ArticlePDF Available

First Report of a Novel Begomovirus Associated with Yellow Vein Disease of Browne's Blechum ( Blechum pyramidatum )

Authors:
Wen-Shi Tsai at National Chiayi University
Wen-Shi Tsai
Su-Ling Shih at World Vegetable Center
Su-Ling Shih
Li-mei Lee
Li-mei Lee
Li-mei Lee
  • This person is not on ResearchGate, or hasn't claimed this research yet.
Lolita M. Dolores
Lolita M. Dolores
Lolita M. Dolores
  • This person is not on ResearchGate, or hasn't claimed this research yet.
Show all 5 authorsHide
Download full-text PDF
Read full-text
Download citation

Abstract and Figures

Browne's Blechum (Blechum pyramidatum) is a common weed found in fields and waste grounds in the Philippines. A disease was observed causing begomovirus-like yellow/chlorotic leaf veins and shortened internodes of Browne?s Blechum plants on the island of Luzon, Philippines; disease incidence ranged from 10 to 50% in fields in 2012. Samples were collected from two plants with symptoms from each of Laguna and Quezon provinces and one plant without symptoms from Laguna province. All four samples from plants with symptoms tested positive for begomovirus by polymerase chain reaction (PCR) using primer pair PAL1v1978B/PAR1c715H (2), but the symptomless plant sample did not. However, no virus DNA-B component was detected in any of the samples using either general detection primer pair DNABLC1?DNABLV2 or DNABLC2?DNABLV2 (1). Using abutting primers AFPH12W1-R2F (TCTGGATCCATTGTTGAACGAGT) and AFPH12W1-R2R (CCGGGATCCCACATTGTTAAACA), a complete DNA-A component sequence was obtained for a Laguna isolate (GenBank Accession No. KF446659) and for a Quezon isolate (GenBank Accession No. KF446660). The Laguna and Quezon isolate sequences were 2764 and 2756 nucleotides respectively, and shared 90.6% nucleotide sequence identity. Both had six open reading frames (ORFs)?two in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4)?and the geminivirus conserved sequence (TAATATTAC). Based on BLASTn searching of GenBank and sequence analysis using MEGALIGN (DNASTAR), both isolates should be considered as a new begomovirus (tentatively named Blechum yellow vein virus, BlYVV) since their DNA-A sequences share less than 89% nucleotide identity with any other begomovirus. Both DNA sequences had the highest nucleotide identity (84.8-87.6%) with Papaya leaf curl Guangdong virus isolates (GenBank Accession No. AJ558122, AY650283, FJ495184, FJ869907 and JN703795). To our knowledge this is the first report of a previously unidentified begomovirus associated with yellow vein disease of this species. References: (1) S. K. Green et al., Plant Dis. 85: 1286, 2001. (2) W. S. Tsai et al., Plant Pathol. 60:787-799, 2011.
No caption available
… 
No caption available
… 
Figures - uploaded by Lawrence Kenyon
Author content
All figure content in this area was uploaded by Lawrence Kenyon
Content may be subject to copyright.
Content uploaded by Lawrence Kenyon
Author content
All content in this area was uploaded by Lawrence Kenyon on Nov 15, 2014
Content may be subject to copyright.
Tsai, W. S., Shih, S. L., Lee, L. M., Dolores, L. M., & Kenyon, L. (2013). First Report of a
Novel Begomovirus Associated with Yellow Vein Disease of Browne's Blechum
(Blechum pyramidatum). Plant Disease, 98, 701-701.
May 2014, Volume 98, Number 5
Page 701
http://dx.doi.org/10.1094/PDIS-10-13-1025-PDN
Disease Notes
First Report of a Novel Begomovirus Associated with
Yellow Vein Disease of Browne's Blechum (Blechum
pyramidatum)
W. S. Tsai, S. L. Shih, and L. M. Lee, AVRDC – The World Vegetable Center, Shanhua, Tainan,
74151 Taiwan; L. M. Dolores, Institute of Plant Breeding, Cop Science Cluster (CSC), College of
Agriculture (CA), University of the Philippines Los Baños (UPLB), College, Laguna, Philippines; and L.
Kenyon, AVRDC – The World Vegetable Center, Shanhua, Tainan, 74151 Taiwan
Browne's Blechum (Blechum pyramidatum) is a common weed found in fields and waste grounds in
the Philippines. A disease was observed causing begomovirus-like yellow/chlorotic leaf veins and
shortened internodes of Browne's Blechum plants on the island of Luzon, Philippines; disease
incidence ranged from 10 to 50% in fields in 2012. Samples were collected from two plants with
symptoms from each of Laguna and Quezon provinces and one plant without symptoms from Laguna
Province. All four samples from plants with symptoms tested positive for begomovirus by PCR using
primer pair PAL1v1978B/PAR1c715H (2), but the symptomless plant sample did not. However, no
virus DNA-B component was detected in any of the samples using either general detection primer pair
DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (1). Using abutting primers AFPH12W1-R2F
(TCTGGATCCATTGTTGAACGAGT) and AFPH12W1-R2R (CCGGGATCCCACATTGTTAAACA), a complete
DNA-A component sequence was obtained for a Laguna isolate (GenBank Accession No. KF446659)
and for a Quezon isolate (KF446660). The Laguna and Quezon isolate sequences were 2,764 and
2,756 nucleotides, respectively, and shared 90.6% nucleotide sequence identity. Both had six open
reading frames (ORFs)—two in the virus sense (V1 and V2) and four in the complementary sense (C1
to C4)—and the geminivirus conserved sequence (TAATATTAC). Based on BLASTn searching of
GenBank and sequence analysis using MEGALIGN (DNASTAR), both isolates should be considered as a
new begomovirus (tentatively named Blechum yellow vein virus, BlYVV) since their DNA-A sequences
share less than 89% nucleotide identity with any other begomovirus. Both DNA sequences had the
highest nucleotide identity (84.8 to 87.6%) with Papaya leaf curl Guangdong virus isolates (AJ558122,
AY650283, FJ495184, FJ869907, and JN703795). To our knowledge, this is the first report of a
previously unidentified begomovirus associated with yellow vein disease of this species.
References: (1) S. K. Green et al. Plant Dis. 85:1286, 2001. (2) W. S. Tsai et al. Plant Pathol. 60:787, 2011.
Supplemental Material
Browne's Blechum without virus symptoms
from Laguna Province, Philippines.
Browne's Blechum with yellow/chlorotic veins and shortened
internodes from Laguna Province, Philippines.
Global Weed-Infecting Geminiviruses
Chapter
  • Jul 2019
Weeds are invasive species that grow along with cultivated plants due to their high phenotypic plasticity. They serve as reservoirs of geminiviruses during off-season for main crops and provide the source of virus inoculum during their plantation. Geminiviruses are single-stranded DNA viruses enclosed in icosahedral geminate particles. These viruses can be either monopartite or bipartite, depending upon the number of genomic circles present. The members of genus Begomovirus are responsible for huge economic crop losses and are transmitted through insect vector Bemisia tabaci. The majority of the weed-infecting monopartite begomoviruses are associated with Betasatellite genus of Tolecusatellitidae family and alphasatellites. Geminiviruses are reported to infect a variety of weeds in South-east Asia, Mediterranean region, Western Europe (mainly Spain and France), Africa, Latin America, Central America, Caribbean region, and Australia. Weeds harbor the mixed infection of viruses; therefore, these plants serve as melting pots for recombination and evolution of begomoviruses. This chapter presents the geminivirus infection on weeds, their recombination, and their spread to newer hosts.
View
Temporal distribution and pathogenicity of the predominant tomato-infecting begomoviruses in Taiwan
Article
  • Aug 2011
  • PLANT PATHOL
Between 1998 and 2009, the four tomato-infecting begomovirus species detected in Taiwan were Ageratum yellow vein Hualien virus (AYVHuV), Tomato leaf curl Taiwan virus (ToLCTWV), Tomato yellow leaf curl Thailand virus (TYLCTHV) and a newly defined species Tomato leaf curl Hsinchu virus (ToLCHsV). AYVHuV was detected occasionally in 2003 and ToLCHsV only in 2000–2001, whilst ToLCTWV was detected throughout the period. TYLCTHV was first detected in 2005. Between 1998 and 2005, >99% of the begomovirus-positive samples were infected with ToLCTWV. In 2007 in western Taiwan, 16% of the positive samples were infected with ToLCTWV, 35% with TYLCTHV and 49% with mixed infection (ToLCTWV/TYLCTHV). In contrast, in eastern Taiwan the proportions were 84% ToLCTWV, 2% TYLCTHV and 14% mixed infection. However, throughout Taiwan in 2008–2009, most positive samples were either identified as TYLCTHV (51%) or mixed infection (ToLCTWV/TYLCTHV; 41%), and only 8% were ToLCTWV. This shows a clear trend of shifting from ToLCTWV to TYLCTHV and mixed infection over a short time period in Taiwan. Sequence analyses indicated that tomato-infecting AYVHuV, an apparent recombinant between ToLCTWV and AYVHuV from Ageratum, represents a new strain Hsinchu. TYLCTHV Taiwan isolates were highly similar to each other, whereas ToLCTWV isolates had greater diversity and were classified into three strains which had one country-wide and two local distributions. ToLCTWV and TYLCTHV were confirmed as monopartite and bipartite begomoviruses, respectively, by agroinfection followed by transmission with Bemisia tabaci biotype B. In addition, TYLCTHV was found to be mechanically transmissible together with viral DNA-B.
View
Multiplex PCR for the Simultaneous Identification and Detection of Meloidogyne incognita, M. enterolobii, and M. javanica Using DNA Extracted Directly from Individual Galls
Article
  • Jul 2011
  • PHYTOPATHOLOGY
Meloidogyne incognita, M. enterolobii, and M. javanica are the most widespread species of root-knot nematodes in South China, affecting many economically important crops, ornamental plants, and fruit trees. In this study, one pair of Meloidogyne universal primers was designed and three pairs of species-specific primers were employed successfully to rapidly detect and identify M. incognita, M. enterolobii, and M. javanica by multiplex polymerase chain reaction (PCR) using DNA extracted from individual galls. Multiplex PCR from all M. incognita, M. enterolobii, and M. javanica isolates generated two fragments of ≈500 and 1,000, 500 and 200, and 500 and 700 bp, respectively. The 500-bp fragment is the internal positive control fragment of rDNA 28S D2/D3 resulting from the use of the universal primers. Other Meloidogyne spp. included in this study generated only one fragment of ≈500 bp in size. Using this approach, M. incognita, M. enterolobii, and M. javanica were identified and detected using DNA extracted directly from individual galls containing the Meloidogyne spp. at various stages of their life cycle. Moreover, the percentage of positive PCR amplification increased with nematode development and detection was usually easy after the late stage of the second-stage juvenile. The protocol was applied to galls from naturally infested roots and the results were found to be fast, sensitive, robust, and accurate. This present study is the first to provide a definitive diagnostic tool for M. incognita, M. enterolobii, and M. javanica using DNA extracted directly from individual galls using a one-step multiplex PCR technique.
View
Supplemental Material Browne's Blechum without virus symptoms from Laguna Province
  • PLANT PATHOL
  • 787
  • S K Green
References: (1) S. K. Green et al. Plant Dis. 85:1286, 2001. (2) W. S. Tsai et al. Plant Pathol. 60:787, 2011. Supplemental Material Browne's Blechum without virus symptoms from Laguna Province, Philippines.