Isolation and characterization of a novel Micrococcus strain for bioremediation of strontium in radioactive residues

Abstract

There has been increased interest in the isolation of bacteria with a potential role in bioremediation from extreme environments such as phosphate mines containing various metals and radionuclides. This paper describes the isolation and characterization of a novel Micrococcus species from a phosphate mining region in the South of Tunisia, designated as strain BRM7. Colonies of bacterial strain BRM7 produced on Tryptone-Glucose-Yeast Extract (TGY) agar plates were yellow, smooth, circular and 0.5–1.5 mm in diameter. Cells of strain BRM7 were Gram-positive cocci, with a diameter of 0.7–1.0 μm. The most abundant cellular fatty acids of strain BRM7 were found to be anteiso-C15: 0 (49.42%) and iso-C15: 0 (32.63%). On the basis of its morphological attributes, biochemical characteristics, and partial sequencing of 16S rRNA gene (rDNA), the strain BRM7 belongs to the genus Micrococcus with 99% identity to Micrococcus luteus. Strain BRM7 grew well in tryptone, glucose and yeast extract (TGY) medium, and tolerated (1) high salt concentrations (up to 20%), (2) a wide range of pH (5.0–12.0), and (3) high temperatures (up to 45°C). The bacterial isolate Micrococus sp. BRM7 showed a high tolerance to strontium (Sr, D10 (dose for 90% reduction in Colony Forming Units (CFUs)) = 350 mM) with a similar tolerance curve to Cupriavidus metallidurans CH34, best known for its high tolerance to a wide range of heavy metals. Interestingly, Micrococus sp. BRM7 has an ionizing-radiation (IR) resistance D10 (800 Gy) four times higher than that of C. metallidurans. Immobilization into alginate beads indicated that Micrococus sp. BRM7 cells have the potential to adsorb 17 and 34% of Sr following an incubation time of 3 and 24 h, respectively. Overall, the results of this study suggest that BRM7 can be valorized to bioremediate Sr in radioactive residues like phosphogypsum (PG), an industrial concentrator of this toxic metal.

Full text

African Journal of Microbiology Research Vol. 6(4), pp. 851-858, 30 January, 2012
Available online at http://www.academicjournals.org/AJMR
DOI: 10.5897/ AJMR-11-1508
ISSN 1996-0808 ©2012 Academic Journals
Full Length Research Paper
Isolation and characterization of a novel Micrococcus
strain for bioremediation of strontium in
radioactive residues
Issam Ben Salem1,2#, Haïtham Sghaier1*, Houda Trifi1,3, Sana Héni1,2, Khaoula Khwaldia4,
Mouldi Saidi1 and Ahmed Landoulsi2
1Research Unit UR04CNSTN01 "Medical and Agricultural Applications of Nuclear Techniques", National Center for
Nuclear Sciences and Technology (CNSTN), Sidi Thabet Technopark, 2020 Sidi Thabet, Tunisia.
2Faculté des sciences de Bizerte, Zarzouna 7021, Tunisia.
3Laboratoire Microorganismes et Biomolécules Actives, Département de Biologie, Faculté des Sciences
de Tunis, Tunisia.
4Laboratoire des Substances Naturelles, Institut National de Recherche et d’Analyse Physico-chimique (INRAP), Sidi
Thabet Technopark, 2020 Sidi Thabet, Tunisia.
Accepted 30 December, 2011
There has been increased interest in the isolation of bacteria with a potential role in bioremediation
from extreme environments such as phosphate mines containing various metals and radionuclides.
This paper describes the isolation and characterization of a novel Micrococcus species from a
phosphate mining region in the South of Tunisia, designated as strain BRM7. Colonies of bacterial
strain BRM7 produced on Tryptone-Glucose-Yeast Extract (TGY) agar plates were yellow, smooth,
circular and 0.5–1.5 mm in diameter. Cells of strain BRM7 were Gram-positive cocci, with a diameter of
0.7–1.0 µm. The most abundant cellular fatty acids of strain BRM7 were found to be anteiso-C15: 0
(49.42%) and iso-C15: 0 (32.63%). On the basis of its morphological attributes, biochemical
characteristics, and partial sequencing of 16S rRNA gene (rDNA), the strain BRM7 belongs to the genus
Micrococcus with 99% identity to Micrococcus luteus. Strain BRM7 grew well in tryptone, glucose and
yeast extract (TGY) medium, and tolerated (1) high salt concentrations (up to 20%), (2) a wide range of
pH (5.0–12.0), and (3) high temperatures (up to 45°C). The bacterial isolate Micrococus sp. BRM7
showed a high tolerance to strontium (Sr, D10 (dose for 90% reduction in Colony Forming Units (CFUs))
= 350 mM) with a similar tolerance curve to Cupriavidus metallidurans CH34, best known for its high
tolerance to a wide range of heavy metals. Interestingly, Micrococus sp. BRM7 has an ionizing-radiation
(IR) resistance D10 (800 Gy) four times higher than that of C. metallidurans. Immobilization into alginate
beads indicated that Micrococus sp. BRM7 cells have the potential to adsorb 17 and 34% of Sr following
an incubation time of 3 and 24 h, respectively. Overall, the results of this study suggest that BRM7 can
be valorized to bioremediate Sr in radioactive residues like phosphogypsum (PG), an industrial
concentrator of this toxic metal.
Key words: Bioremediation, immobilization, ionizing radiation, Micrococcus, phosphate, strontium.
INTRODUCTION
The increasing pollution of toxic metals, metalloids,
radionuclides, and organometal(loid)s in the environment
has boosted a few decades research towards the better
understanding of the impact of toxic metals on
microorganisms, and vice versa, the biotechnological
potential of microorganisms for metal removal and/or
recovery from the biosphere (Beveridge et al., 1997).
Presently, there is a growing interest in microbiologically
mediated remediation because it promises to be simpler,
cheaper, and more environment-friendly than the more
commonly used non-biological options (Lovley, 2003).
Particularly, microorganisms able to survive well in high
concentrations of heavy metals and ionizing radiation are
of great interest as bioremediation agents for radioactive

852 Afr. J. Microbiol. Res.
residues (Barkay and Schaefer, 2001). Among the most
important natural sources of heavy metals and
radionuclides there are phosphate mines and their
industrial residues like PG resulting from processing
phosphate rocks. These rocks, and subsequently PG,
vary considerably in their content of heavy metals and
radionuclides depending on the geographical area from
which they were mined. In Tunisia, Sr is the most
abundant among trace elements in phosphate mines and
PG (1100 mg Kg−1) ((Sattouf et al., 2007; Ajam et al.,
2009) and references therein). In addition, the Gulf of
Gabès between Sfax, Gabès, and the Kerkennah Islands,
in Tunisia, is one of the most polluted places in all of the
Mediterranean Sea. This is a result of several factors
including the massive production (10 million tones per
year) and accumulation of PG piles. When it rains or
when the wind blows, PG gets spread around the general
vicinity of these warehouses. This can lead to many
health problems ((Ajam et al., 2009) and references
therein), unless toxic chemicals were cleaned up using
biological options (Barkay and Schaefer, 2001).
Some species of Micrococcus carry out biosorption of
Sr (Faison et al., 1990). Indeed, these species belong to
a group of bacterial strains that are particularly well
adapted to environments contaminated with elevated
levels of toxic metals, and that are potentially useful for
bioremediation applications ((Young et al., 2010) and
references therein). The genus Micrococcus now
includes five species: M. luteus, Micrococcus lylae,
Micrococcus antarcticus, Micrococcus endophyticus, and
Micrococcus flavus. M. luteus (NCTC2665, DSM 20030T,
"Fleming strain") is the type species of the genus
Micrococcus. With one of the smallest actinobacterial
genomes (2,501,097 bp) sequenced to date, M. luteus
possesses unusual abilities to remediate co-
contaminated sites with organic and metal pollutants
through a whole repertoire of functions which deal with
these pollutants (Sandrin and Maier, 2003; Young et al.,
2010). In addition, M. luteus can degrade hydrocarbons
and olefinic compounds (Zhuang et al., 2003), use
biphenyl as a carbon source, and metabolize
dibutylphthalate by a pathway which has at least five
regulatory units (Eaton and Ribbons, 1982).
The aim of this study was to isolate a novel M. luteus
species which is capable to bioremediate Sr from
radioactive residues. Following a primary screening
molecular studies were carried out to characterize and
identify a bacterial isolate designated Micrococcus sp.
BRM7. In comparison with reference strains, the
adsorption potential and tolerance to Sr of BRM7, and its
highest IR resistance D10 compared to C. metallidurans
*Corresponding author. E-mail: haitham.sghaier@cnstn.rnrt.tn.
Tel: (00216) 71537544. Fax: (00216) 71537555.
#First author contributed equally to this work.
indicated that it could be used as a novel biocatalyst for
co-contaminated residues including PG.
MATERIALS AND METHODS
Study area and sampling
Surface soil samples were collected from phosphate mine in
Metlaoui region in the Prefecture of Gafsa (Tunisia) (Figure 1).
Samples were collected from the soil surface (0-5 cm). Sampling
was carried out in sterile screw-capped glass bottles and
transported to the laboratory. Transport and storage of the samples
were done at a controlled temperature of 4°C.
Isolation and biochemical characterization of bacteria
Samples (0.5 g) were suspended in 10 ml of 0.9% NaCl (saline),
vortexed thoroughly, and allowed to settle. Appropriate dilutions
were plated on solidified TGY media (Bacto Tryptone 1%; Yeast
extract 0.5%; glucose 0.1%, and Bacto agar 1.5%) in triplicate and
incubated in the dark at 30°C for 5 days (Shukla et al., 2007;
Fredrickson et al., 2008). Yellow isolates obtained in this manner
were subsequently cultured in TGY broth (30°C, 100 rpm) to a mid-
log phase and preserved by freezing at –80°C in 40% glycerol
(Fredrickson et al., 2008). Gram-positive cocci were identified to
species using API-Staph (bioMérieux).
Determination of optimal growth temperature, osmotic
pressure and pH
The isolate was used to examine its temperature tolerance by
inoculating equal volume of overnight grown culture in TGY broth
and incubating at temperatures ranging from 30 to 60°C for 24 h.
Cell growth was determined by measuring absorbance at 600 nm.
The cultures obtained on TGY medium were further screened for
their salt tolerance. Media supplemented with various
concentrations of NaCl (ranging from 1 to 50%) were used for
inoculation. Incubation was carried at 30°C, 120 rpm for 24 h. The
growth was measured turbidimetrically at 600 nm (Shukla et al.,
2007). High salt-tolerant culture was further studied for pH
tolerance in TGY broth adjusted to pH 5.0–12.0. Incubation was
carried out at 30°C at 150 rpm for 24 h and cell growth determined
by measuring absorbance at 600 nm (Shukla et al., 2007).
PCR amplification of 16S rDNA and bioinformatics analyses
The genomic DNA was isolated using the DNeasy Blood and
Tissue Kit (Qiagen). The PCR assay was performed using Applied
Biosystems model 9700 with 1 μl of DNA extract in a total volume of
50 μl as recommended (Polz and Cavanaugh, 1998) to reduce bias
in amplification, and to obtain a final DNA concentration equal to
100 ng/µl. The PCR master mixture contained 5 μl of 10X PCR
reaction buffer, 4 μl of 25 mM MgCl2, 5 μl of 20 mM dNTPs, 5 μl of
10 μM of each oligonucleotide primers UP1-F/5′ (5′
AGAGTTTGATCCTGGCTCAG 3′), UP1-R/5′ (5′
GTTACCTTGTTACGACTT 3′), 0.24 μl of Taq DNA polymerase (5
U/µl) and 24.76 μl of molecular grade sterile distilled water. Initially,
denaturation accomplished at 95°C for 5 min. Thirty cycles of
amplification consisted of denaturation at 95°C for 30 s, annealing
at 56°C for 30 s and extension at 72°C for 1 min 30 s. A final
extension phase at 72°C for 15 min was performed. The PCR
product was purified by the EZ-10 Spin Column PCR Purification Kit.
The amplicons were detected by electrophoresing the sample on
1.0% agarose gel. The sequences were determined by cycle

Salem et al. 853
Figure 1. Location of the Metlaoui mine in Tunisia. The arrow shows the location of the
Metlaoui mine.
sequencing using the Taq Dye Deoxy Terminator Cycle
Sequencing Kit (Applied Biosystems), and underwent fragment
separation in an ABI Prism 3130 DNA sequencing as previously
described (Gtari et al., 2004). Alignments of 16S rDNA gene
sequences were performed with the CLUSTAL_X program, version
1.64b (Thompson et al., 1997). A neighbour-joining phylogenetic
tree was constructed based on evolutionary distances that were
calculated with the Kimura two-parameter model. Alignment
positions with insertions or deletions were excluded from the
calculations.
Analysis of fatty acids
Extraction and analysis of fatty acids (Miller, 1982) of BRM7 were
performed at the Deutsche Sammlung von Mikroorganismen und

854 Afr. J. Microbiol. Res.
Zellkulturen (DSMZ, Braunschweig, Germany) using the Sherlock
Microbial Identification System (MIDI, Inc.).
Resistance to ionizing radiation (IR)
Yellow colonies obtained after primary screening were grown in
TGY broth for 18 h. The cells were pelleted down, washed, and
resuspended in 0.9% NaCl, exposed at a dose rate 16.07 Gy/min
for doses below 2 kGy in a 60Co irradiator Gamma chamber
(CNSTN, Sidi Thabet, Tunisia). The survival was checked by
streaking the culture on TGY plates and incubating the plates at
30°C for 48–72 h.
Toxicity of strontium (Sr)
Three replicates of the inoculums from the isolated bacteria were
prepared by mixing 0.5 ml of a stationary bacterial culture with 49.5
ml of double concentrated Tris-salt mineral medium (MM284
medium) (Mergeay et al., 1985) supplemented with yeast extract. In
96-well plates, 100 μl of these inoculum suspensions was mixed
with 100 μl double concentrated medium containing Sr
concentrations ranging from 0 (control), 40, 80, 120, 160, 200, 240,
300 to 360 mM; so giving final concentrations of 0 (control), 20, 40,
60, 80, 100, 120, 150 to 180 mM in normal MM284 medium. The
test microplates were incubated at 30oC on an orbital shaker at 180
rpm. Bacterial growth was measured in terms of optical density at
630 nm after 48 h using the Bio-Tek® Gen5 Date Analysis
Softeware.
Cell immobilization and biosorption studies
BRM7 and CH34 cells were collected from cultures in liquid MM284
medium MM284 medium: supplemented with yeast extract, in mid-
exponential growth phase (~5 ×108 CFU/ml). 17.5 ml of cells were
diluted in 87.5 ml of sterile distilled water and incubated 10 min
under stirring. 3.063 g of sodium alginate (NaC6H7O6) were added
to the final volume (100 ml). The mixture was incubated under
stirring until it becomes viscous. Using a sterile syringe, the volume
was transferred and mixed to 100 ml of calcium chloride (CaCl2,
0.12 M). Once the cells were immobilized, the alginate beads were
conserved in 100 ml of CaCl2 (5 mM) (Wuyep et al., 2007).
Measurement of strontium (Sr) by inductively coupled plasma
atomic emission spectroscopy (ICP-AES)
Immobilized cells of BRM7 and CH34 were incubated in presence
or absence of 180 mM SrCl2 under agitation (120 rpm) during 24 h.
Volumes of supernatant were collected from each solution for
chemical analysis. These supernatant samples were filtered
through a 45 µm filter, conserved in a 0.01 M HCl solution, and
analyzed by ICP-AES, a standard analytical technique used for the
detection of trace metals.
Scanning electron microscopy (SEM) and energy dispersive X-
ray analysis (EDX)
Bacterial pellet of BRM7 was collected from cultures growing in the
presence of 60 mM Sr. Small droplets of the dried pellet at 50°C
were placed on aluminum stubs. These stubs were mounted on a
cold stage and imaged at 2.08°C in an environmental SEM (Philips
XL30, Institut National de Recherche et d’Analyses Physico-
chimiques, Technôpole Sidi-Thabet, Tunisia), which was equipped
with a field emission gun and EDX spectrometer. The instrument
was operated in the wet imaging mode (that is, 100% relative
humidity) at 20 kV.
RESULTS
Morphological and biochemical characterization of
BRM7
Following plating on TGY medium, an isolate, with a
yellow pigmentation on TGY agar plates, was obtained.
Good growth of BRM7 was observed on TGY plates
incubated for 72 h at 30°C. Cells of strain BRM7 were
Gram-positive spherical cocci, with a diameter range of
0.7–1.0 µm. Flagella were not observed. Colonies were
yellow, smooth, circular and 0.5–1.5 mm in diameter after
3 days cultivation on TGY agar. It was non-motile and
non-spore forming. Cells of strain BRM7 were positive for
catalase and alkaline phosphatase but negative for
urease. Acid was not produced from D-glucose, D-
fructose, D-mannose, maltose, lactose, D-trehalose, D-
mannitol, xylitol, D-melibiose, raffinose, xylose,
saccharose, a-methyl-D-glucoside, and N-acetyl-
glucosamine. Reduction of nitrates to nitrites by BRM7
was negative. Strain BRM7 was aerobic and grew over
the temperature range of 30–45°C, pH range of 5.0–12.0,
and tolerated high salt concentrations (up to 20%).
Optimal growth was observed at 30°C and pH 7.
16S rDNA and bioinformatics analyses
16S rRNA gene of strain BRM7 was amplified,
sequenced, and submitted to NCBI (1273 bp, accession
no. GU451721.1). The BLAST search of the nearly
complete 16S rRNA gene sequence of the isolate was
carried out. The isolate matched best with the genus
Micrococcus and showed 99% similarity to M. luteus. 16S
rDNA gene sequence analysis indicated that strain BRM7
was phylogenetically related to members of the genus
Micrococcus. The phylogenetic tree (Figure 2) also
indicated that strain BRM7 clustered with Micrococcus
species and this cluster was strongly supported (100%).
Micrococcus sp. BRM7 was publicly deposited under
DSMZ GmbH Number DSM 24578, under Japan
Collection of Microorganisms Number JCM 17588, and
under Belgian Coordinated Collections of Microorganisms
(BCCM/LMG) Number LMG 26301.
Resistance to ionizing radiation (IR)
Micrococcus sp. BRM7 has an IR resistance D10 (800
Gy) four times higher than that of C. metallidurans, but it
is extremely IR sensitive compared to D. radiodurans
(Figure 3).

Salem et al. 855
Figure 2. Phylogenetic tree constructed with the neighbour-joining method
according to 16S rDNA gene sequence evolutionary distance among Micrococcus
sp. BRM7 and the type strains of recognized members of the genus Micrococcus
and type species of the family Micrococcaceae. GenBank accession numbers and
microorganisms are from top to bottom: GU451721 - Micrococcus sp. strain
BRM7 ; AJ536198 - Micrococcus luteus DSM 20030T ; AJ005932 - Micrococcus
psychrophilum JCM 11467 T; X80750 - Micrococcus lylae DSM 20315T; M23411 -
Arthrobacter globiformis DSM 20124T; X51601 - Renibacterium salmoninarum
ATCC 33209T; M59055 - Rothia dentocariosa ATCC 17931T; X87756 - Kocuria
rosea DSM 20447T; X87755 - Kytococcus sedentarius DSM 20547 T. Kytococcus
sedentarius DSM 20547T was used as an outgroup. Subtree of Micrococcus
species is indicated in bold. Numbers represent confidence levels from 100
replicates bootstrap samplings. Bar, evolutionary distance (Knuc) of 0.01.
Figure 3. Resistance of Micrococcus sp. BRM7 and reference strains to acute
gamma-radiation exposure. Strain BRM7 is represented by open squares.
Deinococcus radiodurans R1 (open lozenges) and Cupriavidus metallidurans
CH34 (open triangles) were used as reference strains. Values are means of
three independent experiments.
Tolerance to strontium (Sr) and its adsorption by
Micrococcus sp. BRM7
Sr D10 of BRM7 was approximately 350 mM (Figure 4).
During immobilization experiments, BRM7 cells have the
potential to adsorb Sr and reached 17 and 34% of fixed
Sr after 3 and 24 h, respectively. The most intense peak
identified with EDX corresponds to Sr, with no other

856 Afr. J. Microbiol. Res.
Figure 4. Tolerance of Micrococcus sp. BRM7 and Cupriavidus metallidurans CH34 to strontium.
Strain BRM7 is represented by a dark line. The reference strain C. metallidurans CH34 is represented
by an interrupted line. Values are means of three independent experiments.
Figure 5. Elemental analysis of the dried pellet of Micrococcus sp. BRM7 obtained from a culture with strontium (60
mM SrCl2). EDX analysis showed a semi-quantitative spectrum of the composition of BRM7 membrane (See the
section Results).
elements detected at similar levels of abundance (Figure
5).
DISCUSSION
The genus Micrococcus seems to be well suited for long-
term survival in extreme environment which may give
them an important role in bioremediation (Greenblatt et
al., 2004). especially, M. luteus is potentially useful
forbioremediation of Sr (Faison et al., 1990), particularly
in Tunisian phosphate and PG mines where it represents
the component the most abundant among trace elements
((Ajam et al., 2009) and references therein). Samples of
soil from a phosphate mine in the South of Tunisia were
used to isolate and characterize Micrococcus species
with a bioremediation potential. As suggested from the
restricted distribution of genes concerned with pigment
production (Young et al., 2010), our primary screening
was based on yellow pigmentation for the identification of
Concentration of SrCl2 (mM)

Salem et al. 857
Table 1. Residual strontium in the medium after contact with immobilized Micrococcus sp. BRM7 and
reference strain Cupriavidus metallidurans CH34.
Hours (h)
Residual Sr concentration (%) in the medium
A
B
C
0
100
100
100
3
95.34
83.78
69.84
24
96.03
66.41
52.12
A: Beads of alginate + 180 mM of SrCl2 (without cells), B: Beads of alginate containing BRM7 cells + 180 mM of
SrCl2, C: Beads of alginate containing CH34 cells + 180 mM of SrCl2.
M. luteus. Besides its yellow pigmentation, the most
abundant cellular fatty acids of strain BRM7 were
anteiso-C15 : 0 (49.42%) and iso-C15 : 0 (32.63%),
which were also found to be the dominant cellular fatty
acids of other members of the genus Micrococcus
(Wieser et al., 2002).
The taxonomy of strain BRM7 was also confirmed on
the basis of comparative analysis of the 16S rDNA
sequences. Using BLAST search, BRM7 showed 99%
similarity to M. luteus. Phylogenetic results indicated in
Figure 2 are supported by the currently accepted
phylogenetic tree of the actinobacteria. Indeed,
Micrococcus clusters with Arthrobacter and
Renibacterium (Stackebrandt et al., 1995). Some other
coccoid actinobacteria originally are also called
Micrococcus, but reclassified into four new genera
(Kocuria, Nesterenkonia, Kytococcus, and
Dermacoccus), which are more distant relatives
(Stackebrandt et al., 1995). In Figure 2, Kytococcus was
chosen as an out group organism.
C. metallidurans CH34 (Janssen et al., 2010) and
Deinococcus radiodurans R1 (Cox and Battista, 2005)
were used as reference strains for bioremediation of non
radioactive and radioactive residues. Initially, the
bioremediation potential of Micrococcus sp. BRM7 was
evaluated, compared to C. metallidurans, based on its
resistance to IR, because this resistance reflects an
enhanced capacity for scavenging reactive molecular
species, protecting proteins, repairing DNA, and
tolerating desiccation ((Daly, 2010) and references
therein). Our results indicating that the D10 of BRM7 was
between those of reference strains D. radiodurans (15
kGy) (Cox and Battista, 2005) and C. metallidurans
(Janssen et al., 2010)  (800 Gy) four times higher
than that of C. metallidurans (Figure 3)  suggest that
BRM7, compared to C. metallidurans, is a good
candidate as a biocatalyst for co-contaminated residues,
particularly radioactive ones. Yet, the mechanisms of IR
resistance ((Confalonieri and Sommer, 2011) and
references therein) in Micrococcus sp. BRM7 need
further investigation. For instance, the question of
whether orthologs belonging to BRM7 of the five
transcripts of D. radiodurans (ddrA, DR_0423; ddrB,
DR_0070; ddrC, DR_0003; ddrD, DR_0326; pprA,
DR_A0346) that are most highly induced following IR and
recovery from desiccation are present and also up-
regulated in Micrococcus sp. BRM7 remains to be
answered ((Sghaier et al., 2008) and references therein).
Interestingly, like C. metallidurans, Micrococcus sp.
BRM7 cells have a similar potential to tolerate Sr (D10 ≈
350 mM) (Figure 4). To study the Sr adsorption efficiency
of Micrococcus sp. BRM7, cells were immobilized in
beads of alginate and grown in contact with high
concentration of SrCl2. Only 4% of Sr was fixed by the
alginate indicating that this matrix is inert and no
significant interference occurred between the alginate
and Sr during the incubation. Immobilization experiments
indicated that Micrococus sp. BRM7 cells have the
potential to adsorb 34% of Sr following an incubation time
of 24 h. IR sensitive C. metallidurans (D10 ≈ 200 Gy)
showed an accumulation of Sr that reached about 50%
after 24 h (Table 1). SEM with EDX spectrometry of
the bacterial membrane surface of Micrococcus sp.
BRM7 showed that the membrane contains a significant
fraction of Sr indicating that this metal is adsorbed on the
surface membrane. Also, EDX results indicate that the
bacterial membrane (mainly carbone (C), oxygen (O),
and phosphorous (P) peaks) of Micrococcus sp. BRM7
has the potential to adsorb Sr (Figure 5). Also, these
results suggest that Micrococcus sp. BRM7 might be
using the process of passive adsorption, a fast process
limited by the saturation of binding sites on the
membrane.
Conclusion
The results made in the present study suggest that the
newly isolated bacterium Micrococcus sp. BRM7 is more
suitable than C. metallidurans for the bioremediation of
radioactive residues like PG. The choice of Micrococcus
sp. BRM7 as a biocatalyst for co-contaminated residues
is supported by previous papers indicating that M. luteus
cells possess a biosorption capacity for U and Th equal
to 38.8 and 77.0 mg/g, respectively (Nakajima and
Tsuruta, 2004; Wang and Chen, 2009). Indeed, since Sr
is an end product of U decay, it could be also a major
component of atomic energy waste management. This
idea is realistic since M. luteus species were also isolated
from irradiated waste samples (Fredrickson et al., 2004),
and they were shown to have numerous adaptations for

858 Afr. J. Microbiol. Res.
survival in extreme nutrient-poor environments
(Greenblatt et al., 2004). In the future, the bioremediation
potential of Micrococcus sp. BRM7 has to be further
investigated to evaluate its utility in the field.
ACKNOWLEDGEMENTS
This work was supported by the National Center for
Nuclear Sciences and Technology (CNSTN), Department
of Research on Environment and Life, Tunisia. The
support of Mrs. Monia Salhi for sampling and the help of
Mr. Nasreddine Bettaieb and Mr. Zied Trabelsi for the use
of the 60Co Gamma Irradiator Facility are acknowledged.
C. metallidurans CH34 is a gift from Dr. ir. Natalie Leys at
the Belgian Nuclear Research Centre (SCK•CEN). D.
radiodurans R1 was generously given by Dr. Marina
Kalyuzhnaya, Department of Microbiology, University of
Washington (U.S.A). Finally, the authors acknowledge
the assistance of DSMZ staff for fatty acids extraction
and analyses.
REFERENCES
Ajam L, Ben Ouezdou M, Sfar Felfoul H, El Mensi R (2009).
Characterization of the Tunisian phosphogypsum and its valorization
in clay bricks. Const. Build. Mat., 23: 3240-3247.
Barkay T, Schaefer J (2001). Metal and radionuclide bioremediation:
issues, considerations and potentials. Curr. Opin. Microbiol., 4: 318-
323.
Beveridge TJ, Hughes MN, Lee H, Leung KT, Poole RK, Savvaidis I,
(1997). Metal-microbe interactions: contemporary approaches. Adv.
Microb. Physiol., 38: 177-243.
Confalonieri F, Sommer S (2011). Bacterial and archaeal resistance to
ionizing radiation. J. Phys. Conf. Ser., 261:012005.
Cox MM, Battista JR (2005). Deinococcus radiodurans - the
consummate survivor. Nat. Rev. Microbiol., 3: 882-892.
Daly MJ (2010). Deinococcus radiodurans: Revising the Molecular
Basis for Radiation Effects on Cells. In: Extremophiles Handbook,
Horikoshi K (eds) Springer Japan KK, pp. 1-16.
Eaton RW, Ribbons DW (1982). Metabolism of dibutylphthalate and
phthalate by Micrococcus sp. strain 12B. J. Bacteriol., 151: 48-57.
Faison BD, Cancel CA, Lewis SN, Adler HI (1990). Binding of Dissolved
Strontium by Micrococcus luteus. Appl. Environ. Microbiol., 56: 3649-
3656.
Fredrickson JK, Zachara JM, Balkwill DL, Kennedy D, Li SM,
Kostandarithes HM (2004). Geomicrobiology of high-level nuclear
waste-contaminated vadose sediments at the hanford site,
washington state. Appl. Environ. Microbiol., 70: 4230-4241.
Fredrickson JK, Li SM, Gaidamakova EK, Matrosova VY, Zhai M,
Sulloway HM (2008). Protein oxidation: key to bacterial desiccation
resistance? ISME J., 2: 393-403.
Greenblatt CL, Baum J, Klein BY, Nachshon S, Koltunov V, Cano RJ
(2004). Micrococcus luteus -- survival in amber. Microb. Ecol., 48:
120-127.
Gtari M, Brusetti L, Skander G, Mora D, Boudabous A, Daffonchio D
(2004). Isolation of Elaeagnus-compatible Frankia from soils
collected in Tunisia. FEMS Microbiol. Lett., 234: 349-355.
Janssen PJ, Van Houdt R, Moors H, Monsieurs P, Morin N, Michaux A,
(2010). The complete genome sequence of Cupriavidus
metallidurans strain CH34, a master survivalist in harsh and
anthropogenic environments. PLoS One 5:e10433.
Lovley DR (2003). Cleaning up with genomics: applying molecular
biology to bioremediation. Nat. Rev. Microbiol., 1: 35-44.
Mergeay M, Nies D, Schlegel HG, Gerits J, Charles P, Van Gijsegem F
(1985). Alcaligenes eutrophus CH34 is a facultative chemolithotroph
with plasmid-bound resistance to heavy metals. J. Bacteriol., 162:
328-334.
Miller LT (1982). Single derivatization method for routine analysis of
bacterial whole-cell fatty acid methyl esters, including hydroxy acids.
J. Clin. Microbiol., 16: 584-586.
Nakajima A, Tsuruta T (2004). Competitive biosorption of thorium and
uranium by Micrococcus luteus. J. Radioanal. Nucl. Chem., 260: 13-
18.
Polz MF, Cavanaugh CM (1998). Bias in template-to-product ratios in
multitemplate PCR. Appl. Environ. Microbiol., 64: 3724-3730.
Sandrin TR, Maier RM (2003). Impact of metals on the biodegradation
of organic pollutants. Environ. Health Perspect, 111: 1093-1101.
Sattouf M, Kratz S, Diemer K, Rienitz O, Fleckenstein J, Schiel D,
Schnug E (2007). Identifying the origin of rock phosphates and
phosphorus fertilizers through high-precision measurement of the
strontium isotopes 87Sr and 86Sr. Landbauforschung Völkenrode, 57:
01-11.
Sghaier H, Ghedira K, Benkahla A, Barkallah I (2008). Basal DNA repair
machinery is subject to positive selection in ionizing-radiation-
resistant bacteria. BMC Genomics, 9: 297.
Shukla M, Chaturvedi R, Tamhane D, Vyas P, Archana G, Apte S
(2007). Multiple-stress tolerance of ionizing radiation-resistant
bacterial isolates obtained from various habitats: correlation between
stresses. Curr. Microbiol., 54: 142-148.
Stackebrandt E, Koch C, Gvozdiak O, Schumann P (1995). Taxonomic
dissection of the genus Micrococcus: Kocuria gen. nov.,
Nesterenkonia gen. nov., Kytococcus gen. nov., Dermacoccus gen.
nov., and Micrococcus Cohn 1872 gen. emend. Int. J. Syst.
Bacteriol., 45: 682-692.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG
(1997). The CLUSTAL_X windows interface: flexible strategies for
multiple sequence alignment aided by quality analysis tools. Nucleic
Acids Res., 25:4876-4882.
Wang J, Chen C (2009). Biosorbents for heavy metals removal and
their future. Biotechnol. Adv., 27: 195-226.
Wieser M, Denner EB, Kampfer P, Schumann P, Tindall B, Steiner U
(2002). Emended descriptions of the genus Micrococcus,
Micrococcus luteus (Cohn 1872) and Micrococcus lylae (Kloos et al.
1974). Int. J. Syst. Evol. Microbiol., 52: 629-637.
Wuyep PA, Chuma AG, Awodi S, Nok AJ (2007). Biosorption of Cr, Mn,
Fe, Ni, Cu and Pb metals from petroleum refinery effluent by calcium
alginate immobilized mycelia of Polyporus squamosus. Scienti. Res.
Essay, 2: 217-221.
Young M, Artsatbanov V, Beller HR, Chandra G, Chater KF, Dover LG,
(2010). Genome sequence of the Fleming strain of Micrococcus
luteus, a simple free-living actinobacterium. J. Bacteriol., 192: 841-
860.
Zhuang WQ, Tay JH, Maszenan AM, Krumholz LR, Tay ST (2003).
Importance of Gram-positive naphthalene-degrading bacteria in oil-
contaminated tropical marine sediments. Lett. Appl. Microbiol., 36:
251-257.