ArticlePDF Available

Abstract and Figures

Saffron, the desiccated stigmas of Crocus sativus, is recognized for its attractive color, flavor, and aroma which are due to the accumulation of crocin, picrocrocin, and safranal, respectively. HPLC analysis demonstrated maximum apocarotenoid accumulation during the fully developed scarlet stage of stigma development followed by the orange and yellow stages of stigma development. Reverse Transcription-PCR analysis revealed a concurrent expression pattern of CsZCD and CsLYC genes in a developmental stagespecific manner. However, CsBCH and CsGT2 genes were specifically expressed during the mature, scarlet stage of stigma development. Real-Time PCR analysis showed a sharp increase in gene expression of CsLYC gene during stigma development indicative of its possible regulatory role in apocarotenoid biosynthesis or stigma development. Results suggest that genetic manipulation of this gene can help to improve the quality of stigma in saffron; besides highlighting its potential to monitor stigma development during in vitro experimentation.
Content may be subject to copyright.
183
The Korean Society of Crop Science
J. Crop Sci. Biotech. 2013 (Sep) 16 (3) : 183~188
RESEARCH ARTICLE
DOI No. 10.1007/s12892-013-0071-0
Relative Expression of Apocarotenoid Biosynthetic Genes in
Developing Stigmas of Crocus sativus L.
Javid IqbaLMzr1,Nazeer Ahmed2, Tassem Ahmad Mokhdomi2,Asrar Hussain Wafai1,Sajad Hassan Wani1,Shoiab Bukhari1,
Asif Amin1,Raies Ahmad Qadri1,*
1University of Kashmir, Srinagar, J & K, India, 190006
2Central Institute of Temperate Horticulture, Srinagar, J & K, India, 190007
Received: June 10, 2013 / Revised: August 29, 2013 / Accepted: September 06, 2013
Korean Society of Crop Science and Springer 2013
Abstract
Saffron, the desiccated stigmas of Crocus sativus,is recognized for its attractive color, flavor, and aroma which are due to the
accumulation of crocin, picrocrocin, and safranal, respectively. HPLC analysis demonstrated maximum apocarotenoid accumulation
during the fully developed scarlet stage of stigma development followed by the orange and yellow stages of stigma development.
Reverse Transcription-PCR analysis revealed a concurrent expression pattern of CsZCD and CsLYC genes in a developmental stage-
specific manner. However, CsBCH and CsGT2 genes were specifically expressed during the mature, scarlet stage of stigma develop-
ment. Real-Time PCR analysis showed a sharp increase in gene expression of CsLYC gene during stigma development indicative of
its possible regulatory role in apocarotenoid biosynthesis or stigma development. Results suggest that genetic manipulation of this
gene can help to improve the quality of stigma in saffron; besides highlighting its potential to monitor stigma development during in
vitro experimentation.
Key words: Crocus sativus,CsBCH,CsGT-2,CsLYC,CsZCD,stigma development
Crocus sativus stigma is the world’s most expensive spice
rich in carotenoid compounds (Bouvier et al. 2003; Moraga
et al. 2004; Rubio et al. 2009). Three important constituents
of saffron stigma are crocin, safranal, and picrocrocin
responsible for its color, aroma, and taste, respectively.
Biosynthesis of apocarenoids occurs in saffron stigmas and
involves two different pathways: (1) Mevalonic acid (MVA)
pathway that occurs in the cytoplasm (Castillo et al. 2005;
Wang et al. 2009) and (2) Non-mevalonic acid (MEP) path-
way (2-Cmethyl- D-erythritol 4-phosphate pathway) takes
place in plastids that provide the precursors for carotenoids
(Arigoni et al. 1997). The MVA pathway starts with the syn-
thesis of mevalonate through three molecules of acetyl CoA
and then continues with the production of isopentenyl
diphosphate (IPP) molecules, geranyl geranyl pyrophosphate
(GGPP), colorless phytoene, colored lycopene,
ß
-catrotene,
(Britton et al. 1998), and zeaxanthin (Bouvier et al. 2003).
Beta-carotene with two rings is built up via cyclization of
lycopene with lycopene-
ß
‚ cyclase (LYC)(Britton et al.
1998). The hydroxylation of
ß
-carotene in the MVA pathway
is catalyzed by
ß
-carotenoid hydroxylase that is coded by the
BCH gene to yield zeaxanthin (Castillo et al. 2005). The bio-
genesis of the color- and odor-active compounds of saffron
are derived by bio-oxidative cleavage of zeaxanthin (Pfander
and Schurtenberger 1982) at the points 7, 8 (7’, 8’) by zeax-
anthin cleavage dioxygenase (CsZCD)to produce crocetin
dialdehyde and picrocrocin. In C. sativus stigmas, the final
step involves glucosylation of the generated zeaxanthin
cleavage products by glucosyltransferase 2 enzyme which is
coded by the CsUGT2 gene in the chromoplast of stigmas
(Teale et al. 1992) and then sequestered into the central vac-
uole of the fully developed stigmas (Bouvier et al. 2003;
Dufresne et al. 1997). The quantitative and qualitative
changes in the carotenoid and the apocarotenoid profile in C.
sativus stigmas have been previously studied (Ahrazem et al.
2010; Castillo et al. 2005; Mir et al. 2012; Rubio et al. 2009)
and it has been shown that transcriptional regulation of a
ß
-
hydroxylase, CsZCD,and lycopene cyclase genes are
Introduction
Raies Ahmad Qadri ( )
E-mail: raies@kashmiruniversity.ac.in
Tel: 0194-2428723 / Fax: 0194-2428723
Gene Expression of Apocarotenoids during Saffron Stigma Development
184
involved in the observed changes. In this study, the relative
quantification of apocarotenoids and their genes at three dif-
ferent stages of stigma development in C. sativus is described
inorder to study the involvement of these genes in the transi-
tion of immature to mature stage of stigma development in C.
sativus and, therefore, in apocarotenoid accumulation. Eight
stages of development have been defined for C. sativus stig-
mas based on the length of the tissue, pigmentation, and
apocarotenoid content (Himeno and Sano 1987). Since sharp
shifts in some key apocarotenoid biosynthesis gene expres-
sion have been found during stages II, IV, and VIII of stigma
development (Mir et al. 2012), these three stages of stigma
development were taken in the present study: stage II corre-
sponds to a yellow, undeveloped stigma, stage VIII repre-
sents a scarlet, fully developed stigma, and stage IV repre-
sents an orange, undeveloped stigma. The apocarotenoid
accumulation and expression patterns of apocarotenoid
biosynthesis genes were studied during these three stages of
stigma development.
Material and Methods
Research material
Three stages of stigma development (scarlet, orange, and
yellow) were collected from September to November 2012
(Fig. 1). Freshly cut stigmas were quickly immersed in liquid
nitrogen and then stored at -80°Cfor RNA isolation. However,
dried stigmas were used for apocarotenoid extraction.
Apocarotenoid extraction and HPLC analysis
For the analysis of apocarotenoids, saffron stigma
carotenoids were extracted in a microcentrifuge tube by
grinding 1 g dried stigma with a micropestle in methanol
(100 mL) and incubated for 5 min on ice. Tris-HCl (50 mM,
pH 7.5; containing 1 M NaCl) was then added (100 mL) and
aincubated for 10 min on ice. The precipitate was collected
by centrifugation at 3,000 g for 5 min at 4°C. The pellet was
then reground in acetone (400 mL) and incubated on ice for
10 min. The mixture was centrifuged at 3,000 g for 5 min at
4°C. This step was repeated until no color was detected in the
pellets. The supernatant was dried and the solid extract was
dissolved in HPLC grade methanol. The analysis was carried
out in a Shimadzu HPLC (Kyoto, Japan) equipped with qua-
ternary pumps, degasser coupled to a photo-diode-array
detector, and injection valve with a 20 µL loop. Separation
was carried out with an injection volume of 20 µL, a flow
rate of 1 mL min-1 with 35-40 min of run time. The analyses
were triplicated for each sample. Safranal was detected at
310 nm and crocin at 440 nm, whereas the internal standards
for respective apocarotenoids (crocin and safranal) as posi-
tive controls and quantitative estimation were detected at the
above-mentioned wavelengths (Lozano et al. 1999).
Chromatographic separations were performed on C18 (250
×4.6 mm), 5 µm column using a solvent system consisting
of 75% acetonitrile and 25% methanol in an isocratic mode.
The mobile phase was filtered through a 0.45 µm membrane
filter (Millipore, Bedford, MA, USA) before analysis. Class
WP software (version 6.1) from Shimadzu was used for
instrument control, data acquisition, and data processing.
Quantitative determinations were made by taking into
account the respective peak areas of standards at particular
retention time versus concentration and expressed in mil-
ligrams per gram of saffron stigmas.
Reverse transcription PCR analysis
Frozen stigmas were ground in a cold and sterilized mor-
tar and pestle into fine powder and total RNA was extracted
using RNA isolation kit (Roche Applied Science) following
the manufacturer’s protocol. Quality of the extracted RNAs
was checked by measuring the absorbance at 260 and 280 nm
by a Nano-Drop and RNAs with ratio of OD 260/280 ranging
from 1.2 to 1.5 were used for cDNA synthesis. For each sam-
ple, 5 µg of total RNA as template and 18 bp oligo dT primer
and first strand cDNA synthesis kit (Roche Applied Science)
were used for first-strand cDNA synthesis as described by
the manufacturer. The synthesized cDNA was stored at -
20°Cfor the gene expression study. Reverse transcription
was carried for amplification of CsZCD,CsLYC,CsBCH,
CsGT2,and CsTUB gene as internal control, using AMVRT
cDNA kit (Roche Applied Science, Penzberg, Germany)
according to the user’s manual. Forward- and reverse-primer
sequences were used for amplification of these genes and the
expected length of amplicons are shown in Table 1. PCR
reactions were performed in thermocycler (Takara, Japan)
with 2-5 µgof cDNA. Initial denaturizing at 95°Cfor 5 min
Fig. 1. Different stages of stigma development in
Crocus sativus
L.
CsZCD
CsLYC
CsBCH
CsGT2
CsTUB
Table 1. Primer sequences for amplification of apocarotenoid biosynthesis
genes in saffron with expected amplicons lengths
Primer
GTCTTCCCCGACATCCAGATC
AGATGGTCTTCATGGATTGGAG
TCGAGCT TCGGCATCACATC
GATCTGCCGTGCGTTCGTAAC
TGATTTCCAACTCGACCAGTGTC
Forward Primer
(5'to 3')
CTCTATCGGGCTCACGTTGG
ATCACACACCTCTCATCCTCTTC
GCAATACCAAACAGCGTGATC
GATGACAGAGTTCGGGGCCTTG
ATACTCATCACCCTCGTCACCATC
Reverse Primer
(5' to 3')
241
247
495
400
225
Amplicon
size (bp)
JCSB 2013 (Sep)16 (3) : 183~188
185
followed by 35 cycles of amplification according to the sub-
sequent scheme: denaturizing 1 min at 94°C, annealing at
56.2°C for 30 s, and extension at 72°C for 40 s and final
extension at 72°C for 7 min. The experiments were repeated
twice. Subsequently, 5 µLof the PCR products were used on
1.2% (w/v) agarose (Sigma-Aldrich, St Louis, MO, USA).
Real-Time PCR analysis
The Real-Time PCR was performed in 96-well plates with
aLightCycler 480 real-time PCR instrument (Roche
Diagnostics) using the LightCycler 480 SYBR Green I
Master kit. Reactions were performed in triplicate and con-
tained 5 µL SYBR Green I Master, 2 µL PCR-grade water, 2
µLcDNA, and 0.5 µLof each of the 10 µm forward- and
reverse gene-specific primers in a final volume of 10 µL.
Tubulin gene was taken as reference gene. Gene expression
at the scarlet stage of stigma development was taken as posi-
tive control. The reactions were incubated at 95°C for 5 min,
followed by 40 cycles of 95°C for 15 s, 56.2°C for 15 s, and
72°Cfor 20 s. The specificity of the PCR reaction was con-
firmed with a heat dissociation protocol (from 60°C to 95°C)
following the final PCR cycle. This ensured the resulting flu-
orescence originated from a single PCR product, and did not
represent primer dimers formed during PCR or a non-specific
product. Primers for real-time PCR assay were evaluated by
performing real-time PCR on serially diluted cDNA to make
sure that concentrations of the primers used in the assay gen-
erate CT values consistent with the dilution. LightCycler 480
software (version 1.5, Roche Diagnostics) was used to collect
the fluorescence data. Advanced relative quantification
between the genotypes and three stages of stigma develop-
ment was done through 2-ΔΔcp method (Livak and Schmittgen
2001).
Results
Relative quantification of apocarotenoids
Crocin and safranal contents were estimated during the
yellow, orange, and scarlet stages of stigma development in
saffron. Both components were identified as previously
described in the literature (Caballero-Ortega et al. 2007; Li et
al. 1999; Lozano et al. 1999; Tarantilis et al. 1995). Fig. 2
shows the representative HPLC chromatograms and concen-
tration of each detected compound in three stages of stigma
development. Crocin content was found to increase from 2 ±
0.4 mg g-1 in the yellow stage to 10 ± 0.2 mg g-1 in the orange
stage of stigma development. It further increased to 40 ± 1.15
mg g-1 of dry stigma during the scarlet stage of stigma devel-
opment. Safranal biosynthesis also showed a drastic increase
from the yellow to the scarlet stage of stigma development.
Safranal increases from 0.03 ± 0.002 to 0.08 ± 0.001 mg g-1
of dry stigma from the yellow to orange stage and further
increases to 0.28 ± 0.003 mg g-1 of dry stigma in the scarlet
stage of stigma development.
Expression of apocarotenoid biosynthesis genes
Expression of key genes responsible for biosynthesis of
apocarotenoids in C. sativus was investigated during differ-
ent stages of stigma development in saffron through semi-
quantitative (Reverse Transcription PCR) or quantitative
(Real-Time PCR) analysis.
Semi-quantitative gene expression analysis
The scarlet stage of stigma development showed the high-
est expression of CsLYC,CsBCH,CsZCD,and CsGT-2
genes. CsLYC and CsZCD genes were also expressed in the
orange and yellow stages of stigma development (Fig. 3);
Fig. 2. Relative apocarotenoid quantification through HPLC during different stages of stigma development. HPLC chromatogram (A) for crocin and safranal during scarlet,
orange, and yellow stages of stigma development (X and Y axis showing mAU and retention time, respectively) and relative quantification (B) of crocin and safranal during scar-
let, orange, and yellow stages of stigma development
however, CsBCH and CsGT-2 gene expression was not found
during the orange and yellow stages of stigma development.
Quantitative changes in apocarotenoid biosynthetic
genes
In the present study, the relative expression of the CsLYC
gene was studied through real-time PCR analysis. Real-Time
PCR amplification of CsLYC and tubulin genes at the yellow,
orange, and scarlet stages of stigma development is shown in
Figs. 4a and 4b, respectively. Real-Time PCR analysis
revealed that CsLYC gene expression gets up-regulated by
82% from yellow to orange and by 8% from orange to scarlet
stages of stigma development (Fig. 5).
Discussion
Relative quantification of apocarotenoids
Carotenoid accumulation and composition during stigma
development of C. sativus is highly regulated by the coordi-
nated transcriptional activation of carotenoid biosynthetic
genes (Castillo et al. 2005). During the development of saf-
fron, the stigma changes in color from white to scarlet, pass-
ing through yellow and orange stages, parallel stigma growth
and apocarotenoid accumulation. Apocarotenoids increased
7% from the yellow to the orange stage and up to 88% in the
scarlet stage (Himeno and Sano 1987). The accumulation of
carotenoids during this process reaches their maximum levels
at the time of anthesis. Beta-carotene and zeaxanthin
increased by 60.5 and 85%, respectively, from the orange to
the scarlet stage (Castillo et al. 2005). Total content of crocin
and safranal depends upon storage of stigma and extraction
method of apocarotenoids (Caballero- Ortega et al. 2007),
hence the amount of these compounds reported by different
workers varies. Alonso et al. 2001 reported that crocins vary
from 0.85to 32.4% dry weight at the scarlet stage of stigma
development. Other values reported vary between 29 (Li et
al. 1999) and 45.99% dry weight (Caballero-Ortega et al.
2007) for Iranian saffron and 67.3% dry weight (Sujata et al.
1992) for Indian saffron. Safranal levels reported in some
studies are around 8% dry weight (Sujata et al. 1992) at
maturity. Safranal vary between a 6t and 29% dry weight
(Hadizadeh et al. 2007). Lage et al. 2009 reported that crocin
and safranal content vary between 17-37 and 0.1-0.48%,
respectively, under Moroccan conditions at the scarlet stage
of stigma development.
Expression of apocarotenoid biosynthesis genes
Expression of apocarotenoid biosynthesis genes viz.
CsBCH,CsZCD,CsLYC,and CsGT-2 was studied through
relative semi-quantitative during three stages of stigma
development. These stages were comparable with those
Gene Expression of Apocarotenoids during Saffron Stigma Development
186
Fig. 5. Change in gene expression of
CsLYC
gene during different stages of stigma
development in saffron.
Cs: Crocus sativus; LYC
:lycopene-ß cyclase
Fig. 4. Amplification curves of
CsLYC
(a) and Tubulin (b) genes at scarlet, orange,
and yellow stages of stigma development.
Cs: Crocus sativus
;
LYC
:lycopene-ß
cyclase
Fig. 3. Semi-quantitative relative expression of apocarotenoid biosynthesis genes
(
ZCD, LYC, GT2
, and
BCH
)and tubulin (Tub) gene at scarlet (S), orange (O), and yel-
low (Y) stages of stigma development in saffron.
ZCD
:Zeaxanthin Cleavage
Dioxygenase;
LYC
:lycopene-ß‚ cyclase;
GT2
:Glycosyl transferase 2;
BCH
carotene
hydroxylase
JCSB 2013 (Sep)16 (3) : 183~188
187
obtained from in vivo studies by Himeno and Sano (1987).
The three developmental stages were chosen based on length,
pigmentation, and apocarotenoid content. Although reverse
transcription PCR analysis is the semi-quantitative method of
gene expression, it is a very good method to determine a
comparative level of gene expression and is a highly sensi-
tive and specific method useful for the detection of rare tran-
scripts or for the analysis of samples available in limiting
amounts. RT-PCR is increasingly used to detect small
changes in gene expression that would otherwise be unde-
tectable (Freeman et al. 1999). In comparison to our findings,
Castillo et al. 2005 found maximum expression of CsLYC,
CsBCH, and CsGT-2 at the scarlet stage of stigma develop-
ment, but they did not observe any CsLYC and CsZCD
expression in the orange and yellow stages of stigma devel-
opment which may be due to different clonal selection or dif-
ferent dates of sample collection. Ahrazem et al. 2010 stud-
ied the expression pattern of two lycopene-
ß
-cyclase genes,
CstLcyB1 and CstLcyB2a,and found that CstLcyB2a encodes
chromoplast-specific lycopene cyclases, with an expression
analysis showing strongly in flower stigmas where it acti-
vates and boosts
ß
-carotene accumulation while CstLcyB1
transcripts were observed in leaves, tepals, and stigmas at
lower levels. It is documented that in C. sativus the develop-
ment of the stigmas occurs concomitantly with transition of
amyloplasts to chromoplasts and parallel with biosynthesis
and accumulation of apocarotenoid which relates to expres-
sion levels of these apocarotenoid biosynthetic genes
(Bouvier et al. 2003; Moraga et al. 2004).
Quantitative changes in CsZCD and CsLYC genes
Quantitative RT-PCR has become a powerful tool for
analysis of gene expression because of its high throughput,
sensitivity, and accuracy (Bustin 2000). Since semi-quantita-
tive expression results reveal that CsBCH and CsGT2 were
not expressed during the orange and yellow stage of stigma
development, hence relative quantification through quantita-
tive real-time PCR was done only for CsZCD and CsLYC
genes which showed differential expression during stigma
development. In our previous study on the relative expression
of the CsZCD gene during different stages of stigma develop-
ment (Mir et al. 2012), we observed that the CsZCD gene
expression gets up-regulated by 8% from yellow to orange
and then by 33% from orange to scarlet stage of stigma
development in saffron (Mir et al. 2012). In the present
study, the relative expression of the CsLYC gene was studied
through real-time PCR analysis. An abrupt increase in
expression of CsLYC from the yellow to orange stage of stig-
ma development was observed. Here, the scarlet stage which
has a fully developed stigma was treated as a positive cali-
brator. Higher expression of CsLYC gene during scarlet stage
of stigma development has been reported using semi-quanti-
tative reverse transcription PCR (Castillo et al. 2005; Rubio
et al. 2004). Semi-quantitative expression of lycopene
cyclase gene has been done in different tissues of saffron
flower and maximum expression has been observed in saf-
fron stigmas at the maturity stage (Ahrazem et al. 2010). This
isthe first report of quantitative analysis of CsLYC gene
expression during stigma development in saffron. The prel-
ude to this would be to validate a set of reference genes along
with other important genes from the same pathway to harmo-
nize the data from various experiments that are expected to
follow suit.
Conclusions
In Crocus sativus during stigma development there are
significant changes in the content of apocarotenoids and
apocarotenoid biosynthetic genes. Two genes, CsZCD and
CsLYC,showed clear changes in expression during different
stages of stigma development, but CsBCH and CsGT2 were
expressed only during the scarlet stage of stigma develop-
ment. Our study found a clear correlation between apoc-
arotenoid content and apocarotenoid gene expression during
different stages of stigma development. In order to find out
the main regulatory gene responsible for apocarotenoid
biosynthesis, we need to correlate apocarotenoids genes with
level of apocarotenoids and substrates like zeaxanthin, beta-
carotene, etc., during different stages of stigma development.
The present findings will play an important role to find out
the stage of flower development under in vivo or in vitro con-
ditions and the quality of stigma can be improved by induc-
ing overexpression of these genes in plant by genetic manip-
ulation approaches.
Acknowledgements
This study was supported jointly by Department of
Biotechnology, University of Kashmir, Srinagar and Central
Institute of Temperate Horticulture, Srinagar.
References
Ahrazem O, Rubio MA, Gomez L. 2010. The expression of
chromoplast specific beta lycopene cyclase gene is
involved in the high production of saffron precursors. J.
Exp. Bot. 61: 105-119
Alonso GL, Salinas MR, Garijo J, Sanchez-Fernandez MA.
2001. Composition of crocins and picrocrocin from
Spanish saffron (Crocus sativus L.). J. Food Qual. 24:
219-233
Arigoni D, Sagner S, Latzel C, Eisenreic W, Bacher A, Zenk
MH. 1997. Terpenoid biosynthesis from 1-deoxy-d-xylu-
lose in higher plants by intramolecular skeletal rearrange-
ment. Proc. Natl. Acad. Sci. USA 94: 10600-10605
Bouvier F, Suire C, Mutterer J, Camara B. 2003. Oxidative
remodeling of chromoplast carotenoids: identification of
the carotenoid dioxygenase CsCCD and CsZCD genes
involved in Crocus secondary metabolite biogenesis. Plant
Cell 15: 47-62
Britton G. 1998 Overview of carotenoid biosynthesis. In G
Britton, S Liaaen-Jensen, H Pfander, eds, Biosynthesis
and Metabolism, Vol. 3, Basel, Birkha user Verlag 13:
148
Bustin SA. 2000. Absolute quantification of mRNA using
real-time reverse transcription polymerase chain reaction
assays. J. Mol. Endocrinol. 25: 169-193
Caballero-Ortega H, Pereda-Miranda R, Abdullaev F. 2007.
HPLC quantification of major active components from 11
different saffron (Crocus sativus L.) sources. Food Chem.
100: 1126-1131
Castillo R, Fernandez JA, Gomez-Gomez L. 2005.
Implications of carotenoid biosynthetic genes in apoc-
arotenoid formation during the stigma development of
Crocus sativus and its closer relatives. Plant Physiol. 139:
674-689
Dufresne C, Cormier F, Dorion S. 1997. In vitro formation of
crocetin glucosyl esters by Crocus sativus callus extract.
Planta Med. 63: 150-153
Freeman WM, Walker SJ, Vrana KE. 1999. Quantitative
RTPCR: pitfalls and potential. Biotechniques 26: 112-115
Hadizadeh F, Mahdaci M, EmamSA, Khashayarmanesh Z,
Hassanzadeh M, Asili J, Seifi M, Nassiri H, Shariatimo-
ghadam A, Noorbakhsh R. 2007. Evaluation of ISO
method in saffron quantification. In: Koosheki, H Nassiri,
Ghorbani, Eds., Proceedings of the Second International
Symposium on Saffron Biology and Technology. Acta
Hort. (ISHS) 739: 405-410
Himeno H, Sano K. 1987. Synthesis of crocin, picrocrocin
and safranal by saffron stigma-like structures proliferated
in vitro.Agric. Biol. Chem. 51: 2395-2400
Lage M, Cantrell CL. 2009. Quantification of saffron
(Crocus sativus L.) metabolites crocins, picrocrocin and
safranal for quality determination of the spice grown
under different environmental Moroccan conditions. Sci.
Hortic. 12: 366-373
Li N, Lin G, Kwan Y, Min Z. 1999. Simultaneous quantifica-
tion of five major biologically active ingredients of saffron
by high-performance liquid chromatography. J.
Chromatogr. A. 849: 349-355
Livak KJ, Schmittgen TD. 2001. Analysis of relative gene
expression data using real- time quantitative PCR and the
2-ΔΔcp Method. Methods 25: 402-408
Lozano P, Castellar MJ, Simancas MJ, Iborra JL. 1999.
Quantitative high-performance liquid chromatographic
method to analyze commercial saffron (Crocus sativus L.)
products. J. Chromatogr. A. 830: 477-483
Mir JI, Ahmed N, Wafai AH, Qadri RA. 2012. Relative
expression of CsZCD gene and apocarotenoid biosynthesis
during stigma development in Crocus sativus L. Physiol.
Mol. Biol. Plants 18(4): 371-375
Moraga AR, Nohales PF, Perez JA, Gômez-Gômez L. 2004.
Glucosylation of the saffron apocarotenoid crocetin by a
glucosyltransferase isolated from Crocus sativus stigmas.
Planta 219(6): 955-966.
Pfander H, Schurtenberger H. 1982. Biosynthesis of C20-
carotenoids in Crocus sativus.Phytochemistry 21: 1039-
1042
Rubio A, Fernández NP, Fernández JA, Gomez-Gomez L.
2004. Glucosylation of the saffron apocarotenoid crocetin
by a glucosyltransferase isolated from Crocus sativus stig-
mas. Planta 219: 955-966
Rubio A, Rambla JL, Ahrazem O, Granell A, Gomez-Gomez
L. 2009. Metabolite and target transcript analyses during
Crocus sativus stigma development. Phytochemistry 70:
1009-1016
Sujata V, Ravishankar A, Venkataraman LV. 1992. Methods
for the analysis of the saffron metabolites crocin, cro-
cetins, picrocrocin and safranal for the determination of
the quality of the spice using thin-layer chromatography,
high performance liquid chromatography and gas chro-
matography. J. Chromatogr. A. 624: 497-502
Tarantilis PA, Tsoupras G, Polissiou M. 1995. Determination
of saffron (Crocus sativus L.) components in crude plant
extracts using high-performance liquid chromatogra-
phy–UV–Vis photodiode-array detection-mass spectrome-
try. J. Chromatogr. A. 699: 107-117
Teale SA, Webster FX, Zhang A. 1992. New aggregation
pheromone for the bark beetle Ips pini and uses thereof.
U.S. Patent 5: 167-955
Wang X, Wang Z, Dong J, Wang M, Gao H. 2009. Cloning
of a 9- cis-epoxycarotenoid dioxygenase gene and the
responses of Caragana korshinskii to a variety of abiotic
stresses. Genes Genet. Syst. 84: 397-405
Gene Expression of Apocarotenoids during Saffron Stigma Development
188
... Apocarenoid biosynthesis occurs in C sativus stigmas and involves two pathways: the mevalonic acid pathway, which occurs in the cytoplasm, and a non-mevalonic acid pathway, which takes place in plastids and provides carotenoid precursors [66]. Moreover, C. sativus metabolites responsible for the color, flavor, and aroma are produced from carotenoids by enzymes that are synthesized in the plastids and then transported to vacuoles for storage [67]. ...
Article
Full-text available
Saffron is derived from the stigmas of the flower Crocus sativus L. The drying process is the most important post-harvest step for converting C. sativus stigmas into saffron. The aim of this review is to evaluate saffron’s post-harvest conditions in the development of volatile compounds and its aroma descriptors. It describes saffron’s compound generation by enzymatic pathways and degradation reactions. Saffron quality is described by their metabolite’s solubility and the determination of picrocrocin, crocins, and safranal. The drying process induce various modifications in terms of color, flavor and aroma, which take place in the spice. It affects the aromatic species chemical profile. In the food industry, saffron is employed for its sensory attributes, such as coloring, related mainly to crocins (mono-glycosyl esters or di-glycosyl polyene).
... a.com/calc/ analy zer) database. The C. sativus tubulin primers (Tub-F: 5′-TGA TTT CCA ACT CGA CCA GTGTC-3′) and (Tub-R:5′-ATA CTC ATC ACC CTC GTC ACC ATC -3′) were used as the reference genes [32][33][34]. ...
Article
Full-text available
Saffron is the world highest-priced spice because its production requires intensive hand labour. Reduce saffron production costs require containerised plant production under controlled conditions and expand the flowering period. Controlling the flowering process and identify the factors involved in saffron flowering is crucial to introduce technical improvements. The research carried out so far in saffron has allowed an extensive knowledge of the influence of temperature on the flower induction, but the molecular mechanisms controlling flowering induction processes are largely unknown. The present study is the first conducted to isolate and characterize a regulator gene of saffron floral induction the Short Vegetative Phase (SVP) gene, which represses the floral initiation genes in the temperature response pathway, which involved in saffron flower induction. The results obtained from both phylogenetic analysis and T-coffee alignment confirms that the isolated sequence belongs to the SVP gene clades of MADS-box gene family. Gene expression analysis in different developmental stages revealed the highest expression of SVP transcript (CsSVP) during the dormancy and the vegetative stages, but decrease when flower development initiated and it was the least in late September when flower primordia are developed. Furthermore, its expression increased in the apical bud when corms are storage at 9–10 ºC, thus inhibiting flower induction. Additionally, comparison of the CsSVP transcript in apical buds from big and small corms, differing in their flowering capacity, indicates that the CsSVP transcript is present only in vegetative buds. Taken together, these results suggested inhibitory role of the SVP gene.
... Recent studies on changes of the secondary metabolites in saffron have demonstrated that the transcriptional regulation of the biosynthesis of crocin and safranal is controlled by genes β-hydroxylase, CsZCD, and lycopene cyclase (Moraga et al. 2009;Ahrazem et al. 2010). The expression profile of CsLYC, CsBCH and CsGT2 show a correlation with the biosynthesis of crocin and safranal (Mir et al. 2012;Mzr et al. 2013). Real-time PCR is a technique used for incessant observation of progress in a PCR reaction over time and can measure the amounts of DNA, cDNA and RNA. ...
Article
Full-text available
The expression of biosynthesis controlling genes of crocin and safranal in saffron (Crocus sativus) can be influenced by ultrasonic waves. Sterilized saffron corms were cultured in a ½-MS medium supplemented by 2-4-D and BAP. Saffron callus cells were treated with ultrasonic waves in a cellular suspension culture under optimal growth conditions. The samples were collected at 24 and 72 hours after treatment in three replications. The secondary metabolites were measured by high-performance liquid chromatography and the gene expression was analysed by the real-time polymerase chain reaction. Results indicate that this elicitor can influence the expressions of genes CsBCH, CsLYC and CsGT-2; the ultrasonic waves acted as an effective mechanical stimulus to the suspension cultures. The analysis of variance of the ultrasonically produced amounts of safranal and crocin indicates that there is a significant difference between once- and twice-treated samples in that the amount of safranal was the highest within the samples taken from the twice-treated suspension culture at 72 h after the ultrasound treatment, and the crocin was maximised after 24 h passed the twice-applied ultrasound treatment.
... The expression pattern of both genes examined in different organs suggested that CstLcyB2a encodes chromoplast-specific lycopene cyclase, its expression restricted to the stigma tissue where it activates and boosts b-carotene accumulation, while CstLcyB1 transcripts were observed in leaves, tepals and stigmas at lower levels. Expression pattern of CsLYC-b, CsZCD, CsBCH and CsGT2 has been studied in different flower parts both during developmental stages of in vitro-formed stigma-like structures [85] and during different stages of stigma development under natural conditions [19,86,87]. RT-PCR analysis revealed concurrent expression pattern of CsZCD and CsLYC-b genes in a developmental stage-specific manner. ...
Article
Saffron is considered to be the costliest spice of the world. It has been regarded as highly valued medicinal plant in Ayurveda to treat various ailments. Over the past few years, considerable interest has developed in saffron because of its anticancer, antimutagenic, antioxidant and immunomodulatory properties. Saffron's colour, bitter taste and aroma are its three main and peculiar characteristics, which are conferred by three chemicals namely: crocin, picrocrocin and safranal, respectively. The present review focuses on recent research/progress made in saffron in the area of functional genomics and highlights the potential of several genes and transcription factors involved in carotenoid/apocarotenoid pathway and responsible for flavour and aroma of saffron.
Article
Full-text available
Improving flower yield through lengthening flowering duration is a primary breeding objective in saffron (Crocus sativus L.). Asexual reproduction in saffron limits biodiversity and conventional breeding. Hence, eliciting flowering-related gene expression by plant growth regulators is one way to achieve this aim. The phytohormones methyl jasmonate (MeJA) and 6-benzyl amino purine (BAP) signals are received by the MADs-box gene family. In this study, to elucidate the role of phytohormones on flower development, plant were treated with BAP (0 and 5 mg L⁻¹), and methyl jasmonate (MeJA) (0, 20, and 100 mM) at three developmental stages of the saffron life cycle. Then, the expression of the SHORT VEGETATIVE PHASE (CsSVP) gene as a MADS-box gene family was assessed in the saffron corm. The activities of antioxidant enzymes, soluble sugar, starch content, and soluble protein content were also measured in corm, leaf, and root tissues. The application of MeJA and BAP treatments resulted in down-regulation of CsSVP expression in the corm during dormancy. At the dormancy stage, catalase, peroxidase activity decreased, and ascorbate peroxidase activity increased following MeJA treatment. In contrast, an increment in catalase and peroxidase activity and reduction of ascorbate peroxidase activity were observed after treatment with MeJA during the flowering stage. This change in enzyme activity is most likely due to flowering, which demands the re-allocation of resources. As flowering is a process heavily influenced by the environment, plants treated with MeJA, which may mimic environmental stress, showed changes in antioxidant enzyme activity. Overall, these results suggested that MeJA and BAP treatments play a significant role in the vegetative-to-reproductive phase change in saffron.
Article
Full-text available
Saffron is a unique plant in many aspects, and its cellular processes are regulated at multiple levels. The genetic makeup in the form of eight chromosome triplets (2n = 3x = 24) with a haploid genetic content (genome size) of 3.45 Gbp is decoded into different types of RNA by transcription. The RNA then translates into peptides and functional proteins, sometimes involving post-translational modifications too. The interactions of the genome, transcriptome, proteome and other regulatory molecules ultimately result in the complex set of primary and secondary metabolites of saffron metabolome. These complex interactions manifest in the form of a set of traits ‘phenome’ peculiar to saffron. The phenome responds to the environmental changes occurring in and around saffron and modify its response in respect of growth, development, disease response, stigma quality, apocarotenoid biosynthesis, and other processes. Understanding these complex relations between different yet interconnected biological activities is quite challenging in saffron where classical genetics has a very limited role owing to its sterility, and the absence of a whole-genome sequence. Omics-based technologies are immensely helpful in overcoming these limitations and developing a better understanding of saffron biology. In addition to creating a comprehensive picture of the molecular mechanisms involved in apocarotenoid synthesis, stigma biogenesis, corm activity, and flower development, omics-technologies will ultimately lead to the engineering of saffron plants with improved phenome.
Preprint
Full-text available
Saffron is a unique plant in many respects and its cellular processes are regulated at multiple levels. The genetic makeup in the form of eight chromosome triplets (2n = 3x = 24) with a haploid generic content (genome size) of 3.45 Gbp is decoded into different types of RNA by transcription. The RNA then translates into peptides and functional proteins, sometimes involving post-translational modifications too. The interactions of genome, transcriptome, proteome and other regulatory molecules ultimately result in the complex set of primary and secondary metabolites of saffron metabolome. These complex interactions manifest in the form of a set of traits ‘phenome’ peculiar to saffron. The phenome responds to the environmental changes occurring in and around saffron and modify its response in respect of growth, development, disease response, stigma quality, apocarotenoid biosynthesis, etc. Understanding these complex relations between different yet interconnected biological activities is quite challenging in saffron where classical genetics has a very limited role owing to its sterility, and the whole genome sequencing has not been done. Omics-based technologies are immensely helpful in overcoming these limitations and develop a better understanding of saffron biology. In addition to creating a comprehensive picture of the molecular mechanisms involved in apocarotenoid synthesis, stigma biogenesis, corm activity, flower development, etc. omics-technologies will ultimately lead to the engineering of saffron plants with improved phenome. In this review, we discuss the role of omics-technologies and bioinformatics tools in studying saffron biology, and in its improvement.
Chapter
Saffron (Crocus sativus L.) is an autumnal herbaceous flowering plant belonging to the Iridaceae family. It is considered the most expensive spice in the world and a valuable medicinal herb. The origin of saffron is unclear. The probable center of origin of the plant is Asia Minor (Greece) and/or the Middle East (Iran). From the historical point of view, use of saffron for medical treatment, perfume, food and dye dates back 4000 years. Saffron stigmas contain three important secondary metabolites, crocin, picrocrocin and safranal that are responsible for the saffron color, taste and aroma, respectively. Saffron’s adaptation to hot and dry climates has led to widespread cultivation in arid regions, notably Iran where it is a primary income source for many people. The triploid genome of saffron causes the production of abnormal pollen triggering self-sterility. With respect to the clonal nature of saffron, it is believed that there is only one cultivar worldwide. Lack of genetic variation restricts the use of traditional plant breeding based on selection. Probable wild relatives could be an excellent source of genes to alter saffron traits by cross-pollination. In addition, an induced mutation approach with various mutagen agent treatments is an alternative to produce genetic variations. Recent advances in sequencing methods and next-generation sequencing (NGS), provide efficient approaches such as transcriptome sequencing along with proteome and metabolome information, which would help to exploit functional genomics toward genetic engineering of the economic traits of saffron.
Chapter
Full-text available
Crocus sativus (L.) is considered to be one of the high-value spices cultivated around the globe, and hence is under scanner of the genomic approaches that have been used to study the identification, expression, and regulation of the key genes involved in its flower development and apocarotenoid biosynthesis. C. sativus flower contains in excess of 150 compounds of aromatic and vaporescent. It produces remarkable amounts of apocarotenoids, such as crocin, picrocrocin, and safranal, that exhibit a wide range of anticancer, neuroprotective, anti-inflammatory, and cardioprotective activities. These apocarotenoids displaying such a wide range of pharmacological activities are of huge interest to culinary and pharmaceutical industries. Advances in biotechnological interventions, like genomic technologies, functional genomics, and transcriptomics studies, have revealed the expression of genes and/or structure, function, evolution, mapping, and editing of genes encoding apocarotenoid biosynthesis and enabled C. sativus genetic improvements in an efficient way through molecular breeding programs. The application of genomic tools and techniques has encouraged C. sativus breeders to adopt precision breeding approaches. The present chapter attempts to traverse across the recent developments in genetics and genomics-based researches conducted in C. sativus to perceive the biosynthetic pathways of its major secondary metabolites.
Chapter
Plants have proven to be a beneficial means for uncovering new products having therapeutic interest in the drug augmentation. Human beings uses plant-produced secondary metabolites since from the prehistoric times. Due to high usage of secondary metabolites in diverse marketing sectors, such as pharmaceutical, food, and chemical industries, the demand for the most relevant and accepted method to separate these metabolites from plants is huge. Different extraction techniques have been used to obtain secondary metabolites, and many of these techniques are built on the extracting strength of solvents and the application of mixing and/or heat. In addition to traditional methods, several new methods have been established, but till now none of them are considered as a standard method for elicitation of secondary metabolites. In the late 1960s, plant cell culture technologies were found as a promising tool for both investigating and designing plant secondary metabolites. With the help of cell cultures, phytochemicals are not only produced in adequate quantity, but also discard the existence of intrusive compounds that develops in the field-grown plants. This technology serves advantageous over classical methods. Many approaches have been used to amplify the yield of secondary metabolite manufacture by cultured plant cells. Among these approaches are selecting a plant with immense biosynthetic capacity, acquiring efficacious cell line for growth and production of the concerned metabolite, manipulating culture environment, elicitation, metabolic engineering, and organ culture. Mass cultivation of plant cells is done with the help of different bioreactors. Application of cell culture provides various benefits including the synthesis of secondary metabolites, working in controlled conditions as well as autonomous to soil and climate conditions. Elicitor which may be biotic or abiotic is considered as one of the stress agents to obtain increased amount of secondary metabolites from different parts of the plants. Polysaccharides like chitosans are natural elicitors which are benefitted for plant cell’s immobilization and permeabilization. A new path has been initiated in current years for secondary metabolite production with the help of elicitors in plant tissue culture. The different criteria that influence the production and accumulation of secondary metabolites include elicitor concentrations, exposure time, cell line, nutrient composition, and age or stage of the culture. In a number of plant cell cultures, elicitors have intensified the production of sesquiterpenoid, phytoalexin, terpenoid indole alkaloids, isoflavonoid, phytoalexins, coumarins, etc. Regardless of these efforts of the past few decades, plant cell cultures have led to very little economic successes for the production of esteemed secondary compounds. Thus, the aim of this chapter is to highlight the prospects of plant cell culture to produce secondary metabolites, and also provides an overview on the important approaches used for the secondary metabolite production and their improvement strategies.
Article
Full-text available
Crocus sativus is a triploid sterile plant characterized by its red stigmas, which produce significant quantities of carotenoid derivatives formed from the oxidative cleavage of β-carotene and zeaxanthin. The accumulation of three major carotenoid derivatives- crocin, picrocrocin, and safranal- is responsible for the color, bitter taste, and aroma of saffron, which is obtained from the dried stigma of Crocus. Maximum apocarotenoid accumulation occurs during fully developed scarlet stage of stigma development. Zeaxanthin is the precursor for biosynthesis of apocarotenoids. Crocus zeaxanthin 7, 8 (7, 8)-cleavage dioxygenase gene (CsZCD) encodes a chromoplast enzyme that initiates the biogenesis of these apocarotenoids by cleaving zeaxanthin. The Reverse Transcription-PCR analysis revealed that CsZCD gene expression followed different patterns during stigma development. Highest levels of CsZCD gene expression was observed in fully developed scarlet stage of stigma. Real Time PCR analysis showed that there is a sharp increase in gene expression from yellow to orange and orange to scarlet stages of stigma development. Increase in CsZCD gene expression parallels with the apocarotenoid content during the development of stigma, suggesting its regulatory role for apocarotenoid biosynthesis and stigma development in saffron.
Article
Full-text available
The factors which are very important in saffron are crocin (color), picrocrocin (flavor) and safranal (aroma). Higher amount of these compounds in saffron provide higher quality of saffron. ISO (the international organization for standardization) has set a classification of saffron based on minimum requirements of each quality. According to ISO picrocrocin, safranal and crocin are expressed as direct reading of the absorbance of 1 % aqueous solution of dried saffron at 257, 330 and 440 nm respectively. There was some doubt about the accuracy of the safranal result using ISO method. Therefore it was decided to evaluate the amounts of safranal and crocin in saffron according to ISO method and compare the results with the amounts of these compounds when using high performance liquid chromatography (HPLC). In HPLC method in an isocratic run a 30 cm ODS column were used. Mobile phase was mixture of acetonitrile and water (76 % v/v). A UV detector at wavelengths of 308nm for safranal and 440 nm for crocin was also employed. Results indicated that standard crocin had significant absorption at 308nm. We concluded that present ISO method is not an accurate method to measure the amount of safranal in saffron. Therefore it is suggested to evaluate this method and meanwhile using a HPLC method to evaluate the amount of safranal and crocin in saffron samples.
Article
Crocin, picrocrocin, and safranal as the major secondary metabolites are important for the high quality of spice saffron. Crocin and picrocrocin were detected in stigma-like structures proliferated in vitro. Safranal appeared after heat treatment. The contents and relative ratio of these substances in the stigma-like structures were similar to those in intact young stigmas, indicating that these stigma-like structures showed not only morphological but also biochemical similarity to the intact stigmas. © 1987, Japan Society for Bioscience, Biotechnology, and Agrochemistry. All rights reserved.
Article
Crocin, picrocrocin, and safranal as the major secondary metabolites are important for the high quality of spice saffron. Crocin and picrocrocin were detected in stigma-like structures proliferated in vitro. Safranal appeared after heat treatment. The contents and relative ratio of these substances in the stigma-like structures were similar to those in intact young stigmas, indicating that these stigma-like structures showed not only morphological but also biochemical similarity to the intact stigmas.
Chapter
The last time an overview of carotenoid biosynthesis was presented in this Symposium series was at the Bern meeting in 1975, when Davies and Taylor [1] and Britton [2] reviewed the early stages and later reactions, respectively. However, biosynthesis has not been neglected in the three meetings since then. Each of these has included several lectures and published chapters which mostly deal with some particular specialized aspect. Thus, in Madison in 1978, Rilling [3] discussed the prenyl transferase enzymes, Porter and Spurgeon [4] described their work with carotenogenic enzyme systems from tomatoes and Cerda-Olmedo and Torres-Martinez [5] covered genetics and regulation of carotenoid biosynthesis, whereas Davies [6] commented on general progress and drew attention to some unsolved problems. At the 1981 Liverpool meeting, the genetic analysis of carotenoid biosynthesis in Rhodopseudomonas capsulata was reported by Marrs [7], stereochemical aspects of carotenoid biosynthesis were surveyed by Milborrow [8], and chemical regulation and the effects of herbicides by Yokoyama [9] and Ridley [10], respectively. Mitzka-Schnabel [11], Bramley [12], and Camara [13] each described progress with their favourite carotenogenic enzyme systems in Munich in 1984, where Rau [14] reviewed photoregulation and Britton [15] outlined the use of stable isotopes in biosynthesis studies.
Article
The accumulation of three major carotenoid derivatives—crocetin glycosides, picrocrocin, and safranal—is in large part responsible for the color, bitter taste, and aroma of saffron, which is obtained from the dried styles of Crocus. We have identified and functionally characterized the Crocus zeaxanthin 7,8(7′,8′)-cleavage dioxygenase gene (CsZCD), which codes for a chromoplast enzyme that initiates the biogenesis of these derivatives. The Crocus carotenoid 9,10(9′,10′)-cleavage dioxygenase gene (CsCCD) also has been cloned, and the comparison of substrate specificities between these two enzymes has shown that the CsCCD enzyme acts on a broader range of precursors. CsZCD expression is restricted to the style branch tissues and is enhanced under dehydration stress, whereas CsCCD is expressed constitutively in flower and leaf tissues irrespective of dehydration stress. Electron microscopy revealed that the accumulation of saffron metabolites is accompanied by the differentiation of amyloplasts and chromoplasts and by interactions between chromoplasts and the vacuole. Our data suggest that a stepwise sequence exists that involves the oxidative cleavage of zeaxanthin in chromoplasts followed by the sequestration of modified water-soluble derivatives into the central vacuole.
Article
Phytoene, phytofluene, tetrahydrolycopene, β-carotene, zeaxanthin and crocetin were isolated from Crocus sativus. The absence of C20-hydrocarbon precursors of crocetin supports a degradation pathway for the biosynthesis of crocetin.
Article
The two most commonly used methods to analyze data from real-time, quantitative PCR experiments are absolute quantification and relative quantification. Absolute quantification determines the input copy number, usually by relating the PCR signal to a standard curve. Relative quantification relates the PCR signal of the target transcript in a treatment group to that of another sample such as an untreated control. The 2(-DeltaDeltaCr) method is a convenient way to analyze the relative changes in gene expression from real-time quantitative PCR experiments. The purpose of this report is to present the derivation, assumptions, and applications of the 2(-DeltaDeltaCr) method. In addition, we present the derivation and applications of two variations of the 2(-DeltaDeltaCr) method that may be useful in the analysis of real-time, quantitative PCR data. (C) 2001 Elsevier science.