RetractedArticlePDF Available

Stimulus-triggered fate conversion of somatic cells into pluripotency

Authors:

Abstract and Figures

Here we report a unique cellular reprogramming phenomenon, called stimulus-triggered acquisition of pluripotency (STAP), which requires neither nuclear transfer nor the introduction of transcription factors. In STAP, strong external stimuli such as a transient low-pH stressor reprogrammed mammalian somatic cells, resulting in the generation of pluripotent cells. Through real-time imaging of STAP cells derived from purified lymphocytes, as well as gene rearrangement analysis, we found that committed somatic cells give rise to STAP cells by reprogramming rather than selection. STAP cells showed a substantial decrease in DNA methylation in the regulatory regions of pluripotency marker genes. Blastocyst injection showed that STAP cells efficiently contribute to chimaeric embryos and to offspring via germline transmission. We also demonstrate the derivation of robustly expandable pluripotent cell lines from STAP cells. Thus, our findings indicate that epigenetic fate determination of mammalian cells can be markedly converted in a context-dependent manner by strong environmental cues.
Content may be subject to copyright.
ARTICLE doi:10.1038/nature12968
Stimulus-triggered fate conversion of
somatic cells into pluripotency
Haruko Obokata
1,2,3
, Teruhiko Wakayama
3
{, Yoshiki Sasai
4
, Koji Kojima
1
, Martin P. Vacanti
1,5
, Hitoshi Niwa
6
, Masayuki Yamato
7
& Charles A. Vacanti
1
Here we report a unique cellular reprogramming phenomenon, called stimulus-triggered acquisition of pluripotency
(STAP), which requires neither nuclear transfer nor the introduction of transcription factors. In STAP, strong external
stimuli such as a transient low-pH stressor reprogrammed mammalian somatic cells, resulting in the generation of plu-
ripotent cells. Through real-time imaging of STAP cells derived from purified lymphocytes, as well as gene rearrange-
ment analysis, we found that committed somatic cells give rise to STAP cells by reprogramming rather than selection.
STAP cells showed a substantial decrease in DNA methylation in the regulatory regions of pluripotency marker genes.
Blastocyst injection showed that STAP cells efficiently contribute to chimaeric embryos and to offspring via germline
transmission. We also demonstrate the derivation of robustly expandable pluripotent cell lines from STAP cells. Thus, our
findings indicate that epigenetic fate determination of mammalian cells can be markedly converted in a context-dependent
manner by strong environmental cues.
In the canalization view of Waddington’s epigenetic landscape, fates
of somatic cells are progressivelydetermined as cellular differentiation
proceeds, like going downhill. It is generally believed that reversal of
differentiated status requires artificial physical or genetic manipulation
of nuclear function such as nuclear transfer
1,2
or the introduction of
multiple transcription factors
3
. Here we investigated the question of
whether somatic cells can undergo nuclear reprogramming simply in
response to external triggers without direct nuclear manipulation. This
type of situation is known to occur in plants—drastic environmental
changes can convert mature somatic cells (for example, dissociated carrot
cells) into immature blastema cells, from which a whole plant structure,
including stalks and roots, develops in the presence of auxins
4
. A chal-
lenging question is whether animal somatic cellshave a similar potential
that emerges under special conditions. Over the past decade, the pres-
ence of pluripotent cells (or closely relevant cell types) in adult tissues
has been a matter of debate, for which conflicting conclusions have
been reported by various groups
5–11
. However, no study so far has proven
that such pluripotent cells can arise from differentiated somatic cells.
Haematopoietic cells positive for CD45 (leukocyte common antigen) are
typicallineage-committed somatic cells thatnever expresspluripotency-
related markers such as Oct4 unless they are reprogrammed
12,13
.We
therefore addressed the question of whether splenic CD45
1
cells could
acquire pluripotency by drastic changes in their external environment
such as those caused by simple chemical perturbations.
Low pH triggers fate conversion in somatic cells
CD45
1
cells were sorted by fluorescence-activated cell sorting (FACS)
from the lymphocyte fraction of postnatal spleens (1-week old) of
C57BL/6 mice carrying an Oct4-gfp transgene
14
, and were exposed
to various types of strong, transient, physical and chemical stimuli
(described below). We examined these cells for activation of the Oct4
promoter after culture for several days in suspension using DMEM/F12
medium supplemented with leukaemia inhibitory factor (LIF) and B27
(hereafter called LIF1B27 medium). Amongthe various perturbations,
we were particularly interested in low-pH perturbations for two reasons.
First, as shown below, low-pH treatment turned out to be most effective
for the induction of Oct4. Second, classical experimental embryology
has shown that a transient low-pH treatment under ‘sublethal’ conditions
can alter the differentiation status of tissues. Spontaneous neural conver-
sion from salamander animal caps by soaking the tissues in citrate-based
acidic medium below pH 6.0 has been demonstrated previously
15–17
.
Without exposure to the stimuli, none of the cells sorted with CD45
expressed Oct4-GFP regardless of the culture period in LIF1B27 medium.
In contrast, a 30-min treatment with low-pH medium (25-min incuba-
tion followed by 5-min centrifugation; Fig. 1a; the most effective range
was pH 5.4–5.8; Extended Data Fig. 1a) caused the emergence of sub-
stantial numbersof spherical clusters that expressed Oct4-GFP in day-7
culture(Fig. 1b). Substantial numbers ofGFP
1
cells appeared in all cases
performed with neonatal splenic cells (n530 experiments). The emer-
gence of Oct4-GFP
1
cells at the expense of CD45
1
cells was also observed
by flow cytometry (Fig. 1c, top, and Extended Data Fig. 1b, c). We next
fractionated CD45
1
cells into populations positive and negative for
CD90 (T cells), CD19 (B cells) and CD34 (haematopoietic progenitors
18
),
and subjected them to low-pH treatment. Cells of these fractions,
including T and B cells, generated Oct4-GFP
1
cells at an efficacy com-
parable to unfractionated CD45
1
cells (25–50% of surviving cells on
day 7), except for CD34
1
haematopoietic progenitors
19
, which rarely
produced Oct4-GFP
1
cells (,2%; Extended Data Fig. 1d).
Among maintenance media for pluripotent cells
20
, the appearance
of Oct4-GFP
1
cells was most efficient in LIF1B27 medium, and did
not occur in mouse epiblast-derived stem-cell (EpiSC) medium
21,22
(Extended Data Fig. 1e). The presence or absence of LIF during days
0–2 did not substantially affect the frequency of Oct4-GFP
1
cell gen-
eration on day 7 (Extended Data Fig. 1f), whereas the addition of LIF
during days 4–7 was not sufficient, indicating that LIF dependency
started during days 2–4.
1
Laboratory for Tissue Engineering and Regenerative Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts 02115, USA.
2
Laboratory for Cellular Reprogramming,
RIKEN Center for Developmental biology, Kobe 650-0047, Japan.
3
Laboratory for Genomic Reprogramming, RIKEN Center for Developmental biology, Kobe 650-0047, Japan.
4
Laboratory for
Organogenesis and Neurogenesis, RIKEN Center for Developmental biology, Kobe 650-0047, Japan.
5
Department of Pathology, Irwin Army Community Hospital, Fort Riley, Kansas 66442, USA.
6
Laboratory for Pluripotent Stem Cell Studies, RIKEN Center for Developmental biology, Kobe 650-0047, Japan.
7
Institute of Advanced Biomedical Engineering and Science, Tokyo Women’s Medical
University, Tokyo 162-8666, Japan. {Present address: Faculty of Life and Environmental Sciences, University of Yamanashi, Yamanashi 400-8510, Japan.
30 JANUARY 2014 | VOL 505 | NATURE | 641
Macmillan Publishers Limited. All rights reserved
©2014
Most of the surviving cells on day 1 werestill CD45
1
and Oct4-GFP
2
.
On day 3, the total cell numbers were reduced to between one-third to
one-half of the day 0 population (Fig. 1d; see Extended Data Fig. 1g, h
for apoptosis analysis),and a substantial number of total survivingcells
became Oct4-GFP
1
(Fig. 1d), albeit with relatively weak signal inten-
sity. On day 7,a significant number of Oct4-GFP
1
CD45
2
cells (one-half
to two-thirds of total surviving cells) constituted a distinct population
from the Oct4-GFP
2
CD45
2
cells (Fig. 1c, top, day 7, and Fig. 1d). No
obvious generation of Oct4-GFP
1
CD45
2
populations wasseen in non-
treated CD45
1
cells cultured similarly but without low-pH treatment
(Fig. 1c, bottom).
Low-pH-treated CD45
1
cells, but not untreated cells, gradually turned
on GFP signals over the first few days (Fig. 1e, Supplementary Videos 1
and 2 and Extended Data Fig. 2a), whereas CD45 immunoreactivity
became gradually reduced in the cells that demonstrated Oct4-GFP
expression (Fig. 1f and Extended Data Fig. 2b). By day5, the Oct4-GFP
1
cells attached together and formed clusters by accretion. These GFP
1
clusters (but not GFP
2
cells) were quite mobile and often showed cell
processes on moving (Supplementary Video 1).
The Oct4-GFP
1
cells demonstrated a characteristic small cell size
with little cytoplasm and also showed a distinct fine structure of the
nucleus compared with that of parental CD45
1
lymphocytes (Fig. 1g).
The Oct4-GFP
1
cells on day 7 were smaller than non-treated CD45
1
cells (Fig. 1g, h and Extended Data Fig. 2c) and embryonic stem (ES)
cells (Fig. 1h), both of which are generally considered to be small in
size. The diameter of low-pH-treated CD45
1
cells became reduced
during the first 2 days, even before they started Oct4-GFP expression
(Fig. 1f), whereas the onset of GFP expression was not accompanied
by cell divisions. Consistent with this, no substantial 5-ethynyl-29-
deoxyuridine (EdU) uptake was observed in the Oct4-GFP
1
cells after
the stressor (Extended Data Fig. 2d).
The lack of substantial proliferation argues against the possibility
that CD45
2
cells, contaminating as a very minor population in the
FACS-sorted CD45
1
cells, quickly grew and formed a substantial Oct4-
GFP
1
population over the first few days after the low-pH treatment.
In addition, genomic rearrangements of Tcrb (T-cell receptor gene)
were observed in Oct4-GFP
1
cells derived from FACS-purified CD45
1
cells and CD90
1
CD45
1
T cells (Fig. 1i, lanes 4, 5, and Extended Data
Fig. 2e–g), indicating at least some contribution from lineage-committed
T cells. Thus, Oct4-GFP
1
cells were generated de novo from low-pH-
treated CD45
1
haematopoietic cells by reprogramming, rather than
by simple selection of stress-enduring cells
23
.
Low-pH-induced Oct4
1
cells have pluripotency
On day 7, the Oct4-GFP
1
spheres expressed pluripotency-related marker
proteins
22
(Oct4, SSEA1, Nanog and E-cadherin; Fig. 2a) and marker
genes (Oct4,Nanog,Sox2,Ecat1 (also called Khdc3), Esg1 (Dppa5a),
Dax1 (Nrob1) and Rex1 (Zfp42); Fig. 2b and Extended Data Fig. 3a) in
a manner comparable to those seen in ES cells
24
. Moderate levels of
expression of these pluripotency marker genes were observed on day 3
b
a
ed h
GL
Rearranged DNA
d2 d3
d1
d5 d6
d4
Oct4-GFP+
Oct4-GFP
1234 5
fd0 d1 d2 d3
ES
Bright-eld
Oct4-GFP
Control Low-pH-treated cells High magnication
Non-treated cells
CD45
Oct4-GFP
d1
Low-pH-treated cells
d7
d1 d7
g
i
CD45 STAP ES
c
pH 5.7
37 °C, 25 min
Spleen
(Oct4-gfp)
DMEM/F12 medium
(B27+LIF)
ES cells
Fibroblasts
Lymphocytes
Sorted Oct4-GFP 1
Sorted Oct4-GFP 2
Lymphocyte
fraction
FACS
sorting Plating
CD45+Remove
supernatant
Centrifugation
Resuspend in
medium
d7
d0
CD45+
Oct4-GFP+
Forward scattering
Viable cells per visual eld
0
100
200
300
400
500
600
d0 d1 d2 d3 d4 d5 d6 d7
+
Events
4810
Distance
m
)
6
0
100
200
300
Figure 1
|
Stimulus-triggered conversion of lymphocytes into
Oct4-
GFP
1
cells. a, Schematic of low-pH treatment. b,Oct4-GFP
1
cell clusters appeared in
culture of low-pH-treated CD45
1
cells (middle; high magnification, right) on
day 7 (d7) but not in culture of control CD45
1
cells (left). Top: bright-field
view; bottom, GFP signals. Scale bar, 100 mm. c, FACS analysis. The xaxis
shows CD45 epifluorescence level; yaxis shows Oct4-GFP level. Non-treated,
cultured in the same medium but not treated with low pH. d,GFP
1
(green) and
GFP
2
(yellow) cell populations (average cell numbers per visual field; 310
objective lens). n525; error bars show average 6s.d. e, Snapshots of live
imaging of culture of low-pH-treated CD45
1
cells (Oct4-gfp). Arrows indicate
cells that started expressing Oct4-GFP. Scale bar, 50 mm. f, Cellsize reduction in
low-pH-treated CD45
1
cells on day 1 before turning on Oct4-GFP without cell
division on day 2. In this live imaging, cells were plated at a half density for
easier viewing of individual cells. Scale bar, 10 mm. g, Electron microscope
analysis. Scale bar, 1 mm. h, Forward scattering analysis of Oct4-GFP
2
CD45
1
cells (red) and Oct4-GFP
1
CD45
2
cells (green) on day 7. Blue line, ES cells.
i, Genomic PCR analysis of (D)J recombination at the Tcrb gene. GL is the size
of the non-rearranged germline type, whereas the smaller ladders correspond
to the alternative rearrangements of J exons. Negative controls, lanes 1, 2;
positive controls, lane 3; FACS-sorted Oct4-GFP
1
cells (two independent
preparations on day 7), lanes 4, 5.
RESEARCH ARTICLE
642|NATURE|VOL505|30JANUARY2014
Macmillan Publishers Limited. All rights reserved
©2014
(Fig. 2b and Extended Data Fig. 3b). Notably, the Oct4-GFP
1
cells on
day 3, but not on day 7, expressed early haematopoietic marker genes
such as Flk1 (also called Kdr)andTal1 (Extended Data Fig. 3c), indicating
that Oct4-GFP
1
cells on day 3, as judged by their expression pattern at
the population level, were still in a dynamic process of conversion.
On day 7, unlike CD45
1
cells andlike ES cells, low-pH-induced Oct4-
GFP
1
cells displayed extensive demethylation at the Oct4 and Nanog
promoter areas (Fig. 2c), indicating that these cells underwent a substantial
reprogrammingof epigenetic status in these key genes for pluripotency.
In vitro differentiation assays
25–27
demonstrated that low-pH-induced
Oct4-GFP
1
cells gave rise to three-germ-layer derivatives (Fig. 2d) as
well as visceral endoderm-like epithelium (Extended Data Fig. 3d).
When grafted into mice, low-pH-induced Oct4-GFP
1
cell clusters formed
teratomas (40%, n520) (Fig. 2e and Extended Data Fig. 4a–c) but no
teratocarcinomas that persistentlycontained Oct4-GFP
1
cells (n550).
Because some cellular variation was observed in the signal levels of
Oct4-GFP within the clusters, we sortedGFP-strongcells (a major popu-
lation) and GFP-dim cells (a minor population) by FACS on day 7 and
separately injected them into mice. In this case, only GFP-strong cells
formed teratomas (Extended Data Fig. 4d). In quantitative polymerase
chain reaction (qPCR) analysis, the GFP-strong population expressed
pluripotency marker genes but not early lineage-specific marker genes,
whereas the GFP-dimcells showed substantial expression of some early
lineage-specific marker genes (Flk1,Gata2,Gata4,Pax6 and Sox17;
Extended Data Fig. 4e) but not Nanog and Rex1. These observations
indicate that three-germ-layer derivatives were generated from the GFP-
strong cells expressing pluripotency marker genes, rather than from
GFP-dim cells that seem to contain partially reprogrammed cells.
Collectively, these findings show that the differentiation state of a
committed somatic cell lineage can be converted into a state of pluri-
potency by strong stimuli given externally. Hereafter, we refer to the
fate conversion from somatic cells into pluripotent cells by strong
external stimuli such as low pH as ‘stimulus-triggered acquisition of
pluripotency’ (STAP) and the resultant cells as STAP cells. Under their
establishment conditions, these STAP cells were rarely proliferative
(Extended Data Figs 2d and 5a, b). Comparative genomic hybridiza-
tion array analysis of STAP cells indicated no major global changes in
chromosome number (Extended Data Fig. 5c).
STAP cells compared to ES cells
STAP cells, unlike mouse ES cells, showed a limited capacity for self-
renewal in the LIF-containing medium and did not efficiently form
Nanog promoter Nanog promoter Nanog promoter Nanog promoter
ES cells
Oct4 promoter
CD45+ cells
Oct4 promoter
Cultured CD45+ cells
Oct4 promoter
a
bc
de
Ectoderm Mesoderm Endoderm
Foxa2/Pdgfrα
Sox1/Tuj Brachyury Sox17/E-cadherin
N-cadherin/Sox1 α-smooth muscle
actin
Ectoderm Mesoderm Endoderm
Oct4 NanogSSEA1 E-cadherin
+DAPI
α-smooth muscle actin
βIII-tubulin
Normalized to Gapdh
Oct4
Nanog
Sox2
Ecat1
Esg1
Dax1
ES cells CD45+ cells Oct4-GFP+ cells
Oct4-GFP+ cells
Oct4 promoter
d3 d7
0
10
20
5
15
Oct4-GFP Marker
f
Single dissociation
Single dissociation
AP Day 7
Day 0
ES cells
Single dissociation
Day 3
Single dissociation
AP
Day 0
gSTAP cells STAP cells STAP cells
Day 7
AP
Single dissociation
+Y-27632
Single dissociation
+Y-27632
Day 0
h
Partial dissociation
Partial dissociation
AP Day 7
Day 0
i
α-fetoprotein
Figure 2
|
Low-pH-induced
Oct4-
GFP
1
cells
represent pluripotent cells. a, Immunostaining
for pluripotent cell markers (red) in day 7 Oct4-
GFP
1
(green) clusters. DAPI, white. Scale bar,
50 mm. b, qPCR analysis of pluripotency marker
genes. From left to right, mouse ES cells; parental
CD45
1
cells; low-pH-induced Oct4-GFP
1
cells on
day 3; low-pH-induced Oct4-GFP
1
cells on day 7.
n53; error bars show average 6s.d. c,DNA
methylation study by bisulphite sequencing. Filled
and open circles indicate methylated and non-
methlylated CpG, respectively. d, Immunostaining
analysis of in vitro differentiation capacity of day 7
Oct4-GFP
1
cells. Ectoderm: the neural markers
Sox1/Tuj1 (100%, n58) and N-cadherin (100%,
n55). Mesoderm: smooth muscle actin (50%,
n56) and brachyury (40%, n55). Endoderm:
Sox17/E-cadherin (67%, n56) and Foxa2/Pdgfra
(67%, n56). Scale bar, 50mm. e, Teratoma
formation assay of day 7 clusters of Oct4-GFP
1
cells. Haematoxylin and eosin staining showed
keratinized epidermis (ectoderm), skeletal muscle
(mesoderm) and intestinal villi (endoderm),
whereas immunostaining showed expression of
Tuj1 (neurons), smooth muscle actin and
a-fetoprotein. Scale bar, 100 mm. fi, Dissociation
culture of ES cells and STAP cells (additional 7 days
from day 7; f,g) on gelatin-coated dishes. Top,
bright-field; bottom, alkaline phosphatase (AP)
staining. Partially dissociated STAP cells slowly
generated small colonies (i), whereas dissociated
STAP cells did not, even in the presence of the
ROCK inhibitor (g,h), which allows dissociation
culture of EpiSCs
29
.
ARTICLE RESEARCH
30 JANUARY 2014 | VOL 505 | NATURE | 643
Macmillan Publishers Limited. All rights reserved
©2014
colonies in dissociation culture (Fig. 2f, g), even in the presence of
the ROCK inhibitor Y-27632, which suppresses dissociation-induced
apoptosis
28,29
(Fig. 2h). Also, even under high-density culture condi-
tions after partial dissociation (Fig. 2i), STAP cell numbers started to
decline substantially after two passages. Furthermore, expression of
the ES cell marker protein Esrrbwas low in STAP cells (Extended Data
Fig. 5d, e). In general, female ES cells do not show X-chromosomal
inactivation
30
and containno H3K27me3-dense foci(indicative of inac-
tivated X chromosomes), unlike female CD45
1
cells and EpiSCs. In
contrast, H3K27me3-dense foci were found in ,40% of female STAP
cells strongly positive for Oct4-GFP (Extended Data Fig. 5f, g).
STAP cells were also dissimilar to mouse EpiSCs, another category
of pluripotent stem cell
21,22,29,31
, and were positive for Klf4 and negative
for the epithelial tight junction markers claudin 7 and ZO-1 (Extended
Data Fig. 5d, e).
STAP cells from other tissue sources
We next performed similar conversion experiments with somatic cells
collected from brain, skin, muscle, fat, bone marrow, lung and liver tissues
of 1-week-old Oct4-gfp mice. Although conversion efficacy varied, the
low-pH-triggered generation of Oct4-GFP
1
cells was observed in day
7 culture of all tissues examined (Fig. 3a and Extended Data Fig. 6a–c),
including mesenchymal cells of adipose tissues (Fig. 3a–c) and neonatal
cardiac cells that were negatively sorted for CD45 by FACS (Fig. 3d–g;
see Extended Data Fig. 6d for suppression of cardiac genes such as Nkx2-5
and cardiac actin).
Chimaera formation and germline transmission in mice
We next performed a blastocyst injection assay with STAP cells that
were generated from CD45
1
cells of neonatal mice constitutively express-
ing GFP (this C57BL/6 line with cag-gfp transgenes is referred to here-
after as B6GFP). We injected STAP cell clusters en bloc that were manually
cut into small pieces using a microknife (Fig. 4a). A high-to-moderate
contribution of GFP-expressing cells was seen in thechimaeric embryos
(Fig. 4b and Extended Data Fig. 7a). These chimaeric mice were born
at a substantial rate and all developed normally (Fig. 4c and Extended
Data Fig. 7b).
CD45
1
cell-derived STAP cells contributed to all tissues examined
(Fig. 4d). Furthermore, offspring derived from STAP cells were born
to the chimaeric mice (Fig. 4e and Extended Data Fig. 7c), demon-
strating their germline transmission, which is a strict criterion for pluri-
potency as well as genetic and epigenetic normality
32,33
. Furthermore,
in a tetraploid (4N) complementation assay, which is considered to be
the most rigorous test for developmental potency
34,35
(Fig. 4a, bottom),
CD45
1
cell-derived STAP cells (from F
1
mice of B6GFP 3129/Sv
or DBA/2) generated all-GFP
1
embryos on embryonic day (E)10.5
(Fig. 4f, Extended Data Fig. 7d and Supplementary Video 3), demon-
strating that STAP cells alone are sufficient to construct an entire embry-
onic structure. Thus, STAP cells have the developmental capacity to
differentiate into all somatic-cell lineages as well as germ-cell lineages
in vivo.
Expandable pluripotent cell lines from STAP cells
STAP cells have a limited self-renewal capacity under the conditions
used for establishment (Fig. 2g and Extended Data Figs 2e and 5a).
However, in the context of the embryonic environment, a small frag-
ment of a STAP cell cluster could grow even into a whole embryo (Fig. 4f).
With this in mind, we next examined whether STAP cells have the
potential to generate expandable pluripotent cell lines in vitro under
certain conditions.
STAP cells could not be efficiently maintained for additional pas-
sages in conventional LIF1FBS-containing medium or 2i medium
20
(most STAP cells died in 2i medium within 7 days; Extended Data
Fig. 8a). Notably, an adrenocorticotropic hormone (ACTH)1LIF-
containing medium (hereafter called ACTH medium) known to facil-
itate clonal expansion of ES cells
36
supported outgrowth of STAP cell
colonies. When cultured in this medium on a MEF feeder or gelatin, a
portion of STAP cell clusters started to grow (Fig. 5a, bottom; such
outgrowth was typically found in 10–20% of wells in single cluster
culture using 96-well plates and in .75% when 12 clusters were plated
ab
c
e
Adipose-derived mesenchymal cells
Control Low-pH-treated cells
Bright-eld
Oct4-GFP
Percentage of
Oct4-GFP+ cells (d7)
Percentage of
Oct4-GFP+ cells
Low pH
Control
0
50
40
30
20
10
CD45+ cells
Bone marrow
(monocytes)
Brain
Lung
Muscle
Adipose
(mesenchyme)
Fibroblasts
Liver
Chondrocytes
SSEA1/DAPI
Nanog/DAPI
Oct4/DAPI
Oct4-GFP
Cardiomyocyte STAP d7 Oct4-GFP
f
Cardiomyocytes
Oct4
Nanog
Rex1
0
1
6
2
7
Control
STAP d3
STAP d7
ES
E7.5
3
4
5
0
1
2
3
4
5
6
7
8
Normalized to Gapdh
Normalized to Gapdh
Oct4
ES
Lung
Muscle
Brain
Liver
CD45
BM STAP
Lung STAP
Muscle STAP
Brain STAP
Condro STAP
Adipose STAP
Fibro STAP
Liver STAP
CD45 STAP
Fibroblast
Condrocyte
Adipose*
Bone marrow
Nanog
Sox2
Klf4
Rex1
d
0
5
10
15
20
25
30
35
40
45
d0 d3 d7
***
***
g
Figure 3
|
STAP cell conversion from a variety of cells by low-pH treatment.
a, Percentage of Oct4-GFP
1
cells in day 7 culture of low-pH-treated cells from
different origins (1 310
5
cells per ml 33 ml). The number of surviving cells
on day 7 compared to the plating cell number was 20–30%, except for lung,
muscle and adipose cells, for which surviving cells were ,10% (n53,
average 6s.d.). b,Oct4-GFP
1
cell clusters were induced by low-pH treatment
from adipose-tissue-derived mesenchymal cells on day 7. Scale bar, 100 mm.
c, Expression of pluripotent cell markers in day 7 clusters of low-pH-treated
adipose-tissue-derived mesenchymal cells. Scale bar, 50 mm. d, Expression of
pluripotency marker genes in STAP cells derived from various tissues. Gene
expressions were normalized by Gapdh (n53, average 6s.d.). Asterisk
indicates adipose tissue-derived mesenchymal cells. e, Quantification of
Oct4-GFP
1
cells in culture of low-pH-treated neonatal cardiac muscle cells.
***P,0.001; Tukey’s test (n53). f, Generation of Oct4-GFP
1
cell clusters
(d7) from CD45
2
cardiac muscle cells.g, qPCR analysis of pluripotency marker
genes in STAP cells from CD45
2
cardiac muscle cells.
RESEARCH ARTICLE
644|NATURE|VOL505|30JANUARY2014
Macmillan Publishers Limited. All rights reserved
©2014
per well). These growing colonies looked similar to those of mouse ES
cells and expressed a high level of Oct4-GFP.
After culturing in ACTH medium for 7 days, this growing popu-
lation of cells, unlike parental STAP cells, could be passaged as single
cells (Fig. 5a, bottom, and Fig. 5b), grow in 2i medium (Extended Data
Fig. 8a) and expand exponentially, up to at least 120 days of culture
(Fig. 5c; no substantial chromosomal abnormality was seen; Extended
Data Fig. 8b, c). Hereafter, we refer to the proliferative cells derived
from STAP cells as STAP stem cells.
STAP stem cells expressed protein and RNA markers for pluripo-
tent cells (Fig. 5d, e), showed low DNA methylation levels at the Oct4
and Nanog loci (Extended Data Fig. 8d), and had a nuclear fine struc-
ture similar to that of ES cells (Extended Data Fig. 8e; few electron-
dense areas corresponding to heterochromatin). In differentiation
culture
25–27
, STAP stem cells generated ectodermal, mesodermal and
endodermal derivatives in vitro (Fig. 5f–h and Extended Data Fig. 8f, g),
including beating cardiac muscles (Supplementary Video 4), and formed
teratomas in vivo (Fig.5i and Extended Data Fig. 8h; no teratocarci-
nomas, n540). After blastocyst injection, STAP stem cells efficiently
contributed to chimaeric mice (Fig. 5j), in which germline transmis-
sion was seen (Extended Data Fig. 8i). Even in tetraploid complemen-
tation assays, injected STAP stem cells could generate mice capable of
growing to adults and producing offspring (Fig. 5k, l; in all eight inde-
pendent lines, Extended Data Fig. 8j).
In addition to their expandability, we noticed at least two other
differences between STAP stem cells and parental STAP cells. First,
the expression of the ES cell marker protein Esrrb, which was unde-
tectable in STAP cells (Extended Data Fig. 5d, e), was clearly seen in
STAP stem cells (Fig. 5e). Second, the presence of H3K27me3 foci,
which was found in a substantial proportion of female STAP cells, was
no longer observed in STAP stem cells (Extended Data Figs 5f and 8k).
Thus, STAP cells have the potential to give rise to expandable cell lines
that exhibit features similar to those of ES cells.
Discussion
This study has revealed that somatic cells latently possess a surprising
plasticity. This dynamic plasticity—the ability to become pluripotent
cells—emerges when cells are transiently exposed to strong stimuli that
they would not normally experience in their living environments.
Low-pH treatment was also used in the ‘autoneuralization’ experi-
ment
15–17
by Holtfreter in 1947, in which exposure to acidic medium
caused tissue-autonomous neural conversion of salamander animal
caps in vitro in the absence of Spemann’s organizer signals. Although
the mechanism has remained elusive, Holtfreter hypothesized that the
strong stimulus releases theanimal cap cells from some intrinsic inhib-
itory mechanisms that suppress fate conversion or, in his words, they
pass through ‘sublethal cytolysis’ (meaning stimulus-evoked lysis of
the cell’s inhibitory state)
15,37
. Although Holtfreter’s study and ours differ
in the direction of fateconversion—orthograde differentiation and nuc-
lear reprogramming, respectively—these phenomena may share some
common aspects, particularlywith regard to sublethal stimulus-evoked
release from a static (conversion-resisting) state in the cell.
A remaining question is whether cellular reprogramming is initiated
specifically by the low-pHtreatment or also by some other types of sub-
lethal stress such as physical damage, plasma membrane perforation,
osmotic pressure shock, growth-factor deprivation, heat shock or high
Ca
21
exposure. At least some of these stressors, particularly physical
damage by rigorous trituration and membrane perforation by strepto-
lysin O, induced the generation of Oct4-GFP
1
cells from CD45
1
cells
(Extended Data Fig. 9a; see Methods). These findings raise the possi-
bility that certain common regulatory modules, lying downstream of
these distantly related sublethal stresses, act as a key for releasing somatic
cells from the tightly locked epigenetic state of differentiation, leading
to a global change in epigenetic regulation. In other words, unknown
cellular functions, activated by sublethal stimuli, may set somatic cells
free from their current commitment to recover the naive cell state.
Our present finding of an unexpectedly large capacity for radical
reprogramming in committed somatic cells raises various important
questions. For instance, why, and for what purpose, do somatic cells
latently possess this self-driven ability for nuclear reprogramming, which
emerges only after sublethal stimulation, and how, then, is this repro-
gramming mechanism normally suppressed? Furthermore, why isn’t
teratoma (or pluripotent cell mass) formation normally seen in in vivo
tissues that may receive strong environmental stress? In our prelim-
inary study, experimentalreflux oesophagitis locally induced moderate
Bright-eld cag-gfp
b
cag-gfp
E10.5
Bright-
eld
f
a
4N blastocyst
2N blastocyst
e
c
*
*
Germline transmission
129/Sv x B6GFP STAP chimaeric mice d
Brain
Skin
Lung
Liver
Heart
Muscle
Chimaera contribution ratio (%)
Chimaera pup 1
Chimaera pup 2
Chimaera pup 3
Chimaera pup 4
Chimaera pup 5
Chimaera pup 6
Chimaera pup 7
Chimaera pup 8
Chimaera pup 9
Average
0
10
20
30
40
50
60
70
80
90
100
Figure 4
|
Chimaeric mouse generation from STAP cells. a, Schematic of
chimaeric mouse generation. b, E13.5 chimaera fetuses from 2N blastocytes
injected with STAP cells (derived from B6GFP CD45
1
cells carrying cag-gfp).
c, Adult chimaeric mice generated by STAP-cell (B6GFP 3129/Sv; agouti)
injection into blastocysts (ICR strain; albino). Asterisk indicates a highly
contributed chimaeric mouse. d, Chimaera contribution analysis. Tissues from
nine pups were analysed by FACS. e, Offspring of chimaeric mice derived
from STAP cells. Asterisk indicates the same chimaeric mouse shown in
c.f, E10.5 embryo generated in the tetraploid complementation assay with
STAP cells (B6GFP 3129/Sv).
ARTICLE RESEARCH
30 JANUARY 2014 | VOL 505 | NATURE | 645
Macmillan Publishers Limited. All rights reserved
©2014
expression of Oct4-GFP but not endogenous Nanog in the mouse
oesophageal mucosa (Extended Data Fig. 9b). Therefore, an intriguing
hypothesis for future research is that the progression from initial Oct4
activation to further reprogramming is suppressed by certain inhib-
itory mechanisms in vivo.
The question of why and how this self-driven reprogramming is
directedtowards the pluripotent state is fundamentally important, given
that STAP reprogramming takes a remarkably short period, only a few
days for substantial expression of pluripotency marker genes, unlike
transgene- or chemical-induced iPS cell conversion
38
. Thus, our results
cast new light on the biological meaning of diverse cellular states in
multicellular organisms.
METHODS SUMMARY
Tissue collection and low-pH exposure. To isolate haematopoietic cells, spleens
were excised from 1-week-old Oct4-gfp C57BL/6 mice, minced by scissors and
mechanically dissociated with pasture pipettes. Dissociated cells were collected,
re-suspended in DMEM medium and added to the same volume of lympholyte
(Cedarlane), then centrifuged at 1,000gfor 20 min. CD45-positive cells were sorted
by FACS Aria(BD Biosciences),and treated with low-pHHBSS solution (pH 5.7 for
25 min at 37 uC), centrifuged for 5 min to remove supernatant, and plated to non-
adhesive culture plates in DMEM/F12 medium supplemented with 1,000U LIF
(Sigma)and B27 (Invitrogen).Although Oct4-GFP
1
cells (expressing pluripotency-
related protein and gene markers and capable of differentiating into three germ-
layer derivatives) were also generated from lymphocytes of young adult mice (for
example, 6-week-old) under the same culture conditions, their proportion in
culture was reduced by several to ten folds as compared to neonatal lymphocytes
when lymphocytes were isolated from 1-month-old mice or older. Live imaging
was performed using specially assembled confocal microscope systems witha CO
2
incubator
39
, and CD45 immunoreactivity in livecells was examined as described
40
.
In vivo
and
in vitro
differentiation assay. STAP cells were seeded onto a sheet
33331 mm, composed of a non-woven mesh of polyglycolic acid fibres and
implanted subcutaneously into the dorsal flanks of 4-week-old NOD/SCID mice.
To examine in vitro differentiation, STAP cells and STAP stem cells were collected
at 7 days and subjected to SDIA or SFEBq culture
25,26
for neural differentiation and
to embryoid body culture for mesodermal and endodermal
27
differentiation.
Online Content Any additional Methods, Extended Data display items and Source
Data are available in the online version of the paper; references unique to these
sections appear only in the online paper.
Received 10 March; accepted 20 December 2013.
1. Gurdon, J. B. The developmental capacity of nuclei taken from intestinal
epitheliumcells of feeding tadpoles. J. Embryol. Exp. Morphol. 10, 622–640 (1962).
2. Wakayama, T., Perry, A. C., Zuccotti, M., Johnson, K. R. & Yanagimachi, R. Full-term
development of mice from enucleated oocytes injected with cumulus cell nuclei.
Nature 394, 369–374 (1998).
3. Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from mouse
embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676
(2006).
4. Thorpe, T. A. History of planttissue culture. Mol. Biotechnol. 37, 169–180 (2007).
5. Jiang, Y. et al. Pluripotency of mesenchymal stemcells derived from adultmarrow.
Nature 418, 41–49 (2002).
6. D’Ippolito, G. et al. Marrow-isolated adult multilineage inducible (MIAMI) cells, a
unique population of postnatal young and old human cells with extensive
expansion and differentiation potential. J. Cell Sci. 117, 2971–2981 (2004).
7. Kucia, M. et al. A population of very small embryonic-like (VSEL) CXCR4
1
SSEA-
1
1
Oct-4
1
stem cells identified in adult bone marrow. Leukemia 20, 857–869
(2006).
8. Kuroda, Y. et al. Unique multipotent cells in adult human mesenchymal cell
populations. Proc. Natl Acad. Sci. USA 107, 8639–8643 (2010).
9. Obokata, H. et al. The potential of stem cells in adult tissues representative of the
three germ layers. Tissue Eng. Part A 17, 607–615 (2011).
10. Lengner,C. J., Welstead, G. G. & Jaenisch, R. The pluripotencyregulator Oct4: a role
in somatic stem cells? Cell Cycle 7, 725–728 (2008).
11. Berg, J. S. & Goodell, M. A. An argument against a role for Oct4 in somatic stem
cells. Cell Stem Cell 1, 359–360 (2007).
12. Hong, H. et al. Suppression of induced pluripotent stem cell generation by the
p53-p21 pathway. Nature 460, 1132–1135 (2009).
13. Hanna, J. et al. Direct reprogramming of terminally differentiated mature B
lymphocytes to pluripotency. Cell 133, 250–264 (2008).
14. Ohbo, K. et al. Identification and characterization of stem cells in prepubertal
spermatogenesis in mice small star, filled. Dev. Biol. 258, 209–225 (2003).
15. Holtfreter, J. Neural induction in explants which have passed through a sublethal
cytolysis. J. Exp. Zool. 106, 197–222 (1947).
Oct4 Nanog Klf4 Esrrβ
abc
Single-cell dissociation
d3
AP
de
j
d0
1060
1040
1020
10 40 80 120
ES
STAP stem cell
MEF
STAP
Number of days
Cell number
Oct4-GFP
Day 1Day 7Passage 1
cag-gfp
cag-gfp
Chimaeric mice
(2N blastocysts)
k
l
Chimaeric mice
(4N blastocysts)
Germline transmission
(4N blastocysts)
Bright-eld
Relative expression levels
(ES=1.0)
Antibodies +DAPI
Sox17/EcadRx/Pax6 Troponin-T
Ectoderm Mesoderm Endoderm
Ectoderm Mesoderm Endoderm
g hf
i
*
*
Oct4
Nanog
Rex1
Klf4
Sox2
Klf2
Esrrb
Tbx3
Klf5
0
ES
STAP stem cell
TS
0.5
1
1.5
2
2.5
3
Figure 5
|
ES-cell-like stem cells can be derived from STAP cells. a, Growth
of STAP stem cells carrying Oct4-gfp. Scale bar, 50 mm. b, Dissociation culture
of STAP stem cells to form colonies. Scale bar, 100mm. c, Robust growth of
STAP stem cells in maintenance culture. Similar results were obtained with
eight independent lines. In contrast, parental STAP cells decreased in number
quickly. d, Immunostaining of STAP stem cells for pluripotency markers (red).
Scale bar, 50 mm. e, qPCR analysis of pluripotency marker gene expression.
fh,In vitro differentiation assays into three-germ-layer derivatives.
f, Ectoderm: Rx
1
/Pax6
1
(retinal epithelium; 83%, n56). g, Mesoderm:
troponin-T
1
(cardiac muscle; 50%, n56). h, Endoderm: Sox17
1
/E-cadherin
1
(endodermal progenitors; 67%, n56). Scale bar, 50 mm. i, Teratoma formation
assays. Formation of keratinized epidermis (ectoderm; left), cartilage
(mesoderm; middle) and bronchial-like epithelium (endoderm; right) is
shown. Scale bar, 100 mm. j, Blastocyst injection assays. These pictures of live
animals were taken serially (asterisk indicates the same chimaeric pup).
k,l, Tetraploid complementation assay. ‘All-GFP
1
’ pups were born (k) and
germline transmission was observed (l).
RESEARCH ARTICLE
646|NATURE|VOL505|30JANUARY2014
Macmillan Publishers Limited. All rights reserved
©2014
16. Gerhart, J. Johannes Holtfreter’scontributions to ongoingstudies of the organizer.
Dev. Dyn. 205, 245–256 (1996).
17. Byrnes, W. M. Ernest Everett Just, Johannes Holtfreter, and the origin of certain
concepts in embryo morphogenesis. Mol. Reprod. Dev. 76, 912–921 (2009).
18. Gratama, J. W., Sutherland, D. R. & Keeney, M. Flow cytometric enumeration and
immunophenotyping of hematopoieticstem and progenitor cells.Semin. Hematol.
38, 139–147 (2001).
19. Inoue, K. et al. Inefficient reprogramming of the hematopoietic stem cell genome
following nuclear transfer. J. Cell Sci. 119, 1985–1991 (2006).
20. Ying, Q. L. et al. The ground state of embryonic stem cell self-renewal. Nature 453,
519–523 (2008).
21. Tesar, P. J. et al. New cell lines from mouse epiblast share defining features with
human embryonic stem cells. Nature 448, 196–199 (2007).
22. Brons, I. G. et al. Derivation of pluripotent epiblast stem cells from mammalian
embryos. Nature 448, 191–195 (2007).
23. Kuroda, Y. et al. Isolation, culture and evaluation of multilineage-differentiating
stress-enduring (Muse) cells. Nature Protocols 8, 1391–1415 (2013).
24. Niwa, H. How is pluripotency determined and maintained? Development 134,
635–646 (2007).
25. Watanabe, K. et al. Directed differentiation of telencephalic precursors from
embryonic stem cells. Nature Neurosci. 8, 288–296 (2005).
26. Kawasaki, H. et al. Induction of midbrain dopaminergic neurons from ES cells by
stromal cell-derived inducing activity. Neuron 28, 31–40 (2000).
27. Gouon-Evans, V. et al. BMP-4 is required for hepatic specification of mouse
embryonic stem cell-derived definitive endoderm. Nature Biotechnol. 24,
1402–1411 (2006).
28. Ohgushi, M. & Sasai, Y. Lonely death dance of human pluripotent stem cells:
ROCKing between metastable cell states. Trends Cell Biol. 21, 274–282 (2011).
29. Ohgushi, M. et al. Molecular pathway and cell state responsible for dissociation-
induced apoptosis in human embryonic stem cells. Cell Stem Cell 7, 225–239
(2010).
30. Murakami, K., Araki, K., Ohtsuka, S., Wakayama, T. & Niwa, H. Choice of random
rather than imprinted X inactivation infemale embryonic stem cell-derived extra-
embryonic cells. Development 138, 197–202 (2011).
31. Pera, M. F. & Tam, P. P. Extrinsic regulation of pluripotent stem cells. Nature 465,
713–720 (2010).
32. Surani, M. A. & Barton, S. C. Development of gynogenetic eggs in the mouse:
implications for parthenogenetic embryos. Science 222, 1034–1036 (1983).
33. Wakayama, S. et al. Successful serial recloning in the mouse over multiple
generations. Cell Stem Cell 12, 293–297 (2013).
34. Nagy, A., Rossant, J., Nagy, R., Abramow-Newerly, W. & Roder, J. C. Derivation of
completely cell culture-derived mice from early-passage embryonic stem cells.
Proc. Natl Acad. Sci. USA 90, 8424–8428 (1993).
35. Eakin, G. S., Hadjantonakis, A. K., Papaioannou, V. E. & Behringer, R. R.
Developmental potential and behavior of tetraploid cells in the mouse embryo.
Dev. Biol. 288, 150–159 (2005).
36. Ogawa, K., Matsui, H., Ohtsuka, S. & Niwa, H. A novel mechanism for
regulating clonal propagation of mouse ES cells. Genes Cells 9, 471–477
(2004).
37. Hurtado, C. & De Robertis, E. M. Neural induction in the absence of organizer in
salamander is mediated by MAPK. Dev. Biol. 307, 282–289 (2007).
38. Hou, P. et al. Pluripotent stem cells induced from mouse somatic cells by
small-molecule compounds. Science 341, 651–654 (2013).
39. Eiraku, M. et al. Self-organizing optic-cup morphogenesis in three-dimensional
culture. Nature 472, 51–56 (2011).
40. Eilken, M. H., Nishikawa, S. & Schroeder, T. Continuous single-cell imaging
of blood generation from haemogenic endothelium. Nature 457, 896–900
(2009).
Supplementary Information is available in the online version of the paper.
Acknowledgements We thank S. Nishikawa for discussion and J. D. Ross, N. Takata,
M. Eiraku, M. Ohgushi, S. Itoh, S. Yonemura, S. Ohtsuka and K. Kakiguchi for help with
experiments and analyses. We thank A. Penvose and K. Westerman for comments on
the manuscript. H.O. is grateful to T. Okano, S. Tsuneda and K. Kuroda for support and
encouragement. Financial supportfor this research was providedby Intramural RIKEN
Research Budget (H.O., T.W. and Y.S.), a Scientific Research in Priority Areas
(20062015) to T.W., the Network Project for Realization of Regenerative Medicine to
Y.S., and Department of Anesthesiology, Perioperative and Pain Medicine at Brigham
and Women’s Hospital to C.A.V.
Author ContributionsH.O. and Y.S. wrote the manuscript. H.O., T.W. and Y.S. performed
experiments,and K.K. assisted with H.O.’s transplantation experiments. H.O., T.W., Y.S.,
H.N. and C.A.V. designed the project. M.P.V. and M.Y. helped with the design and
evaluation of the project.
Author Information Reprints and permissions information is available at
www.nature.com/reprints. The authors declare no competing financial interests.
Readers are welcome to comment on the onlineversion of the paper. Correspondence
and requests for materials should be addressed to H.O. (obokata@cdb.riken.jp) or
C.A.V. (cvacanti@partners.org).
ARTICLE RESEARCH
30 JANUARY 2014 | VOL 505 | NATURE | 647
Macmillan Publishers Limited. All rights reserved
©2014
METHODS
Animal studies. Research involving animals complied with protocols approved
by the Harvard Medical School/Brigham and Women’s Hospital Committee on
Animal Care, and the Institutional Committee of Laboratory Animal Experimen-
tation of the RIKEN Center for Developmental Biology.
Tissue collection and low-pH treatment. To isolate CD45
1
haematopoieticcells,
spleens were excised from 1-week-old Oct4-gfp mice (unless specified otherwise),
minced by scissors and mechanically dissociated with pasture pipettes. Dissociated
spleen cells were suspended with PBS and strained through a cell strainer (BD
Biosciences). After centrifuge at 1,000 r.p.m. for 5 min, collected cells were re-suspended
in DMEM medium and added to the same volume of lympholyte (Cedarlane),
then centrifuged at 1,000gfor 20 min. The lymphocyte layer was taken out and
stained with CD45 antibody (ab25603, Abcam). CD45-positive cells were sorted
by FACS Aria (BD Biosciences). After cell sorting, 1 310
6
CD45-positive cells
were treated with 500 ml of low-pH HBSS solution (titrated to pH5.7 by HCl) for
25 min at 37 uC, and then centrifuged at 1,000 r.p.m. at room temperature for
5 min. After the supernatant (low-pH solution) was removed, precipitated cells
were re-suspended and plated onto non-adhesive culture plates (typically, 1 310
5
cells ml
21
) in DMEM/F12 medium supplemented with 1,000 U LIF (Sigma) and
2% B27 (Invitrogen). Cell cluster formation was more sensitive to the plating cell
density than the percentage of Oct4-GFP
1
cells. The number of surviving cells was
sensitiveto the age of donormice and was low underthe treatment conditions above
when adult spleens were used. The addition of LIF during days 2–7 was essential
for generating Oct4-GFP
1
STAP cell clusters on day 7, as shown in Extended Data
Fig. 1f. Even in the absence of LIF, Oct4-GFP
1
cells (most of them were dim in
signal) appeared transiently during days 2–5 in culture of low-pH-treated CD45
1
cells, but subsequently disappeared, indicating that there is a LIF-independent
early phase, whereas the subsequent phase is LIF-dependent.
Chimaeric mouse generation and analyses. For production of diploid and tetra-
ploid chimaeras with STAP cells, diploid embryos were obtained from ICR strain
females. Tetraploid embryos were produced by electrofusion of 2-cell embryos.
Because trypsin treatment of donor samples turned out to cause low chimaerism,
STAP spherical colonies were cut into small pieces using a microknife under the
microscope, and small clusters of STAP cells were then injected into day-4.5 blas-
tocysts by a large pipette. The next day, the chimaeric blastocysts were transferred
into day-2.5 pseudopregnant females. For experiments using STAP cells from
CD45
1
cells without the Oct4-gfp reporter, STAP cell clusters were identified by
their characteristic cluster morphology (they are made of very small cells with no
strong compaction in the aggregate). When the STAP conversion conditions (low
pH) were applied to CD45
1
lymphocytes, most day-7 clusters that were large and
contained more than a few dozen small cells were positive for Oct4 (although the
expression level varied). Therefore, we used only well-formed characteristic clus-
ters (large ones) for this type of study and cut them by microknife to prepare
donor cell clusters in a proper size for glass needle injection. For an estimate of the
contribution of these injected cells, we used STAP cells that were generated from
CD45
1
cells of mice constitutively expressing GFP (C57BL/6 line with cag-gfp
transgenes; F
1
of C57BL/6 and 129/Sv or DBA/2 was used from the viewpoint of
heterosis).
Because the numberof CD45
1
cells from a neonatal spleen was small, we mixed
spleen cells from male and female mice for STAP cell conversion. To make germ-
line transmission more efficient, we intercrossed chimaeras in some experiments.
For the production of diploid and tetraploid chimaeras with STAP stem cells,
diploid embryos were obtained from ICR strain females. Tetraploid embryos were
produced by electrofusion of 2-cell embryos. STAP stem cells were dissociated
into single cells and injected into day-4.5 blastocysts. In the chimaera studies with
both STAP cells and STAP stem cells, we did not find tumorigenetic tendencies in
their chimaeras or their offspring (up to 18 months).
In vivo
differentiation assay. 1310
7
STAP cells were seeded onto a sheet com-
posed of a non-woven mesh of polyglycolic acid fibres (3 3331 mm; 200 mmin
pore diameter), cultured for 24 h in DMEM 110% FBS, and implanted subcu-
taneously into the dorsal flanks of 4-week-old mice. In this experiment, to better
support tumour formation from slow growing STAP cells by keeping cells in a
locally dense manner, we implanted STAP cells with artificial scaffold made of
polyglycolic acid fibres. Given the artificial nature of the material, we used NOD/
SCID mice as hosts, to avoid possible enhancement of post-graft inflammation
caused by this scaffold even in syngenic mice. STAP stem cells were dissociated
into single cells and cell suspension containing 1 310
7
cells was injected into the
testis. Six weeks later, the implants were analysed using histochemical techniques.
The implants were fixed with 10% formaldehyde, embedded in paraffin, and
routinely processed into 4-mm-thick sections. Sections were stained with haema-
toxylin and eosin. Endoderm tissues were identified with expression of anti-a-
fetoprotein (mouse monoclonal antibody; MAB1368, R&D Systems). Ectodermal
tissues were identified with expression of anti-bIII tubulin (mouse monoclonal
antibody; G7121, Promega). Mesodermal tissues were identified with expression
of anti-a-smooth muscle actin (rabbit polyclonal; DAKO). In negative controls,
the primary antibody was replaced with IgG-negative controls of the same isotype
to ensure specificity.
STAP by exposureto other externalstimuli. To give a mechanical stress to mature
cells, a pasture pipette was heated and then stretchedto create thin capillaries with
the lumens approximately 50 mm in diameter, and then broken into appropriate
lengths.Mature somatic cellswere then repeatedlytriturated through these pipettes
for 20 min, and then cultured for 7 days.To provide a heat shock, cells were heated
at 42 uC for 20 min and cultured for 7 days. A nutrition-deprivation stress was pro-
vided to mature cells, by culturing the cells in basal culture medium for 3 weeks.
High Ca
21
concentration stress was provided to mature cells by culturing cells in
medium containing 2 mM CaCl
2
for 7 days. To give a strong stress by creating
pores in cell membranes, cells were treated with 230 ng ml
21
streptolysineO (SLO)
(S5265, Sigma) for 2 h, then cultured for 7 days. After each treatment, the ratio of
Oct4-GFP-positive cells was analysed by FACS.
Bisulphite sequencing. GFP-positive cellsin STAP clusters were collected by FACS
Aria. Genomic DNA was extractedfrom STAP cells and analysed. Bisulphite treat-
ment of DNA was performed using the CpGenome DNA modification kit (Chemicon,
http://www.chemicon.com), followingthe manufacturer’s instructions. The result-
ing modified DNA was amplified by nested PCR using two forward (F) primers
and one reverse (R) primer: Oct4 (F1, 59-GTTGTTTTGTTTTGGTTTTGGATA
T-39; F2, 59-ATGGGTTGAAATATTGGGTTTATTTA-39;R,59-CCACCCTCT
AACCTTAACCTCTAAC-39). And Nanog (F1, 59-GAGGATGTTTTTTAAGT
TTTTTTT-39; F2, 59-AATGTTTATGGTGGATTTTGTAGGT-39;R,59-CCCA
CACTCATATCAATATAATAAC-39). PCR was done using TaKaKa Ex Taq Hot
Start Version (RR030A). DNA sequencing was performed using a M13 primer at
the Genome Resource and Analysis Unit, RIKEN CDB.
Immunohistochemistry. Cultured cells were fixed with 4% paraformaldehyde
and permeabilized with 0.1% Triton X-100/PBS before blocking with 1% BSA
solution. Cells were incubated with the following primary antibodies: anti-Oct4
(Santa Cruz Biotechnology; C-10), anti-Nanog (eBioscience; MLC-51), anti-SSEA-1
(Millipore; MC480), anti-E-cadherin (Abcam), anti-ZO-1 (Santa Cruz Biotech-
nology; c1607),anti-claudin7 (Abcam), anti-Klf4 (R&DSystems), anti-Esrrb(R&D
Systems), anti-H3K27me3 (Millipore), anti-BrdU (BD Bioscience) and anti-Ki67
(BD Pharmingen). After overnight incubation, cells were incubatedwith secondary
antibodies: goat anti-mouse or -rabbit coupled to Alexa-488 or -594 (Invitrogen).
Cellnuclei werevisualizedwith DAPI (Sigma). Slideswere mountedwith a SlowFade
Gold antifade reagent (Invitrogen).
Fluorescence-activated cell sorting and flow cytometry. Cells were prepared
according to standard protocols and suspended in 0.1% BSA/PBS on ice before
FACS. Propidium iodide (BD Biosciences) was used to exclude dead cells. In nega-
tive controls, the primary antibody was replaced with IgG-negative controls of the
same isotype to ensure specificity. Cells were sorted on a BD FACSAria SORP and
analysed on a BD LSRII with BD FACS Diva Software (BD Biosciences). For hae-
matopoietic fraction sorting, antibodies against T-cell marker (anti-CD90; eBioscience),
B-cell marker (anti-CD19; Abcam) and haematopoietic progenitor marker (anti-
CD34; Abcam) were used.
RNA preparation and RT–PCR analysis. RNA was isolated with the RNeasy
Micro kit (Qiagen). Reverse transcription was performed with the SuperScript III
first strand synthesiskit (Invitrogen). Power SYBR GreenMix (Roche Diagnostics)
was used for amplification, and samples were run on a Lightcycler-II Instrument
(Roche Diagnostics). The primer sets for each gene are listed in Supplementary
Table 1.
In vitro
differentiation assays. For mesodermal differentiation assay, STAP cells
were collected at 7 days, and Oct4-GFP-positive cells were collected by cell sorter
and subjected to culture in DMEM supplemented with 20% FBS. Medium was
exchanged every 3 days. After 7–14 days, muscle cells were stained with an anti-a-
smooth muscle actin antibody (DAKO).
For neural lineage differentiation assay, STAP cells were collected at 7 days and
subjected to SDIA or SFEBq culture. For SDIA culture, collected STAP cell clusters
were plated on PA6 cell feeder as describedpreviously
26
. For SFEBq culture, STAP
cell clusters (one per well; non-cell-adhesive 96-well plate, PrimeSurface V-bottom,
Sumitomo Bakelite) were plated and cultured in suspensi on as described previously
36
.
For endodermal differentiation, STAP cells were collected at 7 days and sub-
jected to suspension culture with inducers in 96-well plates
27
.
TCR-bchain gene rearrangement analysis. Genomic DNA was extracted from
STAP cells and tail tips from chimaeric mice generated with STAP cells derived
from CD45
1
cells.PCR was performed with 50 ng DNAusing the following primers
(Db2: 59-GCACCTGTGGGGAAGAAACT-39andJb2.6: 59-TGAGAGCTGTCT
CCTACTATCGATT-39) that amplify the regions of the (D)J recombination. The
PCR products were subjected to gel electrophoresis in Tris-acetate-EDTA buffer
with 1.6% agarose and visualized by staining with ethidium bromide. PCR bands
RESEARCH ARTICLE
Macmillan Publishers Limited. All rights reserved
©2014
from STAP cells were subjected to sequencing analysis and identified as rear-
ranged genomic fragments of the (D)J recombination.
EdU uptake assay and apoptosis analysis. At various phases in STAP cell culture
(days 0–2, 2–7, 7–14), EdU was added to the culture medium (final concentration:
10 mM) and EdU uptake was analysed by FACS. This assay was performed
according to the manufacturer’s protocol with the Click-iT EdU Flow cytometry
assay kit (Invitrogen).
Apoptosis analysis was performed with flow cytometry using Annexin-V (Bio-
vision) and propidium iodide. Annexin-V analysis by FACS on day 14 showed
that most Oct4-GFP
1
cells were positive for this apoptotic marker; indeed, the
number of surviving cells declined thereafter.
Soft agar assay. Sorted STAP cells (Oct4-GFP-strong or -dim) and control mouse
ES cells (1,000 cells per well of 96-well plate) were plated into soft ager medium
(0.4% agarose) in LIF-B27 medium. After 7 days of culture, cells were dissociated
and their anchorage-independent growth was quantified by fluorescent measure-
ment with thecytoselect 96-wellcell transformationassay kit (Cell Biolabs)accord-
ing to the manufacturer’s protocol.
Comparative genomic hybridization (CGH) array analysis. Genomic DNA was
extracted from STAP (male) and CD45-positive cells (male) by the Gene JET
Genomic DNA purification kit (Thermo Scientific). Using CGH array (Agilent),
the normality of chromosomes derived from STAP was compared with that of
CD45-positive cells whose chromosomal normality was confirmed by a separate
experiment. CGH array and data analysis were performed at TAKARA Bio.
Electron microscopy. For electron microscopic analysis, dissociated cells were
fixed in 2.5% glutaraldehyde and 2% formaldehyde in 0.1 M cacodylate buffer
(pH 7.2) and then processed for thin sectioning and transmission electron microscopy.
Live cell imaging. All live-cell imaging was performed with LCV110-CSUW1
(Olympus). For live-cell imaging of ‘in culture CD45 antibody staining’, CD45
1
cells treated with low pH were plated in culture medium containing 20 ng ml
21
of
fluorescent-labelled CD45 antibody (eBioscience)
40
.
RNA-sequencing and ChIP sequencing analyses. For RNA sequencing of cell
lines, total RNA was extracted from cells by the RNasy mini kit (Qiagen).RNA-seq
libraries were prepared from 1 mg total RNAs followingthe protocol of the TruSeq
RNA Sample Prep kit (Illumina) and subjected to the deep sequencing analysis
with Illumina Hi-Seq1500. Cluster tree diagram of various cell types was obtained
from hierarchical clustering of global expression profiles (log
2
FPKM of all tran-
scripts; FPKM, fragments per kilobase of transcript per million mapped reads).
Complete linkage method applied to 1 2r(r5Pearson’s correlation bet ween profiles)
was used for generating the tree and 1,000 cycles of bootstrap resampling were carried
out to obtain statisticalconfidence score in per cent units (also called AU Pvalues).
ChIP-seq libraries wereprepared from 20 ng input DNAs, 1 ng H3K4me3 ChIP
DNAs, or 5 ng H3K27me3 ChIP DNAs using the KAPA Library Preparation kit
(KAPA Biosystems). TruSeq adaptors were prepared in-house by annealing a TruSeq
universal oligonucleotide and each of index oligonucleotides (59-AATGATACG
GCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC
T-39, and 59-GATCGGAAGAGCACACGTCTGAACTCCAGTCACXXXXXXA
TCTCGTATGCCGTCTTCTGCTTG-39; where X represents index sequences).
Chromatin immunoprecipitation was performed as follows. Cells were fixed in
PBS(-) containing 1% formaldehyde for 10 min at room temperature. Glycinewas
added to a final concentration of 0.25 M to stop the fixation. After washing the
cells twice in ice-cold PBS(-), cells were further washed in LB1 (50mM HEPES-
KOH pH 7.5, 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25%
Triton X-100) and LB2 (10 mM Tris-HCl pH 8.0, 200mM NaCl, 1 mM EDTA,
0.5 mM EGTA). Cells were then re-suspended in lysis buffer (50 mM Tris-HCl
pH 8.0, 10 mM EDTA, 1% SDS).Lysates were preparedby sonication using Covaris
S220 in a mini tube at duty cycle55%, PIP 570, cycles per burst 5200, and the
treatment time of 20 min. Lysates from 2 310
6
cells were diluted in ChIP dilution
buffer (16.7 mM Tris-HCl pH 8.0, 167 mM NaCl, 1.2 mM EDTA, 1.1% Triton X-100,
0.01% SDS). ChIP was performed using sheep anti-mouse IgG beads (Invitrogen)
or protein A beads (Invitrogen) coupled with anti-histone H3K4me3 antibody
(Wako, catalogue no.307-34813) or anti-histone H3K27me3 antibody(CST, cata-
logue no. 9733), respectively. After 4–6 h of incubation in a rotator at 4 uC, beads
were washed five times in low-salt wash buffer (20mM Tris HCl pH 8.0, 150 mM
NaCl, 2 mM EDTA, 1% Triton X-100,0.1% SDS), and three times in high-salt wash
buffer (20 mM Tris-HCl pH 8.0, 500 mM NaCl, 2 mM EDTA, 1% Triton X-100,
0.1% SDS). Target chromatin was eluted off the beads in elution buffer (10mM
Tris-HCl pH8.0, 300 mM NaCl, 5 mM EDTA, 1% SDS) at room temperature for
20 min. Crosslink was reversed at 65 uC, and then samples were treated with RNaseA
and proteinase K. The prepared DNA samples were purified by phenol-chloroform
extraction followed by ethanol precipitation and dissolved in TE buffer.
STAP stem-cell conversion culture. For establishment of STAP stem-cell lines,
STAP cell clusterswere transferred to ACTH-containingmedium
36
on MEF feeder
cells (several clusters, up to a dozen clusters, per well of 96-well plates). Four to
seven days later, the cells were subjected to the first passage using a conventional
trypsin method, and suspended cells were plated in ES maintain medium contain-
ing 20% FBS. Subsequent passaging was performed at a split ratio of 1:10 every
second day before they reached subconfluency. We tested the following three dif-
ferent genetic backgrounds of mice for STAP stem-cell establishment from STAP
cell clusters, and observed reproducible data of establishment: C57BL/6 carrying
Oct4-gfp (29 of 29), 129/Sv carrying Rosa26-gfp (2 of 2) and 129/Sv 3C57BL/6
carrying cag-gfp (12 of 16). STAP stem cells with all these genetic backgrounds
showed chimaera-forming activity.
For clonal analysis of STAP stem cells, single STAP stem cells were manually
picked by a thin-glass pipette, and plated into 96-well plates at one cell per well.
The clonal colonieswere culturedin ES medium containing 20%FBS, and expanded
for subsequent experiments.
Karyotype analysis. Karyotype analysis was performed by Multicolor FISH ana-
lysis (M-FISH). Subconfluent STAP stem cells were arrested in metaphase by col-
cemid (final concentration 0.270 mgml
21
) to the culture medium for 2.5 h at
37 uCin5%CO
2
. Cells were washed with PBS, treated with trypsin and EDTA
(EDTA), re-suspended into cell medium and centrifuged for 5 min at 1,200 r.p.m.
To the cell pellet in 3 ml of PBS, 7ml of a pre-warmed hypotonic 0.0375 M KC1
solutionwas added. Cells wereincubated for 20 min at 37uC. Cells were centrifuged
for 5 min at 1,200 r.p.m. and the pellet was re-suspended in 3–5 ml of 0.0375M
KC1 solution. The cells were fixed with methanol/acetic acid (3:1; vol/vol) by
gently pipetting. Fixation was performed four times before spreading the cells
on glass slides. For the FISH procedure, mouse chromosome-specific painting
probes were combinatorially labelled using seven different fluorochromes and
hybridized as previously described
41
. For each cell line, 9–15 metaphase spreads
were acquired by using a Leica DM RXA RF8 epifluorescence microscope (Leica
Mikrosysteme GmbH) equipped with a Sensys CCD camera (Photometrics). Camera
and microscope were controlled by the Leica Q-FISH software (Leica Microsystems).
Metaphase spreads were processed on the basis of the Leica MCK software and
presented as multicolour karyograms.
Q-band analysis was performed at Chromocentre (Japan). After quinacrin
staining, 20 cells from each sample were randomly selected and the normality
of chromosomes was analysed. Five different independent lines of STAP stem
cells showedno chromosomalabnormalitiesin Q-band analysisafter .10 passages.
41. Jentsch, I., Geigl, J., Klein, C. A. & Speicher, M. R. Seven-fluorochrome mouse
M-FISH for high-resolution analysis of interchromosomal rearrangements.
Cytogenet. Genome Res. 103, 84–88 (2003).
ARTICLE RESEARCH
Macmillan Publishers Limited. All rights reserved
©2014
Extended Data Figure 1
|
Conversion of haematopoietic cells into
Oct4-
GFP
1
cells by a low-pH exposure. a, Optimization of pH conditions for
Oct4-GFP induction. Five days after CD45-positive cells were exposed to acidic
solution treatment at different pH, Oct4-GFP expression was analysed by
FACS (n53, average 6s.d.). b, Gating strategy for Oct4-GFP
1
cell sorting.
Top: representative results 7 days after the stress treatment. Bottom: non-
treated control. P3 populationswere sorted and counted as Oct4-GFP
1
cells for
all experiments. c, Controls for FACS analysis. In Oct4-GFP
1
cell analysis, the
grey and white histograms indicate the negative control (non-stress-treated
Oct4-gfp haematopoietic cells) and the positive control (Oct4-gfp ES cells),
respectively. Also, the green histograms indicate non-treated cells (left) and
stress-treated cells at day7 (right). In CD45
1
cell analysis, the grey and white
histograms indicate the negative (isotype) and positive controls, respectively.
The red histograms indicate non-stress-treated cells (left) and stress-treated
cells at day 7 (right). d,Oct4-GFP
1
cell generation from varioussubpopulations
of CD45
1
cells. Seven days after the stress treatment, Oct4-GFP expression was
analysed by FACS (n53, average 6s.d.). Among total CD45
1
fraction and
its subfractions of CD19
1
,CD90
1
,CD34
1
and CD34
2
cells, the efficacy of
CD34
1
cells was significantly lower than the others. P,0.05 by the
Newman–Keuls test and P,0.01 by one-way ANOVA. e, Comparison of
culture conditions for low-pH-induced conversion. Stress-treated cells were
cultured in various media. The number of Oct4-GFP-expressing clusters was
counted at day 14 (n53, average 6s.d.). ***P,0.001 (B271LIF versus all
other groups); Tukey’s test. In the case of 3i medium, although the clusters
appeared at a moderate efficiency, they appeared late and grew slowly. ACTH,
ACTH-containing ES medium; ES1LIF1FBS, 20% FBS1LIF-containing ES
culture medium; B27, DMEM/F12 medium containing 2% B27; B271LIF,
DMEM/F12 medium containing 2% B271LIF; EpiSC, EpiSC culture medium
containing Fgf21activin. f, Signalling factor dependency of STAP cell
generation. Growth factors that are conventionally used for pluripotent cell
culture such as LIF, activin,Bmp4 and Fgf2 were added to basal culture medium
(B27-supplemented DMEM/F12) in different culture phases (days 0–7, 2–7
and 4–7), and Oct4-GFP expression was analysed by FACS at day 7 (n53,
average 6s.d.). g,h, Time course of apoptosis after the low-pH exposure.
Stress-treatedcells and non-stress-treated control cellswere stained with CD45,
annexin-V and propidium iodide at day 0 (immediately after stress treatment),
day 3 and day 7. g, Blue bars, GFP
1
CD45
2
; orange bars, GFP
2
CD45
1
.
Percentages in total cells included propidium-iodide-positive cells.
h, Annexin-V-positive cells in these cell populations were analysed by FACS.
RESEARCH ARTICLE
Macmillan Publishers Limited. All rights reserved
©2014
Extended Data Figure 2
|
Phenotypic change during STAP cell conversion.
a, Oct4 protein expression in STAP cells was detected by immunostaining at
day 2 (left) and day 7 (right). b, Live cell imaging of STAP conversion
(grey, CD45 antibody; green, Oct4-GFP). See Methods for experimental details
to monitor live CD45 immunostaining. c, Immunostaining of a parental
CD45
1
cell (left) and an Oct4-GFP
1
cell (right). Scale bar, 10 mm. d,EdU
uptake assay (n53, average 6s.d.). e, Schematic of Tcrb gene rearrangement.
f, T-cell-derived STAP cells. Scalebar, 100 mm. g, Genomic PCR analysis of (D)J
recombination at the Tcrb gene of T-cell-derived STAP cells. G.L. is the size
of the non-rearrangedgermline type, whereas the smaller ladderscorrespond to
the alternative rearrangements of J exons (confirmed by sequencing). Negative
controls (ES cells), positive controls (lymphocytes) and T-cell-derived STAP
(two independent preparations on d7) are indicated.
ARTICLE RESEARCH
Macmillan Publishers Limited. All rights reserved
©2014
Extended Data Figure 3
|
Gene expression analyses during STAP
conversion and endoderm differentiation assay. a, Expression of
pluripotency marker genes in STAP cells derived from T cells (n53,
average 6s.d.). b, Expression of pluripotency marker genes in STAP cells.
In this experiment, Oct4-GFP
1
cells seen in live cell imaging (Extended Data
Fig. 2b) were analysed to confirm their conversion into STAP cells (n53,
average 6s.d.). c, Haematopoietic marker expression during STAP conversion
from CD45
1
cells (n53, average 6s.d.). d, Formation of visceral
endoderm-like surfaceepithelium in differentiating STAP clusteron day 2 (left)
and day 8 (right). Scale bars, 50mm.
RESEARCH ARTICLE
Macmillan Publishers Limited. All rights reserved
©2014
Extended Data Figure 4
|
Teratoma formation assay and characterization
of
Oct4
-GFP-dim cells. ac, Teratomas formed from STAP cell clusters
included neuroepithelium (a), striated muscle (b) and pancreas (c; right,
high-magnification view showing a typical acinar morphology and ductal
structures). Scale bars, 100 mm. d, Teratoma-forming ability of Oct4-GFP
1
and
Oct4-GFP-dim cells (isolated by FACS, top). Oct4-GFP
1
cells, but not
Oct4-GFP-dim cells, efficiently formed teratomas (table at the bottom).
However, because STAP cells were dissociation-intolerant, the teratoma-
forming efficiency of dissociated Oct4-GFP
1
cells was lower than that of
non-dissociated STAP cell clusters. e, Gene expression of Oct4-GFP
1
and
Oct4-GFP-dim cells (n53, the average 6s.d.). Haematopoietic marker gene
expression (left) and early lineage marker gene expression (right) are shown.
ARTICLE RESEARCH
Macmillan Publishers Limited. All rights reserved
©2014
Extended Data Figure 5
|
In vitro
characterization of STAP cells.
a, Immunostaining for Ki67 and BrdU. STAP cell clusters (top) and ES cell
colonies (bottom) are shown. For BrdU uptake, BrdU was added into each
culture medium (10 mM) for 12 h until fixation. Scale bar, 100 mm.
b, Transformation assay by soft agar culture. Neither Oct4-GFP
1
nor
Oct4-GFP-dim cells showedcolony formation in soft agar, whereas ES cells and
STAP stem cells showed anchorage-independent growth in the same LIF-B27
medium. Scale bar, 100mm. Proliferated cells were lysed and the amount of
DNA in each well was estimated by chemical luminescence (graph). n53,
average 6s.d. c, No substantial change in chromosome number was seen with
STAP cells in the CGH array. Genomic DNA derived from CD45
1
cells (male)
was used as reference DNA. The spikes (for example, those seen in the X
chromosome) were nonspecific and also found in the data of these parental
CD45
1
cells when the manufacturer’s control DNA was used as a reference.
d, qPCR analysis for pluripotency markers that highly express in ES cells, but
not in EpiSCs. Average6s.d. e, Immunostaining of markers for mouse EpiSC
and ES cells. Scale bar, 100 mm. f,g, H3K27me3
1
foci in female cells, which are
indicative of X-chromosomal inactivation. These foci were not observed in
male cells. Scale bar, 10 mm. In the case of female STAP cells, ,40% of cells
retained H3K27me3
1
foci (g). **P,0.001; Tukey’s test. n53, average 6s.d.
Although nuclear staining looked to be higher in STAP cells with H3K27me3
1
foci (f), this appeared to be caused by some optical artefacts scattering from the
strong focal signal. h, qPCR analysis for the tight junction markers Zo-1 and
claudin 7, which were highly expressed in EpiSCs, but not in ES cells or STAP
cells. **P,0.01; ns, not significant; Tukey’s test; n53, average 6s.d.
RESEARCH ARTICLE
Macmillan Publishers Limited. All rights reserved
©2014
Extended Data Figure 6
|
Conversion of somatic tissue cells into STAP cells.
a, Alkaline phosphatase expression of STAP cells derived from adipose-derived
mesenchymal cells. Scale bar, 100 mm. b, E-cadherin expression of STAP
cells derived from adipose-derivedmesenchymal cells. Scale bar, 50 mm. c,FACS
sorting of dissociated neonatal cardiac muscle cells by removing CD45
1
cells.
d, Cardiomyocyte marker gene expression during STAP conversion from
cardiomyocytes (n53, average 6s.d.).
ARTICLE RESEARCH
Macmillan Publishers Limited. All rights reserved
©2014
Extended Data Figure 7
|
Generation chimaeras with STAP cells. a,2N
chimaeras generated with STAP cells derived from Oct4-gfp C57BL/6 mice
(left) and 129/Sv3C57BL/6 F
1
mice (right). b, Generation of chimaeric mice
from STAP cells by cluster injection. STAP cells used in the experiments above
were generated from CD45
1
lymphocytes of multiple neonatal spleens
(male and female tissues were mixed). *All fetuses were collected at 13.5d.p.c.
to 15.5 d.p.c. and the contribution rate of STAP cells into each organ was
examined by FACS. **The contribution of STAP cells into each chimaera
was scored as high (.50% of the coat colour of GFP expression). ***B6GFP:
C57BL/6 mouse carryingcag-gfp. c, Production of offspringfrom STAP cells via
germline transmission. Chimaeras generated with 129/Sv3B6GFP STAP
cells (obtained from the experiments shown in b) were used for germline
transmission study. d, 4N embryos at E9.5 generated with STAP cells derived
from F
1
GFP mice (B6GFP and DBA/2 or 129/Sv). B6GFP, C57BL/6 mouse
carrying cag-gfp.
RESEARCH ARTICLE
Macmillan Publishers Limited. All rights reserved
©2014
Extended Data Figure 8
|
Molecular and cellular characterization of STAP
stem cells. a, Compatibility of 2i conditions with STAP stem-cell derivation
from STAP cells and STAP stem-cell maintenance. STAP stem cells could not
be established directly from STAP cells in 2i 1LIF medium (top). However,
once established in ACTH medium, STAP stem cells were able to survive
and expand in 2i 1LIF medium. Scale bar, 100 mm. b, Q-band analysis (n54;
all cell lines showed the normal karyotype). c, Multicolour FISH analysis (n58;
all cell lines showed the normal karyotype) of STAP stem cells. d, Methylation
status of the Oct4 and Nanog promoters. e, Electron microscope analysis of
STAP stem cells. Scalebar, 1 mm. f,g, Beating cardiac muscle (mesoderm; 38%,
n58). Red line indicates an analysed region for kymograph (g). h, Clonability
of STAP stem cells. Clonal expansion from single STAP stem cells was
performed. Pluripotency of clonal cell lines was confirmed by teratoma
formation assay, showing the formation of neuroectoderm (left), muscle tissue
(middle) and bronchial-like epithelium (right). Scale bar, 100 mm. i, Production
of chimaeric mice from STAP stem-cell lines using diploid embryos. *These
STAP stem-cell lines were generated from independent STAP cell clusters.
j, Production of mouse chimaeras from STAP stem-cell lines by the tetraploid
complementation method. *These STAP stem-cell lines were generated
from independent STAP cell clusters. k, No H3K27me3-dense foci are seen
in female STAP stem cells (n550; the CD45
1
cell is a positive control).
Scale bar, 10 mm.
ARTICLE RESEARCH
Macmillan Publishers Limited. All rights reserved
©2014
Extended Data Figure 9
|
Effects of various stressors on STAP conversion.
a, Percentages of Oct4-GFP-expressing cells 7 days after stress treatment.
Somatic cells were isolated from various tissues and exposed to different
stressors. Oct4-GFP expression was analysed by FACS. b, Oct4 and Oct4-GFP
expression induced in the reflux oesophagitis mouse model as an in vivo acid
exposure model (top, experimental procedure). Oct4, but not Nanog,
expression was observed in the oesophageal epithelium exposed to gastric acid
(75% of 12 operated mice).
RESEARCH ARTICLE
Macmillan Publishers Limited. All rights reserved
©2014
... Chimeras were made by members of the Laboratory for Animal Resources and Genetic Engineering, CDB, with expertise in chimera production with ES cells (present affiliation: Animal Resource Development Unit, Biosystem Dynamics Group, Division of Bio--Function Dynamics Imaging, Center for Life Science Technologies (CLST)). The previous report indicated that the generation of chimeras using STAP cells involved a distinct technical approach (Obokata et al., 2014a). "Single cell dispersion by trypsinization, as it is done in the chimera production with ES cells, caused low chimaerism. ...
... Injected embryos were transplanted into the uterus of pseudopregnant females of the ICR strain, and recovered mainly at E9.5 to judge the contribution of injected cells in each tissue by GFP--green fluorescence ( Table 2). Note that in the previous study "small clusters of 'STAP' cells are injected into E4.5 blastocysts, and the next day, the chimeric blastocysts were transferred into pseudopregnant females (Obokata et al., 2014a)." In total, 1,154 embryos injected with a cell aggregate were transplanted into a foster uterus, and 671 were recovered. ...
... (1) Preliminary FACS analysis of low pH--treated, Oct--GFP transgenic spleen cells suggested that the frequency of green fluorescent cells was very low and that the majority of surviving cells were CD45--positive after one week in culture under the conditions used in the present study. In the previous study, CD45 cells were rare and a significant number of green fluorescent cells were observed (Fig.1c in the previous study (Obokata et al., 2014a)). ...
Preprint
This reports the results of an attempt by Haruko Obokata to replicate the phenomenon of stimulus-triggered acquisition of pluripotency (STAP), which was first reported in a pair of papers authored by Obokata and colleagues in 2014. The most conclusive evidence for the pluripotency of so-called STAP cells was their purported ability to contribute to chimera formation. In the follow-up trial presented here, putative STAP cells prepared by Obokata were injected into 1154 embryos, of which 671 were recovered. However, the injected cells made no significant contribution in any tissue in any of the embryos developed.
... Namun demikian tidak semua stimulus tersebut mendapatkan respon individu untuk dipersepsi. Stimulus yang akan dipersepsi atau mendapatkan respon dari individu tergantung pada perhatian individu (Obokata et al., 2014). ...
Article
Full-text available
Tujuan penelitian adalah untuk mengetahui tingkat persepsi siswa-siswi terhadap konsep pendidikan jasmani pada SMA Negeri Kabupaten Pasuruan. Populasi dari peneltian ini berjumlah 371 siswa se Kecamatan Kota Pasuruan dan peneltian ini mengunkan sampel berjumlah 360. Instrumen pada penelitian ini menggunakan kuisoner inventori. Teknik analisis data pada peneltian ini mengunakan teknik analisis deskriptif kuantitatif. Analisis data kuantitif diperoleh dari hasil siswa mengisi kuisoner dan di analisis menggunakan rumus presentase. Hasil pengisian kuisoner tingkat persepsi siswa terhadap konsep pendidikan jasmani di SMA Negeri Kabupaten Pasuruan diperoleh 85,76 persen. Perbedaan tingkat persepsi siswa laki-laki dan perempuan terhadap konsep pendidikan jasmani diperoleh nilai signifikan 0,003 dengan taraf signifikansi > 0,05 artinya hipotesis diterima. Selanjutnya perbedaan tingkat persepsi siswa kelas X dan kelas XI terhadap konsep pendidikan diperoleh nilai signifikan 0,003 dengan taraf signifikan > 0,05 artinya hipotesis diterima. Dengan demikian dapat disimpulkan bahwa tingkat persepsi siswa terhadap konsep pendidikan jasmani di SMA Negeri Kabupaten Pasuruan hasilnya sangat baik, tingkat persepsi siswa laki-laki dan perempuan terhadap konsep pendidikan jasmani mengalami perbedaan, dan tingkat persepsi siswa kelas X dan kelas XI terhadap konsep pendidikan jasmani mengalami perbedaan.
... Perpetrated as a hoax for four decades, in 1953 the report was shown to be entirely fabricated. More recently, claimed links between vaccines and autism and reports that a simple method could turn skin cells into stem cells were both exposed as fraudulent science (De Los Angeles et al. 2015;Godlee, Smith, and Marcovitch 2011;Obokata et al. 2014;Wakefield et al. 1998). ...
Article
Fraud in biomedical research, though relatively uncommon, damages the scientific community by diminishing the integrity of the ecosystem and sending other scientists down fruitless paths. When exposed and publicized, fraud also reduces public respect for the research enterprise, which is required for its success. Although the human frailties that contribute to fraud are as old as our species, the response of the research community to allegations of fraud has dramatically changed. This is well illustrated by three prominent cases known to the author over 40 years. In the first, I participated as auditor in an ad hoc process that, lacking institutional definition and oversight, was open to abuse, though it eventually produced an appropriate result. In the second, I was a faculty colleague of a key participant whose case helped shape guidelines for management of future cases. The third transpired during my time overseeing the well-developed if sometimes overly bureaucratized investigatory process for research misconduct at Harvard Medical School, designed in accordance with prevailing regulations. These cases illustrate many of the factors contributing to fraudulent biomedical research in the modern era and the changing institutional responses to it, which should further evolve to be more efficient and transparent.
... One group of researchers also reported that the greatest number of discrepancies came from studies reporting greatest potential benefit for patients (Nowbar et al., 2014). Other studies have also reported on "stimulus triggered acquisition of pluripotency" only to later, following inability of independent J o u r n a l P r e -p r o o f confirmation of the results, admit that the whole research data was fabricated (Obokata et al., 2015). ...
Article
AIMS Stem cells are a promising therapy for various medical conditions. The literature regarding their adoption for the clinical care of cardiovascular diseases (CVD) is still conflicting. Therefore, our aim is to assess the strength and credibility of the evidence on clinical outcomes and application of stem cells derived from systematic reviews and meta-analyses of intervention studies in CVD. METHODS and RESULTS Umbrella review of systematic reviews with meta-analyses of randomized controlled trials (RCTs) using placebo/no intervention as control group. For meta-analyses of RCTs, outcomes with a random-effect p-value< 0.05, the GRADE (Grading of Recommendations Assessment, Development and Evaluation) assessment was used, classifying the evidence from very low to high. From 184 abstracts initially identified, 11 meta-analyses (for a total of 34 outcomes) were included. Half of the outcomes were statistically significant (p < 0.05), indicating that stem cells are more useful than placebo. High certainty of evidence supports the associations of the use of stem cells with a better left ventricular end systolic volume and left ventricular ejection fraction (LVEF) in acute myocardial infarction; improved exercise time in refractory angina; a significant lower risk of amputation rate in critical limb ischemia; a higher successful rate in complete healing in case of lower extremities ulcer; and better values of LVEF in systolic heart failure, as compared to placebo. CONCLUSION and RELEVANCE The adoption of stem cells in clinical practice is supported by a high certainty of strength in different CVD, with the highest strength in acute myocardial infarction and refractory angina.
... More importantly, it generates a non-carcinogenic XEN-like (extraembryonic endodermlike) cell state that expands rapidly in vitro without destroying genomic integrity or stability (Li et al., 2017). Regardless of the path that is used for reprogramming, the rationale of cell reprogramming may be 1) the double alteration of gene expression procedures for one somatic cell (Li et al., 2017); and 2) that differentiated cells are in a temporary stable situation that is overturned once homeostasis is destroyed in the case of injury, disorders, or natural aging (Obokata et al., 2014). Until now, IPS has been used to successfully treat SCI, diabetes, sickle cell anemia, Parkinson's disease, and thrombocytopenia in rodent disease models, and retinal pigment epithelium, leukemia, thrombocytopenia, and transmissible melanoma in human patients. ...
Article
Spinal cord injury has long been a prominent challenge in the trauma repair process. Spinal cord injury is a research hotspot by virtue of its difficulty to treat and its escalating morbidity. Furthermore, spinal cord injury has a long period of disease progression and leads to complications that exert a lot of mental and economic pressure on patients. There are currently a large number of therapeutic strategies for treating spinal cord injury, which range from pharmacological and surgical methods to cell therapy and rehabilitation training. All of these strategies have positive effects in the course of spinal cord injury treatment. This review mainly discusses the problems regarding stem cell therapy for spinal cord injury, including the characteristics and action modes of all relevant cell types. Induced pluripotent stem cells, which represent a special kind of stem cell population, have gained impetus in cell therapy development because of a range of advantages. Induced pluripotent stem cells can be developed into the precursor cells of each neural cell type at the site of spinal cord injury, and have great potential for application in spinal cord injury therapy.
... The two manuscripts on mouse stimulus-triggered acquisition of pluripotency (STAP) cells [9,10] were retracted in 2014. Furthermore, scientists worldwide have been unable to replicate STAP cells and/or the STAP phenomenon [11,12]. ...
Preprint
Full-text available
Scientists worldwide have been unable to replicate the stimulus-triggered acquisition of pluripotency (STAP) cells and/or the STAP phenomenon. However, investigations into STAP cells and/or the STAP phenomenon by RIKEN CDB in Japan found that ATP (adenosine 5’-triphosphate disodium salt hydrate) can upregulate Oct3/4 (POU5F1: POU domain, class 5, transcription factor 1) and Nanog mRNA expression in mouse hepatocytes. On the other hand, no studies have investigated whether ATP can contribute to human blastocyst development. Here we show the reactivation of reprogramming factors within human blastocysts by appropriate ATP treatment (1 mM for 2 days) can contribute to human blastocyst development. In conclusion, although ATP treatment could not replicate STAP cells and/or the STAP phenomenon by scientists worldwide, appropriate ATP treatment (1 mM for 2 days) in cultured human blastocysts with totipotency would be helpful for infertility women.
... Similarly, iPSCs were derived from nearly all somatic cell populations, such as keratinocytes [50], neural cells [51,52], stomach and liver cells [53], melanocytes [54], and lymphocytes [55], via various vectors [56]. To eliminate the risk of genomic integration and insertional mutagenesis, recent methodological improvements, such as treatment with microRNAs [57], synthetic mRNA modified [56], and valproic acid [58] as well as stimulus-triggered acquisition of pluripotency (transient low-pH stressor) [59] and chemically smallmolecule compounds [60], enhance the efficiency of reprogramming, reducing genomic modifications. These concentrated gains demonstrate an increasing number of reprogramming strategies, but these achievements also hint that the transcription network governing pluripotency is unclear. ...
Article
Full-text available
Embryonic stem cells (ESCs) derived from somatic cell nuclear transfer (SCNT) and induced pluripotent stem cells (iPSCs) are promising tools for meeting the personalized requirements of regenerative medicine. However, some obstacles need to be overcome before clinical trials can be undertaken. First, donor cells vary, and the reprogramming procedures are diverse, so standardization is a great obstacle regarding SCNT and iPSCs. Second, somatic cells derived from a patient may carry mitochondrial DNA mutations and exhibit telomere instability with aging or disease, and SCNT-ESCs and iPSCs retain the epigenetic memory or epigenetic modification errors. Third, reprogramming efficiency has remained low. Therefore, in addition to improving their success rate, other alternatives for producing ESCs should be explored. Producing androgenetic diploid embryos could be an outstanding strategy; androgenic diploid embryos are produced through double sperm cloning (DSC), in which two capacitated sperms (XY or XX, sorted by flow cytometer) are injected into a denucleated oocyte by intracytoplasmic sperm injection (ICSI) to reconstruct embryo and derive DSC-ESCs. This process could avoid some potential issues, such as mitochondrial interference, telomere shortening, and somatic epigenetic memory, all of which accompany somatic donor cells. Oocytes are naturally activated by sperm, which is unlike the artificial activation that occurs in SCNT. The procedure is simple and practical and can be easily standardized. In addition, DSC-ESCs can overcome ethical concerns and resolve immunological response matching with sperm providers. Certainly, some challenges must be faced regarding imprinted genes, epigenetics, X chromosome inactivation, and dosage compensation. In mice, DSC-ESCs have been produced and have shown excellent differentiation ability. Therefore, the many advantages of DSC make the study of this process worthwhile for regenerative medicine and animal breeding.
... A cogent use case for this treatment of evidence comes from the recent Surgisphere retractions in COVID-19 research Mehra, Mandeep R et al. 2020), and earlier, the Obokata "stimulus transitioned acquisition of pluripotency" (STAP) retractions (Aizawa 2016;Ishii et al. 2014;Haruko Obokata, Wakayama, et al. 2014). Many more such cases could be cited, including the Wakefield paper in Lancert which claimed that MMR vaccination caused autism (Deer 2011; The Editors of The Lancet 2010; Wakefield et al. 1998). ...
Preprint
Full-text available
Results of computational analyses require transparent disclosure of their supporting resources, while the analyses themselves often can be very large scale and involve multiple processing steps separated in time. Evidence for the correctness of any analysis consists of accessible data and software with runtime parameters, environment, and personnel involved. Evidence graphs - a derivation of argumentation frameworks adapted to biological science - can provide this disclosure as machine-readable metadata resolvable from persistent identifiers for computationally generated graphs, images, or tables, that can be archived and cited in a publication including a persistent ID. We have built a cloud-based, computational research commons for predictive analytics on biomedical time series datasets with hundreds of algorithms and thousands of computations using a reusable computational framework we call FAIRSCAPE. FAIRSCAPE computes a complete chain of evidence on every result, including software, computations, and datasets. An ontology for Evidence Graphs, EVI ( https://w3id.org/EVI ), supports inferential reasoning over the evidence. FAIRSCAPE can run nested or disjoint workflows and preserves the provenance graph across them. It can run Apache Spark jobs, scripts, workflows, or user-supplied containers. All objects are assigned persistent IDs, including software. All results are annotated with FAIR metadata using the evidence graph model for access, validation, reproducibility, and re-use of archived data and software. FAIRSCAPE is a reusable computational framework, enabling simplified access to modern scalable cloud-based components. It fully implements the FAIR data principles and extends them to provide FAIR Evidence, including provenance of datasets, software and computations, as metadata for all computed results.
Chapter
Quality assurance (QA) is an indispensable part of manufacturing industries and corporate. Academics also require QA to avoid misconduct and conflicts. Adhering to Good Lab Practices (GLP) is definitely a prerequisite for quality research. Implementation of QA should be done at different stages of research like the inception of research idea, generation of data, and presentation of research data to avoid any future conflicts. There are numerous examples in the history of research and academics where considerable conflicts raised doubts about the credibility and quality of research. QA provides the reproducibility, back traceability, and reliability of the generated data. It not only strengthens and encourages the researchers to contribute in the respective field but also acts as a defensive shield against jealousy and negative competition-driven accusations. Protection of intellectual property is also vital in academics as it is a sensitive area often infested with conflicts. QA can help in this regard by safeguarding Intellectual Property. Stringent implementation and monitoring of the QA and timely amendment can provide the maximum benefits in academics and research fraternities. This chapter describes the concepts like implementation of QA in academics, history of scientific misconduct which supports the notion of the need for QA, and also lays a format for how QA can be implemented at various stages of research. Here we also discuss the role of QA personnel in ensuring Quality in a GLP laboratory. It basically outlines the importance of QA and how it can be implemented in academics to avoid conflicts and improve the quality standard of research.
Article
Almost quarter of a century long studies aimed at identification, isolation, culturing, and use of postnatal pluripotent cells for the development of cell-based technologies have not met with success and failed to provide reliable and reproducible protocols of cell isolation, identification, and culturing. At the same time, experimental data in this field suggest that postnatal pluripotent cells are not the copies of embryonic cells and, therefore, the tests routinely used for identification of embryonic pluripotent cells are not fully adequate for characterization of their postnatal analogues. Therefore, cell lineage tracing methods showing the differentiation routes of the studied cells in human or animal body after birth should be developed and used.
Article
Full-text available
Pluripotent stem cells can be induced from somatic cells, providing an unlimited cell resource, with potential for studying disease and use in regenerative medicine. However, genetic manipulation and technically challenging strategies such as nuclear transfer used in reprogramming limit their clinical applications. Here, we show that pluripotent stem cells can be generated from mouse somatic cells at a frequency up to 0.2% using a combination of seven small-molecule compounds. The chemically induced pluripotent stem cells resemble embryonic stem cells in terms of their gene expression profiles, epigenetic status, and potential for differentiation and germline transmission. By using small molecules, exogenous “master genes” are dispensable for cell fate reprogramming. This chemical reprogramming strategy has potential use in generating functional desirable cell types for clinical applications.
Article
Full-text available
Multilineage-differentiating stress-enduring (Muse) cells are distinct stem cells in mesenchymal cell populations with the capacity to self-renew, to differentiate into cells representative of all three germ layers from a single cell, and to repair damaged tissues by spontaneous differentiation into tissue-specific cells without forming teratomas. We describe step-by-step procedures for isolating and evaluating these cells. Muse cells are also a practical cell source for human induced pluripotent stem (iPS) cells with markedly high generation efficiency. They can be collected as cells that are double positive for stage-specific embryonic antigen-3 (SSEA-3) and CD105 from commercially available mesenchymal cells, such as adult human bone marrow stromal cells and dermal fibroblasts, or from fresh adult human bone marrow samples. Under both spontaneous and induced differentiation conditions, they show triploblastic differentiation. It takes 4-6 h to collect and 2 weeks to confirm the differentiation and self-renewal capacity of Muse cells.
Article
Full-text available
Balanced organogenesis requires the orchestration of multiple cellular interactions to create the collective cell behaviours that progressively shape developing tissues. It is currently unclear how individual, localized parts are able to coordinate with each other to develop a whole organ shape. Here we report the dynamic, autonomous formation of the optic cup (retinal primordium) structure from a three-dimensional culture of mouse embryonic stem cell aggregates. Embryonic-stem-cell-derived retinal epithelium spontaneously formed hemispherical epithelial vesicles that became patterned along their proximal-distal axis. Whereas the proximal portion differentiated into mechanically rigid pigment epithelium, the flexible distal portion progressively folded inward to form a shape reminiscent of the embryonic optic cup, exhibited interkinetic nuclear migration and generated stratified neural retinal tissue, as seen in vivo. We demonstrate that optic-cup morphogenesis in this simple cell culture depends on an intrinsic self-organizing program involving stepwise and domain-specific regulation of local epithelial properties.
Article
Full-text available
Mature adult tissues contain stem cells that express many genes normally associated with the early stage of embryonic development, when maintained in appropriate environments. Cells procured from adult tissues representative of the three germ layers (spinal cord, muscle, and lung), each exhibiting the potential to mature into cells representative of all three germ layers. Cells isolated from adult tissues of different germ layer origin were propagated as nonadherent clusters or spheres that were composed of heterogeneous populations of cells. When the clusters or spheres were dissociated, the cells had the ability to reform new, nonadherent spheres for several generations. When implanted in vivo, in association with biodegradable scaffolds, into immunodeficient mice, tissue containing cells characteristic of the three germ layers was generated. These findings suggest the existence of a population of stem cells in adult tissues that is quite different and distinct from embryonic stem cells that demonstrate a greater potency for differentiation across germ lines than previously believed. Such cells could potentially be as useful as embryonic stem cells in tissue engineering and regenerative medicine.
Article
Previous studies of serial cloning in animals showed a decrease in efficiency over repeated iterations and a failure in all species after a few generations. This limitation led to the suggestion that repeated recloning might be inherently impossible because of the accumulation of lethal genetic or epigenetic abnormalities. However, we have now succeeded in carrying out repeated recloning in the mouse through a somatic cell nuclear transfer method that includes a histone deacetylase inhibitor. The cloning efficiency did not decrease over 25 generations, and, to date, we have obtained more than 500 viable offspring from a single original donor mouse. The reprogramming efficiency also did not increase over repeated rounds of nuclear transfer, and we did not see the accumulation of reprogramming errors or clone-specific abnormalities. Therefore, our results show that repeated iterative recloning is possible and suggest that, with adequately efficient techniques, it may be possible to reclone animals indefinitely.
Article
Two kinds of human pluripotent cells, human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs), promise new avenues for medical innovation. These human cells share many similarities with mouse counterparts, including pluripotency, and they exhibit several unique properties. This review examines the diversity of mammalian pluripotent cells from a perspective of metastable pluripotency states. An intriguing phenomenon unique to human pluripotent stem cells is dissociation-induced apoptosis, which has been a technical problem for various cellular manipulations. The discovery that this apoptosis is suppressed by ROCK inhibitors brought revolutionary change to this troublesome situation. We discuss possible links of the metastable pluripotent state to ROCK-dependent human embryonic stem cell apoptosis and summarize recent progress in molecular understandings of this phenomenon.
Article
In female mammals, one of two X chromosomes is epigenetically inactivated for gene dosage compensation, known as X inactivation (Xi). Inactivation occurs randomly in either the paternal or maternal X chromosome in all embryonic cell lineages, designated as random Xi. By contrast, in extra-embryonic cell lineages, which are segregated from somatic cell lineages in pre-implantation development, the paternal X chromosome is selectively inactivated, known as imprinted Xi. Although it is speculated that erasure of the imprinted mark on either the maternal or paternal X chromosome in somatic cell lineages might change the mode of Xi from imprinted to random, it is not known when this event is completed in development. Here, we tested the mode of Xi during the differentiation of female mouse embryonic stem (ES) cells derived from the inner cell mass (ICM) of blastocyst-stage embryos toward trophectoderm (TE) and primitive endoderm (PrE) lineages induced by artificial activation of transcription factor genes Cdx2 and Gata6, respectively. We found that random Xi occurs in both TE and PrE cells. Moreover, cloned embryos generated by the transfer of nuclei from the female ES cells showed random Xi in TE, suggesting the complete erasure of all X imprints for imprinted Xi in ICM-derived ES cells.
Article
Human embryonic stem cells (hESCs), unlike mouse ones (mESCs), are vulnerable to apoptosis upon dissociation. Here, we show that the apoptosis, which is of a nonanoikis type, is caused by ROCK-dependent hyperactivation of actomyosin and efficiently suppressed by the myosin inhibitor Blebbistatin. The actomyosin hyperactivation is triggered by the loss of E-cadherin-dependent intercellular contact and also observed in dissociated mouse epiblast-derived pluripotent cells but not in mESCs. We reveal that Abr, a unique Rho-GEF family factor containing a functional Rac-GAP domain, is an indispensable upstream regulator of the apoptosis and ROCK/myosin hyperactivation. Rho activation coupled with Rac inhibition is induced in hESCs upon dissociation, but not in Abr-depleted hESCs or mESCs. Furthermore, artificial Rho or ROCK activation with Rac inhibition restores the vulnerability of Abr-depleted hESCs to dissociation-induced apoptosis. Thus, the Abr-dependent "Rho-high/Rac-low" state plays a decisive role in initiating the dissociation-induced actomyosin hyperactivation and apoptosis in hESCs.
Article
During early mammalian development, as the pluripotent cells that give rise to all of the tissues of the body proliferate and expand in number, they pass through transition states marked by a stepwise restriction in developmental potential and by changes in the expression of key regulatory genes. Recent findings show that cultured stem-cell lines derived from different stages of mouse development can mimic these transition states. They further reveal that there is a high degree of heterogeneity and plasticity in pluripotent populations in vitro and that these properties are modulated by extrinsic signalling. Understanding the extrinsic control of plasticity will guide efforts to use human pluripotent stem cells in research and therapy.