharide elucid ate the structural basis of their antimicrobial
activities. Infect. Immun. 72: 7124–7130.
Schneider B. and Gross R (2001). Bordetella pertussis : Increasing problems with
a wellknown pathogen and its relatives. In: Em erging bacterial
pathogens. Muhldorf er, I., Schafer, K.P., eds. Basel, Switzerland: S.
Karger Publishing. 123–136 p.
Sebaihia M, Preston A, Maskell DJ, Kuzmiak H, Connell TD, King ND et al.
(2006). Comparison of the genome sequence of th e poultry pathogen
Bordetella avium with those of B. bronchiseptica, B. pertussis and B.
parapertussis reveals extensive diversity in surface structures associated
with host interaction. J. Bacteriol. 188: 6002–6015.
Shimoni Z, Niven M, Mosenkis M and G reif J (2000). Fatal pneumonia due to
Bordetella bronchiseptica. Isr. Med. Assoc. J. 2: 402–403.
Shome BR, Shome R, Rahman H, Mazumder Y, Das A, Rahman MM and
Bujarbaruah KM (2006). Characterization of Bordetella bronchiseptica
associated with atrophic rhinitis outbreak in pigs. Indian J. Anim. S ci.
76(6): 433–436.
Stępniewska K and Markowska DI (2010). Evaluation of PCR test for
detection of dermonecrotoxin of Bordetella Bronchiseptica. Bull. Vet. Inst.
Pulawy. 54: 495– 499.
Vojtova J, Kamanova J and Sebo P (2006). Bordetella adenylate cyclase toxin: A
swift saboteur of host defense. Curr. Opin. Microbiol. 9: 69–75.
Xin W, ShiFeng Y and Fang W (200 8). Development and application of PCR
assay for detection of Bordetella bronchiseptica in rabbits . Pathol. Hyg. 9th
World Rabbit Congress: 879–1179.