ArticlePDF Available

Abstract and Figures

Sarcopenia, the loss of muscle mass and function with age, is associated with increased morbidity and mortality. Current understanding of the underlying mechanisms is limited. Glucocorticoids (GC) in excess cause muscle weakness and atrophy. We hypothesized that GC may contribute to sarcopenia through elevated circulating levels or increased glucocorticoid receptor (GR) signaling by increased expression of either GR or the GC-amplifying enzyme 11beta-hydroxysteroid dehydrogenase type 1 (11βHSD1) in muscle. There were 82 participants; group 1 comprised 33 older men (mean age 70.2years, SD 4.4) and 19 younger men (22.2years, 1.7) and group 2 comprised 16 older men (79.1years, 3.4) and 14 older women (80.1years, 3.7). We measured muscle strength, mid-thigh cross-sectional area, fasting morning plasma cortisol, quadriceps muscle GR and 11βHSD1 mRNA, and urinary glucocorticoid metabolites. Data were analysed using multiple linear regression adjusting for age, gender and body size. Muscle strength and size were not associated with plasma cortisol, total urinary glucocorticoids or the ratio of urinary 5β-tetrahydrocortisol +5α-tetrahydrocortisol to tetrahydrocortisone (an index of systemic 11βHSD activity). Muscle strength was associated with 11βHSD1 mRNA levels (β -0.35, p = 0.04), but GR mRNA levels were not significantly associated with muscle strength or size. Although circulating levels of GC are not associated with muscle strength or size in either gender, increased cortisol generation within muscle by 11βHSD1 may contribute to loss of muscle strength with age, a key component of sarcopenia. Inhibition of 11βHSD1 may have therapeutic potential in sarcopenia.
Content may be subject to copyright.
Increased Skeletal Muscle 11bHSD1 mRNA Is Associated
with Lower Muscle Strength in Ageing
Alixe H. M. Kilgour
1
*, Iain J. Gallagher
2
, Alasdair M. J. MacLullich
1,2
, Ruth Andrew
3
, Calum D. Gray
4
,
Philippa Hyde
2
, Henning Wackerhage
5
, Holger Husi
2
, James A. Ross
2
, John M. Starr
1
, Karen E. Chapman
3
,
Kenneth C. H. Fearon
2
, Brian R. Walker
3
, Carolyn A. Greig
2
1Centre for Cognitive Ageing and Cognitive Epidemiology, Geriatric Medicine Unit, University of Edinburgh, Edinburgh, United Kingdom, 2Department of Clinical and
Surgical Sciences, Division of Health Sciences, School of Clinical Sciences, University of Edinburgh, Edinburgh, United Kingdom, 3Endocrinology Unit, Centre for
Cardiovascular Science, Queen’s Medical Research Institute, University of Edinburgh, Edinburgh, United Kingdom, 4Clinical Research Imaging Centre, Queen’s Medical
Research Institute, University of Edinburgh, Edinburgh, United Kingdom, 5School of Medical Sciences, University of Aberdeen, Aberdeen, United Kingdom
Abstract
Background:
Sarcopenia, the loss of muscle mass and function with age, is associated with increased morbidity and
mortality. Current understanding of the underlying mechanisms is limited. Glucocorticoids (GC) in excess cause muscle
weakness and atrophy. We hypothesized that GC may contribute to sarcopenia through elevated circulating levels or
increased glucocorticoid receptor (GR) signaling by increased expression of either GR or the GC-amplifying enzyme 11beta-
hydroxysteroid dehydrogenase type 1 (11bHSD1) in muscle.
Methods:
There were 82 participants; group 1 comprised 33 older men (mean age 70.2years, SD 4.4) and 19 younger men
(22.2years, 1.7) and group 2 comprised 16 older men (79.1years, 3.4) and 14 older women (80.1years, 3.7). We measured
muscle strength, mid-thigh cross-sectional area, fasting morning plasma cortisol, quadriceps muscle GR and 11bHSD1
mRNA, and urinary glucocorticoid metabolites. Data were analysed using multiple linear regression adjusting for age,
gender and body size.
Results:
Muscle strength and size were not associated with plasma cortisol, total urinary glucocorticoids or the ratio of
urinary 5b-tetrahydrocortisol +5a-tetrahydrocortisol to tetrahydrocortisone (an index of systemic 11bHSD activity). Muscle
strength was associated with 11bHSD1 mRNA levels (b-0.35, p = 0.04), but GR mRNA levels were not significantly associated
with muscle strength or size.
Conclusion:
Although circulating levels of GC are not associated with muscle strength or size in either gender, increased
cortisol generation within muscle by 11bHSD1 may contribute to loss of muscle strength with age, a key component of
sarcopenia. Inhibition of 11bHSD1 may have therapeutic potential in sarcopenia.
Citation: Kilgour AHM, Gallagher IJ, MacLullich AMJ, Andrew R, Gray CD, et al. (2013) Increased Skeletal Muscle 11bHSD1 mRNA Is Associated with Lower Muscle
Strength in Ageing. PLoS ONE 8(12): e84057. doi:10.1371/journal.pone.0084057
Editor: Cedric Moro, INSERM/UMR 1048, France
Received September 10, 2013; Accepted November 18, 2013; Published December 31, 2013
Copyright: ß2013 Kilgour et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: The authors thank the British Heart Foundation and Chief Scientist Office of the Scottish Government for financial support. AHJK, AMJM and JMS are
members of The University of Edinburgh Centre for Cognitive Ageing and Cognitive Epidemiology, part of the cross council Lifelong Health and Wellbeing
Initiative. Funding from the BBSRC, EPSRC, ESRC and MRC is gratefully acknowledged. The funders had no role in study design, data collection and analysis,
decision to publish, or preparation of the manuscript.
Competing Interests: B.R.W. is an inventor on relevant patents owned by the University of Edinburgh and has consulted for several companies developing
selective 11bHSD1 inhibitors. No other potential conflicts of interest relevant to this article were reported. This does not alter the authors’ adherence to all the
PLOS ONE policies on sharing data and material.
* E-mail: a.kilgour@ed.ac.uk
Introduction
Sarcopenia is the loss of muscle mass and function which
accompanies even healthy ageing [1–3]. Both muscle mass and
function (i.e., power and strength) begin to decline from the third
decade with mass reducing by 1–2% per year and strength
reducing by around 2% per year [4–8]. Sarcopenia is associated
with an increased risk of falls and fractures, disability, loss of
independence and mortality [9–11]. Despite this public health
problem, current understanding of the mechanisms underlying
sarcopenia is limited, hampering progress in the development of
novel treatments for maintenance of muscle mass and physical
independence in old age. Theories underlying the development of
sarcopenia include: inflammation, cellular senescence, hormones
and growth factors and lifestyle factors (eg nutrition) [12,13].
One possible mechanism within the field of hormones and
growth factors is glucocorticoid dysregulation. It is well known that
glucocorticoids at pharmacological levels or in spontaneous
Cushing’s syndrome cause myopathy, with a combination of
muscle atrophy and dysfunction. Glucocorticoids are believed to
effect these changes on muscle through a combination of increased
protein breakdown (particularly through the ubiquitin-proteasome
system) [14], decreased protein synthesis (by inhibiting transport of
amino acids into muscle and inhibiting the action of insulin and
PLOS ONE | www.plosone.org 1 December 2013 | Volume 8 | Issue 12 | e84057
IGF-1) [15] and decreasing production of IGF-1 and myostatin
[14]. In the context of sarcopenia, this mechanism could occur via
elevated circulating glucocorticoids due to age-related hypotha-
lamic-pituitary-adrenal (HPA) axis dysregulation. Alternatively, it
could occur selectively within the muscle, by increased activity of
the glucocorticoid receptor (GR) or the enzyme 11b-hydroxyste-
roid dehydrogenase type 1 (11bHSD1). 11bHSD1 converts
inactive cortisone to active cortisol and is known to be present
and biologically active in human muscle as well as many other
tissues [16–18]. Indeed a recent study by Tiganescu et al found
that elevated 11bHSD1 activity was inceased in skin biopsies from
older adults compared to younger adults and that this increased
activity was associated with markers of skin ageing (eg dermal
atrophy and deranged collagen structural organization) [19].
Establishing links between GC and sarcopenia could lead to novel
therapies, as several 11bHSD1 inhibitors are currently in clinical
development for type 2 diabetes and other degenerative diseases,
including cognitive dysfunction [20].
There is some evidence of an association between increased
plasma and salivary cortisol and lower muscle mass and strength
but these data are inconsistent [21–24]. Glucocorticoid metabo-
lites in a 24 hour urine sample may be more informative than
plasma cortisol levels since they reflect glucocorticoid status over
the diurnal cycle. Additionally ratios of the metabolites can be
used as an index of peripheral 11bHSD activity [25]. However, no
studies to date have examined the relationship between urinary
glucocorticoid metabolites and sarcopenia. Similarly, there are no
published data examining the relationship between GR and
11bHSD1 expression and muscle loss and function in older adults.
Importantly, expression of 11bHSD1 and GR mRNA has been
shown to reflect glucocorticoid activity, for example there is a
correlation between 11bHSD1 mRNA expression and enzyme
function [26].
The aim of this study was to investigate the relationship between
plasma and urinary glucocorticoid metabolites and levels of
mRNA encoding GR and 11bHSD1 in skeletal muscle, with
muscle size and strength. We hypothesized that increased
glucocorticoid signaling in skeletal muscle acting through GR
by, (a) elevated circulating cortisol, (b) increased expression of
11bHSD1 or (c) increased expression of GR, is associated with
reduced muscle size and strength.
Methods
Participants
Participants were healthy volunteers recruited at two sites in
Scotland: young and older men were recruited in Aberdeen
(Group 1) and older men and women were recruited in Edinburgh
(Group 2). This allowed us to test for possible age and gender
effects. Participants were defined as healthy after applying
previously published health selection criteria to the responses to
a questionnaire [27]. Existing samples were available from two
nearby cities in Scotland so these were used for analysis, rather
than beginning a new de novo cohort collection. No comparisons
were made between these two independent cohorts.
Ethics Statement
Written informed consent was obtained and all procedures
received local ethical committee approval. In Edinburgh this was
by the Lothian Local Research Ethics Committee 02 and in
Aberdeen this was by the North of Scotland Research Ethics
Committees. The study conformed to the standards set by the
Declaration of Helsinki.
Anthropometry
Body weight was measured with participants in light clothing
using a beam scale (Seca, UK). Height was measured using a wall
mounted stadiometer.
Muscle Function
Maximum voluntary isometric knee extensor strength was
measured using an established method [28]. Following instruction,
the participant made a maximum voluntary contraction (Newtons)
which was held for 5 seconds. Three separate measurements were
obtained and the highest value was used in subsequent analysis.
Muscle Size
Mid-thigh quadriceps cross-sectional area (CSA) was measured
using a 1.5T MR scanner (Phillips Gyroscan Intera). T1-weighted
axial images were taken with the isocentre of the magnetic field
located at the mid-femur point which was landmarked prior to the
scan according to International Standards of Anthropometric
Assessment (ISAK) guidelines 2001. Imaging parameters were:
slice thickness 10 mm; acquisition matrix 5126512; echo time
(TE) 15 ms; repetition time (TR) 425 ms; and flip angle 90u. The
CSA of the quadriceps was quantified using Analyze 8.0 (Mayo
Clinic, Rochester, USA) according to a previously published
technique [29]. Two of the subjects from Group 2 did not undergo
MRI due to claustrophobic symptoms.
Plasma Cortisol
Blood samples were obtained from participants in the morning
after overnight fast (mean time 0945h, range 0915–1030h). Plasma
cortisol was measured by competitive immunoassay with direct
chemiluminescent technology using the Bayer Advia Centaur
method (see http://labmed.ucsf.edu/labmanual/db/resource/
Centaur_Cortisol.pdf).
Quadriceps Muscle Biopsy
Quadriceps femoris samples were obtained from the region of
vastus lateralis via percutaneous needle biopsy using a Bergstrom
needle [30]. The biopsy was obtained in a sterile environment by
sharp dissection under local anaesthetic using 1% lidocaine. The
samples were then snap frozen in liquid nitrogen and stored at
280uC before analysis [31].
RNA Isolation
Total RNA was isolated from quadriceps muscle biopsies using
the Qiazol reagent (Qiagen, Crawley, UK) and miRNeasy RNA
isolation columns (Qiagen, Crawley, UK). Briefly biopsies were
homogenised in 1400 ul or 700 ul Qiazol depending on the size of
the tissue sample using a Polytron PT1200E (Kinematica AG).
Total RNA was isolated from the homogenised muscle using
miRNEasy columns with an on column DNAse treatment step
using the RNase-Free DNase Set (Qiagen, Crawley, UK). After
elution from the column into 30 ul nuclease free H
2
O, RNA was
quantified using the Nanodrop instrument (Labtech, UK) and
quality assessed using the Bioanalyzer (Agilent, UK). All samples
had 260/280 ratios above 1.8, and RIN scores above 7.5.
cDNA Preparation and qPCR
RNA samples were converted to cDNA using the Ovation RNA
Amplification kit (Nugen, Netherlands). RNA was diluted to
10 ng/ul and 50 ng total RNA was used in the amplification
reaction carried out according to the manufacturer’s instructions,
yielding between 3 ug and 11 ug cDNA. For qPCR, cDNA was
diluted to ,50 ng/ul. Quantitative RT-PCR reactions were run,
Skeletal Muscle 11bHSD1 and Lower Muscle Strength
PLOS ONE | www.plosone.org 2 December 2013 | Volume 8 | Issue 12 | e84057
in triplicate, on an Applied Biosystems Step One Plus system. The
reaction mix was POWER SYBR Green x2 Master mix 12.5 ul,
forward primer (10 uM) 1 ul, reverse primer (10 uM) 1 ul, H2O
9.5 ul and cDNA 1 ul. Reaction conditions were 95uC for 10
mins, 95uC for 15s, 60uC for 60s (40 cycles) followed by melting
curve generation from 60uCto95uC. Ct values were examined
and within triplicates any value greater than 0.3 Ct were removed
before means were calculated. Data were then analysed using the
delta Ct method with HPRT as a normaliser. After normalisation
data were inverted and scaled such that the largest value for each
gene was set to 100.
Primer sequences used were NR3C1 FP –
CTGTCGCTTCTCAATCAGACTC; RP – GCATTGCT-
TACTGAGCCTTTTG; 11bHSD1 FP –
AGGCTGCTGCCTGCTTAGGA; RP – AGCCCCA-
GAATGGGGAGGAGA; HPRT FP – TGACACTGGCAAAA-
CAATGCA; RP- GGTCCTTTTCACCAGCAAGCT. HPRT
was chosen as a normaliser as preliminary analysis of housekeep-
ing gene performance showed HPRT to be stable across samples
and expressed at a similar level to genes of interest compared to b-
actin, GAPDH, b2M and 18S.
Urinary Glucocorticoid Metabolism
24 hour urine samples were collected to quantify urinary
glucocorticoid metabolites using gas chromatography electron
impact mass spectrometry following solid phase extraction,
hydrolysis of conjugates and formation of their methoxime-
trimethylsilyl derivatives, as described previously [25].
Two composites of the data were used in subsequent analyses.
Firstly, total urinary steroids, comprising the sum of 5b-tetra-
hydrocortisol (5bTHF), 5a-tetrahydrocortisol (5aTHF), the main
urinary metabolites of cortisol, and tetrahydrocortisone (THE), the
main urinary metabolite of cortisone (total urinary GC = 5bTHF
+5aTHF+THE). Secondly, an indirect indicator of systemic
11bHSD activity, comprising the ratio of 5bTHF and 5aTHF
to THE (ratio of cortisol to cortisone metabolites = (5bTHF
+5aTHF)/THE).
Statistical Analysis
Statistical analysis was performed using SPSS version 18.0.
Bivariate correlations were performed using Spearman’s rho to
allow analysis of the non-parametric variables. Forced entry
multiple linear regression was performed and the data from the
Table 1. Group characteristics.
Group 1 younger
men (n = 19)
Group 1 older
men (n = 33) p-value
a
Group 2 older
men (n = 16)
Group 2 older
women (n = 14) p-value
b
Age (years) 22.2 (1.7) 70.2 (4.4) ,0.001 79.1 (3.4) 80.1 (3.7) n/s
Height (cm) 177.6 (6.7) 171.9 (5.4) 0.001 171.3 (6.1) 157.6 (5.9) ,0.001
BMI (kg/m
2
)24.0 (2.5) 25.2 (2.5) n/s 25.3 (3.9) 24.1 (3.1) n/s
Muscle Size (cm
2
)92.7 (11.5) 67.3 (7.4) ,0.001 63.5 (7.3) 43.8 (6.8) ,0.001
Muscle Strength (Newton) 774.9 (136.6) 525.2 (73.6) ,0.001 364.7 (79.7) 273.4 (73.4) 0.003
Total Urinary GC* (microg/
day)
9887 (7721–18372) 10224 (7841–17000) n/s 8192 (5534–12506) 4925 (3699–6806) n/s
11bHSD activity (urine
THFs:THE)
1.12 (0.37) 1.15 (0.45) n/s 1.28 (0.79) 0.81 (0.49) n/s
Plasma cortisol (nmol/litre) 349 (106) 321 (65) n/s
GR mRNA 59.4 (24.5) 58.3 (18.8) n/s
11bHSD1 mRNA 25.3 (19.7) 32.2 (31.8) n/s
Data are mean (SD) except *non-parametric data therefore median and IQ range shown.
a. Independent t test between younger and older men in Group 1.
b. Independent t test between men and women in Group 2.
n/s = not significant.
doi:10.1371/journal.pone.0084057.t001
Table 2. Bivariate correlations including muscle size and strength.
Group 1 muscle size Group 1 muscle strength Group 2 muscle size Group 2 muscle strength
Height .34* .22 .68** .42*
BMI –.04 –.07 .32 .38*
Total urinary GC –.04 .01 .61** .45*
11bHSD activity –.09 –.05 .35 .16
Plasma cortisol – – –.20 –.31
GR mRNA ––.11.04
11bHSD1 mRNA – – –.15 –.29
Data are Spearman’s Rho Correlation Coefficients.
**p,0.01 (2-tailed).
*p,0.05 (2-tailed).
doi:10.1371/journal.pone.0084057.t002
Skeletal Muscle 11bHSD1 and Lower Muscle Strength
PLOS ONE | www.plosone.org 3 December 2013 | Volume 8 | Issue 12 | e84057
two groups were analysed separately, when possible, to test
reproducibility. Due to the large difference in age between the
older and younger groups, age was analysed as a binary variable in
the multivariate regression. Group 1 (n =52) had 80% power at
the p =0.05 level to detect a correlation of r = 0.38 and Group 2
(n = 30) had 80% power at the p = 0.05 level to detect a correlation
of r = 0.49. In view of the power calculations and the exploratory
nature of the study, adjusting for multiple hypotheses testing was
not deemed to be appropriate.
Results
In total, 82 participants were recruited. Table 1 shows numbers
of participants and their age, height, BMI, and the main outcome
variables for each group. Independent t tests found significant sex
and age related differences for height, muscle size and muscle
strength but not for BMI or any measure of glucocorticoid status
(Table 1). Table 2 shows bivariate correlations, which confirmed
that measures of body size (height and BMI) were significantly
associated with muscle size and strength. Therefore in constructing
multivariate models we adjusted for body size as well as age and
gender, which had been selected a priori due to their accepted
relationships with muscle size and strength. BMI correlated with
total urinary GC (rho = 0.60, p = 0.0005) and plasma cortisol
(rho = 20.52, p = 0.006), whereas height did not significantly
correlate with total urinary GC or plasma cortisol (p.0.05 for
both). Therefore in multivariate analyses with urinary GC and
plasma cortisol as predictor variables we adjusted for potential
confounding by BMI, gender and age (see Tables 3 & 4). Neither
BMI nor height correlated with the muscle GR or 11bHSD1
mRNA expression levels. Therefore because height correlated
more significantly with muscle size and strength than BMI
(Table 2), we adjusted for height and gender for the multivariate
analyses with muscle GR and 11bHSD1 mRNA as predictor
variables (Table 4).
Plasma cortisol was measured in Group 2 only. There were no
significant association between fasting morning plasma cortisol
and muscle size and a non-significant negative trend with muscle
strength (b20.35, p = 0.08) (Table 4). In both groups neither total
urinary glucocorticoids nor the ratio of cortisol:cortisone metab-
olites were associated with muscle size or strength (Tables 3 & 4).
We used muscle biopsies from a subset of Group 2 to examine
the relationships between GR and 11bHSD1 mRNA levels and
muscle size and strength. Increased 11bHSD1 mRNA was
significantly associated with lower muscle strength after adjust-
ment for sex and height (b20.35, p = 0.039, n = 22:12 men mean
age 79.8 (sd 3.6) and 10 women, mean age 80.5 (sd 4.1)). There
were no significant relationships between GR mRNA and muscle
size or strength, or between 11bHSD1 mRNA and muscle size
(Table 4).
Discussion
This study investigated the relationship between circulating and
tissue indices of glucocorticoid status and muscle size and strength
in two groups. Group 1 allowed comparison of older with younger
men. There were no age differences in urinary cortisol metabolites,
although muscle biopsies were not obtained in this group so we did
not test the effect of ageing per se on muscle mRNA levels. Group 2
allowed comparison of older men with older women. There were
no differences in plasma cortisol, urinary glucocorticoid metabo-
lites or muscle GR or 11bHSD1 mRNA levels between the sexes
in this relatively small sample. Within each group we explored
associations between glucocorticoid variables and muscle size and
strength after adjustment for potential confounding effects of age,
gender and body size as appropriate. In these analyses, indices of
HPA axis function, including morning plasma cortisol and 24 h
urinary cortisol metabolite excretion, were not associated with
muscle strength or size. Additionally urinary cortisol:cortisone
metabolite ratios, which principally reflect 11bHSD activity in the
major organs of liver and kidney, were not associated with muscle
strength or size. However, in muscle itself, higher levels of mRNA
encoding the cortisol-amplifying enzyme 11bHSD1 were associ-
ated with reduced muscle strength. This finding is consistent with
the hypothesis that enhanced glucocorticoid signalling within
muscle contributes to sarcopenia.
To our knowledge there have been no previous investigations of
muscle glucocorticoid signaling in human sarcopenia. We
Table 3. Regression coefficients for the glucocorticoid measures in models predicting muscle size/strength (Group 1).
Glucorticoid Measure Muscle Size
Beta (sig, n)
Muscle Strength
Beta (sig, n)
Total Urinary GC
a
20.10 (p.0.05, 52) ,20.01 (p.0.05, 52)
THFs:THE
a
,0.01 (p.0.05, 52) 0.04 (p.0.05, 52)
a
adjusting for age and BMI.
doi:10.1371/journal.pone.0084057.t003
Table 4. Regression coefficients for the glucocorticoid measures in models predicting muscle size/strength (Group 2).
Glucorticoid Measure Muscle Size
Beta (sig, n)
Muscle Strength
Beta (sig, n)
Plasma Cortisol
a
20.12 (p.0.05, 25) 20.35 (p.0.05, 27)
Total Urinary GC
a
0.23 (p.0.05, 28) 0.18 (p.0.05, 30)
THFs:THE
a
0.08 (p.0.05, 28) 0.10 (p.0.05, 30)
GR mRNA
b
0.03 (p.0.05, 20) 0.04 (p.0.05, 22)
11bHSD1 mRNA
b
20.17 (p.0.05, 20) 20.35 (p = 0.04, 22)
a
adjusting for gender and BMI.
b
adjusting for gender and height.
doi:10.1371/journal.pone.0084057.t004
Skeletal Muscle 11bHSD1 and Lower Muscle Strength
PLOS ONE | www.plosone.org 4 December 2013 | Volume 8 | Issue 12 | e84057
hypothesized that because 11bHSD1 and GR regulate the
exposure of target tissues to glucocorticoids, increased expression
of 11bHSD1 and GR could therefore contribute to sarcopenia in
the absence of an increase in circulating GCs. We found that
increased 11bHSD1 mRNA expression in muscle is associated
with lower muscle strength. This is consistent with this hypothesis.
We did not find a relationship between 11bHSD1 mRNA
expression and muscle size, but in normal ageing, muscle strength
is reported to deteriorate more rapidly than muscle size; suggesting
a decline in force generating capacity with age [5,32]. A number of
contributory mechanisms have been proposed to explain this (eg
increased muscle fibre stiffness); our data suggest a possible role for
increased GC action at the muscle level. GC may affect strength
more than muscle mass by exacerbating glycation of the myosin
molecule, which appears to slow the intrinsic shortening velocity of
the muscle fibre, decrease force per cross-sectional area and
increase intramuscular collagen cross-linking which can cause
muscle stiffness [33,34]. In addition, GC may cause mitochondrial
dysfunction and reduced oxidative capacity, which would similarly
result in a decrease in force generating capacity [35]. 11bHSD1 is
known to act locally within muscle, resulting in measurable
production of cortisol in samples from veins draining human
muscle, and therefore increased 11bHSD1 mRNA expression is
likely to increase myocellular cortisol levels thereby mediating
these effects [18]. More research with larger samples and with a
wider range of severity of sarcopenia is required to investigate the
relationship between 11bHSD1 expression and activity and
muscle ageing.
We found no relationship between GR mRNA expression and
muscle mass or strength. It is possible that polymorphisms of GR
modulate the effect of GC on muscle, and that level of expression
is less important than genotype. For example male carriers of the
ER22/23EK polymorphism in GR, which is associated with
relative GC resistance, have greater muscle mass and strength
than non-carriers [36].
There are no published studies investigating the association
between urinary GC and muscle size or strength. However, there
are studies reporting associations between salivary and plasma
GCs and muscle size and function. In a previous study of men and
women .75 years higher salivary, but not serum, cortisol was
associated with lower appendicular skeletal mass (ASM) measured
using DEXA [21]. Similarly, in a large longitudinal ageing study
higher salivary but not serum cortisol predicted loss of grip
strength over 6 years, but there was no association of cortisol with
baseline grip strength or ASM [22]. A smaller study including both
young and older men found that increased serum cortisol
correlated with lower knee extensor strength in both age groups
and with quadriceps cross-sectional area only in the older group
[23]. The Caerphilly Prospective Study, which included measure-
ments of cortisol status and physical performance over 20 years,
found that higher mid-life plasma cortisol predicted faster walking
speeds in older age, although salivary cortisol did not correlate
with walking speed or balance in older age [24]. Collectively, these
studies provide contradictory evidence relating salivary or plasma
cortisol to muscle strength and mass. Taken with our data, there
does not appear to be a consistent association between activation
of the HPA axis and age-associated sarcopenia. These negative
findings are important in excluding this plausible hypothesis.
Some limitations of this study should be acknowledged. We
examined the effect of GC on ageing muscle using a younger and
older group of volunteers separated in age by nearly 50 years and
by many lifestyle factors; a problem inherent to cross-sectional
studies. Longitudinal studies investigating rate of decline of muscle
mass and function and measures of GC would be more
informative but are difficult to conduct due to the slow decline
of muscle mass and strength during ageing. The sample sizes were
relatively modest, particularly with respect to muscle GC data
which were obtained from only a subset of Group 2 who
underwent muscle biopsy. It has also been shown that sarcopenia
affects the upper and lower limbs differently and our study
investigated only the lower limbs [4,37–39]. Also, our healthy
older volunteers constituted a sample which may be not fully
representative of the ageing population; this may influence the
generalisability of our results. Finally, we used mRNA expression
as a marker of activity rather than a direct measure of 11bHSD1
activity, however several studies have found correlations between
mRNA expression and enzyme activity in rodents and humans, so
we regard mRNA as an appropriate indicator of 11b-HSD1
activity [26].
Conclusion
Sarcopenia is one of the major causes of frailty and disability in
older people. It is associated with greatly increased risk of loss of
independence and institutionalization. In this novel investigation
of healthy old and young people we found a significant association
between increased muscle 11bHSD1 expression and lower
quadriceps strength. We found no significant associations between
plasma cortisol, urinary GC metabolites or GR expression and
muscle mass or strength. Longitudinal studies are now required to
investigate these relationships and to further explore the possibility
of 11bHSD1 inhibitors as a novel treatment for sarcopenia.
Acknowledgments
We are grateful to staff of the Wellcome Trust Clinical Research Facility,
Edinburgh for assistance in conducting the study.
Author Contributions
Conceived and designed the experiments: AMJM HW JR BW KCHF
CAG. Performed the experiments: IG PH HW CAG. Analyzed the data:
AHMK IG RA CG PH HW JS BW CAG. Contributed reagents/
materials/analysis tools: CG HH RA KC BW. Wrote the paper: AHMK
JS KCHF BW CAG.
References
1. Cruz-J entoft AJ, Baeyens JP, Bauer JM, Boirie Y, Cederholm T, et al. (2010)
Sarcopenia: European consensus on definition and diagnosis. Age and Ageing
39: 412–423.
2. Fielding RA, Vellas B, Evans WJ, Bhasin S, Morley JE, et al. (2011) Sarcopenia:
an undiagnosed conditi on in older adults. Curr ent consensus definition:
prevalence, etiology, and conse quences. International workin g group on
sarcopenia. J Am Med Dir Assoc 12: 249–256.
3. Muscari toli M, Anker SD, Argiles J, Aversa Z, Bauer JM, et al. (2010) Consensus
definition of sarcopenia, cachexia and pre-cachexia: Joint document elaborated
by Special Interest Groups (SI G) ‘‘cachexia-anorexia in chronic wasting
diseases’’ and ‘‘nutrition in geriatrics’’. Clinical Nutrition 29: 154–159.
4. Janssen I, Heymsfield SB, Wang ZM, Ross R (2000) Skeletal muscle mass and
distribution in 468 men and women aged 18–88 yr. Journal of Applied
Physiology 89: 81–88.
5. Goodp aster BH, Park SW, Harris TB, Kritchevsky SB, Nevitt M, et al. (2006)
The loss of skeletal muscle strength, mass, and quality in older adults: The
health, aging and body composition study. Journals of Gerontology Series a-
Biological Sciences and Medical Sciences 61: 1059–1064.
6. Frontera WR, Hughes VA, Fielding RA, Fiatarone MA, Evans WJ, et al. (2000)
Aging of skeletal muscle: a 12-yr longitudinal study. Journal of Applied
Physiology 88: 1321–1326.
Skeletal Muscle 11bHSD1 and Lower Muscle Strength
PLOS ONE | www.plosone.org 5 December 2013 | Volume 8 | Issue 12 | e84057
7. Skelton DA, Greig CA, Davies JM, Young A (1994) Strength, power and related
functional ability of healthy people aged 65–89 years. Age and Ageing 23: 371–
377.
8. Starr JM, Deary IJ (2011) Socio-economic position predicts grip strength and its
decline between 79 and 87 years: the Lothian Birth Cohort 1921. Age Ageing
40: 749–752.
9. Lauretani F, Russo CR, Bandinelli S, Bartali B, Cavazzini C, et al. (2003) Age-
associated change s in skeletal muscles and their effect on mobi lity: an
operational diagnosis of sarcopenia. J Appl Physiol 95: 1851–1860.
10. Baumgartner RN, Koehler KM, Gallagher D, Romero L, Heymsfield SB, et al.
(1998) Epidemiology of sarcopenia among the elderly in New Mexico. American
Journal of Epidemiology 147: 755–763.
11. Rantanen T (2003) Muscle strength, disability and mortality. Scand J Med Sci
Sports 13: 3–8.
12. Welle S (2002) Cellular and molecular basis of age-related sarcopenia. Canadian
Journal of Applied Physiology-Revue Canadienne De Physiologie Appliquee 27:
19–41.
13. Sayer A, Robinson S, Patel H, Shavlakadze T, Cooper C, et al. (2013) New
horizons in the pathogenesis, diagnosis and management of sarcopenia. Age and
Ageing 42: 145–150.
14. Schakman O, Gilson H, Thissen J (2008) Mechanisms of glucocorticoid induced
myopathy. Journal of Endocrinology 197: 1–10.
15. Shah O, Kimball S, Jefferson L (2000) Acute attenuation of translation initiation
and protein synthesis by glucocorticoids in skeletal muscle. Am J Physiol
Endocrinol Metab 278: E76–82.
16. Jang C, Obeyesekere VR, Dilley RJ, Alford FP, Inder WJ (2006) 11 beta
hydroxysteroid dehydrogenase type 1 is expressed and is biologically active in
human skeletal muscle. Clinical Endocrinology 65: 800–805.
17. Whorwood CB, Donovan SJ, Wood PJ, Phillips DI (2001) Regulation of
glucocorticoid receptor alpha and beta isoforms and type I 11beta-hydroxyste-
roid dehydrogenase expression in human skeletal muscle cells: a key role in the
pathogenesis of insulin resistance? Journal of Clinical Endocrinology &
Metabolism 86: 2296–2308.
18. Hughes KA, Manolopoulos KN, Iqbal J, Cruden NL, Stimson RH, et al. (2012)
Recycling between cortisol and cortisone in human splanchnic, subcutaneous
adipose, and skeletal muscle tissues in vivo. Diabetes 61: 1357–1364.
19. Tiganescu A, Tahrani A, Morgan S, Otranto M, Desmoulie`re A, et al. (2013)
11b-Hydroxysteroid dehydrogenase blockade prevents age-induced skin struc-
ture and function defects. J Clin Invest 123: 3051–3060.
20. Hughes KA, Webster SP, Walker BR (2008) 11-Beta-hydroxysteroid dehydro-
genase type 1 (11beta-HSD1) inhibitors in type 2 diabetes mellitus and obesity.
Expert Opin Investig Drugs 17: 481–496.
21. Waters DL, Qualls CR, Dorin RI, Veldhuis JD, Baumgartner RN (2008)
Altered growth hormone, cortisol, and leptin secretion in healthy elderly persons
with sarcopenia and mixed body composition phenotypes. Journals of
Gerontology Series a-Biological Sciences and Medical Sciences 63: 536–541.
22. Peeters GMEE, van Schoor NM, van Rossum EFC, Visser M, Lips P (2008) The
relationship between cortisol, muscle mass and muscle strength in older persons
and the role of genetic variations in the glucocorticoid receptor. Clinical
Endocrinology 69: 673–682.
23. Izquierdo M, Hakkinen K, Anton A, Garrues M, Ibanez J, et al. (2001) Maximal
strength and power, endurance performance, and serum hormones in middle-
aged and elderly men. Med Sci Sports Exerc 33: 1577–1587.
24. Gardner MP, Lightman SL, Gallacher J, Hardy R, Kuh D, et al. (2011) Diurnal
cortisol patterns are associated with physical performance in the Caerphilly
Prospective Study. Int J Epidemiol 40: 1693–1702.
25. Best R, Walker BR (1997) Additional value of measurement of urinary cortisone
and unconjugated cortisol metabolites in assessing the activity of 11 beta-
hydroxysteroid dehydrogenase in vivo. Clinical Endocrinology 47: 231–236.
26. Wake DJ, Rask E, Livingstone DEW, Soderberg S, Olsson T, et al. (2003) Local
and systemic impact of transcriptional up-regulation of 11 beta-hydroxysteroid
dehydrogenase type 1 in adipose tissue in human obesity. Journal of Clinical
Endocrinology & Metabolism 88: 3983–3988.
27. Greig CA, Young A, Skelton DA, Pippet E, Butler FMM, et al. (1994) Exercise
studies with elderly volunteers. Age and Ageing 23: 185–189.
28. Edwards RH, Hyde S (1977) Methods of measuring muscle strength and fatigue.
Physiotherapy 63: 51–55.
29. Gray C, MacGillivray TJ, Eeley C, Stephens NA, Beggs I, et al. (2011) Magnetic
resonance imaging with k-means clustering objectively measures whole muscle
volume compartments in sarcopenia/cancer cachexia. Clinical Nutrition 30:
106–111.
30. Bergstro¨ m J (1975) Percutaneous Needle Biopsy of Skeletal Muscle in
Physiological and Clinical Research. Scandinavian Journal of Clinical &
Laboratory Investigation 35: 609–616.
31. Stephens NA, Gallagher IJ, Rooyackers O, Skipworth RJ, Tan BH, et al. (2010)
Using transcriptomics to identify and validate novel biomarkers of human
skeletal muscle cancer cachexia. Genome medicine 2: 1.
32. Young A, Stokes M, Crowe M (1985) The size and strength of the quadriceps
muscles of old and young men. Clinical Physiology 5: 145–154.
33. Hook P, Sriramoju V, Larsson L (2001) Effects of aging on actin sliding speed on
myosin from single skeletal muscle cells of mice, rats, and humans. American
Journal of Physiology-Cell Physiology 280: C782-C788.
34. Haus JM, Carrithers JA, Trappe SW, Trappe TA (2007) Collagen, cross-linking,
and advanced glycation end products in aging human skeletal muscle. Journal of
Applied Physiology 103: 2068–2076.
35. Mitsui T, Azuma H, Nagasawa M, Iuchi T, Akaike M, et al. (2002) Chronic
corticosteroid adm inistration causes mitochondrial dysfunction in skeletal
muscle. Journal of Neurology 249: 1004–1009.
36. van Rossum EFC, Voorhoeve PG, te Velde SJ, Koper JW, Delemarre-van de
Waal HA, et al. (2004) The ER22/23EK Polymorphism in the Glucocorticoid
Receptor Gene Is Associated with a Beneficial Body Composition and Muscle
Strength in Young Adults. Journal of Clinical Endocrinology & Metabolism 89:
4004–4009.
37. Aniansson A, Sperling L, Rundgren A, Lehnberg E (1983) Muscle function in
75-year-old men and women - a longitudinal-study. Scandinavian Journal of
Rehabilitation Medicine: 92–102.
38. Aniansson A, Hedberg M, Henning GB, Grimby G (1986) Muscle morphology,
enzymatic-activity, and muscle strength in elderly men - a follow-up-study.
Muscle & Nerve 9: 585–591.
39. Aniansson A, Grimby G, Hedberg M (1992) Compensatory muscle-fiber
hypertrophy in elderly men. Journal of Applied Physiology 73: 812–816.
Skeletal Muscle 11bHSD1 and Lower Muscle Strength
PLOS ONE | www.plosone.org 6 December 2013 | Volume 8 | Issue 12 | e84057
... So 11β-HSD1 is known as the local amplifier of GC and plays a key role in regulating organ aging (11). Some studies have found that the expression of 11β-HSD1 increases with aging in brain, skin, and muscle tissues, which is closely related to impaired memory, skin aging and decreased muscle strength (12)(13)(14). It has been confirmed that CR can affect the expression level of 11β-HSD1 in fat, liver, muscle, and other organs of mice and pigs (15). ...
... The expression level and activity of the 11β-HSD1 gene are also significantly increased in elderly skin, promoting skin aging (13). Increased expression of 11β-HSD1 in muscle tissue of elderly individuals is significantly correlated with decreased muscle strength (14). In our study, we first found that 11β-HSD1 plays a key role in the relationship between CR and sarcopenia and further found that muscle-specific knockout of 11β-HSD1 could delay muscle atrophy and improve muscle function in aged mice. ...
Article
Full-text available
Introduction Calorie restriction (CR) is an important direction for the delay of sarcopenia in elderly individuals. However, the specific mechanisms of CR against aging are still unclear. Methods In this study, we used a CR model of elderly mice with muscle-specific 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1) knockout mice and 11β-HSD1 overexpression mice to confirm that CR can delay muscle aging by inhibiting 11β-HSD1 which can transform inactive GC(cortisone) into active GC(cortisol). The ability of self-proliferation and differentiation into muscle fibers of these mouse muscle stem cells (MuSCs) was observed in vitro . Additionally, the mitochondrial function and mitochondrial ATP production capacity of MuSCs were measured by mitochondrial oxygen consumption. Results It was found that the 11β-HSD1 expression level was increased in age-related muscle atrophy. Overexpression of 11β-HSD1 led to muscle atrophy in young mice, and 11β-HSD1 knockout rescued age-related muscle atrophy. Moreover, CR in aged mice reduced the local effective concentration of glucocorticoid (GC) through 11β-HSD1, thereby promoting the mitochondrial function and differentiation ability of MuSCs. Conclusions Together, our findings highlight promising sarcopenia protection with 40% CR in older ages. Furthermore, we speculated that targeting an 11β-HSD1-dependent metabolic pathway may represent a novel strategy for developing therapeutics against age-related muscle atrophy.
... Additionally, an increased cortisol response to stress in aging has been reported (Otte et al., 2005). Moreover, 11β-HSD shows increased activity during aging, increasing cortisol availability (Kilgour et al., 2013). ...
... In agreement with these results, Yanagita et al. (2019) reported this relationship in elderly patients with type 2 diabetes mellitus. In contrast, Kilgour et al. (2013) found no significant relationships between plasma cortisol, urinary glucocorticoid metabolites or cortisol receptor expression and muscle mass or strength. In spite of these results, they found a significant association between increased muscle 11β-HSD1 expression and lower quadricep strength. ...
Chapter
Aging involves numerous changes in body composition that include a decrease in skeletal muscle mass. The gradual reduction in muscle mass is associated with a simultaneous decrease in muscle strength, which leads to reduced mobility, fragility and loss of independence. This process called sarcopenia is secondary to several factors such as sedentary lifestyle, inadequate nutrition, chronic inflammatory state and neurological alterations. However, the endocrine changes associated with aging seem to be of special importance in the development of sarcopenia. On one hand, advancing age is associated with a decreased secretion of the main hormones that stimulate skeletal muscle mass and function (growth hormone, insulin-like growth factor 1 (IGFI), testosterone and estradiol). On the other hand, the alteration of the IGF-I signaling along with decreased insulin sensitivity also have an important impact on myogenesis. Other hormones that decline with aging such as the adrenal-derived dehydroepiandrosterone, thyroid hormones and vitamin D seem to also be involved in sarcopenia. Adipokines released by adipose tissue show important changes during aging and can affect muscle physiology and metabolism. In addition, catabolic hormones such as cortisol and angiotensin II can accelerate aged-induced muscle atrophy, as they are involved in muscle wasting and their levels increase with age. The role played by all of these hormones and the possible use of some of them as therapeutic tools for treating sarcopenia will be discussed.
... ubiquitin proteosome pathway) (125). Accordingly, measures of glucocorticoid activity predict muscle atrophy in populations with hypercortisolism (126,127) and even in the general population (128)(129)(130). A direct role for glucocorticoid signalling in CKD-related muscle loss has been proposed by preclinical studies highlighting glucocorticoids as a required cofactor for muscle atrophy in catabolic conditions of acidosis and insulin resistance (131,132). ...
Article
Full-text available
Chronic kidney disease (CKD) describes the long-term condition of impaired kidney function from any cause. CKD is common and associated with a wide array of complications including higher mortality, cardiovascular disease, hypertension, insulin resistance, dyslipidemia, sarcopenia, osteoporosis, aberrant immune function, cognitive impairment, mood disturbances and poor sleep quality. Glucocorticoids are endogenous pleiotropic steroid hormones and their excess produces a pattern of morbidity that possesses considerable overlap with CKD. Circulating levels of cortisol, the major active glucocorticoid in humans, are determined by a complex interplay between several processes. The hypothalamic-pituitary-adrenal axis (HPA) regulates cortisol synthesis and release, 11β-hydroxysteroid dehydrogenase enzymes mediate metabolic interconversion between active and inactive forms, and clearance from the circulation depends on irreversible metabolic inactivation in the liver followed by urinary excretion. Chronic stress, inflammatory states and other aspects of CKD can disturb these processes, enhancing cortisol secretion via the HPA axis and inducing tissue-resident amplification of glucocorticoid signals. Progressive renal impairment can further impact on cortisol metabolism and urinary clearance of cortisol metabolites. Consequently, significant interest exists to precisely understand the dysregulation of cortisol in CKD and its significance for adverse clinical outcomes. In this review, we summarize the latest literature on alterations in endogenous glucocorticoid regulation in adults with CKD and evaluate the available evidence on cortisol as a mechanistic driver of excess mortality and morbidity. The emerging picture is one of subclinical hypercortisolism with blunted diurnal decline of cortisol levels, impaired negative feedback regulation and reduced cortisol clearance. An association between cortisol and adjusted all-cause mortality has been reported in observational studies for patients with end-stage renal failure, but further research is required to assess links between cortisol and clinical outcomes in CKD. We propose recommendations for future research, including therapeutic strategies that aim to reduce complications of CKD by correcting or reversing dysregulation of cortisol.
... Although the upper extremity muscles were not included in this study, the diagnostic accuracy for low SMI and the differences between men and women were similar to the results of this study. Sex differences in age-related muscle loss were observed and studied in numerous studies [23][24][25], and the altered contraction of the muscle fibre [26] and differences in hormone levels and the corresponding regulatory axes [27][28][29][30] were considered to be potential influencing factors. In the verification group, the sensitivity of ultrasound in diagnosing low SMI was 93.6% for men and 89.7% for women, and the NPV was 94.9% for men and 94.7% for women. ...
Article
Full-text available
Background Quantitative assessment of muscle mass is a critical step in sarcopenia disease management. Expanding upon the use of ultrasound in foetal growth assessment, we established and validated an ultrasound-derived muscle assessment system for older adults at a risk of sarcopenia. Methods A total of 669 older adults were recruited in three cohorts in this cross-sectional study. In cohort 1(n = 103), the most valuable sites for skeletal muscle mass index (SMI) estimation were located among 11 ultrasound scanning sites. An ultrasound-derived SMI estimating algorithm based on muscle thickness (MT) was obtained in the modelling group composed of cohorts 1 and 2 (n = 309). The reliability of the muscle mass estimation equation and the validity of the obtained cut-off values were verified in cohort 3 (n = 257), which was selected as the verification group. Results In the modelling group, the cut-off values of ultrasound-derived e-SMI for low SMI were 7.13 kg/m2 for men and 5.81 kg/m2 for women. In the verification group, the intraclass correlation between e-SMI and SMI was 0.885. The sensitivity of the e-SMI in detecting low SMI was 93.6% for men and 89.7% for women, and the negative predictive value was 94.9% for men and 94.7% for women. Combined with the handgrip strength and gait speed, the e-SMI had an overall diagnostic sensitivity of 92.7% and a specificity of 91.0% for sarcopenia. Conclusion The ultrasound-derived muscle assessment system can be a promising muscle mass estimation tool and a potential disease classification tool.
... Firstly, from the perspective of the microenvironment, skeletal muscle is affected by a variety of hormones, including testosterone, glucocorticoids, growth hormone (GH), and insulin-like growth factor-1 (IGF-1), and there are six differences in the levels of these hormones and corresponding receptor levels. Studies have demonstrated that excess glucocorticoids may cause muscle weakness and atrophy with age through increased levels of the glucocorticoid-amplifying enzyme 11 beta-hydroxysteroid dehydrogenase type 1 (11βHSD1) in muscle (22), the expression of which was found to be increased in older women, with no age-associated differences observed in men (23). In addition to this, the GH/IGF-1 axis has been proven to be correlated with body composition, function, and metabolism (24,25), and the correlation between muscle power and IGF-1 has been reported to only exist in older women and not in men (26). ...
Article
Background: Sarcopenia is an age-associated syndrome of decreased skeletal muscle function and loss of muscle mass. This cross-sectional study was designed to investigate whether ultrasound can be used to quantitatively estimate muscle mass in older adults as an efficient assistive method for the diagnosis of sarcopenia. Methods: A cohort of 103 older adults older aged over 60 years who were at risk of sarcopenia, including 57 males and 46 females, was recruited. The participants underwent ultrasound to measure the muscle thickness (MT) of 11 sites across the whole body. Bioelectrical impedance analysis (BIA) was then used to estimate the appendicular muscle mass, and the correlation between skeletal muscle mass index (SMI) and MT at different sites was studied. Finally, muscle mass estimation algorithms for older adults were developed using multiple linear regression. Results: Male participants had a significantly higher SMI (7.03±0.73 vs. 5.84±0.72 kg/m2, P<0.001) and higher MT than female participants at all 11 sites (all P<0.05). The MT of Site 7 (rectus femoris and intermedius femoris) in males had the strongest correlation with SMI (R=0.719, P<0.001). In females, the MT at Site 3 (flexor pollicis longus, flexor digitorum superficialis, and brachioradialis) had the strongest correlation with SMI (R=0.733, P<0.001). The MT of Site 7 was selected for a one-site algorithm; the R2 and standard error of estimate (SEE) values were 0.701 and 0.519 kg/m2, respectively. The MT of Site 3, Site 7, Site 1 (biceps and brachialis), and Site 9 (tibialis anterior) were selected for a four-site algorithm; the R2 and SEE values were 0.819 and 0.404 kg/m2, respectively. Conclusions: MT measured using ultrasound is correlated with SMI at some sites, and the correlations differ between men and women. When sex and age were included in the algorithm, the MT at Site 1, Site 3, Site 7, and Site 9 were valuable for estimating SMI, with Site 7 being the best parameter among them. Ultrasound-derived algorithms can achieve a satisfying fitting effect and provide new solutions for muscle mass estimation in older adults.
... Clinical data on the potential benefits of 11β-HSD1 inhibition on muscle metabolism is emerging. Observational studies have reported a correlation of 11β-HSD1 expression in muscle with total lean mass and muscle strength in healthy elderly [26,27]. Furthermore, a clinical trial found that the 11β-HSD1 inhibitor AZD4017 increased total lean mass in young overweight women [11]. ...
Article
Full-text available
Glucocorticoids provide indispensable anti-inflammatory therapies. However, metabolic adverse effects including muscle wasting restrict their use. The enzyme 11beta-hydroxysteroid dehydrogenase type 1 (11β-HSD1) modulates peripheral glucocorticoid responses through pre-receptor metabolism. This study investigates how 11β-HSD1 influences skeletal muscle responses to glucocorticoid therapy for chronic inflammation. We assessed human skeletal muscle biopsies from patients with rheumatoid arthritis and osteoarthritis for 11β-HSD1 activity ex vivo. Using the TNF-α-transgenic mouse model (TNF-tg) of chronic inflammation, we examined the effects of corticosterone treatment and 11β-HSD1 global knock-out (11βKO) on skeletal muscle, measuring anti-inflammatory gene expression, muscle weights, fiber size distribution, and catabolic pathways. Muscle 11β-HSD1 activity was elevated in patients with rheumatoid arthritis and correlated with inflammation markers. In murine skeletal muscle, glucocorticoid administration suppressed IL6 expression in TNF-tg mice but not in TNF-tg11βKO mice. TNF-tg mice exhibited reductions in muscle weight and fiber size with glucocorticoid therapy. In contrast, TNF-tg11βKO mice were protected against glucocorticoid-induced muscle atrophy. Glucocorticoid-mediated activation of catabolic mediators (FoxO1, Trim63) was also diminished in TNF-tg11βKO compared to TNF-tg mice. In summary, 11β-HSD1 knock-out prevents muscle atrophy associated with glucocorticoid therapy in a model of chronic inflammation. Targeting 11β-HSD1 may offer a strategy to refine the safety of glucocorticoids.
... TNF-α induces the activity of 11β-hydroxysteroid dehydrogenase-1 (11βHSD1) [185]. Higher expression of 11βHSD1 in skeletal muscle was associated with reduced muscle strength in older adults [186], insulin resistance, and visceral fat accumulation [187]; thus with metabolic disturbances and possibly sarcopenic obesity. ...
Article
Full-text available
Coronavirus Disease 2019 (COVID-19) is characterized with a wide range of clinical presentations from asymptomatic to severe disease. In patients with severe disease, the main causes of mortality have been acute respiratory distress syndrome, cytokine storm and thrombotic events. Although all factors that may be associated with disease severity are not yet clear, older age remains a leading risk factor. While age-related immune changes may be at the bottom of severe course of COVID-19, age-related hormonal changes have considerable importance due to their interactions with these immune alterations, and also with endothelial dysfunction and comorbid cardiometabolic disorders. This review aims to provide the current scientific evidence on the pathogenetic mechanisms underlying the pathway to severe COVID-19, from a collaborative perspective of age-related immune and hormonal changes together, in accordance with the clinical knowledge acquired thus far.
Article
Objectives: This study aimed to evaluate the endogenous hormonal factors related to dominant handgrip strength (HGS) in postmenopausal women. Methods: A cross-sectional study was performed on 402 postmenopausal women aged 47 to 83 years. The following variables were recorded: age, age at menopause, smoking status, adiposity, HGS, and physical activity. Hormonal parameters (follicle-stimulating hormone, estradiol, testosterone, cortisol, dehydroepiandrosterone sulfate, Δ4 androstenedione, insulin-like growth factor-1 [IGF-1], vitamin D, and parathormone levels) were measured and results reported as odds ratios (ORs), β coefficients and 95% confidence interval (95% CI). A directed acyclic graph was used to identify potential confounding variables and was adjusted in the regression model to assess associations between endogenous hormones and HGS. Results: The mean dominant HGS was 22.8 ± 3.7 kg, and 25.6% of women had dynapenia. There were significant differences in plasma levels of follicle-stimulating hormone (OR, 0.99; 95% CI, 0.98-1.00), cortisol (OR, 1.07; 95% CI, 1.02-1.12), and dehydroepiandrosterone sulfate (OR, 0.99; 95% CI, 0.98-1.00) between women with normal HGS and those who presented with dynapenia. After adjusting for confounding variables, no significant association was found between endogenous hormones and HGS. Conclusions: Our results showed that studied ovarian steroids, adrenal hormones, IGF-1, parathormone, and vitamin D were not associated with HGS.
Article
Full-text available
Objective: We tried to reveal how the normal appearing white matter (NAWM) was affected in patients with glioblastoma treated with chemo-radiotherapy (CRT) in the period following the treatment, by multiparametric MRI. Materials and methods: 43 multiparametric MRI examinations of 17 patients with glioblastoma treated with CRT were examined. A total of six different series or maps were analyzed in the examinations: Apparent Diffusion Coefficient (ADC) and Fractional Anisotropy (FA) maps, Gradient Echo (GRE) sequence, Dynamic susceptibility contrast (DSC) and Arterial spin labeling (ASL) perfusion sequences. Each sequence in each examination was examined in detail with 14 Region of Interest (ROI) measurements. The obtained values were proportioned to the contralateral NAWM values and the results were recorded as normalized values. Time dependent changes of normalized values were statistically analyzed. Results: The most prominent changes in follow-up imaging occurred in the perilesional region. In perilesional NAWM, we found a decrease in normalized FA (nFA), rCBV (nrCBV), rCBF (nrCBF), ASL (nASL)values (p < 0.005) in the first 3 months after treatment, followed by a plateau and an increase approaching pretreatment values, although it did not reach. Similar but milder findings were present in other NAWM areas. In perilesional NAWM, nrCBV values were found to be positively high correlated with nrCBF and nASL, and negatively high correlated with nADC values (r: 0.963, 0.736, - 0.973, respectively). We also found high correlations between the mean values of nrCBV, nrCBF, nASL in other NAWM areas (r: 0.891, 0.864, respectively). Discussion: We showed that both DSC and ASL perfusion values decreased correlatively in the first 3 months and showed a plateau after 1 year in patients with glioblastoma treated with CRT, unlike the literature. Although it was not as evident as perfusion MRI, it was observed that the ADC values also showed a plateau pattern following the increase in the first 3 months. Further studies are needed to explain late pathophysiological changes. Because of the high correlation, our results support ASL perfusion instead of contrast enhanced perfusion methods.
Chapter
Acute sarcopenia is usually related to hospitalization or a surgical procedure that triggers the acute loss of muscle mass and function due to an increased inflammatory burden in combination with muscle disuse. In order to describe the incidence of acute sarcopenia, a rapid reduction in muscle mass and muscle function should be demonstrated. Available data in the intensive care unit (ICU) setting suggest a prevalence of sarcopenia between 60 and 71% in older adults admitted to the ICU for major trauma or for acute respiratory failure. A review in the rehabilitation setting found a prevalence of sarcopenia ranging from 28 to 69% of patients. Immobilization and disuse play a fundamental role in accelerating muscle loss, in association with an imbalance between protein synthesis and degradation, inflammation, hormones deregulation, and acute malnutrition. Different treatment strategies have been proposed to reduce muscle loss in acutely ill hospitalized patients.
Article
Full-text available
We employed a whole body magnetic resonance imaging protocol to examine the influence of age, gender, body weight, and height on skeletal muscle (SM) mass and distribution in a large and heterogeneous sample of 468 men and women. Men had significantly ( P < 0.001) more SM in comparison to women in both absolute terms (33.0 vs. 21.0 kg) and relative to body mass (38.4 vs. 30.6%). The gender differences were greater in the upper (40%) than lower (33%) body ( P < 0.01). We observed a reduction in relative SM mass starting in the third decade; however, a noticeable decrease in absolute SM mass was not observed until the end of the fifth decade. This decrease was primarily attributed to a decrease in lower body SM. Weight and height explained ∼50% of the variance in SM mass in men and women. Although a linear relationship existed between SM and height, the relationship between SM and body weight was curvilinear because the contribution of SM to weight gain decreased with increasing body weight. These findings indicate that men have more SM than women and that these gender differences are greater in the upper body. Independent of gender, aging is associated with a decrease in SM mass that is explained, in large measure, by a decrease in lower body SM occurring after the fifth decade.
Article
Full-text available
This cross-sectional study was designed to examine the effects of healthy ageing on muscle strength, power, and potentially related functional ability. Subjects were recruited through local and national newspapers and inclusion was based on strict health criteria, by questionnaire. Isometric knee extensor, isometric elbow flexor and handgrip strength, leg extensor power, timed rise from a low chair, lifting a weighted bag on to a surface, and stepping unaided on to boxes of different heights were measured in 50 men and 50 women, evenly distributed over the age range 65—89 years. The differences in isometric strength and leg extensor power over the age range were equivalent to 'losses' of 1-2% per annum and ~ 3j% per annum, respectively. The decline of explosive power was faster than the decline of knee extensor strength in men (p = 0.0001), but not significantly so in women (p = 0.08). Power standardized for body weight influenced chair rise time and step height. Isometric knee extensor strength standardized for body weight influenced chair rise time.
Article
Full-text available
Glucocorticoid excess frequently results in obesity, insulin resis- tance, glucose intolerance, and hypertension and may be the product of altered glucocorticoid hormone action. Tissue sensitivity to glu- cocorticoid is regulated by the expression of glucocorticoid receptor isoforms (GRa and GRb) and 11b-hydroxysteroid dehydrogenase type I (11bHSD1)-mediated intracellular synthesis of active cortisol from inactive cortisone. We have analyzed the expression of GRa ,G Rb, and 11bHSD1 and their hormonal regulation in skeletal myoblasts from men (n 5 14) with contrasting levels of adiposity and insulin resis- tance. Immunohistochemical, Northern blot, and Western blot anal- ysis indicated abundant expression of GRa and 11bHSD1 under basal conditions. The apparent Km and maximum velocity for the conver- sion of cortisone to cortisol were 440 6 14 nmol/L and 75 6 7 pmol/mg proteinzh and 437 6 16 nmol/L and 33 6 6 pmol/mg proteinzh (mean 6 SEM ;n 5 4) in the presence and absence of 20% serum. Incubation of myoblasts with increasing concentrations of glucocorticoid (50 -1000 nmol/L) resulted in a dose-dependent decline in GRa expression and a dose-dependent increase in GRb expression. 11bHSD1 activity was sensitively up-regulated by increasing concentrations of glucocorti- coid (50 -1000 nmol/L: P , 0.05). Abolition of these effects by the GR antagonist, RU38486, indicates that regulation of GRa ,G R b, and 11bHSD1 expression is mediated exclusively by the GRa ligand- binding variant. In contrast, 11bHSD1 was down-regulated by insulin (20 -100 mU/mL: P , 0.01) in the presence of 20% serum, whereas incubation with insulin under serum-free conditions resulted in a dose-dependent increase in 11bHSD1 activity (P , 0.05). Incubation with insulin-like growth factor I resulted in a similar pattern of 11bHSD1 activity. Although neither testosterone nor androstenedi- one (5-200 nmol/L) affected 11bHSD1 activity, incubation of myo- blasts with dehydroepiandrosterone (500 nmol/L) resulted in a de- cline in 11bHSD1 activity (P , 0.05). These data suggest that glucocorticoid hormone action in skeletal muscle is determined prin- cipally by autoregulation of GRa ,G Rb, and 11bHSD1 expression by the ligand-binding GRa isoform. Additionally, insulin and insulin- like growth factor I regulation of 11bHSD1 may represent a novel mechanism that maintains insulin sensitivity in skeletal muscle tis- sue by diminishing glucocorticoid antagonism of insulin action. (J Clin Endocrinol Metab 86: 2296 -2308, 2001)
Article
Full-text available
Glucocorticoid (GC) excess adversely affects skin integrity, inducing thinning and impaired wound healing. Aged skin, particularly that which has been photo-exposed, shares a similar phenotype. Previously, we demonstrated age-induced expression of the GC-activating enzyme 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) in cultured human dermal fibroblasts (HDFs). Here, we determined 11β-HSD1 levels in human skin biopsies from young and older volunteers and examined the aged 11β-HSD1 KO mouse skin phenotype. 11β-HSD1 activity was elevated in aged human and mouse skin and in PE compared with donor-matched photo-protected human biopsies. Age-induced dermal atrophy with deranged collagen structural organization was prevented in 11β-HSD1 KO mice, which also exhibited increased collagen density. We found that treatment of HDFs with physiological concentrations of cortisol inhibited rate-limiting steps in collagen biosynthesis and processing. Furthermore, topical 11β-HSD1 inhibitor treatment accelerated healing of full-thickness mouse dorsal wounds, with improved healing also observed in aged 11β-HSD1 KO mice. These findings suggest that elevated 11β-HSD1 activity in aging skin leads to increased local GC generation, which may account for adverse changes occurring in the elderly, and 11β-HSD1 inhibitors may be useful in the treatment of age-associated impairments in dermal integrity and wound healing.
Article
Full-text available
Sarcopenia is the age-related loss of skeletal muscle mass and function. It is now recognised as a major clinical problem for older people and research in the area is expanding exponentially. One of the most important recent developments has been convergence in the operational definition of sarcopenia combining measures of muscle mass and strength or physical performance. This has been accompanied by considerable progress in understanding of pathogenesis from animal models of sarcopenia. Well-described risk factors include age, gender and levels of physical activity and this knowledge is now being translated into effective management strategies including resistance exercise with recent interest in the additional role of nutritional intervention. Sarcopenia is currently a major focus for drug discovery and development although there remains debate about the best primary outcome measure for trials, and various promising avenues to date have proved unsatisfactory. The concept of 'new tricks for old drugs' is, however, promising, for example, there is some evidence that the angiotensin-converting enzyme inhibitors may improve physical performance. Future directions will include a deeper understanding of the molecular and cellular mechanisms of sarcopenia and the application of a lifecourse approach to understanding aetiology as well as to informing the optimal timing of interventions.
Article
Full-text available
The European Working Group on Sarcopenia in Older People (EWGSOP) developed a practical clinical definition and consensus diagnostic criteria for age-related sarcopenia. EWGSOP included representatives from four participant organisations, i.e. the European Geriatric Medicine Society, the European Society for Clinical Nutrition and Metabolism, the International Association of Gerontology and Geriatrics-European Region and the International Association of Nutrition and Aging. These organisations endorsed the findings in the final document. The group met and addressed the following questions, using the medical literature to build evidence-based answers: (i) What is sarcopenia? (ii) What parameters define sarcopenia? (iii) What variables reflect these parameters, and what measurement tools and cut-off points can be used? (iv) How does sarcopenia relate to cachexia, frailty and sarcopenic obesity? For the diagnosis of sarcopenia, EWGSOP recommends using the presence of both low muscle mass + low muscle function (strength or performance). EWGSOP variously applies these characteristics to further define conceptual stages as 'presarcopenia', 'sarcopenia' and 'severe sarcopenia'. EWGSOP reviewed a wide range of tools that can be used to measure the specific variables of muscle mass, muscle strength and physical performance. Our paper summarises currently available data defining sarcopenia cut-off points by age and gender; suggests an algorithm for sarcopenia case finding in older individuals based on measurements of gait speed, grip strength and muscle mass; and presents a list of suggested primary and secondary outcome domains for research. Once an operational definition of sarcopenia is adopted and included in the mainstream of comprehensive geriatric assessment, the next steps are to define the natural course of sarcopenia and to develop and define effective treatment.
Article
The mean isometric strength of the stronger quadriceps muscles of 12 healthy men in their seventies was 39% less than that of 12 healthy men in their twenties (P < 0–001). The cross-sectional area of the quadriceps was measured at mid-thigh, by ultrasound scanning; the older men's stronger quadriceps were 25% smaller (P < 0–001). The ratio of the stronger quadriceps' strength to its cross-sectional area was very similar in the old men to values obtained previously for both old and young women, but averaged 19% less than in the young men (P < 0–02). Quadriceps size and strength were correlated in the old men (P= 0–77, P= 0–03) but not in the young men (r= 0.15). The principal axis of the relationship between quadriceps size and strength in the old men was very similar to those previously reported for both old and young women. The quadriceps strength of some young men is greater than would be expected from the size of the muscle.
Article
Purpose: To examine maximal strength, power and muscle cross-sectional area, maximal and submaximal cycling endurance characteristics, and serum hormone concentrations of testosterone (T), free testosterone (FT), and cortisol (C) in middle-aged and elderly men. Methods: Maximal knee extension force (isometric; MIF(KE)), power-load curves during concentric actions with loads ranging from 15% to 70% of 1 RM half-squat (1RM(HS)), muscle cross-sectional area of quadriceps femoris (CSA(QF)), workload, heart rate and lactate accumulation during incremental cycling, and serum hormone concentrations were measured in 26 middle-aged (M42 yr) and 21 elderly men (M65 yr). Results: The 1RM(HS) (14%), MIF(KE) (24%) and CSA(QF) (13%) were lower in M65 than in M42 (P < 0.05-0.01). Power during submaximal actions was lower (P < 0.05-0.001) in M65 than in M42, but the differences disappeared when expressed relative to CSA(QF). Serum FT was in M42 higher (P < 0.05) than in M65. Maximal workload, maximal heart rate and peak blood lactate during cycling in M65 were 31%, 11%, and 20% lower than in M42 (P < 0.01). During submaximal cycling blood lactate rose more rapidly with increasing workload in M65 than in M42 (P < 0.05-0.01), but the differences disappeared when expressed relative to CSA(QF). Significant correlations existed between individual values of serum FT:C ratio, C and T, and those of muscle strength and maximal workload. Conclusion: Declines in maximal strength, muscle mass, and endurance performance seem to take place with increasing age, although muscle power and demand for aerobic energy per unit of muscle tissue during submaximal loads remain similar. The balance between anabolic and catabolic hormones in aging people over the years may be associated with age-related decreased strength and declines in maximal cycling workload.
Article
Objective: It has been shown recently that 11 beta-hydroxysteroid dehydrogenase (11 beta-HSD) is expressed as at least 2 isozymes. In the liver, 11 beta-HSD1 converts cortisone to cortisol; in the kidney, 11 beta-HSD2 converts cortisol to cortisone. Conventional assessment of 11 beta-HSD activity in vivo has relied on gas chromatographic measurement of the ratios of conjugated cortisol and cortisone metabolites. However, these do not permit distinction between the tissue-specific activities of the enzymes and do not reflect all forms of 11 beta-HSD deficiency. In this report, we have assessed the usefulness of measuring unconjugated cortisol metabolites and free cortisol and cortisone in urine as indices of renal 11 beta-HSD activity in man. Design: Six healthy male subjects established in sodium balance were given either glycyrrhetinic acid (170 mg t.d.s., to inhibit 11 beta-HSD2), carbenoxolone (100 mg t.d.s., to inhibit both 11 beta-HSD1 and 11 beta- HSD2) or both inhibitors in combination. Measurements: Urinary electrolytes were measured and the concentrations of total and unconjugated urinary cortisol and its metabolites were determined by gas chromatography mass spectrometry. Results: Glycyrrhetinic acid and carbenoxolone inhibited renal 11 beta-HSD2 to a similar degree, as judged by similar sodium retention. As previously reported, conventional measurement of ratios of total cortisol to cortisone metabolites were influenced to a greater extent by glycyrrhetinic acid (100-200% increase in ratio from baseline) than by carbenoxolone (< 30% increase). However, the effect of carbenoxolone was readily detected by measurement of urinary unconjugated cortisol/cortisone (130-480% increase of ratio from baseline) and also by measurement of ratios of unconjugated cortisol metabolites (60-130% increase). Conclusions: Measurement of free cortisol and cortisone in urine provides the most sensitive index of renal 11 beta-HSD activity. Measurement of total and conjugated urinary steroids is insensitive in circumstances where 11 beta-HSD activity in liver or elsewhere may be abnormal.