Content uploaded by Lawrence Kenyon
Author content
All content in this area was uploaded by Lawrence Kenyon on Nov 15, 2014
Content may be subject to copyright.
Tsai, W. S., Shih, S. L., Lee, L. M., Dolores, L. M., & Kenyon, L. (2013). First Report of a
Novel Begomovirus Associated with Yellow Vein Disease of Browne's Blechum
(Blechum pyramidatum). Plant Disease, 98, 701-701.
May 2014, Volume 98, Number 5
Page 701
http://dx.doi.org/10.1094/PDIS-10-13-1025-PDN
Disease Notes
First Report of a Novel Begomovirus Associated with
Yellow Vein Disease of Browne's Blechum (Blechum
pyramidatum)
W. S. Tsai, S. L. Shih, and L. M. Lee, AVRDC – The World Vegetable Center, Shanhua, Tainan,
74151 Taiwan; L. M. Dolores, Institute of Plant Breeding, Cop Science Cluster (CSC), College of
Agriculture (CA), University of the Philippines Los Baños (UPLB), College, Laguna, Philippines; and L.
Kenyon, AVRDC – The World Vegetable Center, Shanhua, Tainan, 74151 Taiwan
Browne's Blechum (Blechum pyramidatum) is a common weed found in fields and waste grounds in
the Philippines. A disease was observed causing begomovirus-like yellow/chlorotic leaf veins and
shortened internodes of Browne's Blechum plants on the island of Luzon, Philippines; disease
incidence ranged from 10 to 50% in fields in 2012. Samples were collected from two plants with
symptoms from each of Laguna and Quezon provinces and one plant without symptoms from Laguna
Province. All four samples from plants with symptoms tested positive for begomovirus by PCR using
primer pair PAL1v1978B/PAR1c715H (2), but the symptomless plant sample did not. However, no
virus DNA-B component was detected in any of the samples using either general detection primer pair
DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (1). Using abutting primers AFPH12W1-R2F
(TCTGGATCCATTGTTGAACGAGT) and AFPH12W1-R2R (CCGGGATCCCACATTGTTAAACA), a complete
DNA-A component sequence was obtained for a Laguna isolate (GenBank Accession No. KF446659)
and for a Quezon isolate (KF446660). The Laguna and Quezon isolate sequences were 2,764 and
2,756 nucleotides, respectively, and shared 90.6% nucleotide sequence identity. Both had six open
reading frames (ORFs)—two in the virus sense (V1 and V2) and four in the complementary sense (C1
to C4)—and the geminivirus conserved sequence (TAATATTAC). Based on BLASTn searching of
GenBank and sequence analysis using MEGALIGN (DNASTAR), both isolates should be considered as a
new begomovirus (tentatively named Blechum yellow vein virus, BlYVV) since their DNA-A sequences
share less than 89% nucleotide identity with any other begomovirus. Both DNA sequences had the
highest nucleotide identity (84.8 to 87.6%) with Papaya leaf curl Guangdong virus isolates (AJ558122,
AY650283, FJ495184, FJ869907, and JN703795). To our knowledge, this is the first report of a
previously unidentified begomovirus associated with yellow vein disease of this species.
References: (1) S. K. Green et al. Plant Dis. 85:1286, 2001. (2) W. S. Tsai et al. Plant Pathol. 60:787, 2011.
Supplemental Material
Browne's Blechum without virus symptoms
from Laguna Province, Philippines.
Browne's Blechum with yellow/chlorotic veins and shortened
internodes from Laguna Province, Philippines.